EYESPOT ASSEMBLY AND POSITIONING
IN CHLAMYDOMONAS REINHARDTII
by
JOSEPH SAMUEL BOYD
________________________
A Dissertation Submitted to the Faculty of the
DEPARTMENT OF MOLECULAR AND CELLULAR BIOLOGY
In Partial Fulfillment of the Requirements
For the Degree of
DOCTOR OF PHILOSOPHY
WITH A MAJOR IN
BIOCHEMISTRY AND MOLECULAR AND CELLULAR BIOLOGY
in the Graduate College
THE UNIVERSITY OF ARIZONA
2011
2
THE UNIVERSITY OF ARIZONA
GRADUATE COLLEGE
As members of the Dissertation Committee, we certify that we have read the dissertation
prepared by Joseph S. Boyd
titled Eyespot Assembly and Positioning in Chlamydomonas reinhardtii
and recommend that it be accepted as fulfilling the dissertation requirement for the
Degree of Doctor of Philosophy
_______________________________________________________________________
Date: April 15, 2011
Carol Dieckmann
_______________________________________________________________________
Date: April 15, 2011
Ted Weinert
_______________________________________________________________________
Date: April 15, 2011
Frans Tax
_______________________________________________________________________
Date: April 15, 2011
Hanna Fares
_______________________________________________________________________
Date: April 15, 2011
Lisa Nagy
Final approval and acceptance of this dissertation is contingent upon the candidate’s
submission of the final copies of the dissertation to the Graduate College.
I hereby certify that I have read this dissertation prepared under my direction and
recommend that it be accepted as fulfilling the dissertation requirement.
________________________________________________ Date: April 15, 2011
Dissertation Director: Carol L. Dieckmann
3
STATEMENT BY AUTHOR
This dissertation has been submitted in partial fulfillment of requirements for an
advanced degree at the University of Arizona and is deposited in the University Library
to be made available to borrowers under rules of the Library.
Brief quotations from this dissertation are allowable without special permission, provided
that accurate acknowledgment of source is made. Requests for permission for extended
quotation from or reproduction of this manuscript in whole or in part may be granted by
the head of the major department or the Dean of the Graduate College when in his or her
judgment the proposed use of the material is in the interests of scholarship. In all other
instances, however, permission must be obtained from the author.
SIGNED: Joseph Boyd
4
ACKNOWLEDGMENTS
First I would like to thank my advisor, Dr. Carol Dieckmann, who I can honestly say is
the best mentor a student could ask for. Her patience, intelligence, insight, and constant
support and guidance have been invaluable and it has been such a blessing to have been
able to work in her lab on such a fascinating and enjoyable project during graduate school.
Dr. Telsa Mittelmeier taught me many lab skills, and I cannot thank her enough
for all of her support, constructive criticism, and guidance. Dr. Melissa Schonauer was a
great help and provided much-needed moral support. I thank lab technicians Mike Rice
and (also fellow grad student) Dylan Odam for their research support and friendship.
Their stay in the lab was much too short.
Without the work our collaborator, Dr. Mary Rose Lamb, this project would not
have been possible. She graciously allowed me to analyze her eyespot mutants which are
included in this study. Drs. Peter Berthold and Peter Hegemann kindly provided the
photoreceptor antibody which was invaluable for the experiments included herein, and I
thank Dr. Patrice Hamel for providing the insertional library for the genetic screen and Dr.
Cynthia Horst for allowing me to study the cmu1 mutant.
The staff in the Biochemistry and Molecular and Cellular Biology departments
was immensely helpful with the myriad details and paperwork throughout grad school:
Marilyn Kramer, Joan Navarro, Olivia Mendoza, Jane Dugas, Denise Slay, Pam Murray,
and Barb Johnson are much appreciated.
Members of Dr. Roy Parker’s laboratory, including Denise Muhlrad. Dr. Carolyn
Decker, and my fellow grad student, friend and neighbor Kylie Swisher provided support
and assistance with many things. Dr. Carl Boswell was a great help with microscopy.
I would like to thank my committee members, Drs. Roy Parker, Ted Weinert,
Frans Tax, Lisa Nagy, and Hanna Fares, for their support and help. I thank also the many
undergraduate students who I have had the privilege to work with (and learn from) over
the years, including Shad Smith, Derrick Sund, Christopher Brown, Ximin Du, Soba
Tharmarajah, and especially Miranda Gray, who discovered the posterior-eyespot mutant
during her summer research visit in 2008 and was my erstwhile companion on
impromptu algae-collecting field trips.
Funding for this project was provided by the National Science Foundation, a
National Institutes of Health Graduate Training Grant in Biochemistry & Molecular and
Cellular Biology, and the Department of Biochemistry and Molecular Biophysics at the
University of Arizona.
I thank my professors at the University of Redlands, my advisor Dr. Debra Van
Engelen, for her guidance, and Dr. Linda Silveira for spurring my interest in cell biology.
I also give thanks for my wonderful church family at Desert Springs Presbyterian
Church, and the many people I have known through Reformed University Fellowship and
the Graduate Christian Fellowship at the University of Arizona for their spiritual support
and encouragement, and most of all thank God for sustaining me through the many times
of loneliness, failure, and discouragement.
Finally I want to thank my mum and dad, Sheila and Craig Boyd, for their
constant love and support.
5
DEDICATION
To the glory of God
6
TABLE OF CONTENTS
LIST OF FIGURES............................................................................................................9
LIST OF TABLES.............................................................................................................12
ABSTRACT......................................................................................................................13
DISSERTATION OVERVIEW......................................................................................14
CHAPTER 1. INTRODUCTION.....................................................................................15
Section 1: Cellular Asymmetry and Organelle Biogenesis: General Principles...........15
Section 2: Cellular Organization and Life Cycle of Chlamydomonas..........................16
Section 3: Cytoskeletal Contributions to Eyespot Positioning......................................19
Section 4: Ultrastructure, Functions, and Protein Components of the Eyespot............23
Section 5: Eyespot Assembly and Positioning Mutants in C. reinhardtii.....................29
CHAPTER 2. EFFECTS OF EYESPOT-ASSEMBLY LOCI ON ASYMMETRY IN
CHLAMYDOMONAS REINHARDTII...............................................................................33
SUMMARY..................................................................................................................33
INTRODUCTION.......................................................................................................34
RESULTS.....................................................................................................................37
Section 1: Characterization of Novel Eyespot Loci and Their Effects on Eyespot
Assembly and Asymmetric Positioning.....................................................................37
The MIN2 locus affects eyespot size and assembly...............................................37
min2 exacerbates the eyespot-assembly defect of min1........................................40
min2 partially suppresses the multiple-eyespot, but not asymmetry, defects of
mlt1........................................................................................................................40
The MLT2 locus affects eyespot number, size, and asymmetry............................42
The MIN2 and MLT2 loci map to existing eyespot gene clusters..........................44
mlt2 is epistatic to min1 and min2..........................................................................45
Section 2: Effects of Eyespot Assembly and Positioning Loci on Localization and
Steady-State Levels of the Channelrhodopsin-1 Photoreceptor................................46
Eyespot pigment granule layers are required to maintain the shape of the ChR1
photoreceptor patch................................................................................................46
Miniature and multiple-eyespot mutants affect ChR1 localization.......................49
Effect of miniature and multiple-eyespot mutations on steady-state levels of
ChR1......................................................................................................................52
DISCUSSION...............................................................................................................53
CHAPTER 3. ROLES OF EYE2, EYE3, MLT1, AND MLT2 IN EYESPOT
ASSEMBLY......................................................................................................................58
STATEMENT BY AUTHOR.....................................................................................58
SUMMARY..................................................................................................................58
INTRODUCTION.......................................................................................................59
RESULTS.....................................................................................................................60
Section 1: Characterization and Localization of EYE2 and EYE3...........................60
The EYE3 gene encodes a predicted ser/thr kinase of the ABC1 family..............60
EYE3 localizes to the eyespot pigment granule layers........................................62
EYE2 localizes to the chloroplast envelope region of the eyespot......................66
7
TABLE OF CONTENTS-Continued
EYE2 co-positions with ChR1 in eye3 and min1 cells..........................................68
EYE2 associates with ChR1 in the eyespot before pigment granules are
organized................................................................................................................72
Section 2: Effects of the MLT1 and MLT2 Loci on Eyespot Organization...............74
Eyespot organization is perturbed in the mlt1 and mlt2 mutants, but not in min2.74
DISCUSSION...............................................................................................................81
EYE3 localizes to, and is required for, formation of the eyespot pigment granule
arrays......................................................................................................................81
EYE2 localizes to an area corresponding to the chloroplast envelope in the
eyespot...................................................................................................................82
Eyespot pigment granule arrays are necessary for maintaining the supramolecular
organization of the eyespot....................................................................................83
MLT1 and MLT2 affect the maintenance of eyespot organization.......................85
A working model of eyespot assembly..................................................................87
CHAPTER 4. ROLE OF THE D4 ROOTLET IN EYESPOT POSITIONING..............91
STATEMENT BY AUTHOR.....................................................................................91
SUMMARY..................................................................................................................91
INTRODUCTION.......................................................................................................92
RESULTS.....................................................................................................................94
Genetic screen identifies a novel eyespot-position mutant........................................94
Microtubule length varies in eyespot-position mutants.............................................96
Eyespot position correlates with acetylated microtubule rootlet length....................98
The pey1 and cmu1 mutations do not affect eyespot morphology...........................101
Eyespot position is established and becomes independent of the D4 rootlet prior to
interphase.................................................................................................................103
DISCUSSION.............................................................................................................106
CHAPTER 5. PROSPECTIVE FUTURE DIRECTIONS.............................................110
Gene Identification and Localization of the Mini- and Multi-Eye Proteins................110
Functional Analysis of EYE3 and Related Eyespot Kinases.......................................111
Experimental Investigation of Factors Required for Eyespot Disassembly................111
CHAPTER 6. MATERIALS AND METHODS............................................................113
Chlamydomonas strains and media...........................................................................113
Generation of antisera...............................................................................................115
Protein sequence analysis..........................................................................................115
Phototaxis assays........................................................................................................115
Genetic screen.............................................................................................................115
Genetic analysis..........................................................................................................116
Bright field microscopy.............................................................................................116
Immunofluorescence microscopy.............................................................................116
Electron microscopy..................................................................................................118
Peptide blocking........................................................................................................118
Measurements............................................................................................................118
8
TABLE OF CONTENTS- Continued
Cold treatment...........................................................................................................119
Culture Synchronization...........................................................................................120
Immunoblotting.........................................................................................................120
Identification of APHVII insertion flanking sequence...........................................121
DNA sequencing........................................................................................................121
Oligonucleotide synthesis..........................................................................................123
Figure preparation.....................................................................................................123
APPENDIX A: REACTIVITY OF CHLAMYDOMONAS REINHARDTII EYESPOT
ANTIBODIES IN OTHER CHLAMYDOMONAS SPECIES.........................................124
REFERENCES...............................................................................................................126
9
LIST OF FIGURES
Figure 1. Diagram of Chlamydomonas reinhardtii cellular organization.......................18
Figure 2. Ultrastructure of the basal body region in C. reinhardtii.................................20
Figure 3. Diagram of eyespot positioning and cytoskeletal organization in
C. reinhardtii....................................................................................................22
Figure 4. Ultrastructure of the eyespot in C. reinhardtii.................................................25
Figure 5. Electron micrographs of the eyespot in wild-type C. reinhardtii cells............26
Figure 6. Bright field micrographs of wild-type and eyespot mutant strains in C.
