Cryptic Epitope Identified in Rat and Human
Cardiac Myosin S2 Region Induces
Myocarditis in the Lewis Rat
This information is current as
of June 18, 2017.
Ya Li, Janet S. Heuser, Stanley D. Kosanke, Mark Hemric
and Madeleine W. Cunningham
J Immunol 2004; 172:3225-3234; ;
doi: 10.4049/jimmunol.172.5.3225
http://www.jimmunol.org/content/172/5/3225
Subscription
Permissions
Email Alerts
This article cites 50 articles, 22 of which you can access for free at:
http://www.jimmunol.org/content/172/5/3225.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2004 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
References
The Journal of Immunology
Cryptic Epitope Identified in Rat and Human Cardiac Myosin
S2 Region Induces Myocarditis in the Lewis Rat1
Ya Li,* Janet S. Heuser,* Stanley D. Kosanke,† Mark Hemric,* and
Madeleine W. Cunningham2*
M
yocarditis is an inflammatory heart disease often associated with a previous viral infection (1–5). Evidence has suggested that myocarditis may be due to
autoimmune responses directed against cardiac tissue (6 –10). The
inflammatory immune response caused after infection may break
tolerance by mechanisms of molecular mimicry, bystander activation, and loss of immune regulation (11–16). The innate immune
response to infection and release of cardiac myosin or other cardiac
Ag may contribute to the overall enhanced inflammatory state in the
myocardium (17). Once initiated, the immune responses leading to
myocarditis can be perpetuated by exposed and presented cardiac Ags
in the presence of inflammatory cytokines (18 –21).
Experimental autoimmune myocarditis (EAM)3 is a model of
inflammatory heart disease generated by immunizing susceptible
rats or mice with cardiac myosin or its myocarditic epitopes. In the
EAM model, cellular infiltrates consist primarily of T cells and
macrophages, and T lymphocytes responsive to cardiac myosin
can transfer disease (8, 22–25). The pathogenic role of autoantiDepartments of *Microbiology and Immunology, and †Pathology, University of Oklahoma Health Sciences Center, Biomedical Research Center, Oklahoma City, OK
73104
Received for publication April 28, 2003. Accepted for publication December
18, 2003.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work is supported by Grant HL 56267 from the National Heart, Lung, and
Blood Institute and the American Heart Association. M.W.C. is the recipient of a
National Heart, Lung, and Blood Institute Merit Award, and Y.L. is the recipient of
an American Heart Association predoctoral fellowship.
2
Address correspondence and reprint requests to Dr. Madeleine W. Cunningham,
Department of Microbiology and Immunology, University of Oklahoma Health Sciences Center, Biomedical Research Center, Room 217, 975 NE 10th Street, Oklahoma City, Oklahoma 73104. E-mail address: [email protected]
3
Abbreviations used in this paper: EAM, experimental autoimmune myocarditis;
HCM, human cardiac myosin; RCM, rat cardiac myosin; LMM, light meromyosin.
Copyright © 2004 by The American Association of Immunologists, Inc.
bodies involved in the myocardial damage is not clear, although
they were found to deposit in the hearts of mice with EAM (5,
26 –28). Cytokines, such as IL-1, TNF-␣, IL-12, and IL-4 have
also been shown to be critical for the development of murine autoimmune myocarditis (18, 20, 21, 29), whereas IL-10 protected
rats against disease (30). In the mouse model of EAM, particularly
in A/J and BALB/c strains of mice, eosinophilia and a TH2 response develop during myocarditis, which is in contrast to the
Lewis rat model of giant cell granulomatous EAM in which TH1
responses may be more prevalent in the disease (21, 29). Myocarditis in the human may be a heterogeneous disease and TH1- or
TH2-mediated depending on the individual immune response pattern in the host.
Previous studies have demonstrated that cardiac myosin is an
immunodominant Ag in autoimmune myocarditis, and pathogenic
regions of cardiac myosin have been identified using the EAM
model in both rats and mice (10, 22, 31–38). Cardiac myosin is a
large peptide, which is composed of two H chains and two pair of
L chains. Proteolysis of myosin yields three subfragments including a globular head or subfragment 1 (S1) region, an ␣ helicalcoiled coil rod comprised of subfragment 2 (S2), and light meromyosin (LMM) (39). In the Lewis rat, the S2 subfragment has been
shown to produce the most severe myocarditis (38). In addition,
peptide fragments within residues 1070 –1165 of cardiac myosin
S2 rod region produced myocarditis (32, 36, 37), and residues
1304 –1320 and 1539 –1555 in the LMM region induced mild
myocarditis in Lewis rats (31). A pathogenic epitope in BALB/c
mice contained amino acid residues 614 – 643 of mouse cardiac
myosin, which is located in the S1 head portion of the molecule
(33). In addition, residues 735-1032 in S1 and S2 portions were
shown to induce EAM in both BALB/c and C57B/6 mice (34). In
A/J mice, the pathogenic epitope in mouse cardiac myosin was
located in the S1 subfragment and contained residues 334 –352,
which binds strongly to MHC class I-Ak molecules on the cell
0022-1767/04/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Myocarditis is a common cause of dilated cardiomyopathy leading to heart failure. Chronic stages of myocarditis may be initiated
by autoimmune responses to exposed cardiac Ags after myocyte damage. Cardiac myosin, a heart autoantigen, induced experimental autoimmune myocarditis (EAM) in susceptible animals. Although cardiac myosin-induced myocarditis has been reported
in Lewis rats, the main pathogenic epitope has not been identified. Using overlapping synthetic peptides of the S2 region of human
cardiac myosin, we identified an amino acid sequence, S2–16 (residues 1052–1076), that induced severe myocarditis in Lewis rats.
The myocarditic epitope was localized to a truncated S2–16 peptide (residues 1052–1073), which contained a sequence identical
in human and rat cardiac myosin. The S2–16 peptide was not myocarditic for three other strains of rats, in which the lack of
myocarditis was accompanied by the absence of strong S2–16-specific lymphocyte responses in vitro. For Lewis rats, S2–16 was
characterized as a cryptic epitope of cardiac myosin because it did not recall lymphocyte and Ab responses after immunization
with cardiac myosin. Lymphocytes from S2–16 immunized rats recognized not only S2–16, but also peptides in the S2–28 region.
Furthermore, peptide S2–28 was the dominant epitope recognized by T cells from cardiac myosin immunized rats. S2–16 was
presented by Lewis rat MHC class II molecules, and myocarditis induction was associated with an up-regulation of inflammatory
cytokine production. S2–16-induced EAM provides a defined animal model to investigate mechanisms of EAM and modulation of
immune responses to prevent autoimmune myocarditis. The Journal of Immunology, 2004, 172: 3225–3234.
3226
CRYPTIC EPITOPE OF CARDIAC MYOSIN INDUCES MYOCARDITIS
Materials and Methods
Antigens
Thirty-two overlapping peptides from the S2 region of HCM (Table I) were
synthesized and purified as 25-mers with an 11 aa overlap by Genemed
Synthesis (South San Francisco, CA).
Preparation of purified HCM or RCM and its subfragment
Cardiac myosin was purified from human and Lewis rat heart tissue according to the method of Tobacman and Adelstein (39), with slight modification. Briefly, heart tissue was homogenized in a low-salt buffer (40 mM
KCL, 20 mM imidazole, (pH 7.0), 5 mM EGTA, 5 mM DTT, 0.5 mM
PMSF, 1 ␮g of leupeptin/ml) for 15 s on ice. The washed myofibrils were
collected by centrifugation at 16,000 ⫻ g for 10 min. The pellets were then
resuspended in high-salt buffer (0.3 M KCL, 0.15 M K2HPO4, 1 mM
EGTA, 5 mM DTT, 0.5 mM PMSF, 1 ␮g of leupeptin/ml) and homogenized for three 30-s bursts on ice. The homogenized tissue was further
incubated on ice with stirring for 30 min to facilitate actomyosin extraction.
After clarification by centrifugation, actomyosin was precipitated by addition of 10 volumes of cold water, followed by a pH adjustment to 6.5. DTT
was added to 5 mM, and the precipitation was allowed to proceed for 30
min. The actomyosin was then pelleted by centrifugation at 16,000 ⫻ g.