reinhardtii.........................................................................................................30
Figure 7. Schematic diagram of the domain organization of the EYE2 and MIN1
proteins.............................................................................................................32
Figure 8. Bright field micrographs of eyespot assembly and positioning mutants in
Chlamydomonas reinhardtii.............................................................................35
Figure 9. Diagrammatic representation of comparative eyespot areas of wild-type and
miniature-eyed strains......................................................................................38
Figure 10. Comparison on eyespot morphology in wild-type, min1, min2 and min1 min2
cells grown without acetate or with acetate...................................................38
Figure 11. Eyespots in the mlt2 mutant are distributed over a wide size range, but are on
average smaller than wild-type......................................................................43
Figure 12. Some mlt2 cells have multiple pyrenoids.......................................................43
Figure 13. ChR1 photoreceptor localization pattern is altered in eyeless mutants..........47
Figure 14. Effects of miniature and multiple-eyespot loci on ChR1 photoreceptor
localization.....................................................................................................50
Figure 15. Immunoblot showing steady-state levels of ChR1 and EYE2 in eyespot
mutants...........................................................................................................53
Figure 16. Clustal alignment of the amino acid sequence of the region including the
kinase active site of the EYE3 protein (residues 549 to 654) with related
ABC1 kinases in Chlamydomonas reinhardtii..............................................61
Figure 17. EYE3 localizes to eyespot pigment granules.................................................63
10
LIST OF FIGURES- Continued
Figure 18. Anti-EYE3 antibody is specific to EYE3 protein and EYE3 is not detectable
in the eye2 mutant..........................................................................................65
Figure 19. EYE2 localizes to area corresponding to the chloroplast envelope in the
eyespot...........................................................................................................67
Figure 20. Western blot of whole-cell extracts of auxotrophically-grown wild-type, eye2,
min1, and eye3 strains probed with anti-ChR1, anti-EYE2, and antitubulin............................................................................................................69
Figure 21. EYE2 protein shares aberrant localization patterns with ChR1 photoreceptor
in eye3 and min1 mutant cells........................................................................70
Figure 22. EYE2 associates with ChR1 and localizes to the eyespot region before
organization of the pigment granule arrays...................................................73
Figure 23. Eyespot organization in mlt1, min2, and mlt2 mutant cells............................75
Figure 24. EYE2, EYE3, and ChR1 positioning is dramatically disrupted in
asynchronous populations of mlt1 and mlt2 cells..........................................77
Figure 25. Comparison of the extent of EYE2, EYE3, and ChR1 co-positioning in mlt1
and mlt2 cells.................................................................................................80
Figure 26. Model of eyespot assembly............................................................................89
Figure 27. Bright field micrographs of a wild-type C. reinhardtii cell and eyespotposition mutants.............................................................................................95
Figure 28. Acetylated rootlet length is perturbed in eyespot-position mutants...............97
Figure 29. Eyespot position and flagellar length vary over a wider, longer range in the
pey1 and cmu1 mutants compared to wild-type, and eyespot position
correlates with D4 rootlet length....................................................................99
Figure 30. Combined immunofluorescence micrographs demonstrating eyespot
positions and rootlet associations in wild-type C. reinhardtii and eyespotposition mutants...........................................................................................102
Figure 31. Eyespot positioning in cold-treated and early G1 phase wild-type and pey1
cells..............................................................................................................104
11
LIST OF FIGURES- Continued
Figure 32. Reactivity of Chlamydomonas reinhardtii eyespot antibodies in C. incerta
and C. eugametos.........................................................................................125
12
LIST OF TABLES
Table 1. Eyespot area of miniature-eyed mutants............................................................38
Table 2. Eyespot phenotypes of min2 mlt1 and min1 min2 double mutants....................41
Table 3. Linkage data for eyespot-assembly loci.............................................................44
Table 4. ChR1 localization patterns in eye3 and min1 mutants.......................................48
Table 5. Co-positioning of EYE2, EYE3, and ChR1 in an asynchronous mlt1
population..........................................................................................................79
Table 6. Co-positioning of EYE2, EYE3, and ChR1 in an asynchronous mlt2
population..........................................................................................................79
Table 7. Summary of metrics of wild-type, pey1, and cmu1 cells...................................96
Table 8. Chlamydomonas strains used in this study......................................................114
Table 9. Oligonucleotides used in this study..................................................................122
13
ABSTRACT
The eyespot of the biflagellate unicellular green alga Chlamydomonas reinhardtii is a
complex organelle that facilitates directional responses of the cell to environmental light
stimuli. The eyespot, which assembles de novo after every cell division and retains a
distinctive association with the microtubule cytoskeleton, comprises an elliptical patch of
rhodopsin photoreceptors in the plasma membrane and stacks of carotenoid-rich pigment
granule arrays in the chloroplast and serves as a model for understanding how organelles
are formed and placed asymmetrically in the cell. This study describes the roles of
several factors in the assembly and positioning of the eyespot. Two loci, EYE2 and
EYE3, define factors involved in the formation and organization of the eyespot pigment
granule arrays. Whereas EYE3, a serine/threonine kinase of the ABC1 family, localizes
to pigment granules, EYE2 localization corresponds to an area of the chloroplast
envelope in the eyespot. These proteins play interdependent roles: EYE2 and the ChR1
photoreceptor co-position in the absence of pigment granules, and the pigment granules
are required to maintain the shape and integrity of the EYE2/ChR1 patch. The miniatureeyespot locus MIN2 affects eyespot size and likely regulates the amount of material
available for eyespot assembly. The MLT2 locus regulates eyespot size, number, and
asymmetry. A novel locus, PEY1, modulates the position of the eyespot on the anteriorposterior axis by affecting microtubule rootlet length. A working model is developed
wherein rootlet microtubule-directed photoreceptor localization establishes connections
in the chloroplast envelope with EYE2, which directs the site for pigment granule array
assembly, and MLT2 is proposed to negatively regulate the levels of eyespot proteins.
14
DISSERTATION OVERVIEW
This dissertation investigates the biogenesis and positioning of the eyespot, an
asymmetrically-localized photosensory organelle, in the unicellular alga Chlamydomonas
reinhardtii. In this study, aspects of eyespot assembly will be examined by the genetic
and phenotypic characterization of eyespot mutants and the localization of and
associations between the eyespot proteins EYE2, EYE3, and ChR1. Eyespot positioning
will be discussed in light of the CMU1, MLT1 and PEY1 loci which alter the cytoskeletal
microtubule rootlets.
Chapter One introduces principles of organelle biogenesis and cellular asymmetry
and describes the cellular organization of Chlamydomonas reinhardtii. The ultrastructure,
functions, and known protein components of the eyespot are summarized, along with
contributions of cytoskeletal elements to eyespot placement. A brief survey of
previously-described eyespot assembly and positioning mutants is presented.
Chapter Two covers the genetic and phenotypic characterization of the MIN2 and
MLT2 loci and analysis of genetic interactions with other eyespot mutants. The effects of
these mutations on asymmetric localization of the ChR1 photoreceptor are discussed.
The roles of the EYE2 and EYE3 proteins in eyespot assembly and the effects of
multiple-eyespot loci on eyespot organization are examined in Chapter Three, while
Chapter Four delineates the role of the D4 microtubule rootlet in the anterior-posterior
positioning of the eyespot and events in the establishment of eyespot placement.
Prospective topics for future investigation are outlined in Chapter Five. Finally,
Chapter Six describes the experimental materials and methods used in this study.
15
CHAPTER 1
INTRODUCTION
Section 1: Cellular Asymmetry and Organelle Biogenesis: General Principles
Asymmetry is a fundamental property of all cells. The arrangement of organelles in the
cell is not random, but guided by specific intrinsically polar components and the
mechanisms of organelle duplication and biogenesis. Similar principles undergird
cellular patterning across the spectrum of life, from the intracellular organization of
protein complexes in prokaryotes to establishment of apical-basal polarity in eukaryotic
cells to the development of tissues. In most metazoa, the centrioles, intrinsically
asymmetric structures within the centrosome, transmit positional information through a
network of interactions with subcellular organelles (Beisson and Jerka-Dziadosz 1999;
Geimer and Melkonian 2004; Feldman et al. 2007; Bornens 2008). Variations on this
theme give rise to the multifarious arrays of cellular architecture displayed in diverse
organisms.
There are four basic modes of organelle biogenesis: fission, differentiation from
existing organelles, semiconservative replication, and de novo synthesis. The initial two
represent the most common mechanisms (Nunnari and Walter 1996). Mitochondria and
chloroplasts are well-known examples of fissile organelles. Examples of organelles
arising via differentiation include nuclear envelope membranes (Ellenberg et al. 1997)
and organelles in the secretory pathway, such as the Golgi apparatus (Zaal et al. 1999),
which is thought to arise from extensions of endoplasmic reticulum membrane as cells
16
exit mitosis. The centrioles replicate semiconservatively each cell cycle, the mother
centriole serving as a template for the newly-formed daughter centriole (Stearns 2001).
De novo biogenesis is exemplified by flagella and primary cilia, which assemble using
the centrioles (acting as basal bodies) as templates. Centrioles can also assemble by a de
novo pathway, but this process takes longer and is not the normal mode of duplication
(Dutcher 2003). Cases in which organelles assemble completely without pre-existing
elements are less well-studied, but provide a fascinating opportunity to investigate both
the mechanisms of organelle biogenesis and the coordination of cellular processes
necessary for their development. The photosensory organelle found in many algae, the
eyespot, is both precisely located asymmetrically in the cell and assembles de novo after
each cell division in many species. In particular, the eyespot of the unicellular
chlorophyte Chlamydomonas reinhardtii has served as a model system for study of
organelle biogenesis and asymmetric positioning.
Section 2: Cellular Organization and Life Cycle of Chlamydomonas
Chlamydomonas reinhardtii, a unicellular, biflagellate green alga, has a characteristic cell
geometry (Figure 1). The flagella grow from and are anchored to the two basal bodies,
which define the anterior pole of the cell. The mother basal body is inherited from the
mother cell while the daughter basal body is newly formed from the probasal body in the
daughter cell. The nucleus is connected to the basal bodies via a network of fibers,
termed the rhizoplast, which is made up of the calcium-responsive contractile protein
centrin (Geimer and Melkonian 2005); the endoplasmic reticulum and Golgi are situated
17
on the opposite side of the nucleus in reference to the basal bodies. The single, cupshaped chloroplast fills the posterior two-thirds of the cell. At the base of the chloroplast
lies the pyrenoid, a compartment that functions in carbon sequestration and other
metabolic functions, containing high concentrations of the enzyme ribulose-1,5bisphosphate carboxylase/oxygenase (Rubisco). The eyespot is visible as a red-orange
elliptical spot that is located at or near the cell equator. Although the term “eyespot
apparatus” has been introduced to distinguish between the chloroplast-localized pigment
granule compartment and the eyespot in toto including plasma membrane proteins
(Melkonian and Robenek 1984), in this study the term “eyespot” will be used to refer to
the entire assemblage of chloroplast and plasma membrane components, the subcompartments being designated more precisely as necessary.
Chlamydomonas is a haploid heterotroph that can reproduce both asexually and
sexually (Harris 1989). During cell division, the flagella are disassembled and the basal
bodies, now acting as centrioles, move to opposite ends of the cell. The chloroplast and
pyrenoid divide and the eyespot disassembles, and the former location of the eyespot is
divided by the cleavage plane, which runs along the anterior-posterior axis. In the sexual
cycle, mating-competent gametes of opposite mating types fuse and form a thick-walled
zygospore, which undergoes meiosis and germinates into a tetrad. The ability to induce
the sexual cycle in the laboratory facilitates genetic analysis. Chlamydomonas
reinhardtii can grow photoautotrophically or in the dark utilizing acetate as a carbon
source (Harris 1989).
18
flagella
contractile vacuoles
basal bodies
mitochondrion
endoplasmic
reticulum
rhizoplast
nucleus
Golgi apparatus
chloroplast
eyespot
pyrenoid
Figure 1 Diagram of Chlamydomonas reinhardtii cellular organization. The two
flagella are located at the anterior of the cell and propel the cell forward in a breaststroke-like beating pattern. The basal bodies (blue circles) nucleate the flagella and are
connected to the nucleus by a network of centrin fibers termed the rhizoplast. The
remainder of the cell is dominated by a single large, cup-shaped chloroplast, in which the
pyrenoid is situated near the posterior pole. The photosensory eyespot is placed
asymmetrically on the daughter side of the cell approximately at the cell equator.
19
Section 3: Cytoskeletal Contributions to Eyespot Positioning
Flagellate algae are characterized by a set of basal body-associated cytoskeletal structures
(Inouye 2000). The basal bodies are associated with various fibrous structures, including
proximal and distal striated fibers linking the two basal bodies to each other, lateral fibers
connecting the basal bodies with their respective probasal bodies, and actin filaments
which play a role in generating the cleavage furrow during cytokinesis (Figure 2)
(Dutcher 2003; Ehler and Dutcher 1998). In biflagellate chlorophytes, two microtubular
rootlets arise from specific triplet microtubules at the proximal ends of each basal body,
arranged in a cruciate pattern, and are associated with the proximal striated fiber. Two of
the four rootlets have two microtubules and the other two have variable numbers of
microtubules depending on the species (Goodenough and Weiss 1978). C. reinhardtii
has a 4-2-4-2 microtubular rootlet system (Figure 3A). The two mother rootlets
associated with the mother basal body are inherited from the mother cell after cytokinesis.
The daughter rootlets form anew from the daughter basal body; in the subsequent cell
cycle the daughter rootlets become the new mother rootlets in the daughter cell. The
microtubules of the four-membered rootlets are arranged in a three-over-one
configuration (Harris 2009).
In Chlamydomonas and other green algal genera, the eyespot is invariably
positioned in association with the daughter four-membered (D4) rootlet (Ringo 1967;
Moestrup 1978; Melkonian 1984), positioned 45° from the plane of the flagella (Holmes
and Dutcher 1989) (Figure 3B). The precise positioning of the eyespot is essential for
coordination with flagellar beat frequency and proper photoorientation of the cell in
20
response to light signals (Rüffer and Nultsch 1991). The rootlet microtubules are highly
acetylated, a modification that confers enhanced stability concurrent with increased
resistance to microtubule-depolymerizing drugs (LeDizet and Piperno, 1986). Data are
indicative that the acetylation track of these rootlets extends the full length of the rootlet
in the majority of cells during most of the cell cycle (Mittelmeier et al. 2011). The
eyespots of a few green algal genera do not exhibit rootlet association, but in these
instances the eyespot does not form de novo but divides in situ and is retained in the
daughter cells (Melkonian and Robenek 1984), thus a positioning cue is not required.
Figure 2 Ultrastructure of the basal body region in C. reinhardtii. A: Electron
micrograph showing ultrastructure of the basal body region in cross-section. The two
basal bodies are connected at their distal and proximal ends by striated fibers. The twomembered rootlets originate from triplet nine and four-membered from triplets two and
three at the proximal ends of each basal body. Abbreviations: BB, basal body; DSF,
distal striated fiber; PSF, proximal striated fiber; M, mitochondrion. Magnification:
40,000x. B: Diagram of the basal body region showing microtubule rootlets. The lateral
striated fibers, connecting the basal bodies and rootlets to the probasal bodies, have been
omitted for clarity. Adapted from Harris (2009).
21
A
B
distal striated fiber
basal body
probasal body
4-membered rootlet
2-membered rootlet
proximal striated fiber
22
Figure 3 Diagram of eyespot positioning and cytoskeletal organization in C. reinhardtii.
A: The basal bodies (gray circles) nucleate the two flagella and four microtubule rootlets.
Two rootlets (D2 and D4) extend from the region of the daughter basal body and two
(M2 and M4) are inherited from the mother cell. The eyespot (large gray oval) is
associated with the D4 rootlet. B: View from the anterior pole of a cell showing the
cruciate arrangement of the rootlets. The eyespot is situated 45° from the plane of the
flagellar beat (dark bars).
23
Section 4: Ultrastructure, Functions, and Protein Components of the Eyespot
Phototactic cells respond to varying light levels by either swimming toward a source of
low intensity light (positive phototaxis) or away from high intensity light (negative
phototaxis), an adaptation for optimizing photosynthetic efficiency in their aqueous
environment (for reviews see Witman 1993; Kreimer 1994). These phototactic responses
are induced by alteration of the flagellar beat pattern via Ca2+-mediated signaling
mechanisms (Nultsch 1983; Kamiya and Witman 1984; Hegemann et al. 1990). The
eyespot mediates such perception of environmental light cues. The structural
organization of the eyespot of C. reinhardtii is complex, encompassing components in
both the chloroplast and plasma membrane and comprising two to four layers of
carotenoid-filled pigment granules arranged in hexagonally close-packed arrays between
layers of thylakoid membranes and tightly apposed to the chloroplast envelope (Figures 4
and 5; Melkonian and Robenek 1984; for reviews see Dieckmann 2003; Kreimer 2009).