The actomyosin pellet was then resuspended in high-salt buffer, ammonium sulfate was increased to 33%, and the KCL concentration was increased to 0.5 M. After the actomyosin pellet and salts were dissolved,
Table I. Overlapping synthetic peptides (25-mer) of HCM S2 region
Peptide No.
Amino Acid Sequencea
Residue No.
S2-1
S2-2
S2-3
S2-4
S2-5
S2-6
S2-7
S2-8
S2-9
S2-10
S2-11
S2-12
S2-13
S2-14
S2-15
S2-16
S2-17
S2-18
S2-19
S2-20
S2-21
S2-22
S2-23
S2-24
S2-25
S2-26
S2-27
S2-28
S2-29
S2-30
S2-31
S2-32
SAEREKEMASMKEEFTRLKEALEKS
FTRLKEALEKSEARRKELEERMVSL
RKELEEKMVSLLQEKNDLQLQVQAE
KNDLQLQVQAEQDNLADAEERCDQL
LADAEERCDQLIKNKIQLEAKVKEM
KIQLEAKVKEMNERLEDEEEMNAEL
LEDEEEMNAELTAKKRKLEDECSEL
KRKLEDECSELKRDIDDLELTLAKV
IDDLELTLAKVEKEKHATENKVKNL
KHATENKVKNLTEEMAGLDEIIAKL
MAGLDEHAKLTKEKKALQEAHQQA
KKALQEAHQQALDDLQAEEDKVNTL
LQAEEDKVNTLTKAKVKLEQQVDDL
KVKLEQQVDDLEGSLEQEKKVRMDL
LEQEKKVRMDLERAKRKLEGDLKLT
KRKLEGDLKLTQESIMDLENDKQQL
IMDLENDKQQLDERLKKKDFELNAL
LKKKDFELNALNARIEDEQALGSQL
IEDEQALGSQLQKKLKELQARIEEL
LKELQARIEELEEELESERTARAKV
LESERTARAKVEKLRSDLSRELEEI
RSDLSRELEEISERLEEAGGATSVQ
LEEAGGATSVQIEMNKKREAEFQKM
NKKREAEFQKMRRDLEEATLQHEAT
LEEATLQHEATAAALRKKHADSVAE
LRKKHADSVAELGEQIDNLQRVKQK
QIDNLQRVKQKLEKEKSEFKLELDD
EKSEFKLELDDVTSNMEQUKAKAN
NMEQIIKAKANLEKMCRTLEDQMNE
MCRTLEDQMNEHRSKAEETQRSVND
KAEETQRSVNDLTSQRAKLQTENGE
ETQRSVNDLTSQRAKLQTENGELSR
842– 866
856 – 880
870 – 894
884 –908
898 –922
912–936
926 –950
940 –964
954 –978
968 –992
982–1006
996 –1020
1010 –1034
1024 –1048
1038 –1062
1052–1076
1066 –1090
1080 –1104
1094 –1118
1108 –1132
1122–1146
1136 –1160
1150 –1174
1164 –1188
1178 –1202
1192–1216
1206 –1230
1220 –1244
1234 –1258
1248 –1272
1262–1286
1265–1289
a
Peptide sequences based on published sequence of HCM ␤-chain (50). S2-32
and S2-31 peptides have 22-amino acid overlapping sequence, from residues
1265–1286.
ATP was added to 10 mM and MgCl2 was added to 5 mM, and then the
solution was centrifuged at 20,000 ⫻ g for 15 min to remove actin filaments. The supernatant was removed and stored at 4°C in the presence of
the following inhibitors: 0.5 mM PMSF, 5 ␮g/ml N-tosyl-L-lysine chloromethyl ketone, and 1 ␮g of leupeptin/ml.
Immunization of animals
Female Lewis, Brown Norway, F344, and BB/DR rats (6 – 8 wk old) were
purchased from Harlan Sprague Dawley (Indianapolis, IN) and maintained
in groups of three at the Animal Resources Unit at the University of Oklahoma Health Sciences Center (Oklahoma City, OK). The study was conducted under an Institutional Animal Care and Use Committee approved
protocol. The rats, after being anesthetized with 10 mg of ketamine/0.2 mg
of xylazine, were injected in one hind footpad with 500 ␮g of cardiac
myosin or S2 peptide emulsified in CFA at 1:1 ratio (v/v). On day 0 and
day 3 after immunization, the rats were injected i.p. with 1 ⫻ 1010 heatkilled Bordetella pertussis. Seven days after primary immunization, the
rats were boosted s.c. with 500 ␮g Ag emulsified in IFA at 1:1 ratio (v/v).
Control rats received PBS plus adjuvants. All rats were sacrificed at day 21
by cardiac puncture under anesthesia.
Histopathological examination of tissue
Skeletal muscle, hearts, livers, and kidneys were fixed in 10% buffered
Formalin and imbedded in paraffin. Sections (5 ␮M) were stained with
H&E for microscopic histological examination. Myocardium was blindly
scored for the presence of histopathological myocarditis according to the
scale: 0 ⫽ normal, 1 ⫽ mild (⬍5% of heart cross-section involved), 2 ⫽
moderate (5–10% of cross-section involved), 3 ⫽ marked (10 –25% of
cross-section involved), and 4 ⫽ severe (⬎25% of cross-section involved).
Skeletal muscle, livers, and kidneys were also evaluated for cellular infiltrates as well as myocardium.
ELISA for Ab detection
For sera IgG Ab detection, 10 ␮g/ml Ag was coated onto Immulon-4 96well microtiter plates (Dynatech Laboratories, Chantilly, VA) at 50 ␮l/well
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
surface of APCs (10). Studies in mice show most epitopes that
produce disease are in the S1 region, which is in contrast to the
Lewis rat model in which the S1 subfragment did not produce
myocarditis. In addition, ␣-myosin was shown to be the immunodominant isoform to induce EAM in mice, whereas in rats, fragments derived from both ␣- and ␤-isoforms of cardiac myosin
were equally myocarditic (33, 36, 37).
Our previous studies show that both human cardiac myosin
(HCM) and rat cardiac myosin (RCM) induced severe myocarditis
in the Lewis rat, and overlapping synthetic peptides of cardiac
myosin ␤-chain LMM residues 1529 –1611 produced moderate
myocarditis, but a purified S2 subfragment produced severe disease (38). The purpose of our present study was to identify the
pathogenic epitopes of cardiac myosin and to develop a greater
understanding of mechanisms underlying autoimmune myocarditis. We tested a panel of synthetic peptides from the S2 region of
HCM for production of myocarditis. We chose initially to use the
panel of HCM peptides because of their availability in our laboratory for the study of both HCM and RCM and the high homology
(96%) between HCM and RCM amino acid sequences. By this
strategy, we identified a pathogenic epitope in the S2 rod region
(residues 1052–1073) of cardiac myosin and found that its amino
acid sequence was identical in human and rat. The pathogenic
epitope was contained within synthetic peptide S2–16 (residues
1052–1076). S2–16 was highly pathogenic in Lewis rats, whereas
three other rat strains were resistant to S2–16-induced myocarditis.
S2–16 was characterized as a cryptic epitope because it was not
recognized by cardiac myosin sensitized lymphocytes, and S2–16
sensitized lymphocytes did not demonstrate a strong anti-cardiac
myosin response. The T cell response against S2–16 was found to
be reactive with S2–28, a dominant epitope in intact cardiac myosin, which may correlate with the high pathogenicity of S2–16.
S2–16 peptide-induced myocarditis was accompanied by gene expression of cytokines in myocardium and TH1 cytokine production
by Ag-specific T cells. Our study provides a defined EAM model
that is induced by a cryptic epitope of cardiac myosin. To our
knowledge, this is the first report showing that a cryptic epitope
shared between RCM and HCM has a strong myocarditic pathogenicity in the Lewis rat. The characterization of the Lewis rat
EAM model will allow a better understanding of human inflammatory heart disease, and can be used to study modulation of autoimmune myocarditis.