Each eyespot comprises an average of 120 pigment granules in C. reinhardtii (Melkonian
and Robenek 1984). The membranes in the eyespot region are highly specialized, the
outer chloroplast envelope membrane characterized by a high intermembrane particle
density (Melkonian and Robenek 1980). By electron microscopy, fibrillar material is
often observed in the area between the plasma membrane and chloroplast envelope
(Figure 5A).
Directly overlaying the pigment granule compartment is a particle-dense region of
plasma membrane containing light-gated rhodopsin photoreceptors, channelrhodopsins 1
and 2 (ChR1 and ChR2) which differentially mediate responses to high and low-intensity
24
light and have respective absorption maxima of 510 and 470 nm (Sineshchekov et al.
2002; Nagel et al. 2002; Nagel et al. 2003; Berthold et al. 2008). The regular stacks of
the eyespot pigment granule arrays act in what the physics of light is called a quarterwave interference reflector, reflecting incoming light onto the photoreceptors while
concomitantly blocking light from other directions, thus enhancing directional perception
and sensitivity of photoresponses to light stimuli (Foster and Smyth 1980; Morel-Laurens
and Feinleib 1983). The channelrhodopsins conduct hydrogen and divalent cations upon
conformational changes induced by trans-to-cis isomerization of the retinal chromophore
(Berthold et al. 2008). ChR1 and ChR2 possess large C-terminal domains that are targets
of phosphorylation, and it has been proposed that photoresponses are modulated by
reversible phosphorylation of the photoreceptor by specialized eyespot kinases (Wagner
et al. 2008). At high light intensities the light-induced depolarization of the membrane is
rapid and likely does not involve intermediary signaling components; however, it is
probable that a pathway exists for signal amplification at low light intensities
(Sineshchekov and Govorunova 2001).
25
Figure 4 Ultrastructure of the eyespot in C. reinhardtii. Bright field micrograph of a
wild-type C. reinhardtii cell and diagram of the eyespot apparatus. Layers of carotenoidfilled pigment granules in the chloroplast are subtended by thylakoid membranes. The
pigment granule layers are closely apposed to the chloroplast envelope and the overlying
photoreceptor molecules in the plasma membrane. The regular spacing of the pigment
granule stacks acts as a quarter-wave plate reflector, acting both to reflect orthogonal
light, increasing photon capture by the photoreceptors, and to absorb light from other
directions, thus enhancing directional light perception.
26
Figure 5 Electron micrographs of the eyespot in wild-type C. reinhardtii cells. A:
Electron micrograph of a cross-section through the eyespot, showing the layers of
regularly-spaced pigment granules associated with the chloroplast envelope and thylakoid
membranes. Magnification: 53,000x. Abbreviations: CE, chloroplast envelope; CW, cell
wall; PG, pigment granule, PM, plasma membrane, S, stroma; T, thylakoid. B: Electron
micrograph of a tangential section through the eyespot showing association of the eyespot
with D4 rootlet microtubules (arrows). The oval arrangement of the eyespot pigment
granules is visible. The anterior of the cell is toward the top of the image. Magnification:
66,000x.
27
28
A proteomic analysis of isolated eyespots from C. reinhardtii revealed at least
200 different proteins, of which 30 were novel or of unknown function (Schmidt et al.
2006). Proteins of the carotenoid and retinal synthesis pathways and protein kinases of
the ABC1 family, whose homologs in yeast and bacteria function in quinone biosynthesis,
were also enriched in the eyespot. The eyespot pigment granules are rich in carotenoids,
with β-carotene comprising the vast majority of pigment content in the C. reinhardtii
eyespot (Ohad et al. 1969). The pigment granules bear resemblance to plastoglobules,
lipid-filled structures that blister from and are co-extensive with thylakoid membranes
(Ytterberg et al. 2006; Bréhélin et al. 2007). Plastoglobules are sites for lipid storage and
biosynthesis of carotenoids, tocopherols, and quionones (Kessler and Vidi 2007). It is
possible that eyespot pigment granules play a role in lipid metabolism. The eyespot also
functions in chemotaxis and circadian control of photoresponses, containing such
important regulators as the blue-light photoreceptor phototropin and the signaling protein
casein kinase 1 (Schmidt et al. 2006). The eyespot is thus a multifunctional organelle
possessing metabolic and regulatory roles in addition to photosensing.
A major class of predicted structural proteins identified in the eyespot was
plastoglobule associated proteins (PAP)/fibrillins, also known as plastid lipid-associated
proteins (PLAPs). In plants, PAP/fibrillins facilitate the formation of plastoglobules from
thylakoids by binding carotenoids (Deruère et al. 1994; Simkin et al. 2007). One of the
eight PAP/fibrillins identified in the eyespot proteome was also present in
phosphoproteome (Wagner et al. 2008). In the eyespot, fibrillins may function in a
structural capacity in the pigment granules, assisting in their aggregation by mediating
29
interactions between the globules and with associated membranes while preventing
coalescence of the granules. The many unknown proteins identified in the eyespot
illustrate the complexity of this multifaceted system and underscore the challenges that
await efforts at elucidation of eyespot-assembly mechanisms and characterization of the
full complement of its protein components.
Section 5: Eyespot Assembly and Positioning Mutants in C. reinhardtii
Forward genetic approaches have been instructive in identifying several of the factors
involved in the eyespot-assembly process. Classes of mutations affecting eyespot
biogenesis, structure, and positioning have been discovered. Loci affecting eyespot
assembly and positioning include the miniature-eyespot locus MIN1, the eyeless loci
EYE2 and EYE3, and the multiple-eyespot MLT1 locus (Lamb et al. 1999). Both the eye2
and eye3 mutants lack eyespots (Figure 6B,C) and are unable to phototax at low light
intensity, yet exhibit negative phototaxis in response to high light, indicative that the
photosensory signaling system in these mutants remains intact (Roberts 1999; Roberts et
al. 2001). The EYE2 protein contains a LysM domain and thioredoxin motif (Figure 7).
However, since thioredoxin activity is not required for eyespot assembly (Roberts et al.
2001), EYE2 has been suggested to serve a chaperone-like function in assembly of the
eyespot pigment granule arrays. The min1 mutant possesses a miniature eyespot
characterized by disorganized pigment granules in the chloroplast stroma (Figure 6D).
MIN1 is a C2/LysM-domain protein, present in the eyespot proteome (Schmidt et al.
2006), that was postulated to be involved in chloroplast envelope-plasma membrane
30
Figure 6 Bright field micrographs of wild-type and eyespot mutant strains in C.
reinhardtii. Arrows indicate eyespots. A: A wild-type cell with equatorially-localized
eyespot. B and C: eye2 and eye3 mutant cells, which lack organized pigment granule
arrays. D: The min1 mutant has a miniature, equatorially-localized eyespot. E and F:
Cells of the mlt1 mutant have multiple mis-positioned eyespots. Approximately half of
mlt1 cells with two eyespots have both positioned on one side of the cell (E) and half
possess one eyespot on either side (F). Scale bars, 5 μm.
31
attachment (Mittelmeier et al. 2008) (Figure 7). LysM domains were originally identified
in bacterial cell-wall degrading enzymes as binding peptidoglycans (Bateman and
Bycroft 2000) and they mediate interactions with other proteins in defense responses in
plants (Knogge and Scheel 2006). Cells of the multiple-eyespot mutant mlt1 most often
have two eyespots per cell that can be positioned with both on the same side of the cell or
one on either side of the cell (Figure 6E,F). mlt1 eyespots have normal pigment granule
organization, and cells grown for an extended period in stationary phase acquire
additional eyespots (Lamb et al. 1999). The predicted MLT1 protein is a large (233 kDa)
low-complexity protein that is not predicted to possess a chloroplast-targeting sequence
(JGI C. reinhardtii version 4.0; Protein ID 188661; http://www.chlamy.org) and has no
functional domains or homology to other proteins in the databases.
The present study characterizes novel loci important for eyespot development and
positioning and probes the roles of the EYE2 and EYE3 proteins in eyespot assembly.
Effects of eyespot mutations on interactions between eyespot proteins and the role of the
D4 rootlet in eyespot positioning are elucidated and discussed in light of a working model
for biogenesis and positioning of this organelle.
32
Figure 7 Schematic diagram of the domain organization of the EYE2 and MIN1 proteins.
The EYE2 protein contains an N-terminal chloroplast-targeting domain, thioredoxin
active site motif, LysM domain, and transmembrane helix (solid black region; residues
311-330). In the MIN1 protein, an N-terminal C2 (phospholipid binding) domain and an
alanine-rich region are separated from the C-terminal LysM domain by a transmembrane
helix (residues 251-270).
33
CHAPTER 2
EFFECTS OF EYESPOT-ASSEMBLY LOCI ON
ASYMMETRY IN CHLAMYDOMONAS REINHARDTII
SUMMARY
The eyespot of Chlamydomonas reinhardtii is a model system for the study of organelle
biogenesis and placement. Eyespot assembly and positioning are affected by several
genetic loci in this organism, which have been identified in forward genetic screens for
phototaxis-defective mutants. While the photobehaviors of these mutants have been
analyzed, genetic and phenotypic characterization of these loci has not been thoroughly
investigated. In this study, the effects of eyeless, miniature, and multiple-eyespot
mutations on the localization and expression levels of the rhodopsin photoreceptor
channelrhodopsin-1 (ChR1) are examined and genetic interactions between these loci are
characterized. ChR1 remains asymmetrically-localized in eyeless and miniature-eyed
mutants, but asymmetry is lost in multiple-eyespot mutants. The MLT2 locus maps to
chromosome 12 and is tightly linked to MLT1. The MIN2 locus is linked to EYE3 on
chromosome 2, providing evidence for a second eyespot gene cluster. Both min1 and
min2 suppress, to varying degrees, the phenotypes of mlt1 but not mlt2. The data are
indicative that MIN2 is a regulator of eyespot size, MLT2 regulates eyespot number, size,
and asymmetry, and the eyespot pigment granules are required for maintaining the shape
of the photoreceptor patch.
34
INTRODUCTION
The characteristic cellular geometry and genetic tractability of the unicellular chlorophyte
Chlamydomonas reinhardtii have made it an excellent model system for the study of
organelle biogenesis and positioning. The eyespot of C. reinhardtii is an asymmetricallylocalized organelle that mediates responses of the cell to environmental light stimuli. The
major photoreceptors of the eyespot, channelrhodopsins 1 and 2 (ChR1 and ChR2; Nagel
et al. 2001; Nagel et al. 2002; Sincechekov et al. 2002), are light-gated cation channels
located in the plasma membrane overlaying the chloroplast-localized pigment granule
stacks of the eyespot. Phototactic responses of the organism are elicited through
flagellar-mediated swimming responses to the generated signals. The photoreceptor
ChR1 is associated with the D4 rootlet and may be actively trafficked from the anterior
basal body region to the eyespot (Mittelmeier et al. 2011).
Several mutants affecting eyespot assembly have been isolated from genetic
screens for phototaxis-defective strains and described, including the eyeless mutants eye2
and eye3, which lack organized pigment granule arrays; min1, which has a miniature
eyespot; and mlt1, which assembles multiple eyespots that can be positioned on either
side of the cell. In addition, two other phototaxis-defective mutants have been isolated:
min2-1 was a spontaneous mutation isolated after mutagenesis of wild-type strain 137c
mt+ with the CRY-1 insertion (Nelson et al. 1994), while mlt2-1 was isolated following 5fluorodeoxyuridine-induced mutagenesis of strain 137c mt+ (M. R. Lamb, personal
communication). min2 and mlt2 have not been fully characterized phenotypically or
genetically. In the present study, novel eyespot-assembly loci are genetically mapped,
35
and epistasis analysis is carried out with previously-described eyespot mutant strains to
investigate genetic interactions and unravel possible functions for the factors encoded by
the gene products of these loci in eyespot assembly and asymmetric positioning. The
effects of mutations in these loci on localization of the ChR1 photoreceptor and
asymmetric placement of the eyespot apparatus are explored and discussed.
Figure 8 Bright field micrographs of eyespot assembly and positioning mutants in
Chlamydomonas reinhardtii. Arrows indicate eyespots. Scale bars, 5 μm. Panels A and
D are reproduced from Figure 6. A: min1 has a miniature, equatorially-localized eyespot.
B: The miniature eyespot in min2 is equatorially-localized and slightly smaller than wildtype. C: min1 min2 double mutant. Over half of cells in this mutant have no eyespot
observable by bright field light microscopy, with eyespots of the remainder of cells in a
population ranging in size from ultra-mini to approximately min1 size. D: mlt1 cell with
two eyespots on same side of cell. E: mlt1 cell with two eyespots on opposite sides. F:
mlt2 cell with three eyespots. Combined image from two focal planes. G: min1 mlt1
double mutant cell with ultra-mini eyespot in anterior lobe of chloroplast. H: min1 mlt1
cell with three miniature, non-asymmetric eyespots. I: min1 mlt2 double mutant with
four eyespots, exhibiting the mlt2 phenotype. Combined image from two focal planes. J:
min2 mlt1 cell with ultra-mini eyespot at anterior of chloroplast lobe. K: min2 mlt1 cell
with slightly anteriorly-localized miniature eyespot. L: min2 mlt2 double mutant with
three eyespots, exhibiting the mlt2 phenotype.