The Journal of Immunology
in 0.1 M carbonate-bicarbonate coating buffer (pH 9.6), then incubated
overnight at 4°C. Plates were washed three times with PBS containing
0.05% Tween 20, then blocked with 1% BSA in PBS for 1 h at 37°C, and
washed with PBS Tween 20. Diluted rat serum samples (50 ␮l, 1/200
dilution for epitope mapping) in PBS with 1% BSA were added to wells in
duplicate and incubated overnight at 4°C. Plates were washed with PBS
with Tween 20, and 50 ␮l of goat anti-rat IgG whole molecule (SigmaAldrich, St. Louis, MO) conjugated with alkaline phosphatase (1/250 dilution for epitope mapping) was added and incubated at 37°C for 1 h. Plates
were washed and 50 ␮l of substrate para-nitrophenyl phosphate 104 (Sigma-Aldrich) in 0.1 M diethanolamine buffer (pH 9.8) was added. After 30
min, OD was measured at 410 nm in an ELISA plate reader (Dynex Technologies, Chantilly, VA). Controls included Ab conjugate alone and BSA
alone.
Lymphocyte proliferation assays
Adoptive transfer of EAM
Female 6- to 8-wk-old Lewis rats were immunized with S2–16 or PBS in
CFA as previously described. Fourteen days after first injection, spleens
were removed from rats, and single cell suspension was prepared and cultured with 10 ␮g/ml S2–16 at 5 ⫻ 106/ml for 2 days. Cells were then
washed three times, and 0.5–1 ⫻ 108 cells were injected into the inguinal
veins of naive syngeneic recipients. Fourteen days following transfer, the
recipients were sacrificed for histological examination.
RT-PCR for detection of cytokine mRNA
On day 14 and day 21 postimmunization, poly(A)⫹ RNA extraction from
myocardium of rats, and cDNA synthesis were performed according to
manufacturer’s instruction (Qiagen, Valencia, CA; Invitrogen, Carlsbad,
CA). In a total volume of 50 ␮l of PCR buffer, 4 ␮l of cDNA were incubated with 1.25 U of TaqDNA polymerase, 0.5 mM deoxynucleotide
triphosphates, and 1 ␮M sense and antisense cytokine-specific primers.
Samples were placed in a thermocycler, and each cycle consisted of 94°C
denaturing for 60 s, 54°C annealing for 60 s, and 72°C extension for 90 s.
Five percent of the PCR were electrophoresed in agarose/ethidium bromide
gels and visualized under UV light. The sizes of the bands were determined
by m.w. standards (DNA low mass ladder; Invitrogen, Carlsbad, CA). The
sequences of primer pairs specific for rat IL-6, IL-12 (p40), IFN-␥, TNF-␣,
and G3PDH are as follows: IL-2, GCGCACCCACTTCAAGCCCT and
CCACCACAGTTGCTGGCTCA; IL-6, GAAATACAAAGAAATGAT
GG and GTGTTTCAACATTCATATTGC; IL-12 (p40), CCACTCA
CATCTGCTGCTCCACAAG and ACTTCTCATAGTCCCTTTGGTCC
AG; IL-10, TGCCTTCAGTCAAGTGAAGACT and AAACTCATTCA
TGGCCTTGTA; IFN-␥, GCTCTGCCTCATGGCCCTCTCTGGC and
GCACCGACTCCTTTTCCGCTTCCTT; TNF-␣, GAGATGTGGAACT
GGCAGAG and CTTGAAGAGACCCTGGGAGTA; G3PDH, TCCAC
CACCCTGTTGCTGTA and ACCACAGTCCATGCCATCAC.
ELISA for cytokine detection
To determine cytokine production, splenocytes were cultured in culture
medium alone or culture medium containing 10 ␮g/ml Ags for 24 –72 h.
Cytokine levels were assayed in 24 h (IL-2) or 48 h (IL-4, IL-10, TNF-␣,
and IFN-␥) culture supernatants by cytokine-specific ELISA according to
the manufacturer’s protocol (BD PharMingen, San Diego, CA). OD was
measured at 450 nm in the ELISA plate reader (Dynatech Laboratories).
Sample cytokine concentrations were determined according to the standard
curves established using known concentration of each cytokine.
Statistical analysis
Means, SEMs, and unpaired Student’s t test were used to analyze the data.
Groups were considered statistically different if p ⱕ 0.05.
Results
Myocarditic epitope is located in the S2 fragment of cardiac
myosin
Thirty-two overlapping synthetic peptides (25-mers) spanning the
amino acid sequence of the S2 region of HCM were divided into
eight groups with four contiguous peptides in each group (Table I).
Groups of 6- to 8-wk-old female Lewis rats were immunized with
each of the S2 peptide groups. Examination of heart sections from
rats immunized with the S2–13 to S2–16 peptide group revealed
myocarditis in all animals tested (Table II and Fig. 1C). Two other
S2 peptide groups shown to induce mild myocarditis in immunized
rats were peptide groups S2–9 to S2–12, and S2–25 to S2–28,
which had average scores of 0.5 and 0.7, respectively (Table II).
HCM immunized rats, comprising the positive control group, developed moderate to severe myocarditis (Table II and Fig. 1B).
Heart tissue sections from rats immunized with PBS and CFA had
no cellular infiltrate and exhibited normal myocardium (Table II
and Figure 1A). Rats immunized with other peptide groups were
negative for myocarditis (Table II and Fig. 1D).
To further identify the highly pathogenic epitope in the S2 subfragment of cardiac myosin, Lewis rats were immunized with single S2 peptides from S2–13 to S2–16. S2–16 peptide (residues
1052–1076) induced moderate to severe myocarditis in all six peptide-immunized rats, with average histopathological score of 2.9
(Table III and Fig. 1E). The frequency and severity of myocarditis
induced by S2–16 was comparable to that induced by intact cardiac myosin. S2–13, S2–14, and S2–15 did not induce myocarditis
in most tested rats. In addition to actively inducing EAM, S2–16
primed lymphocytes were also found to be capable of passively
transferring the disease after adoptive transfer of S2–16 peptide
activated splenic T cells into naive syngeneic rats. Results showed
myocarditis in five of six recipients of S2–16 primed T cells,
whereas none of the rats receiving CFA-primed T cells developed
EAM (Table III).
To delineate the myocarditic sequence within S2–16, we generated a panel of truncated or modified peptides based on the
S2–16 sequence (Table III). Among them, rS2–16 was designed
based upon the rat S2–16 sequence, which has only one amino acid
Table II. Induction of myocarditis in Lewis rats by immunization with
cardiac myosin or S2 peptides
Immunogen
HCM
S2 peptides 1– 4b
S2 peptides 5– 8
S2 peptides 9 –12
S2 peptides 13–16
S2 peptides 17–20
S2 peptides 21–24
S2 peptides 25–28
S2 peptides 29 –32
PBS ⫹ adjuvant
Myocarditis
(positive/total)
Average Lesion Scorea
(1⫹– 4⫹)
3/3
0/3
0/3
1/3
3/3
0/3
0/3
2/3
0/3
0/3
2
0
0
0.5
3
0
0
0.7
0
0
a
Lesions were scored histologically based on the following scale: 0 ⫽ normal,
1 ⫽ mild (⬍ 5% of cross-section involved), 2 ⫽ moderate (5–10% of cross-section
involved), 3 ⫽ marked (10 –25% of cross-section involved), 4 ⫽ severe (⬎25% of
cross-section involved).
b
S2 peptide sequences are listed in Table I.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Spleens were removed from rats and pressed through fine mesh screens.
The single cell suspension was prepared, counted by trypan blue exclusion,
and resuspended to 5 ⫻ 106/ml in culture medium (RPMI 1640 supplemented with 10% FBS, 1% sodium pyruvate, 1% nonessential amino acids,
and antibiotics). The cells were plated in 96 –well round-bottom tissue
culture plates (Nunc, Naperville, IL) in 100 ␮l of culture medium. Splenocytes were incubated at 37°C in 5% CO2 for 6 days with protein or peptide
Ags at various concentrations before addition of 0.5 ␮Ci of tritiated thymidine (ICN, Irvine, CA). After 18 –24 h, cells were harvested onto filters
with a cell harvester (MACH II; Wallac, Turku, Finland), and tritiated
thymidine incorporation was measured in a liquid scintillation counter
(Betaplate 1250; Wallac). Values represent the stimulation index with the
equation: Stimulation index ⫽ (mean test cpm/mean of medium control
cpm). MHC restriction was determined by measuring proliferation of
splenic T cells in the presence of 0.5 ␮g/ml anti-RT1.B (OX-6) or antiRT1.D (OX-17) Abs (Serotec, Raleigh, NC).
3227
3228
CRYPTIC EPITOPE OF CARDIAC MYOSIN INDUCES MYOCARDITIS
difference from S2–16 derived from HCM sequence (leucine vs
glutamine at residue 1074). To identify the optimal length of the
pathogenic S2–16 epitope, we also generated four truncated peptides of S2–16 including tS2–16a, tS2–16b, and tS2–16c, which
are three shortened 11-mer peptides, and tS2–16d, which was synthesized as a 22-mer with the last three amino acids in S2–16
deleted. The design of the truncated peptide tS2–16d eliminated
the single amino acid difference between the rat and human sequence. Therefore, tS2–16d sequence was identical in both RCM
and HCM. We found both rS2–16 and tS2–16d produced moderate
to severe myocarditis in Lewis rats (Table III and Fig. 1, F and G,
respectively), whereas the three truncated shorter 11-mer tS2–16
peptides were completely nonmyocarditic (Table III and Fig. 1H).
Therefore, the myocarditic portion of S2–16 was localized to a 22
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 1. Histopathologic features of autoimmune
myocarditis in rats. Female 6 – 8-wk-old Lewis rats
were immunized with PBS (A), HCM (B), S2 peptide
group 13–16 (C), and S2 peptide group 21–24 (D),
S2–16 peptide (E), rS2–16 (rat S2–16 sequence) (F),
tS2–16d (the truncated sequence identical in RCM and
HCM) (G), and tS2–16a (the truncated 11-mer peptides) (H) in CFA. Experiments in several rat strains
revealed that the Lewis rat (E) was most susceptible,
whereas other strains (Table IV) including F344 were
more resistant to developing myocarditis after S2–16
immunization (I). BB/DR rats (I) and Brown Norway
rats did not develop myocarditis, whereas F344 rats developed weak myocarditis (J).
amino acid sequence (residues 1052–1073), which is identical in
both RCM and HCM.
The myocarditis inducing capacity of S2–16 was Lewis
strain-specific
Immunization of Brown Norway, F344, and BB/DR rats with
S2–16 failed to induce severe (3⫹ to 4⫹) histopathological myocarditis (Table IV). Heart tissue sections from PBS/CFA immunized control rats and other rat strains immunized with S2–16 had
little or no cellular infiltration in myocardium (Table IV and Fig.
1I). F344 rat strain immunized with S2–16 showed little (0.1⫹)
myocardial infiltration (Table IV and Fig. 1J), whereas the BB/DR
The Journal of Immunology
3229
Table III. Induction of myocarditis in Lewis rats by a single cardiac myosin S2 peptide sequence
Myocarditis
(positive/total)
Immunogen
Peptide Sequences
S2-13
S2-14
S2-15
S2-16
S2-16
rS2-16
tS2-16a
tS2-16b
tS2-16c
tS2-16d
PBS ⫹ adjuvant
PBS ⫹ adjuvant
LQAEEDKVNTLTKAKVKLEQQVDDL
KVKLEQQVDDLEGSLEQEKKVRMDL
LEQEKKVRMDLERAKRKLEODLKLT
KRKLEGDLKLTQESIMDLENDKQQL
KRKLEGDLKLTQESIMDLENDKQQL
KRKLEGDLKLTQESIMDLENDKLQLb
KRKLEGDLKLTc
DLKLTQESIMDc
QESIMDLENDKc
KRKLEGDLKLTQESIMDLENDKd
None
None
1/6
1/6
1/6
6/6
5/6 (passive)a
3/3
0/3
0/3
0/3
3/3
0/6
0/6 (passive)a
Average Lesion Score
(1⫹– 4⫹)
0.3
0.2
0.2
2.9
1.5
3.5
0
0
0
2.8
0
0
and Brown Norway rat strains demonstrated no myocarditis lesions (Table IV). Therefore, Lewis rats were the most susceptible
strain to S2–16-induced EAM.
Fig. 1 shows cellular infiltrates in sections of rat myocardium
stained with H&E. Lesions contained mononuclear cell infiltrates
and were granulomatous with myocyte necrosis. Multinucleated
giant cells were present in the inflammatory lesions. Inflammatory
infiltrates were similar in hearts of rats immunized with HCM (Fig.
1B), S2–16 (Fig. 1E), rat S2–16 peptide (rS2–16, Fig. 1F), and the
truncated 22-mer S2–16 peptide (tS2–16d, Fig. 1G). Heart tissue
sections from PBS immunized control rats had no cellular infiltration and showed normal myocardium (Fig. 1A). Examination of
multiple sections of skeletal muscle, liver, and kidney from rats
with myocarditis did not find evidence of tissue infiltration of
mononuclear cells (data not shown).
Enhanced cellular immune responses against S2–16 correlate
with disease in immunized Lewis rats
We first detected the proliferative responses of lymphocytes from
S2–16 immunized multistrain rats. Splenic lymphocytes were isolated, and in vitro stimulated with various concentrations of S2–16
peptide (Fig. 2). Lymphocytes from Lewis rats responded strongly
against S2–16 restimulation in a dose-dependent pattern. Although
S2–16 reactive lymphocytes were also present in BB/DR and F344
rats after immunization with S2–16, the lymphocyte proliferative
response to S2–16 was much lower than that of Lewis rats. None
or very low lymphocyte reaction to S2–16 was detected in Brown
Norway rats. Therefore, the high reactivity of S2–16 specific T cell
responses was associated with EAM induction.
S2–16 is a cryptic epitope with characterization of Ab and
lymphocyte responses in S2–16 and HCM immunized Lewis rats
For Lewis rats, we mapped the peptide epitopes recognized by T
cells and Abs from S2–16 immunized rats, and compared them
with those of cardiac myosin immunized rats and PBS/CFA immunized control rats. We measured both Ab (Fig. 3) and T cell
(Fig. 4) responses against 32 overlapping synthetic peptides spanning the HCM S2 region after immunization. Ab from S2–16 immunized Lewis rats recognized not only S2–16, but also S2– 4,
S2–17, and S2–18 peptides. However, sera from HCM and RCM
(data similar for the RCM) immunized Lewis rats did not show
strong reactivity with any specific S2 peptide although sera reacted
strongly with HCM and RCM (Fig. 3). A similar IgG Ab response
pattern was also observed at day 14 and day 28 after immunization.
No peptide reactivity was shown by PBS/CFA control Ab (OD
0.3– 0.5 for each peptide).
Lymphocytes from spleens of S2–16 and HCM immunized rats
were stimulated in vitro with overlapping synthetic peptides of the
S2 fragment of HCM or the native Ag HCM, and proliferative
responses were measured by tritiated thymidine incorporation.
Lymphocytes from S2–16 immunized rats proliferated with a stimulation index greater than 2 in response to S2–16, S2–17, S2–22,
S2–28, S2–29, S2–31, and S2–32, but not HCM, whereas lymphocytes from HCM immunized rats proliferated in the presence
of S2–28, S2–29, S2–31, S2–32, and HCM (Fig. 4). As a comparison, lymphocytes from RCM immunized rats proliferated to
S2–10, S2–15, S2–21, S2–22, S2–27, S2–28, S2–29, S2–31, S2–
32, and HCM, but not S2–16 (Fig. 4). Lymphocytes from adjuvant
Table IV. Immunization of different rat strains with S2-16 or PBS in adjuvants
MHC Complex
Immunogen
Myocarditis
(positive/total)
Average Lesion Score
(1⫹– 4⫹)
Lewis
RT1l
Brown Norway
RT1n
F344
RT1v
BB/DR
RT1u
S2-16
PBS ⫹ adjuvant
S2-16
PBS ⫹ adjuvant
S2-16
PBS ⫹ adjuvant
S2-16
PBS ⫹ adjuvant
2/3
0/3
0/3
0/3
1/3
0/3
0/3
0/3
2.7
0
0
0
0.1
0
0
0
Rat Strain
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
a
Splenic lymphocytes (0.5–⬃1 ⫻ 108) from S2-16 in CFA, or CFA primed rats, were adoptively transferred into naive
syngeneic recipients. The disease severity of recipients was examined 14 days after transfer.
b
Rat amino acid sequence of S2-16 peptide. There is only one amino acid difference between the RCM and HCM S2-16
sequence.
c
S2-16 sequence in three shorter peptides (11-mer).
d
Truncated S2-16 that contains all of the S2-16 sequence except the last three amino acids, eliminating the one amino acid
difference between rat and human S2-16.