36
37
RESULTS
Section 1: Characterization of Novel Eyespot Loci and Their Effects on Eyespot
Assembly and Asymmetric Positioning
The MIN2 locus affects eyespot size and assembly
The min2-1 mutant was identified in a genetic screen for strains defective in phototaxis
following insertional mutagenesis of wild-type strain 137c mt+. The mutation in min2-1
was found to be unlinked to the CRY-1 insertion (M. R. Lamb, personal communication).
min2-1 cells are characterized by bright field microscopy by an equatorially-localized
miniature eyespot (Figure 8B). The average area of eyespots measured in a min2
population was 0.85 ± 0.16 μm2 (71% of wild-type area) compared to an average area of
0.38 ± 0.09 μm2 for min1 cells (32% of wild-type area) and average area of wild-type
eyespots of 1.2 ± 0.24 μm2 (Table 1). A diagrammatic representation of average eyespot
areas of wild-type, min1, and min2 cells is shown in Figure 9. The eyespot morphology
of min2 cells did not appear to differ between cultures grown photoautotrophically and
cells grown mixotrophically in acetate-containing medium (Figure 10E,F).
38
Figure 9 Diagrammatic representation of comparative eyespot areas of wild-type and
miniature-eyed strains. min1 eyespots are on average 32% of wild-type area while min2
cells possess eyespots that are an average of 71% wild-type area (Table 1 below).
Table 1
Eyespot area of miniature-eyed mutants
Strain
wild-type
Average eyespot
area (μm2)
1.2
S.D. (μm2)
0.24
% wild-type area
N/A
n
100
min1
0.38
0.09
32
100
min2
0.85
0.16
71
100
.
39
Figure 10 Comparison on eyespot
morphology in wild-type, min1, min2
and min1 min2 cells grown without
acetate or with acetate. Cells shown
in left column were grown in M
medium (no acetate) and cells in right
column in R (+ acetate). While min1
cells assemble a more organized,
slightly larger eyespot when grown
with acetate (D), no change in eyespot
morphology is observed in wild-type
(A-B), min2 (E-F) or min1 min2 cells
(G-H). Scale bars, 5 µm.
40
min2 exacerbates the eyespot-assembly defect of min1
Cells of the min1 mutant assemble a miniature, disorganized eyespot when grown
photoautotrophically in medium lacking acetate (Figure 8A), but min1 cells grown
mixotrophically in acetate-containing medium assemble eyespots that are more organized
and closer in morphology to wild-type (Lamb et al. 1999; Mittelmeier et al. 2008). The
combination of the min1 and min2 mutations resulted in cells with an intensified eyespot
assembly defect. Of min1 min2 cells scored after overnight growth in M medium, 58%
had no eyespot observable by bright field microscopy under oil immersion at 1500x
magnification (Table 2). The remainder of cells in the population had a miniature
eyespot which appeared to be approximately min1-size (Figure 8C). Thus, eyespots can
assemble in the absence of both MIN1 and MIN2 function, but the lack of MIN2 function
exacerbates the eyespot assembly defect of min1 mutants. Unlike min1, min1 min2 cells
are unable to assemble a larger eyespot when grown in medium containing acetate
(Figure 10G,H). These data are consistent with the hypothesis that MIN2 regulates the
amount of material available for eyespot assembly.
min2 affects the multiple-eyespot, but not asymmetry, defects of mlt1
Of eyespots scored by bright field microscopy in a population of min2 mlt1 double
mutant cells (n=244), 76% had one eyespot, 13% had two eyespots, and 11% had no
observable eyespot (Table 2). Eyespots of double mutant cells ranged in size from ultraminiature to approximately min2-size, and ranged in position from the anterior tip of the
chloroplast lobe (Figure 8J) to approximately equatorial (Figure 8K). Among min2 mlt1
41
cells possessing two eyespots, the proportion of eyespots on the same versus opposite
sides of the did not substantially differ from the proportions observed in a mlt1
population (Table 2). These data appear to indicate that the min2 mutation affects the
eyespot number defect, but does not affect the asymmetry defect, of mlt1.
Table 2
Eyespot phenotypes of min2 mlt1 and min1 min2 double mutants and mlt1 cells
No. of
cells
Strain
scored 0
min1 min2 101
59
(58%)
min2 mlt1
244
mlt1
104
27
(11%)
0
No. of eyespots/cell
1
2
3
42
0
0
(42%)
185
(76%)
0
32
(13%)
35
(34%)
4-5
0
Position of multiple
eyespots in cell*
same
opposite
N/A
0
0
19
(59%)
13
(41%)
56
(54%)
13
(12%)
42
(46%)
49
(54%)
*scoring excludes mlt1 cells with four or more eyespots
42
The MLT2 locus affects eyespot number, size, and asymmetry
The multiple-eyespot mutant mlt2 was identified following 5-fluorodeoxyuridine-induced
mutagenesis of wild-type strain 137c mt+. The mlt2 strain does not display positive
phototaxis, but negative phototaxis has not been characterized in this mutant. The mlt2
mutation complements mlt1-1 (10 ptx+ diploids with wild-type eyespots, n=10). The
eyespot phenotype of mlt2 displays both loss of asymmetry and defects in eyespot
positioning, as well as mis-regulation of eyespot number. As observed by bright-field
light microscopy, mlt2 cells have one to five eyespots that are positioned throughout the
chloroplast of the cell (Figure 8F). Thus, unlike mlt1 cells, eyespots of the mlt2 mutant
are not restricted to the flagellar hemisphere of the cell. Eyespots scored in a mlt2
population ranged in size from 0.04 to 1.39 μm2 (Figure 11). mlt2 eyespots are on
average smaller than wild-type, with a mean area of 0.49 ± 0.29 μm2 (n=54) compared to
the typical wild-type average of 1.2 μm2 (strain 137c, this study) or 1.3 μm2 (strain g1,
Kreimer 2001). 21% of mlt2 cells have two pyrenoids (Figure 12), but mlt2 cells have no
observable growth defect, suggestive that the multiple-pyrenoid phenomenon is not a
result of defective cytokinesis.
43
25
% Cells in Population
20
15
wild-type
mlt2
10
5
2
1.
8
1.
6
1.
4
1.
2
1
0.
8
0.
6
0.
4
0.
2
0
0
Eyespot Area (micrometers squared)
Figure 11 Eyespots in the mlt2 mutant are distributed over a wide size range, but are on
average smaller than wild-type. Histogram showing distribution of eyespot sizes in wildtype (n=100 eyespots) and a mlt2 population (n=54 eyespots). Areas ranged from 0.04 to
1.39 μm2, averaging 0.49 μm2. Wild-type C. reinhardtii cells have an average eyespot
area of 1.2 μm2.
Figure 12 Some mlt2 cells have multiple pyrenoids.
Bright field micrograph of a mlt2 cell with two pyrenoids
(arrows). 21% of mlt2 cells have two pyrenoids while
79% have one pyrenoid (n=102). Bar, 5 µm.
44
The MIN2 and MLT2 loci map to existing eyespot gene clusters
The previously-described MIN1, MLT1, and EYE2 loci were found to be mutually linked
on chromosome 12 (Lamb et al. 1999), while the EYE3 locus is unlinked to the other
three loci and maps to chromosome 2. Surprisingly, the MLT2 locus is very tightly
linked to MLT1, with an estimated genetic distance of 0.50 map units (approximately 50
kbp physical distance) (Table 3). Analysis of tetrad products from crosses of min2 to an
allele of eye3 revealed that the min2 mutation is linked to eye3 at a distance within 6 map
units (Table 3). The min2-eye3 linkage on chromosome 2 thus constitutes a second
cluster of eyespot-assembly loci in C. reinhardtii.
Table 3
Linkage data for eyespot-assembly loci
Cross
mlt1 x mlt2
PD:NPD:TT
121 : 0 : 1
Total
122
R.F.
0.005
Est. m.u.
0.50
min1 x mlt2
69 : 3 : 6
78
0.09
9.0
eye3 x min2
119 : 0 : 18
137
0.066
6.0
.
45
mlt2 is epistatic to min1 and min2
The combination of the min1 mutation with mlt1 produces a synthetic phenotype in
which double mutant cells are either eyeless or possess a single ultra-miniature spot of
unorganized pigment granules at or near the anterior tip of the chloroplast lobe (Lamb et
al. 1999; Figure 8G). Some min1 mlt1 cells were observed to have multiple miniature
eyespots that were not asymmetrically-localized (Figure 8H). The similarity of
phenotypes of mlt2 to mlt1 might be expected to result in similar genetic interactions of
mlt2 with min1 and min2. Interestingly, however, combinations of mlt2 with both min1
and min2 resulted in cells that exhibited the multiple-eyespot phenotype of mlt2,
demonstrative that mlt2 is epistatic to both miniature-eyespot mutations (Figure 8I,L). It
is intriguing to note that eyespot sizes in the min1 mlt2 and min2 mlt2 double mutants
were not noticeably smaller than the range of sizes observed in mlt2 alone. The
extremely low recombination frequency of mlt1 with mlt2 precluded isolation of multiple
strains to confirm the phenotype of mlt1 mlt2 double mutants, but observation of tetratype
products from a mlt1 x mlt2 cross, which exhibited the supernumerary-eyespot phenotype
of mlt2, was suggestive that mlt2 is also epistatic to mlt1.
46
Section 2: Effects of Eyespot Assembly and Positioning Loci on Localization and
Steady-State Levels of the Channelrhodopsin-1 Photoreceptor
Eyespot pigment granule layers are required to maintain the shape of the ChR1
photoreceptor patch
As previously noted, the ChR1 photoreceptor appears as a single elliptical patch on the
plasma membrane (Berthold et al. 2008) and is associated with the D4 microtubule
rootlet in wild-type Chlamydomonas reinhardtii cells (Figure 13A). To investigate if the
eyespot pigment granule layers affect localization of the photoreceptor molecules on the
plasma membrane or their association with the D4 rootlet, wild-type, eye2, and eye3
mutant cells were stained with anti-ChR1 and anti-acetylated tubulin. In both eye2 and
eye3 cells, aggregations of ChR1 are seen as multiple patches arranged in bars or stripes
on the rootlet (Figure 13B,C). A subset (23%) of cells scored in an eye3 population
(n=126) possessed distinct ChR1 patches not associated with the D4 rootlet in addition to
one or more rootlet-associated patches (Table 4 and Figure 13D). In all cells of this subpopulation, off-rootlet ChR1 patches remained in one longitudinal half of the cell in
proximity to the rootlet. Highly similar staining patterns were observed in
photoautotrophically-grown min1 cells (Table 4). These data are indicative that the
presence of organized pigment granules is necessary for the maintenance of the elliptical
shape of the photoreceptor patch. The D4-rootlet-associated asymmetric localization of
ChR1 remains intact in the eyeless and miniature-eyed mutants.
47
Figure 13 ChR1 photoreceptor localization pattern is altered in eyeless mutants.
Combined immunofluorescence micrographs stained with antibodies against
channelrhodopsin-1 (ChR1) (red) and acetylated α-tubulin (AcTub) (green). A: A wildtype Chlamydomonas cell showing a single discrete patch of ChR1 near the end of the
acetylated track of the D4 microtubule rootlet. B: eye2 cell showing ChR1 staining in
multiple patches along the rootlet. C: Photoreceptor localization in an individual cell of
the eyeless mutant eye3-1. ChR1 is observed in multiple patches along the rootlet. D:
eye3 cell showing ChR1 in a stripe associated with the rootlet (arrow). Discrete ChR1
patches not associated with the rootlet are also observed (arrowheads). Bars, 5 µm.
48
Table 4
ChR1 localization patterns in eye3 and min1 mutants
Strain
eye3-1
min1-1
No. of cells
No. of
with ChR1 spots
cells scored only on rootlet
126
97 (77%)
53
42 (79%)
No. of cells
with off-rootlet
ChR1 spots
29 (23%)
Percentage of
off-rootlet spots in
proximity to rootlet
100%
11 (21%)
100%
49
Miniature and multiple-eyespot mutations affect ChR1 localization
As previously described, ChR1 localization is perturbed in the min1 mutant, appearing as
stripes or multiple spots along the D4 rootlet (Figure 14A) (Mittelmeier et al. 2008). If
MIN2 has a role in promotion of eyespot organization comparable to that of MIN1,
similar ChR1 localization patterns might be expected to be observed in min2. In fact,
ChR1 staining patterns in min2 cells double-stained with antibodies to ChR1 and
acetylated tubulin were unaffected, the photoreceptor patch retaining its elliptical shape
and rootlet association (Figure 14B). Not surprisingly, min1 min2 double mutant cells
were typified by multiple ChR1 patches associated with the rootlet (Figure 14C).
ChR1 localization in the mlt1 mutant was characterized by multiple nonasymmetric patches observed most often around the anterior pole of the cell (Figure 14D).
Although ChR1 patches were usually associated with a rootlet, some lacked rootlet
association (arrow in 14D). ChR1 localization in the min1 mlt1 double mutant mirrored
eyespot position as observed by bright field microcopy, appearing as a small asymmetric
spot near the anterior of the cell (Figure 14E). A similar phenotype was observed in min2
mlt1 cells, with the ChR1 spot positions paralleling the range of observed eyespot
positions (Figure 14F). However, most min2 mlt1 cells had no observable ChR1 staining,
suggestive of an interaction between the gene products of these loci resulting in an effect
on expression or stability of the photoreceptor.
50
Figure 14 Effects of miniature and multiple-eyespot loci on ChR1 photoreceptor
localization. Combined immunofluorescence micrographs of cells stained with antiChR1 (red) and anti-acetylated α-tubulin (AcTub, green). Scale bars, 5μm. A: “Stripes”
and multiple spots of ChR1 are found along the D4 rootlet in min1 cells. B: The shape
and position of the ChR1 patch are maintained in min2 mutant cells. C: min1 min2 cell,
showing ChR1 pattern similar to that of min1. D: mlt1 cells possess ChR1 patches on
either side of the cell that are often clustered around the anterior pole and associated with
acetylated rootlets. Arrow indicates ChR1 patch not associated with a rootlet. E: min1
mlt1 cell with small, asymmetric ChR1 spot. F: min2 mlt1 cell. G: mlt2 cells have
multiple ChR1 patches, often associated with rootlets. H: min1 mlt2 cells. Cell at bottom
exemplifies the clustering of ChR1 spots often seen around the anterior pole. I: min2
mlt2 cell, showing occasionally observed asymmetry of photoreceptor patches.
51
52
In the mlt2 mutant, photoreceptor was localized to multiple patches that were
often associated with acetylated rootlets but largely confined to the flagellar hemisphere
of the cell (Figure 14G). As mentioned above, the eyespot phenotype of mlt2 observed
by bright field light microscopy is epistatic to both min1 and min2. Localization patterns
of ChR1 in min1 mlt2 and min2 mlt2 cells were similar to those observed in mlt2 cells
(Figure 14H,I). Occasional cells clearly exhibited asymmetric photoreceptor localization
(Figure 14I), patterns which may be indicative that some asymmetric positioning cue is
retained in the mlt2 mutant.
Effect of miniature and multiple-eyespot mutations on steady-state levels of ChR1
Figure 15 shows an immunoblot of whole-cell extracts of photoautotrophically-grown
wild-type, mini-, and multiple-eyespot mutant strains probed with antibodies against
ChR1, the eyespot protein EYE2, and tubulin. As previously observed, MIN1 affects the
levels and stability of ChR1 (Mittelmeier et al. 2008), and levels are diminished in the
min1 mutant compared to wild-type. Levels of ChR1 in the min2 mutant were not
significantly diminished compared to wild-type. ChR1 levels were dramatically higher in
the mlt2 mutant. Although present at lower levels and thus more difficult to detect than
ChR1 in simultaneous exposures, EYE2 levels appear to be increased in both mlt1 and
mlt2. As expected, min2 mlt1 cells demonstrated lower levels of ChR1 compared to
wild-type or mlt1.
53
Figure 15 Immunoblot showing steady-state levels of ChR1 and EYE2 in eyespot
mutants. Whole-cell protein extracts were probed with anti-ChR1, anti-EYE2, and antitubulin. ChR1 and EYE2 levels appear significantly higher in the mlt2 mutant compared
to wild-type or mlt1. Levels of EYE2 also appear to be increased in mlt1 cells.
DISCUSSION
Several phototaxis-defective mutants with defects in eyespot assembly and placement
have been isolated in Chlamydomonas reinhardtii and have been informative in
contributing to our understanding of organelle biogenesis and asymmetric positioning.
These mutants fall into three classes: eyeless mutants, strains with a miniature eyespot,
and strains possessing multiple eyespots. In this study the miniature-eyed mutant min2
and multiple-eyespot mutant mlt2 have been further characterized, and the genetic
54
interactions of the MIN2 and MLT2 loci have been examined, along with effects of these
mutations on eyespot assembly and asymmetry and steady-state levels of the ChR1
photoreceptor. In addition, ChR1 localization in eyeless mutants has been analyzed to
investigate the role of the eyespot pigment granules in ChR1 localization.
Like the min1 mutant, cells of the min2-1 strain have a miniature eyespot located
at the equator of the cell. The eyespot-assembly defect in min2 is not as severe as that
seen in min1, as min2 cells have an average eyespot area only 26% smaller than wild-type,
while eyespots of photoautotrophically-grown min1 cells average only one-third wildtype area and have unorganized pigment granules (Lamb et al. 1999). The observation
that the absence of MIN2 function exacerbates the eyespot-assembly defect of min1, with
the majority of min1 min2 double mutant cells not possessing an observable eyespot and
unable to partially restore eyespot organization under heterotrophic nutrient conditions, is
evidence that the hypothetical MIN2 protein functions in parallel (or partway redundantly)
with MIN1 in promoting eyespot organization and regulating eyespot size.
min2 interacts genetically with mlt1 as well. ChR1 photoreceptor levels are
reduced in min2 mlt1 double mutant cells, and most cells do not have detectable spots of
aggregated ChR1 protein when observed by immunofluorescence. The min2 mutation
influences the eyespot number defect of mlt1. It is probable that the eyespot phenotypes
observed in the min2 mlt1 mutant represent an additive effect of the mutations, the min2
mutation limiting the available amount of eyespot material rather than affecting the
eyespot number and asymmetric positioning cues regulated by MLT1. The rare
observation of multiple, non-asymmetrically-positioned eyespots in the min1 mlt1 double
55
mutant could indicate that the min1 mutation, in the absence of MLT1 function, may also
be acting to limit the level of eyespot material available for assembly rather than to
suppress eyespot asymmetry or number-regulating mechanisms per se.
min2 cells are unable to positively phototax, but can negatively phototax under
high light intensity (Roberts 1999). In previous studies, this strain was characterized by
reduced photoreceptor current in comparison to wild-type that was nonetheless larger
than expected given its imprecise photomovement. These data were suggestive that the
eyespot-assembly defect in min2 cells affects some aspect of the signal transduction
pathway downstream of photoreceptor activation (Roberts 1999). Unlike what was
observed in min1, ChR1 photoreceptor was localized normally in min2 and protein levels
were not significantly reduced, likely accounting for the relatively large photoreceptor
current observed in this strain.
Both multiple-eyespot mutant strains, mlt1 and mlt2, are characterized by
supernumerary, non-asymmetrically-localized eyespots. While mlt1 cells have an
average of two eyespots per cell, mlt2 cells typically have three to five. As observed by
bright field microscopy, eyespots in mlt2 cells are placed at various locations throughout
the chloroplast and are not restricted to the flagellar half of the cell. Eyespots in mlt2 are
smaller than normal but can attain the typical wild-type size. The phenotype of the mlt2
mutant is highly similar to that of the multiple-eyespot mutant mes-10, described by
Nakamura et al. (2001). Like mlt2 cells, mes-10 cells have one to over four eyespots per
cell that display a range of sizes, and half of mes-10 cells possessed two pyrenoids, a
phenotype also observed in mlt2, although not at such a high frequency. Unlike mlt1
56
cells (Roberts 1999), mes-10 cells retained negative phototactic ability. The ability of
mlt2 cells to undergo negative phototaxis has not been ascertained. The ultrastructure of
mes-10 eyespots examined by electron microscopy appeared normal, with regular
pigment granule layers and chloroplast envelope apposed to the plasma membrane,
although some eyespots were seen facing the nucleus instead of the cell surface. It is
highly probable that the mes-10 mutation is allelic to mlt2, but since mes-10 gametes are
unable to mate (Nakamura et al. 2001), it was not possible to carry out genetic
characterization of this mutant. The multiple-pyrenoid phenotype of mes-10 and mlt2 is
fascinating, as it implies that regulation of eyespot number is in some way connected to
regulation of the number of other organelles.
The ChR1 photoreceptor in mlt2 cells is most often localized non-asymmetrically
in patches in the anterior hemisphere of the cell, which retain association with acetylated
microtubule rootlets, but is sometimes observed to retain asymmetric localization,
suggestive that some asymmetry cues, quite possibly involving MLT1, are preserved in
this mutant. The significantly higher levels of ChR1 seen in immunoblots of whole-cell
extracts of mlt2 is perhaps not surprising given the abnormal number of eyespots in this
strain. The epistasis of mlt2 to min1 and min2, in addition to the ability of mlt2 cells to
assemble large eyespots, is indicative that the dramatic up-regulation of eyespot
components in the mlt2 mutant overcomes limitations imposed by lack of some eyespot
proteins.
It is quite interesting that both the min2 and mlt2 mutations map to novel loci near
existing eyespot-assembly genes. As suggested by Lamb et al. (1999), the clustering of
57
eyespot-assembly loci may be an instrument for coordinated gene expression linked to
cell-cycle control. The tight linkage especially of mlt1 to mlt2 is supportive of the idea
that the MLT1 and MLT2 genes, which affect similar aspects of eyespot development, are
coordinately regulated. The mapping of the min2 and mlt2 mutations should facilitate the
identification of the gene products of these loci.
The aberrant localization of ChR1 in the eyeless mutants eye2 and eye3 is
indicative that the eyespot pigment granules, or factors associated with the granules, help
to maintain the shape and integrity of the photoreceptor patch on the plasma membrane.
The continued association of ChR1 with the D4 rootlet in eyeless strains implies that
asymmetric localization and aggregation of the photoreceptor molecules occurs
independently of eyespot pigment granule layer assembly.
Eyespot assembly and placement involves a complex interplay between
cytoskeletal, chloroplastic, and plasma membrane-associated factors. The interactions
and suborganellar localization of eyespot-assembly factors and the roles of eyespot loci in
organization of this organelle will be explored in the subsequent chapter.
58
CHAPTER 3
ROLES OF EYE2, EYE3, MLT1, AND MLT2 IN EYESPOT ASSEMBLY
STATEMENT BY AUTHOR
The majority of this chapter is based on a manuscript published in Molecular Biology of
the Cell in 2011. Additional original material has been added and integrated into the text.
All of the data is my own with the exception of the immunoblot in Figure 20, which was
supplied by Telsa Mittelmeier, a co-author on the paper.
SUMMARY
The eyespot, which assembles de novo after every cell division and is associated with the
daughter four-membered (D4) microtubule rootlet, comprises an elliptical patch of
rhodopsin photoreceptors on the plasma membrane and stacks of carotenoid-rich pigment
granule arrays in the chloroplast. Two loci, EYE2 and EYE3, define factors involved in
the formation and organization of the eyespot pigment granule arrays. While EYE3, a
serine/threonine kinase of the ABC1 family, localizes to pigment granules, EYE2
localization corresponds to an area of the chloroplast envelope in the eyespot. EYE2 is
positioned along, and adjacent to, the D4 rootlet in the absence of pigment granules and
co-positions with the channelrhodopsin-1 photoreceptor. Eyespot components are mislocalized in the mlt1 and mlt2 mutants, suggestive of a role for the MLT1 and MLT2
proteins in maintaining the structure of the eyespot. A model of eyespot assembly is
proposed wherein rootlet and photoreceptor direct EYE2 to an area of the chloroplast
59
envelope, where it acts to facilitate assembly of pigment granule arrays, and EYE3 plays
a role in the biogenesis of the pigment granules.
INTRODUCTION
The necessity of coordinated assembly of the multi-compartmental system of the eyespot
which is both structurally intricate and precisely positioned raises important questions
concerning the factors and mechanisms involved in biogenesis of the eyespot and the
directional cues needed for orchestrating its asymmetric positioning. Loci affecting
eyespot assembly and positioning in Chlamydomonas reinhardtii include MIN1, MLT1,
EYE2, and EYE3 (Lamb et al. 1999), and the uncharacterized loci MIN2 and MLT2. The
EYE2 protein contains a LysM domain and thioredoxin motif. However, since
thioredoxin activity is not required for eyespot assembly (Roberts et al. 2001), EYE2 has
been suggested to serve a chaperone-like function in assembly of the eyespot pigment
granule arrays. MIN1 is a C2/LysM-domain protein, present in the eyespot proteome
(Schmidt et al. 2006), that is postulated to be involved in chloroplast envelope-plasma
membrane attachment (Mittelmeier et al. 2008). LysM domains were originally
identified in bacterial cell-wall degrading enzymes as binding peptidoglycans (Bateman
and Bycroft 2000) and they mediate interactions with other proteins in defense responses
in plants (Knogge and Scheel 2006). In this study the roles of EYE2 and EYE3 in
eyespot assembly are investigated, and interactions between EYE3, EYE2, and the
photoreceptor ChR1 are analyzed in the multiple-eyespot mutants mlt1 and mlt2. The
results are employed to develop a model for eyespot biogenesis.
60
RESULTS
Section 1: Characterization and Localization of EYE2 and EYE3
The EYE3 gene encodes a predicted ser/thr kinase of the ABC1 family
Chlamydomonas reinhardtii strain 12-18 (eye3-1) was originally isolated from a genetic
screen for phototaxis-defective strains following UV-mutagenesis of wild-type strain
137c (CC-125) (Lamb et al. 1999). A NIT1 insertional allele of EYE3 was used to
identify the gene (Boyd et al. 2011). The EYE3 gene is predicted to encode a large
hydrophobic, chloroplast-localized serine/threonine kinase which is a member of the
ABC1 (UbiB/AarF) family of ser/thr kinases involved in regulation of quinone
biosynthesis (Do et al. 2001). Six other members of this protein family are predicted
from gene models in the Chlamydomonas genome (JGI v 4.0; http://www.chlamy.org),
including chloroplast-targeted ABC1 kinases termed AKCs (ABC1 kinases in the
chloroplast) (Merchant et al. 2007). Notably, the predicted AKC2 kinase (protein ID
205779) possesses a putative LysM domain that could be involved in protein-protein
interactions. EYE3 highly resembles ABC1 kinase family members in Arabidopsis
(At1g71810 and At1g79600) that are associated with plastoglobules, structures quite
similar to eyespot pigment granules (Ytterberg et al. 2006). A clustal alignment of the
EYE3 sequence with other ABC1 kinases in Chlamydomonas reinhardtii demonstrated
the high degree of conservation of the characteristic kinase domain sequence of this
family (Figure 16). The characteristics of the members of this protein family contributed
to the hypothesis that EYE3 localizes to the eyespot pigment granules.
61
Figure 16 Clustal alignment of the amino acid sequence of the region including the
kinase active site of the EYE3 protein (residues 549 to 654) with related ABC1 kinases in
Chlamydomonas reinhardtii. Predicted amino acid sequences of proteins supported by
gene models in version 4 of the genome are shown: ABC1 kinases in the chloroplast
AKC3 (protein ID 205743) and AKC2 (protein ID 205779); predicted eyespot kinases
Cr_113847 and Cr_104934; and ubiquinone synthesis protein COQ8 (protein ID 126076).
Background shading denotes residues that are identical (black) or similar (gray) in ≥ 60%
of the sequences. The residues in EYE3 used for generating peptide-directed antiserum
are marked with asterisks. Positions of critical aspartate residues in the kinase active site
of EYE3 are marked with arrowheads.
62
EYE3 localizes to the eyespot pigment granule layers
To determine the localization of EYE3 in wild-type Chlamydomonas cells, a polyclonal
antiserum to EYE3 was used in immunofluorescence staining of methanol-fixed cells.