3230
CRYPTIC EPITOPE OF CARDIAC MYOSIN INDUCES MYOCARDITIS
FIGURE 2. Recall proliferative response of lymphocytes from S2–16
immunized Lewis rats as compared with F344, Brown Norway (BN), and
BB/DR strain of rats. Splenic lymphocytes were isolated from four strains
of rats 21 days after they were immunized with S2–16. Lymphocytes were
stimulated with various concentrations of S2–16 peptides for 6 days, and
the proliferative responses were measured by [3H]thymidine incorporation.
Results of the proliferation assay were expressed as stimulation index ⫽
(mean test cpm/mean of medium control cpm) ⫾ SEM. Results presented
represent an average of two independent experiments.
FIGURE 4. Proliferative responses of splenic lymphocytes from Lewis rats immunized with S2–16,
HCM, RCM, and PBS in CFA. Lymphocytes taken
from spleens at day 21 were cultured in vitro with each
of 32 overlapping S2 peptides. Results of proliferative
assay were expressed as stimulation index ⫽ (mean
test cpm/mean of medium control cpm) ⫾ SEM. Results presented represent an average of 3–5 independent experiments. A mean SI ⱖ 2 was considered
positive.
liferation response pattern was also observed at day 14 and at day
28 of disease (data not shown).
To define the Ag specificity of S2–16 sensitized T cells, a series
of modified S2–16 peptides and HCM were tested in vitro for their
capacity to induce proliferative responses by splenocytes from
S2–16 immunized rats. Human S2–16 peptide, and rat S2–16 peptide as well as truncated S2–16d, the truncated identical sequence
of rat and human S2–16, stimulated strong recall proliferative responses in an Ag dose-dependent pattern (Fig. 5A). T cells primed
with S2–16 did not respond well to HCM (Fig. 5A) and RCM (data
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
control rats did not proliferate in response to any S2 peptides. T
cells primed with intact RCM and HCM did not recognize and
respond in proliferation assays to the S2–16 peptide (Fig. 4), even
when S2–16 was given at higher concentrations (data not shown),
indicating that S2–16 is a cryptic epitope of both RCM and HCM.
The definition of a cryptic epitope is an epitope not recognized by
Ab or T cells of animals immunized with intact Ag (40). The
immune dominant epitope of both RCM and HCM was observed
in peptide S2–28/S2–29 (Fig. 4). Furthermore, S2–16- and cardiac
myosin-primed T cells had common S2 peptide reactivity in peptides S2–28, S2–29, S2–31, and S2–32. A similar lymphocyte pro-
FIGURE 3. IgG Ab responses of S2–16 and HCM immunized Lewis
rats to synthetic S2 peptides. Sera were collected from S2–16 and HCM
immunized Lewis rats at day 21. The reaction of IgG Ab to 32 overlapping
synthetic peptides of the HCM S2 region were measured by ELISA. Multiple serum dilutions were tested, but the serum dilution used for this figure
was 1/200. Error bars represent SEMs. The same assay was also performed
for PBS/CFA immunized control Lewis rats. No peptide-specific IgG response was observed in control rats (OD 0.3– 0.5) with each peptide. RCM
immunized Lewis rats demonstrated little response against the S2 peptides
similar to that shown for HCM (data not shown).
The Journal of Immunology
3231
in the maximum inflammatory phase (day 21), in the myocardium
of both S2–16 and HCM immunized rats, but not in myocardium
of control rats. IL-6 and IL-12 gene expression was also observed
on day 14 in S2–16 and HCM immunized rats (Fig. 6A). In addition, S2–16 stimulated spleen cells from S2–16 immunized rats
(day 21) secreted significantly higher levels of IFN-␥ ( p ⬍ 0.005),
IL-2, and TNF-␣ ( p ⬍ 0.05), compared with cells from PBS/CFA
only injected rats. In contrast, there was no significant difference in
IL-10 production for these two groups of rats when cell culture
supernatants were assayed by cytokine-specific ELISA (Fig. 6B).
The production of IL-4 by splenocytes from S2–16/CFA and PBS/
CFA immunized rats was virtually nondetectable (data not shown).
Discussion
FIGURE 5. Proliferative responses of lymphocytes from spleens of
Lewis rats immunized with S2–16. A, Lymphocytes were isolated from
Lewis rats at 21 days after immunization with S2–16, and cultured in vitro
with S2–16, rS2–16, and truncated 11-mer peptides tS2–16a, tS2–16b,
tS2–16c, and tS2–16d. Ags were added to a final concentration from 0.1
␮g/ml to 100 ␮g/ml. Results of proliferative assays were expressed as
stimulation index ⫽ (mean test cpm/mean of medium control cpm) and
represent averages of three independent experiments. B, MHC restriction
of S2–16 response. Abs against rat MHC class II molecule RT1.B (OX-6),
RTI.D (OX-17), as well as an isotype control Ab mouse IgG1 (mIgG1)
were added to the cell culture when testing the recall response of splenocytes from S2–16 immunized rats (f) and HCM immunized rats (o). The
Ags S2–16 and HCM were used respectively in the proliferative assay. The
percentage of inhibition of proliferation by Ab was calculated relative to
the SI without Ab addition. Data are representative of three to five experiments. Error bars represent SEMs, and Student’s t test was used to determine the significant differences between anti-RT1.B or anti-RT1.D and an
isotype control Ab mouse IgG1 inhibition (ⴱ, p ⱕ 0.05; ⴱⴱⴱ, p ⱕ 0.0005).
not shown). The three 11-mer truncated peptides tS2–16a, tS2–
16b, and tS2–16c were nonstimulatory, which was consistent with
the absence of pathogenicity of these 11-mer S2 peptides.
MHC restriction indicates dual recognition of S2–16 and HCM
by RT1.B and RT1.D
To characterize the MHC restriction of the S2–16 specific in vitro
lymphocyte response and compare it with that of HCM-induced
lymphocyte response, Abs against rat MHC class II RT1.B (OX-6)
and RT1. D (OX-17) loci were added into S2–16 and HCM stimulated splenocyte culture. As shown in Fig. 5B, the addition of
both RT1.B and RT1.D blocking Abs substantially reduced proliferation responses initiated by S2–16 as well as HCM, compared
with the control mouse IgG1 Ab addition ( p ⬍ 0.05). Therefore,
both S2–16 peptide and HCM were presented by MHC class II
RT1.B and RT1.D molecules.
Cytokine expression of S2 and HCM immunized rats
To determine the cytokine profile in S2–16-induced EAM and
compare it with that of HCM-induced EAM, RT-PCR of inflammatory cytokine genes were performed by using RNA isolated
from the myocardium of S2–16 and HCM immunized rats, as well
as myocardium of adjuvant control rats. Marked mRNA expression of IL-6, IL-2, IL-12, IFN-␥, TNF-␣, and IL-10 were detected
FIGURE 6. Cytokine mRNA expression in S2–16, HCM, and PBS immunized rat heart as detected by RT-PCR. A, Poly(A)⫹ RNA was extracted
from hearts of each group of rats, and was reverse transcribed using oligo(dT) primers. Reverse transcriptase reaction (10%) was used in PCR to
detect the presence of the indicated cytokine mRNA. Cytokine mRNA
expression (lanes 1–3) in day 14 hearts of immunized rats and that of day
21 hearts (lanes 4 – 6) of immunized rats. Control rats (lanes 1 and 4),
HCM immunized rats (lanes 2 and 5), and S2–16 immunized rats (lanes 3
and 6) are shown. Size of the amplified fragments are indicated to the right
and were determined by comparison to DNA standards separated by electrophoresis on the same gel. B, Cytokine production in cell culture supernatant. Spleen cells were collected after Lewis rats were immunized with
S2–16 in CFA or CFA only were sacrificed on day 21 and were cultured
in the presence of medium alone or medium containing S2–16. Cytokine
levels were assayed in 24 h (IL-2), or 48 h (IL-4, IL-10, TNF-␣, and
IFN-␥) culture supernatants by cytokine-specific ELISA. Data are representative of three independent experiments. Error bars represent SEMs, and
Student’s t test was used to determine the significant differences between
S2–16/CFA immunized group and CFA only injected group. ⴱ, p ⱕ 0.05,
ⴱⴱ, p ⱕ 0.005. Cytokine levels of cells cultured with medium alone were
below 20% of specific response (data not shown).
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
We previously reported that myocarditic epitopes for the Lewis rat
were located within the rod region of cardiac myosin in S2 and
LMM with the most pathogenic epitopes located in the S2 subfragment (38). In this study, we identified a peptide in the cardiac
myosin S2 region (residues 1052 to 1076) that induced autoimmune myocarditis in the Lewis rat following immunization. Our
3232
CRYPTIC EPITOPE OF CARDIAC MYOSIN INDUCES MYOCARDITIS
rats. However, S2–16-specific recall responses in the Lewis rat
were much stronger than those in the resistant rats (Fig. 2). This
might be due to the existence of higher quantity or affinity of
S2–16-specific T cells in Lewis rats. Although the MHC-class II
restriction of S2–16 presentation was suggested by in vitro antiRT1.B and anti-RT1.D blocking experiments, both MHC-linked
and non-MHC-linked mechanisms, such as the nature of the S2–
16-specific T cell repertoire, should be considered in the susceptibility of the Lewis rat strain and the resistance of 3 other rat
strains to the S2–16 induced myocarditis.
Numerous studies have demonstrated the importance of cellular
immunity in autoimmune myocarditis (8, 24, 25). T cell infiltration
of myocardium has been demonstrated following immunization
with cardiac myosin or its myocarditic epitopes (6, 10, 22, 31, 42,
43). In our study, we characterized T cell responses after S2–16
and cardiac myosin immunization and found that S2–16 was a
cryptic determinant of cardiac myosin. Peptide S2–16 was incapable of inducing proliferative responses of T cells from rats immunized with HCM or RCM, and HCM or RCM did not strongly
stimulate S2–16 sensitized T cells (Fig. 4 and Fig. 5A). It should
be noted that cardiac myosin, in contrast to the S2–16 peptide, was
not a strong Ag in vitro in our proliferation assays because in HCM
or RCM immunized rats, the response to cardiac myosin was moderate (Fig. 4). The cryptic nature of the S2–16 Ag was also suggested by B cell responses in cardiac myosin immunized rats (Fig.
3). S2–16 was not recognized by HCM induced Abs, although IgG
Abs against cardiac myosin were produced after S2–16 immunization as detected in the ELISA and Western immunoblot when
using high sera concentrations (data not shown). This may suggest
that T cell-dependent B cell recognition of cardiac myosin was
induced after S2–16 immunization.
Although cryptic epitopes may not be exposed after native Ag
priming and processing, they may play an important role in perpetuation of chronic inflammatory disease due to epitope spreading
or mimicry within cardiac myosin. Our data show that both cardiac
myosin and S2–16 sensitization induced T cell responses against
common epitopes such as S2–28, S2–29, S2–31, and S2–32. B cell
Ab responses were directed against S2–16 and S2– 4, S2–17 and
S2–18 as well which were different from the T cell epitopes. A
similar B and T cell response pattern was observed during the early
and late phases of myocarditis in the Lewis rats, which suggested
that the multiple peptide reaction of S2–16 primed T cells or Abs
may not be due to the epitope spreading. The amino acid sequence
alignments of S2–16 and S2–28 and S2–31/S2–32 peptides shows
40% identity and 70 – 80% homology between S2–16 and these
peptides in a 15 amino acid overlap. The data support a crossreactive response at the T cell level that may be due to epitope
mimicry within cardiac myosin. When we immunized rats with
peptide S2–28, a lower disease incidence (30%) and milder infiltrate than S2–16 and intact cardiac myosin immunization were
observed (data not shown). S2–28 was the most dominant epitope
in proliferation assays of lymphocytes from HCM and RCM immunized rats (Fig. 4). This result was consistent with the hypothesis that undeleted T cells specific to the dominant S2–28 epitope
of cardiac myosin might have been partially tolerized in the Lewis
rat. The data support the mechanism that cryptic epitope S2–16
may induce disease in part by activation of T cells specific for the
dominant epitope S2–28 as well as against itself. However, we did
not detect a T cell proliferative response to S2–16 when rats were
immunized with S2–28 in our model system (data not shown). The
data suggest that T cells specific for S2–16 can recognize S2–28
but not vice versa. T cell degeneracy could also be a mechanism by
which S2–16 sensitized T cells recognize S2–28 (44).
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
results demonstrated that myocarditis induced by the S2–16 peptide was as severe as and indistinguishable from the disease induced by HCM. Characterization of the myocarditic S2–16 determinant showed that the length of the pathogenic S2–16 epitope
could be reduced from a 25-amino acid sequence to a 22-amino
acid sequence containing residues 1052 to 1073, an identical
amino acid sequence in both RCM and HCM. The myocarditic
character of the S2–16 epitope was closely associated with cellular
immune responses against S2–16, as shown by in vitro T cell recall
responses in myocarditic animals and passive transfer of myocarditis by S2–16 primed T cells.
Previously in the rat EAM model, Wegmann et al. (31) reported
two synthetic peptides corresponding to amino acids 1304 –1320
and 1539 –1555 in LMM of RCM ␣H chain which induced myocarditis. However, their pathogenicity required enhancement by
acetylation of the N-terminal amino acids. In our studies of LMM
peptides, it was clear that in comparison to the S2 fragment that the
LMM peptides produced milder disease (38). Using enzymatically
digested porcine cardiac myosin fragments, Inomata et al. (32)
identified a myocarditic epitope located within a 96 amino acid
fragment of cardiac myosin S2 region residues 1070 –1165. Kohno
et al. (36) used recombinant technology to further determine that
residues 1124 –1153 of cardiac myosin S2 region could induce
severe myocarditis in Lewis rats. In addition, they showed both ␤
and ␣H chains of cardiac myosin could provoke active myocarditis
in the Lewis rat (37). Although we did not find a myocarditic
epitope within residues 1070 –1165 in our panel of peptides
(S2–21 to S2–24), this may be explained by different Ag processing of the fragments of cardiac myosin in a 96 residue fragment
that may be presented in a different way than our 25-mer peptides.
The 11 amino acid overlap in our synthetic peptides was used as an
attempt to prevent loss of epitopes, but in our peptides the 1070 –
1165 epitope was apparently lost.
The synthetic overlapping peptides of the S2 region used in this
study were made according to the amino acid sequence of HCM
␤-chain, which is the dominant isoform in human ventricle tissue.
RCM ␣H chain, the dominant isoform for adult rat heart, and
HCM ␤H chain are 93% identical and 98% homologous in amino
acid sequence. The myocarditic 22-mer within the S2–16 peptide
(residues 1052–1073) has exactly the same amino acid sequence in
both RCM and HCM H chains. Although the S2 peptides contain
HCM sequences, they were successful in identifying a myocarditic
epitope identical in RCM and HCM.
To determine whether the myocarditic nature of the S2–16 peptide was specific to the susceptible Lewis strain and restricted to
certain MHC class II molecules for Ag presentation, we immunized three other different rat strains with the S2–16 peptide. The
S2–16 peptide induced marked myocarditis in the Lewis rat, but
not in the other three strains of rats. The reduced pathogenicity of
S2–16 in other rat strains might be due to their different MHC
haplotypes. S2–16 immunized F344 rats, which express same
RT1-B/D (rat MHC class II) but are different in RT1-C/E/M (rat
MHC telomeric class I region), did not develop marked myocarditis, which suggested that factors in addition to the RT1-B/D may
contribute to the development of myocarditis after S2–16 immunization. In the rat model of experimental allergic encephalomyelitis, it was shown that congenic BN-1L rats, which have LEW
MHC on a BN-derived background, similar to the wild-type BN
rats, were resistant to experimental allergic encephalomyelitis.