The EYE3 signal appeared as an eyespot-shaped elliptical spot in wild-type cells that was
absent in both eye3 and eye2 cells, which also lack pigment granules (Figure 17). Edgeon micrographs of wild-type cells strengthened the hypothesis that the EYE3 signal
emanates from the eyespot pigment granule layers in the chloroplast below the plasmamembrane-localized ChR1 photoreceptor (Figure 17). Blocking of anti-EYE3-labeled
wild-type cells with the immunizing peptide confirmed that the immunofluorescence
signal was specific to EYE3 (Figure 18A,B). No EYE3 staining was detectable above
background in eye2-2 insertion mutant cells (Figure 18B). Despite repeated attempts
under various experimental conditions, the EYE3 antibody did not detect protein on
Western blots.
63
Figure 17 EYE3 localizes to eyespot pigment granules. Upper panels:
Immunofluorescence micrographs of a wild-type C. reinhardtii cell (left) and eye3-1 cell
(right) stained with antibody directed against EYE3. EYE3 localizes to the eyespot
(arrow) in wild-type cell whereas staining is absent in the eye3 mutant. Non-specific
staining in the basal body region is observed. Lower panel: Combined
immunofluorescence micrograph of a wild-type cell, showing localization of EYE3 to the
pigment granule area of the eyespot. Inset highlights the distinct, yet closely apposed,
pigment granule spot (red) and ChR1 photoreceptor patch (green) associated with the D4
microtubule rootlet (blue). Bars, 5 µm unless otherwise noted.
64
wild-type
1 µm
5 µm
EYE3
ChR1
AcTub
65
C
Figure 18 Anti-EYE3 antibody is specific to EYE3 protein and EYE3 is not detectable
in the eye2 mutant. A: Wild-type cell incubated with anti-EYE3, showing eyespot
staining (arrow). B: Wild-type cell incubated with anti-EYE3 blocked with immunizing
peptide. C: EYE3 protein is not detectable in eye2 cells. Immunofluorescence
micrograph of an eye2-2 (eye2::ARG7) cell stained with anti-EYE3. No staining is
visible above background. Bars, 5 μm.
66
EYE2 localizes to the chloroplast envelope region in the eyespot
EYE2 is thought to be a chaperone-like protein required for eyespot assembly (Roberts et
al. 2001). The EYE2 protein was present in a proteomic analysis of the eyespot and
possesses a single predicted transmembrane domain (Schmidt et al. 2006). EYE2 has a
chloroplast-targeting sequence as well as a LysM domain and thioredoxin active site
motif. Like the eye3 mutant, eye2 mutant strains lack pigment granule arrays (Lamb et
al.1999). Polyclonal antiserum raised against EYE2, like that for EYE3, detected an
eyespot-shaped patch in wild-type cells that was absent in an eye2 insertion mutant
(Figure 19). Although in biochemical preparations of eyespots of the green alga
Spermatozopsis similis, a homolog of EYE2 was not found to be enriched in the fraction
containing the pigment granules (Renninger et al. 2006), given that EYE2 is required for
assembly of the eyespot pigment granule layers, it might be expected to localize, like
EYE3, to this compartment. Surprisingly, immunofluorescence triple-staining of wildtype cells with EYE2, EYE3, and ChR1 antisera revealed that EYE2 does not co-localize
with EYE3 in the pigment granules, but is instead found in an area between the pigment
granules and the plasma-membrane-localized photoreceptor patch (Figure 19). This
staining pattern is suggestive that EYE2 localizes to a specialized area of the chloroplast
envelope in the eyespot.
67
EYE2
EYE2
wild-type
1 µm
5 µm
EYE2
EYE3
ChR1
Figure 19 EYE2 localizes to area corresponding to the chloroplast envelope in the
eyespot. Upper panels: Immunofluorescence micrographs of wild-type (left) and eye2-2
cells (right) stained with antibody directed against EYE2. EYE2 localizes to the eyespot
(arrow) in wild-type cells, whereas staining is absent in the insertion mutant. Bars, 5 µm.
Lower panel: Combined immunofluorescence micrograph of wild-type C. reinhardtii cell
stained with antibodies against EYE3 (blue), EYE2 (green), and ChR1 (red). Inset shows
a close-up view of the eyespot area. EYE2 staining appears between the pigment granule
layers and the plasma membrane-localized photoreceptor patch.
68
EYE2 co-positions with ChR1 in eye3 and min1 cells
By Western blotting it was discovered that anti-EYE2 antiserum detects EYE2 both in
wild-type and eye3 mutant cells (Figure 20). Since the absence of pigment granules
markedly affects photoreceptor localization, we investigated whether the localization
patterns of EYE2 are affected similarly in mutants lacking organized pigment granule
arrays, and whether EYE2 localization is dependent or independent of ChR1 localization.
In both eye3 mutant cells, EYE2 consistently shared an aberrant localization pattern with
the ChR1 photoreceptor on the track of, or in the proximity of, the D4 rootlet (Figure
21A), indicating that some sort of stable connection is maintained between EYE2 and
ChR1.
It was previously hypothesized that the MIN1 protein is required for the
apposition of plasma membrane and chloroplast envelope in the eyespot during
photoauxotrophic-growth. This hypothesis was based on electron micrographs showing
lack of membrane apposition in sections containing aggregations of pigment granules in
the chloroplast stroma (Lamb et al. 1999). If apposition of the chloroplast envelope and
plasma membrane were required for the connection between EYE2 and photoreceptor,
loss of MIN1 might be expected to abolish the co-positioning of EYE2 and ChR1.
Unexpectedly, in the majority of photoauxotrophically-grown min1 cells, EYE2 remained
co-positioned with ChR1 (Figure 21B,C). However, some min1 cells exhibited discrete
EYE2 patches that were not associated with ChR1 patches (Figure 21D). In cases where
ChR1 patches were not on the rootlet track, EYE2 co-positioning was still observed
69
(Figure 21E), indicating that the co-positioning phenomenon does not require interaction
with the rootlet. MIN1 is known to play a role in stability of the ChR1 photoreceptor, as
min1 cells exhibit reduced levels of ChR1 (Mittelmeier et al. 2008). Western blots of
whole-cell extracts probed with anti-ChR1 and anti-EYE2 showed that levels of both
proteins were reduced in min1 strains in comparison to wild-type cells (Figure 20).
Taken together, these results are consistent with the hypothesis that the photoreceptors or
associated proteins, together with D4 microtubule rootlet-associated positioning cues, are
responsible for the positioning, localization, and stability of EYE2 in the eyespot.
Figure 20 Western blot of whole-cell extracts of auxotrophically-grown wild-type, eye2,
min1, and eye3 strains probed with anti-ChR1, anti-EYE2, and anti-tubulin. Levels of
both ChR1 and EYE2 are lower in min1 and eye3 mutant strains in comparison to wildtype. EYE2 protein is present in eye3 mutant cells.
70
Figure 21 EYE2 protein shares aberrant localization patterns with ChR1 photoreceptor
in eye3 and min1 mutant cells. A: Immunofluorescence micrographs of a single eye3
(eyeless) cell labeled with antibodies against EYE2 (red), ChR1 (green), and acetylatedα-tubulin (blue). Patches of EYE2 co-position with ChR1 patches and remain in the
vicinity of the microtubule rootlet. B: Immunofluorescence micrographs of a
representative min1 cell showing EYE2-ChR1 co-positioning in the area of the rootlet
(arrow). EYE2-ChR1 co-positioning does not require MIN1 protein. C, D, and E:
Combined immunofluorescence micrographs of min1-2 (insertion mutant) and min1-1
cells stained for EYE2 (red), ChR1 (green), and acetylated-α-tubulin (blue). C:
Combined immunofluorescence micrograph of a min1-2 field. Arrows indicate cells
where EYE2 and ChR1 are co-positioned (yellow). D: Single min1-2 cell showing EYE2
spot (arrow) not co-positioned with ChR1. E: Single min1-1 cell showing EYE2 and
ChR1 co-positioned in a spot not associated with rootlet (arrow). Bars for all images: 5
µm.
71
72
EYE2 associates with ChR1 in the eyespot before pigment granules are organized
The localization of EYE2 to the chloroplast envelope compartment of the eyespot, and
association of EYE2 with ChR1 photoreceptor and the D4 rootlet in eye3 cells, which
lack pigment granule arrays, is supportive of the hypothesis that EYE2 functions to direct
the site for assembly of the pigment granule arrays and acts upstream of pigment granule
array assembly steps in the biogenesis of the eyespot. However, EYE2 localization is
perturbed in interphase eye3 cells, indicative that interactions with the pigment granule
array that is apposed to the chloroplast inner membrane is necessary for maintaining
proper localization. To confirm that EYE2 localization to the eyespot precedes pigment
granule array assembly, EYE2 and ChR1 staining was analyzed in the eye1 mutant
(Hartshorne 1953). eye1 is a conditional mutant that is eyeless during logarithmic growth
but assembles wild-type eyespots as cells approach stationary phase, indicative of a delay
in pigment granule biosynthesis and/or array organization (Morel-Laurens and Bird 1984).
EYE2 and ChR1 associate in a typical elliptical patch in eye1 cells harvested in
logarithmic growth phase (Figure 22), providing confirmation that formation of the EYE2
“patch” precedes the subsequent assembly of the pigment granule arrays.
73
Figure 22 EYE2 associates with ChR1 and localizes to the eyespot region before
organization of the pigment granule arrays. Combined immunofluorescence micrographs
of individual eye1 cells harvested in logarithmic phase of growth stained for EYE2 (blue),
ChR1 (red), and acetylated tubulin (green). Examination of cells by bright field
microscopy confirmed absence of pigment granule layers. A: Face-on view showing
EYE2 and ChR1 co-positioned in an elliptical spot associated with the rootlet. B: Edgeon view of a different cell. Bars, 5 µm.
74
Section 2: Effects of the MIN2, MLT1, and MLT2 Loci on Eyespot Organization
Eyespot organization is perturbed in the mlt1 and mlt2 mutants, but not in min2
The pigment granule arrays in eyespots of the mlt1 mutant appear morphologically
normal by electron microscopy (Lamb et al. 1999). To determine if the mlt1 mutation
affects eyespot organization in addition to altering the number and asymmetric placement
of eyespots, cells were stained for EYE3, ChR1, and AcTub and examined by
immunofluorescence microscopy. Although most eyespots in mlt1 exhibited fairly
normal EYE3-ChR1 apposition, disjunction between eyespot pigment granules and
photoreceptor patches was observed in 54% of cells scored (n=160) (Figure 23A,B),
providing evidence that the MLT1 protein plays a structural role in maintenance of
eyespot organization.
As noted previously, ChR1 remains positioned in an elliptical patch in min2 cells,
unlike the aberrant patterns observed in the min1 mutant. Staining with EYE3 and ChR1
demonstrated that pigment granule layers were co-extensive with the photoreceptor patch
in min2 cells (Figure 23C). Thus, the min2 mutation does not affect the general
organization of the eyespot layers.
Evidence was already suggestive that organization of eyespot components in the
mlt2 mutant is abnormal, as ChR1 localization patterns occur almost exclusively in the
anterior hemisphere of the cell while eyespot pigment granule spots are observed
throughout the chloroplast. Indeed, ChR1 patches and pigment granule spots in mlt2
cells were often not co-positioned (Figure 23D).
75
Figure 23 Eyespot organization in mlt1, min2, and mlt2 mutant cells. Combined
immunofluorescence micrographs of individual cells stained for EYE3 (red), ChR1
(green), and AcTub (blue). Bars, 5 μm. A and B: Pigment granules and photoreceptor
are often not associated in mlt1 cells. Arrow in B indicates pigment granule spot not
associated with adjacent photoreceptor patch. C: Organization of eyespot layers is
unaffected in min2 cells, with ChR1 co-extensive with EYE3 staining. D: Eyespot
organization is perturbed in mlt2. mlt2 cell with a ChR1 patch not associated with
pigment granule layers (a), an eyespot showing ChR1 and EYE3 co-positioning (b), and
two pigment granule spots without associated photoreceptor (c).
76
The observation that the mlt1 and mlt2 mutations disrupt the normal organization
of EYE3 and ChR1 prompted the question of EYE2 localization in these strains. EYE2
was most often observed co-positioned with ChR1 in min1 and eye3 mutants. If the
multiple-eyespot mutations affect predominantly association of pigment granule layers
with the rest of the eyespot, EYE2 might retain association with ChR1. In actuality, mlt1
and mlt2 were found to have dramatic effects on organization of eyespot components. In
cells of both mlt1 and mlt2 observed by immunofluorescence, EYE2, EYE3, and ChR1
spots were visible singly (i.e., without either of the other proteins associated) and in
various combinations of co-positioned spots (Figure 24), including EYE2 and EYE3 copositioned without associated ChR1. The distances between single spots was highly
variable and could be relatively large in some cells (e.g. the mlt2 cell in Figure 24C).
Surprisingly, some mlt2 cells exhibited very small or no ChR1 spots (Figure 24B). Copositioning of EYE3 and ChR1 was generally not observed in mlt1 or mlt2 unless EYE2
was present in the co-positioned spot as well, although pigment granule spots and
photoreceptor were sometimes found in close proximity (e.g. Figure 24E). The extent of
EYE2, EYE3, and ChR1 co-positioning was variably distributed in populations of both
mlt1 and mlt2 cells (Tables 5 and 6); however, mlt1 cells had a greater proportion of copositioned spots, while single spots of all three proteins predominated in mlt2 cells
(Figure 25). These data are suggestive that MLT1, and especially MLT2, are important
factors in maintenance of the supramolecular organization of the eyespot, and that in the
absence of MLT1 or MLT2 gene function, extensive disintegration of eyespot structure
occurs after biogenesis of the organelles.
77
Figure 24 EYE2, EYE3, and ChR1 positioning is dramatically disrupted in
asynchronous populations of mlt1 and mlt2 cells. Scale bars for all images, 5 µm. Key to
letter designations: a: single EYE2 spot; b: single ChR1 spot; c: single EYE3 spot; d:
EYE2/EYE3 co-positioned spot; e: EYE2/ChR1 co-positioned spot; f:
EYE2/EYE3/ChR1 co-positioned spot. Quantitation of spot positioning is provided in
Tables 5 and 6 below. A: Z-projection of combined immunofluorescence micrographs of
a mlt1 field stained for EYE2 (green), EYE3 (blue), and ChR1 (red). Various
combinations of single and co-positioned spots are observed (arrows). B: Z-projection of
combined immunofluorescence micrographs of a mlt2 field. Various spot-positioning
combinations are again observed, with single spots predominating. Unexpectedly, some
cells exhibited very small or no detectable ChR1 spots (arrow). C-E: Z-projections of
combined immunofluorescence micrographs of individual mlt2 cells illustrating
positioning of EYE2, EYE3, and ChR1 spots. Same letter designations as above. Cell in
E exhibits EYE2 staining extending between two spots of EYE2/EYE3/ChR1 copositioning.
78
79
Table 5
Co-positioning of EYE2, EYE3, and ChR1 in an asynchronous mlt1 population
No. of spots
No. of cells
% total single spots
% total
co-positioned spots
% total spots
Single
EYE2
spot
32
32
39
Single
EYE3
spot
33
30
40
Single
ChR1
spot
18
17
21
EYE2/
EYE2/EYE3 EYE2/ChR1 EYE3/ChR1
co-positioned co-positioned co-positioned .
63
144
100
61
106
82
----
-8
-9
-5
20
16
47
37
33
26
Table 6
Co-positioning of EYE2, EYE3, and ChR1 in an asynchronous mlt2 population
No. of spots
No. of cells
% total single spots
% total
co-positioned spots
% total spots
Single
EYE2
spot
62
29
62
Single
EYE3
spot
40
28
40
Single
ChR1
spot
28
18
28
EYE2/EYE3
co-positioned
20
16
--
EYE2/ChR1
co-positioned
7
7
--
EYE2/
EYE3/ChR1
co-positioned .
9
8
--
-17
-17
-11
44
12
19
4
22
5
80
40
37
35
30
% Total Spots
26
25
mlt1
20
17
17
15
11
10
8
mlt2
16
12
9
5
4
5
5
EY
E2
/E
YE
3/
Ch
R1
EY
E2
/C
hR
1
EY
E2
/E
YE
3
Ch
R1
EY
E3
EY
E2
0
Spot Type
Figure 25 Comparison of the extent of EYE2, EYE3, and ChR1 co-positioning in mlt1
and mlt2 cells. Percent of single or co-positioned spots per total spots scored is shown.
Co-positioned spots of combinations of EYE2, EYE3, and ChR1 are markedly more
prevalent in mlt1 cells compared to mlt2 cells, and mlt2 cells have a greater proportion of
single EYE2, EYE3, or ChR1 spots not co-positioned with other eyespot proteins.
81
DISCUSSION
EYE3 localizes to, and is required for, formation of the eyespot pigment granule
arrays
The layers of carotenoid-filled pigment granules in the eyespot function to enhance
directional light perception by their shading and reflective properties. The granules are
organized into regular close-packed arrays between chloroplast and thylakoid membranes.
The EYE3 gene encodes a serine/threonine protein kinase of the ABC1 family that
localizes to, and is required for, assembly of the eyespot pigment granule arrays in
Chlamydomonas reinhardtii. ABC1 kinases similar to EYE3 have been identified in
Arabidopsis thaliana chloroplasts as components of plastoglobules, lipid-filled structures
that blister from and are linked to the thylakoid membrane (Ytterberg et al. 2006;
Bréhélin et al. 2007). The blistering events occur at curved margins of thyakoid
membranes and are hypothesized to be induced by accumulation of carotenoids and
mediated by carotenoid-binding proteins termed plastoglobulins (PAP/fibrillins) (Austin
et al. 2006; Simkin et al. 2007). Eight putative proteins with a PAP/fibrillin domain were
identified in the eyespot proteome (Schmidt et al. 2006; Renninger et al. 2006), seven of
which have functional homologs in Arabidopsis plastoglobules (Ytterberg et al. 2006).
The similarities between plastoglobules and eyespot pigment granules have led to the
hypothesis that plastoglobules may be precursors of the pigment granules (Kreimer 2009),
and that ABC1 kinases may function in their biosynthesis. Analogous ABC1 kinases in
Escherichia coli (Poon et al. 2000) and Saccharomyces cerevisiae (Do et al. 2001) are
involved in ubiquinone biosynthesis. The enzymes of the ubiquinone biosynthesis
82
pathway in S. cerevisiae associate to form complexes (Marbois et al. 2005; Marbois et al.
2009), and stability of the Coq3 subunits of the Coq3/5/9 complex is dependent on the
kinase Coq8 (Tauche et al. 2008). EYE3 may regulate the interactions of structural
proteins via phosphorylation or may itself serve a structural role, as it is stably expressed
in pigment granules. It is also possible that EYE3 functions in regulating quinone
metabolism, but the absence of an observable growth defect in eye3 deletion mutants
implies that such activity would be non-essential or redundant.
EYE2 localizes to an area corresponding to the chloroplast envelope in the eyespot
The EYE2 protein was found in the eyespot proteome (Schmidt et al. 2006) and
possesses a LysM domain, a single transmembrane helix, and a thioredoxin active site.
The role of EYE2 in eyespot assembly does not require the redox function of the EYE2
thioredoxin domain (Roberts et al. 2001). In wild-type C. reinhardtii eyespots, EYE2
localizes to an area between the pigment granule stacks and the plasma-membranelocalized ChR1 photoreceptor, a region corresponding to an area of the chloroplast
envelope. This localization pattern is suggestive of a role for EYE2 in directing the site
for assembly of the pigment granule arrays rather than in pigment granule biogenesis.
Additionally, EYE2 was observed to organize into an elliptical patch in logarithmicphase cells of the eye1 mutant, which is characterized by a delay in assembly of the
pigment granule arrays, thus supportive of the hypothesis that formation of the EYE2
patch on the chloroplast envelope precedes pigment granule array biogenesis in the
eyespot assembly process.
83
The observation that EYE2 co-positions with ChR1 in mutants lacking organized
pigment granule arrays is suggestive of an interaction or stable connection between these
proteins. A direct connection would be supportive of a model placing EYE2 in the outer
envelope, and freeze-fracture studies of C. reinhardtii eyespot membranes were
suggestive of eyespot-specific elaboration of the outer membrane (Melkonian and
Robenek 1980). However, EYE2 has a putative chloroplast transit peptide, which
proteins destined for the outer membrane typically do not possess (Strittmatter et al.
2010). Additionally, in sequence alignments, EYE2 clusters with chloroplast stromal
adenylyl sulfate reductases (Roberts et al. 2001), suggestive that EYE2 may be an inner
envelope protein with its thioredoxin site positioned on the stromal side. Association of
EYE2 with the inner envelope would be consistent with a model in which EYE2 directs
the site for pigment granule array assembly. The N-terminal LysM domain of EYE2
likely functions to mediate protein-protein interactions necessary for the formation and
stabilization of the association between the chloroplast envelope and plasma membrane
in the eyespot. The presence of a LysM domain in a chloroplast protein is atypical but
not completely anomalous, as another LysM-domain protein in C. reinhardtii, LMR1
(protein ID 184328), is predicted to have a chloroplast-targeting signal.
Eyespot pigment granule arrays are necessary for maintaining the supramolecular
organization of the eyespot
The altered localization patterns EYE2 in the eyeless mutant eye3 are indicative that the
eyespot pigment granules, or factors associated with the granules, act to maintain the
84
elliptical shape and integrity of both the EYE2 patch as well as the photoreceptor patch.
Mediatory structural connections are likely responsible for keeping the specialized
regions of chloroplast envelope and plasma membrane together in a single integrated unit.
Surprisingly, although patches of EYE2 were sometimes observed without associated
ChR1, co-positioning of EYE2 and ChR1 patches was maintained in the vast majority of
min1 mutant cells, which have been previously characterized as lacking apposition of
plasma membrane with chloroplast envelope (Lamb et al. 1999; Mittelmeier et al. 2008).
This conclusion was drawn from observations of eyespot pigment granules by electron
microscopy in thin sections of cells grown without acetate. It is possible that the pigment
granules observed in EM sections were not near the area of apposed eyespot membranes.
Eyespot organization in min1 cells is restored during mixotrophic growth with acetate
(Lamb et al. 1999), indicating that other structural proteins function redundantly with
MIN1 under certain nutrient conditions. MIN2 is a likely candidate for such a structural
component. The min2 mutation does not appear to affect eyespot organization but rather
eyespot size and photoreceptive signaling, and, as described earlier, min2 mutant cells are
not able to assemble a larger eyespot when combined with the min1 mutation under
mixotrophic growth in acetate-containing medium.
In both eye3 and min1 mutants, co-positioned patches of EYE2 and ChR1 were
most often observed in proximity to the D4 microtubule rootlet. The lack of pigment
granules, or organized arrays of the pigment granules, does not affect the asymmetric
localization of ChR1 or EYE2 to the daughter side of the cell. The rootlet association
evident in staining patterns of EYE2 in eye3 and min1 mutants is suggestive that the
85
localization of chloroplastic components of the eyespot is also in some way directed by
the D4 rootlet.
MLT1 and MLT2 affect the maintenance of eyespot organization
The multiple-eyespot mutants mlt1 and mlt2 are characterized by loss of asymmetry,
increased eyespot number, and up-regulation of EYE2 and the ChR1 photoreceptor.
Eyespots in mlt1 and especially mlt2 exhibit drastic disjunction of pigment granules,
photoreceptor, and EYE2 spots, which may retain varying degrees of co-positioning but
are often observed as distinct punctae that can be widely separated in the cell. This
separation is more pronounced in mlt2 than mlt1, in which co-positioned spots are more
frequently observed. The multiple spots of eyespot components likely represent eyespots
at various stages of disintegration. The putative MLT1 protein is a large (estimated 233
kDa), low-complexity protein with no domain homology to other proteins.
Immunolocalization studies with peptide antisera raised against portions of the predicted
MLT1 sequence have been unsuccessful (J. Boyd and T. Mittelmeier, unpublished
observations). MLT1 may be localized to the region near the mother basal body, where it
restricts transport of eyespot components to the daughter side. It is known that the
periphery of the flagellar base is a staging area for intraflagellar transport (IFT) particle
assembly with vesicles delivered from the Golgi apparatus (Qin et al. 2004). It is
hypothesized that the eyespot rhodopsin photoreceptors are transported in a similar
manner (Mittelmeier et al. 2011), and a recent study in mammalian cone photoreceptor
cells implicates an IFT protein, IFT20, in trafficking of opsins from the Golgi (Keady et
86
al. 2011). Absence of MLT1 function could allow for transport of the photoreceptor to
the mother side of the cell and accretion of associated eyespot-assembly factors. It is
interesting that some eyespots in mlt1 cells are properly organized while others are not.
Some feedback regulation involving MLT1 may affect the levels of some eyespot
components while leaving others unchanged or even down-regulated. If a critical
structural protein is limiting, additional eyespots formed would not be able to maintain
their organization. These data are consistent with the hypothesis that a “quantal
synthesis” model of organelle size and number determination (Stephens 1989), a system
which has been supported experimentally in studies on C. reinhardtii flagella
(Rosenbaum et al. 1969; Coyne and Rosenbaum 1970), also applies to eyespot assembly.
The MIN1 and MIN2 loci interact genetically with MLT1, and it is possible that there is
some regulatory relationship between MLT1 and these predicted structural proteins.
Localization data would be informative in deciphering the interactions and relationships
between these factors.
The defects observed in the mlt2 mutant are suggestive of a role for MLT2 in
maintaining eyespot organization in addition to regulating asymmetry and eyespot
number. The multitude of phenotypes may be indicative that MLT2 functions as a
“master regulator” of eyespot assembly. Furthermore, the observation of multiple
pyrenoids in a substantial subset of mlt2 cells may be suggestive that the roles of MLT2
extend beyond eyespot formation to processes affecting the biogenesis of other organelles.
Given the dramatically increased levels of ChR1 photoreceptor in mlt2 cultures analyzed
by Western blot, it was quite surprising to observe individual cells without discernible
87
ChR1 spots or with very few, small ChR1 spots even though the cells were grown under
the same culture conditions. It is possible that with loss of the stabilizing effect of other
eyespot proteins, ChR1 is degraded in some mlt2 cells.
A working model of eyespot assembly
The data presented in this study are consistent with a working model wherein the stable
ultrastructure of the eyespot is formed in a “top-down” cascade with rootlet-directed
factors, likely including photoreceptor molecules, recruiting and facilitating coalescence
of other components in the chloroplast (Figure 26). In this model, photoreceptor
molecules are guided to the site of eyespot assembly by interaction with the D4
microtubule rootlet, directed to the daughter side by cues in the basal body region,
including MLT1. MLT2 may regulate the expression of eyespot genes or proteins,
possibly through transcriptional or translational repression. MIN1 stabilizes the
photoreceptors in the plasma membrane, and other membrane-spanning proteins are
recruited to the area, forming a stable connection between the chloroplast envelope and
plasma membrane. EYE2 forms a specialized patch on the chloroplast envelope, shown
in this model associated with the inner membrane, where it nucleates formation of the
pigment granule arrays, which self-assemble via interactions with associated fibrillin
proteins. EYE3 plays a role in formation and stabilization of the pigment granules from
plastoglobules in the chloroplast. Additional interactions are established between the
arrays of pigment granules and thylakoid membrane, resulting in the regular stacked
arrangement of the layers in the eyespot.
88
The development of the complex supramolecular structures that comprise the
eyespot depend on upstream cues to direct the placement of components, ensure protein
stability, and establish close contact between membrane layers in both the chloroplast and
plasma membrane. In the following chapter, the mechanisms that establish the
positioning of the eyespot on the anterior-posterior axis will be investigated, along with
examination of eyespot assembly and positioning in cells immediately following cell
division.