This non-MHC encoded resistance was associated with the ability
to produce regulatory cytokines such as TGF-␤ and increased frequency of CD45RClow regulatory CD4⫹ T cells (41). Our study
showed that S2–16-specific T cells were present not only in the
Lewis rat, but also in the resistant strains such as BB/DR and F344
The Journal of Immunology
References
1. Herskowitz, A., K. W. Beisel, L. J. Wolfgram, and N. R. Rose. 1985. Coxsackievirus B3 murine myocarditis: wide pathologic spectrum in genetically defined
inbred strains. Hum. Pathol. 16:671.
2. Leslie, K., R. Blay, C. Haisch, A. Lodge, A. Weller, and S. Huber. 1989. Clinical
and experimental aspects of viral myocarditis. Clin. Microbiol. Rev. 2:191.
3. McManus, B. M., L. H. Chow, J. E. Wilson, D. R. Anderson, J. M. Gulizia,
C. J. Gauntt, K. E. Klingel, K. W. Beisel, and R. Kandolf. 1993. Direct myocardial injury by enterovirus: a central role in the evolution of murine myocarditis. Clin. Immunol. Immunopathol. 68:159.
4. Herskowitz, A., S. Willoughby, T. C. Wu, W. E. Beschorner, D. A. Neumann,
N. R. Rose, K. L. Baughman, and A. A. Ansari. 1993. Immunopathogenesis of
HIV-1-associated cardiomyopathy. Clin. Immunol. Immunopathol. 68:234.
5. Fairweather, D., C. M. Lawson, A. J. Chapman, C. M. Brown, T. W. Booth,
J. M. Papadimitriou, and G. R. Shellam. 1998. Wild isolates of murine cytomegalovirus induce myocarditis and antibodies that cross-react with virus and cardiac
myosin. Immunology 94:263.
6. Neu, N., N. R. Rose, K. W. Beisel, A. Herskowitz, G. Gurri-Glass, and
S. W. Craig. 1987. Cardiac myosin induces myocarditis in genetically predisposed mice. J. Immunol. 139:3630.
7. Neumann, D. A., C. L. Burek, K. L. Baughman, N. R. Rose, and A. Herskowitz.
1990. Circulating heart-reactive antibodies in patients with myocarditis or cardiomyopathy. J. Am. Coll. Cardiol. 16:839.
8. Smith, S. C., and P. M. Allen. 1991. Myosin-induced acute myocarditis is a T
cell-mediated disease. J. Immunol. 147:2141.
9. Brown, C. A., and J. B. O’Connell. 1995. Myocarditis and idiopathic dilated
cardiomyopathy. Am. J. Med. 99:309.
10. Donermeyer, D. L., K. W. Beisel, P. M. Allen, and S. C. Smith. 1995. Myocarditis-inducing epitope of myosin binds constitutively and stably to I-Ak on antigen-presenting cells in the heart. J. Exp. Med. 182:1291.
11. Lawson, C. M., H. L. O’Donoghue, and W. D. Reed. 1992. Mouse cytomegalovirus infection induces antibodies which cross-react with virus and cardiac
myosin: a model for the study of molecular mimicry in the pathogenesis of viral
myocarditis. Immunology 75:513.
12. Gauntt, C. J., H. M. Arizpe, A. L. Higdon, H. J. Wood, D. F. Bowers,
M. M. Rozek, and R. Crawley. 1995. Molecular mimicry, anti-coxsackievirus B3
neutralizing monoclonal antibodies, and myocarditis. J. Immunol. 154:2983.
13. Huber, S. A., C. J. Gauntt, and P. Sakkinen. 1998. Enteroviruses and myocarditis:
viral pathogenesis through replication, cytokine induction, and immunopathogenicity. Adv. Virus Res. 51:35.
14. Hill, S. L., and N. R. Rose. 2001. The transition from viral to autoimmune myocarditis. Autoimmunity 34:169.
15. Shevach, E. M. 2000. Regulatory T cells in autoimmmunity. Annu. Rev. Immunol.
18:423.
16. Cunningham, M. W. 2001. Cardiac myosin and the TH1/TH2 paradigm in autoimmune myocarditis [comment]. Am. J. Pathol. 159:5.
17. Kaya, Z., M. Afanasyeva, Y. Wang, K. M. Dohmen, J. Schlichting, T. Tretter,
D. Fairweather, V. M. Holers, and N. R. Rose. 2001. Contribution of the innate
immune system to autoimmune myocarditis: a role for complement. Nat. Immun.
2:739.
18. Lane, J. R., D. A. Neumann, A. Lafond-Walker, A. Herskowitz, and N. R. Rose.
1992. Interleukin 1 or tumor necrosis factor can promote Coxsackie B3-induced
myocarditis in resistant B10.A mice. J. Exp. Med. 175:1123.
19. Neumann, D. A., J. R. Lane, G. S. Allen, A. Herskowitz, and N. R. Rose. 1993.
Viral myocarditis leading to cardiomyopathy: do cytokines contribute to pathogenesis? Clin. Immunol. Immunopathol. 68:181.
20. Afanasyeva, M., Y. Wang, Z. Kaya, E. A. Stafford, K. M. Dohmen,
A. A. Sadighi Akha, and N. R. Rose. 2001. Interleukin-12 receptor/STAT4 signaling is required for the development of autoimmune myocarditis in mice by an
interferon-␥-independent pathway. Circulation 104:3145.
21. Okura, Y., T. Kazuyoshi, S. Honda, H. Hanawa, H. Watanabe, M. Kodama,
T. Izumi, Y. Aizawa, S. Seki, and T. Abo, T. 1998. Recombinant murine interleukin-12 facilitates induction of cardiac myosin-specific type 1 helper T cells in
rats. Circ. Res. 82:1035.
22. Kodama, M., Y. Matsumoto, M. Fujiwara, F. Masani, T. Izumi, and A. Shibata.
1990. A novel experimental model of giant cell myocarditis induced in rats by
immunization with cardiac myosin fraction. Clin. Immunol. Immunopathol.
57:250.
23. Jones, W. K., J. Gulick, S. Wert, J. Neumann, J. Robbins, and C. Pummerer.
1991. Cellular infiltrate, major histocompatibility antigen expression and immunopathogenic mechanisms in cardiac myosin-induced myocarditis. J. Biol. Chem.
266:24613.
24. Smith, S. C., and P. M. Allen. 1993. The role of T cells in myosin-induced
autoimmune myocarditis. Clin. Immunol. Immunopathol. 68:100.
25. Kodama, M., Y. Matsumoto, and M. Fujiwara. 1992. In vivo lymphocyte-mediated myocardial injuries demonstrated by adoptive transfer of experimental autoimmune myocarditis. Circulation 85:1918.
26. Neu, N., K. W. Beisel, M. D. Traystman, N. R. Rose, and S. W. Craig. 1987.
Autoantibodies specific for the cardiac myosin isoform are found in mice susceptible to Coxsackievirus B3-induced myocarditis. J. Immunol. 138:2488.
27. Neumann, D. A., J. R. Lane, S. M. Wulff, G. S. Allen, A. LaFond-Walker,
A. Herskowitz, and N. R. Rose. 1992. In vivo deposition of myosin-specific
autoantibodies in the hearts of mice with experimental autoimmune myocarditis.
J. Immunol. 148:3806.
28. Liao, L., R. Sindhwani, M. Rojkind, S. Factor, L. Leinwand, and B. Diamond.
1995. Antibody-mediated autoimmune myocarditis depends on genetically determined target organ sensitivity. J. Exp. Med. 181:1123.
29. Afanasyeva, M., Y. Wang, Z. Kaya, S. Park, J. Zilliox, B. H. Schofield, S. L. Hill,
and N. R. Rose. 2001. Experimental autoimmune myocarditis in A/J mice is an
interleukin-4-dependent disease with a Th2 phenotype. Am. J. Pathol. 159:193.
30. Watanabe, K., M. Nakazawa, K. Fuse, H. Hanawa, M. Kodama, Y. Aizawa,
T. Ohnuki, F. Gejyo, H. Maruyama, and J. Miyazaki. 2001. Protection against
autoimmune myocarditis by gene transfer of interleukin-10 by electroporation.
Circulation 104:1098.
31. Wegmann, K. W., W. Zhao, A. C. Griffin, and W. F. Hickey. 1994. Identification
of myocarditogenic peptides derived from cardiac myosin capable of inducing
experimental allergic myocarditis in the Lewis rat: the utility of a class II binding
motif in selecting self-reactive peptides. J. Immunol. 153:892.
32. Inomata, T., H. Hanawa, T. Miyanishi, E. Yajima, S. Nakayama, T. Maita,
M. Kodama, T. Izumi, A. Shibata, and T. Abo. 1995. Localization of porcine
cardiac myosin epitopes that induce experimental autoimmune myocarditis. Circ.
Res. 76:726.
33. Pummerer, C. L., K. Luze, G. Grassl, K. Bachmaier, F. Offner, S. K. Burrell,
D. M. Lenz, T. J. Zamborelli, J. M. Penninger, and N. Neu. 1996. Identification
of cardiac myosin peptides capable of inducing autoimmune myocarditis in
BALB/c mice. J. Clin. Invest. 97:2057.
34. Liao, L., R. Sindhwani, L. Leinwand, B. Diamond, and S. Factor. 1993. Cardiac
␣-myosin heavy chains differ in their induction of myocarditis: identification of
pathogenic epitopes. J. Clin. Invest. 92:2877.
35. Bachmaier, K., N. Neu, R. S. Yeung, T. W. Mak, P. Liu, and J. M. Penninger.
1999. Generation of humanized mice susceptible to peptide-induced inflammatory heart disease. Circulation 99:1885.
36. Kohno, K., Y. Takagaki, Y. Nakajima, and T. Izumi. 2000. Advantage of recombinant technology for the identification of cardiac myosin epitope of severe autoimmune myocarditis in Lewis rats. Jpn. Heart J. 41:67.
37. Kohno, K., Y. Takagaki, N. Aoyama, H. Yokoyama, H. Takehana, and T. Izumi.
2001. A peptide fragment of ␤ cardiac myosin heavy chain (␤-CMHC) can provoke autoimmune myocarditis as well as the corresponding ␣ cardiac myosin
heavy chain (␣-CMHC) fragment. Autoimmunity 34:177.
38. Galvin, J. E., M. E. Hemric, S. D. Kosanke, S. M. Factor, A. Quinn, and
M. W. Cunningham. 2002. Induction of myocarditis and valvulitis in Lewis rats
by different epitopes of cardiac myosin and its implications in rheumatic carditis.
Am. J. Pathol. 160:297.
39. Tobacman, L. S., and R. S. Adelstein. 1984. Enzymatic comparisons between
light chain isozymes of human cardiac myosin subfragment-1. J. Biol. Chem.
259:11226.
40. Sercarz, E. E., P. V. Lehmann, A. Ametani, G. Benichou, A. Miller, and
K. Moudgil. 1993. Dominance and crypticity of T cell antigenic determinants.
Annu. Rev. Immunol. 11:729.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
In addition to T cell repertoire recognition of myocarditic
epitopes, other factors such as activation of APCs and the local
production of cytokines may influence and perpetuate autoimmune
reactivity in vivo (18, 21, 45, 46). Normal heart may not be susceptible to autoreactive T cell attack unless interstitial APCs of
myocardium are activated and up-regulate their surface MHC class
II expression, which is mediated through the cytokines such as
IFN-␥ and TNF-␣ (46 – 49). We demonstrated that in S2–16-induced EAM, a high level of inflammatory cytokines including
IL-6, IL-12, TNF-␣, IL-2, and IFN-␥ were expressed in the myocardium after S2–16 immunization, which was similar to the cytokine expression pattern in HCM treated Lewis rats myocardium.
Although IL-10 mRNA from myocardium was also detected on
day 21 for rats immunized with S2–16 or HCM, the up-regulation
of IL-10 production by S2–16 sensitized T cells at or before day 21
was not detected. Our data suggest that at the induction phase of
S2–16-induced EAM, cytokines induced by TH1 cells were predominant. TH1 cytokines expressed in S2–16-induced EAM are in
contrast to certain mouse models of EAM in which TH2 cytokine
production is associated with myocarditis induction (16, 29).
In conclusion, our study identified a strong pathogenic cryptic
epitope of cardiac myosin that induced EAM in the Lewis rat.
Disease induction was closely associated with Ag-specific T cell
reactivities, MHC complex restriction and other non-MHC factors,
and inflammatory cytokine expression. Because the S2–16 epitope
stimulates such a strong T cell response, it may be an ideal peptide
ligand for the study of T cell degeneracy in myocarditis (44). The
highly myocarditic peptide S2–16 will continue to be useful in
the investigation of the role of epitope mimicry or spreading in the
progression of myocarditis, as well as for a better understanding
the mechanisms in disease or immune tolerance and for the design
of immunotherapies for myocarditis.
3233
3234
CRYPTIC EPITOPE OF CARDIAC MYOSIN INDUCES MYOCARDITIS
41. Cautain, B., J. Damoiseaux, I. Bernard, H. van Straaten, P. van Breda Vriesman,
B. Boneu, P. Druet, and A. Saoudi. 2001. Essential role of TGF-␤ in the natural
resistance to experimental allergic encephalomyelitis in rats. Eur. J. Immunol.
31:1132.
42. Tsuchida, T., R. V. Turner, K. C. Parker, J. E. Coligan, W. E. Biddison, and
H. Hanawa. 1993. Characterization of T cells infiltrating the heart in rats with
experimental autoimmune myocarditis: their similarity to extrathymic T cells in
mice and the site of proliferation. J. Immunol. 151:5930.
43. Neu, N., E. Timms, V. A. Wallace, D. R. Koh, K. Kishihara, C. Pummerer, and
T. W. Mak. 1993. T cells in cardiac myosin-induced myocarditis. J. Exp. Med.
178:1837.
44. Hemmer, B. 1997. Identification of high potency microbial and self ligands for a
human autoreactive class II-restricted T cell clone. J. Exp. Med. 185:1651.
45. Lane, J. R., D. A. Neumann, A. Lafond-Walker, A. Herskowitz, and N. R. Rose.
1991. LPS promotes CB3-induced myocarditis in resistant B10.A mice. Cell.
Immunol. 136:219.
46. Pummerer, C. L., G. Grassl, M. Sailer, K. W. Bachmaier, J. M. Penninger, and
N. Neu. 1996. Cardiac myosin-induced myocarditis: target recognition by autoreactive T cells requires prior activation of cardiac interstitial cells. Lab. Invest.
74:845.
47. Pummerer, C., P. Berger, M. Fruhwirth, C. Ofner, and N. Neu. 1991. Cellular
infiltrate, major histocompatibility antigen expression and immunopathogenic
mechanisms in cardiac myosin-induced myocarditis. Lab. Invest. 65:538.
48. Smith, S. C., and P. M. Allen. 1992. Expression of myosin-class II major histocompatibility complexes in the normal myocardium occurs before induction of
autoimmune myocarditis. Proc. Natl. Acad. Sci. USA 89:9131.
49. Cockfield, S. M., V. Ramassar, and P. F. Halloran. 1993. Regulation of IFN-␥ and
tumor necrosis factor-␣ expression in vivo: effects of cycloheximide and cyclosporine in normal and lipopolysaccharide-treated mice. J. Immunol. 150:342.
50. Jaenicke, T., K. W. Diederich, W. Haas, J. Schleich, P. Lichter, M. Pfordt,
A. Bach, and H. P. Vosberg. 1990. The complete sequence of the human ␤-myosin heavy chain gene and a comparative analysis of its product. Genomics 8:194.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017