89
Figure 26 Model of eyespot assembly. Diagram not drawn to scale. A: Cues in the
basal body region, likely including MLT1, direct the rhodopsin photoreceptor molecules
to the daughter side of the cell. MLT1 may associate with the mother basal body (M) and
block movement of photoreceptor to the mother side of the cell. MLT2 may regulate
expression of eyespot genes and/or proteins. B: Photoreceptor molecules are trafficked
or otherwise associate with the D4 rootlet. C: Photoreceptor accretes into an elliptical
patch and is stabilized by association with eyespot proteins such as MIN1. Apposition of
the plasma membrane and chloroplast envelope is established. D: Structural connecting
proteins bridge the outer eyespot membrane layers. MIN2 may also be involved in
regulating the size of the supramolecular assembly. EYE2 protein localizes to a patch on
the chloroplast envelope. E: Pigment granules biosynthesis occurs in the chloroplast
stroma, possibly from plastoglobule precursors attached to thylakoid membranes. EYE3
is required for pigment granule formation and may also stabilize the granules. F: EYE2
nucleates formation of the pigment granule arrays. G: The pigment granules selfassemble into an organized array. H: As the arrays assemble, they associated with
thylakoid membrane, possibly through mediation of fibrillins and other unknown
interactors.
90
91
CHAPTER 4
ROLE OF THE D4 MICROTUBULE ROOTLET IN EYESPOT POSITIONING IN
CHLAMYDOMONAS REINHARDTII
AUTHOR’S STATEMENT
The majority of this chapter is a version of a manuscript submitted for publication in the
journal Cytoskeleton in 2011. All of the data is my own. Additional original material has
been added and integrated into the text.
SUMMARY
The eyespot is localized asymmetrically in the cell at a precisely-defined position relative
to the flagella and cytoskeletal microtubule rootlets. A mutant was isolated in a genetic
screen, named pey1 for posterior eyespot, with variable microtubule rootlet lengths. The
length of the acetylated daughter four-membered microtubule rootlet correlates with the
position of the eyespot, which appears in a posterior position in the majority of cells. The
correlation of rootlet length with eyespot positioning was also observed in the cmu1
mutant, which has longer acetylated microtubules, and the mlt1 mutant, in which the
rootlet microtubules are shorter. Observation of eyespot positioning after
depolymerization of rootlet microtubules was suggestive that eyespot position is fixed
early in eyespot development and becomes independent of the rootlet. These data
demonstrate that the length of the daughter four-membered rootlet is the major
92
determinant of eyespot positioning on the anterior-posterior axis and are suggestive that
the gene product of the PEY1 locus is a novel regulator of acetylated microtubule length.
INTRODUCTION
The eyespot in wild-type Chlamydomonas reinhardtii cells is invariably associated with
the daughter four-membered (D4) microtubule rootlet. The rootlet microtubules are
highly acetylated, a modification that confers enhanced stability concurrent with
increased resistance to microtubule-depolymerizing drugs (LeDizet and Piperno 1986).
Data are indicative that the acetylation track of these rootlets extends the full length of
the rootlet in the majority of cells (Mittelmeier et al. 2011). Evidence is suggestive that
the tubulin cytoskeleton guides localization of the rhodopsin photoreceptors of the
eyespot to the daughter side of the cell (Mittelmeier et al. 2011) and that this positioning
cue is required for initiating the coordinated assembly of the eyespot and association with
its chloroplastic components (Boyd et al. 2011).
Despite the established role of the D4 rootlet in the asymmetric positioning of the
eyespot in C. reinhardtii, the factors that define the positioning of this organelle on the
anterior-posterior axis of the cell have not been thoroughly investigated. In addition to
mutants affecting assembly of the basal bodies and flagellar apparatus (Preble et al. 2001;
McVittie 1972; Barsel et al. 1988; Tam et al. 2007; Berman et al. 2003), previous genetic
studies have identified mutants defective in various aspects of cytoskeletal structure that
have supplied clues in the pursuit of this question. The cmu1 (cytoplasmic microtubules
unorganized) mutant has supernumerary acetylated and non-acetylated microtubules that
93
extend and curl around the posterior of the cell (Horst et al. 1999). The mlt1 (multiple
eyespot) mutant is characterized by supernumerary eyespots exhibiting loss of asymmetry
(Lamb et al. 1999) and acetylated rootlets that are significantly shorter than wild-type
lengths (Mittelmeier et al. 2011). In this study the identification and characterization of a
novel mutant, pey1 (posterior eyespot) is described, which has both variable flagellar
lengths and variable microtubule rootlet lengths that correlate with the position of the
eyespot in the cell. These data demonstrate that the D4 microtubule rootlet is the major
determining factor for establishing eyespot placement in C. reinhardtii, and that
positioning of this organelle becomes independent of the rootlet soon after eyespot
assembly.
94
RESULTS
Genetic screen identifies a novel eyespot-position mutant
Wild-type Chlamydomonas reinhardtii cells have an asymmetrically-localized eyespot at
or near the cell equator (Figure 27A). Cells of the previously-described cmu1-1 mutant
are characterized by defects in microtubule organization (Horst et al. 1999) and, when
examined by bright field microscopy, often exhibit posteriorly-positioned eyespots
(Figure 3D). Cells of the mlt1 mutant have multiple eyespots that are frequently more
anteriorly positioned than wild-type eyespots (Lamb et al. 1999) (Figure 27E). To
identify additional mutants with defects in eyespot assembly or positioning, we
conducted a forward genetic screen of 600 insertion mutants (gift of Patrice Hamel, The
Ohio State University, Columbus, OH) using a simple phototaxis assay (Lamb et al.
1999). One strain was initially characterized by erratic swimming behavior. When
scored by bright field light microscopy, a majority of cells within a population of this
strain had an eyespot at or near the posterior end of the cell (Figure 27C,D). The mutant
was named pey1 for posterior eyespot. Subsequent out-crosses of this strain indicated
that the swimming defect did not segregate with the eyespot-positioning phenotype. The
pey1 mutation is unlinked to the cmu1 mutation. The location of the APHVII insertion in
pey1 was mapped to chromosome 3, but did not segregate with the eyespot phenotype
(see Materials and Methods).
95
Figure 27 Bright field micrographs of a wild-type C. reinhardtii cell and eyespotposition mutants. Arrows indicate eyespots. A: Wild-type cell with an equatoriallypositioned eyespot. B: cmu1 mutant cell with a posteriorly-positioned eyespot near the
pyrenoid. C,D: pey1 mutant cells with posterior eyespots. E: mlt1 mutant cell with two
eyespots, one of which is positioned anteriorly in the chloroplast lobe. F: The pey1 mlt1
double mutant exhibits the mlt1 phenotype. Bars, 5 µm.
96
Microtubule rootlet length varies in eyespot-position mutants
Microtubule rootlets in the mlt1 and pey1 mutants were examined using an
antibody to acetylated-α-tubulin (clone 6-11-B-1, Sigma, St. Louis, MO). Interestingly,
mlt1 cells have significantly shorter microtubule rootlets than wild-type, with the ratio of
longest rootlet to cell length (R1/L) approximately one quarter less than the wild-type
average (Figure 28B) (Mittelmeier et al. 2011). The lengths of microtubule rootlets in the
pey1 mutant are more variable and often longer than wild-type (Figure 28C). These
observations led to the hypothesis that D4 rootlet length correlates with eyespot position
in C. reinhardtii.
Table 7
Summary of metrics of wild-type, pey1, and cmu1 cells
Strain
Θeye (°) (n)
% E1/R1 (n)
wild-type 89 ± 9 (116) 90.6 ± 7.1 (63)
Flagellar
Length (μm) (n)
8.9 ± 1.2 (100)
Tag
Length (μm) (n)
0.34 ± 0.33 (20)
pey1
110 ± 18 (81)
88.7 ± 9.0 (84)
8.5 ± 1.6
(100)
0.54 ± 0.45
(20)
cmu1
144 ± 19 (32)
100 ± 7.0 (32)
9.3 ± 1.5
(100)
0.26 ± 0.26
(20)
97
Figure 28 Acetylated rootlet length is
perturbed in eyespot-position mutants.
Immunofluorescence micrographs of fields of
methanol-fixed C. reinhardtii cells stained
with anti-acetylated tubulin. A: Wild-type
cells. Ends of the acetylated D4 rootlets are
marked by arrowheads. B: The mlt1 mutant
has shorter acetylated rootlets. C: Rootlets in
the pey1 mutant vary in length and are often
longer than those of wild-type cells.
Bars, 10 μm.
98
Eyespot position correlates with acetylated microtubule rootlet length
For quantitation of eyespot position in the pey1 and cmu1 mutants, Θeye was defined as
the angle of the eyespot along the anterior-posterior axis from the center of the cell body.
The anterior flagellar pole lies at an angle of 0° and the posterior pole at an angle of 180°
(Figure 29A). Θeye varied widely in pey1 cells, in contrast to the wild-type range, and
eyespots of cells of a cmu1 population were all in a posterior range (Figure 5B). The
mean Θeye in wild-type cells was 89 ± 9° (n=116) whereas pey1 cells had a mean Θeye of
110 ± 18° (n=81) and cmu1 a mean of 144 ± 19°. The position of the eyespot in relation
to the highly-acetylated D4 rootlet was also quantified, E1 defined as the distance from
the anterior pole to the posterior of the eyespot and R1 as the distance from the anterior
pole to the end of rootlet acetylation (Figure 29C). Immunofluorescence microscopy of
pey1 and cmu1 cells stained with antibodies against acetylated α-tubulin and the
photoreceptor channelrhodopsin-1 (ChR1) revealed that the position of the eyespot
strongly correlated with the length of the acetylated track of the D4 rootlet. Of eyespots
scored, 94% of wild-type (n=63), 91% of pey1 (n=86), and 100% of cmu1 cells had an
E1/R1 ratio greater than 75% of the total rootlet distance (R1) (Figure 29D). The lengths
of pey1 and cmu1 flagella did not differ markedly from wild-type (Table 7 and Figure
29E).
99
Figure 29 Eyespot position varies over a wider, longer range in the pey1 and cmu1
mutants compared to wild-type, and eyespot position correlates with the length of the D4
rootlet. A: Diagram of a C. reinhardtii cell showing basis for positioning measurements.
Eyespot angle (Θeye) along the anterior-posterior axis was defined from the center of the
cell. B: Histogram showing the distribution of Θeye in populations of wild-type, pey1, and
cmu1 cells. The distribution of eyespot angles in the pey1 mutant is skewed toward the
posterior of the cell, and eyespots in cmu1 cells are always observed in the posterior
range. C: Diagram showing basis for distance measurements. Distances from the anterior
pole to the distal ends of the eyespot (E1) and D4 rootlet (R1) were measured as straight
lines. Distance between end of eyespot staining and rootlet staining was calculated from
E1/R1. D: Graph plotting the percentage of E1/R1 between the eyespot and end of the
D4 rootlet in populations of wild-type, pey1, and cmu1 cells. 94% of wild-type cells
(n=63), 91% of pey1 cells (n=86), and 100% of cmu1 cells (n=32) had an E1/R1 of 75%
or greater. E: Histogram showing the distribution of flagellar lengths in populations of
wild-type, pey1, and cmu1 cells. The distribution of flagellar lengths in pey1 and cmu1
cells is not markedly different than wild-type. F: Histogram showing distributions of D4
rootlet “tag” lengths in wild-type, pey1, and cmu1 cells (n=20 for each population)
measured from the posterior edge of ChR1 staining to end of rootlet acetylation. Tag
lengths in the pey1 mutant are more variably distributed than those of wild-type or cmu1
cells.
100
101
In 75% of wild-type and cmu1 cells, and 95% of pey1 cells examined (n=20), a “tag” of
acetylation on the rootlet extending beyond the posterior edge of the photoreceptor patch
was observed. The length of the tag was variable in both wild-type and pey1 cells but
was more variably distributed in pey1 (Figure 29F), although average tag length was not
significantly different than wild-type (wild-type average 0.34 ± 0.33
μm; pey1 average 0.54 ± 0.45 μm; P(0.05)=0.065; Student’s T-test assuming equal
variances).
The pey1 and cmu1 mutations do not affect eyespot morphology
Double-staining for ChR1 and the eyespot pigment granule marker EYE3 in pey1 and
cmu1 cells demonstrated that eyespot morphology and structure appear normal (Figure
30B-E), an indication that the cytoskeletal defects of these mutants do not affect eyespot
assembly. The mlt1 mutation does not appear to affect flagellar length.
Examination of the mlt1 mutant by immunofluorescence staining with EYE3 and
ChR1 antisera confirmed that the eyespots are often anteriorly positioned, correlating
with the short-rootlet phenotype of this mutant (Figure 30F). A double mutant of pey1
and mlt1 exhibited the mlt1 phenotype, indicating that mlt1 is epistatic to pey1 (Figure
30H).
102
Figure 30 Combined immunofluorescence micrographs demonstrating eyespot positions
and rootlet associations in wild-type C. reinhardtii and eyespot-position mutants stained
with anti-EYE3 (red), anti-ChR1 (green), and anti-acetylated tubulin (blue). A: Wildtype cell with equatorially-positioned eyespot, visible by the co-positioned layers of
photoreceptor (ChR1, green) and eyespot pigment granules (EYE3, red). Note
association of eyespot with the D4 rootlet (AcTub, blue). B-D: pey1 mutant cells exhibit
a range of eyespot positions including posterior (arrows in B and C) and equatorial (D).
Arrow in C highlights rootlet association. Eyespot structure and morphology appears
normal in pey1 cells. E: cmu1 mutant cell. The posteriorly-positioned eyespot is
associated with the rootlet (arrow). F: The pey1 mlt1 double mutant exhibits the
multiple-eyespot phenotype of mlt1 including anterior eyespots. Bars, 5 µm.
103
Eyespot position is established and becomes independent of the D4 rootlet prior to
interphase
The observation of the role of the D4 rootlet in eyespot placement along the anteriorposterior axis led to the question as to whether the positioning of the eyespot is labile and
could be experimentally manipulated by altering microtubule organization. If eyespot
position in interphase cells is dependent upon the length of the D4 rootlet, shortening or
lengthening the rootlet would be expected to cause a proportional change in eyespot
position on the anterior-posterior axis. As microtubule stabilizing and destabilizing drugs
have limited effects on the rootlets, eyespot position was assessed in asynchronous
populations of wild-type and pey1 cells after an extended incubation at 0°C, which
depolymerizes all cytoplasmic microtubules (LeDizet and Piperno 1986). Cells were
fixed and stained with anti-acetylated tubulin, EYE3, and ChR1 after 90 minutes at 0°C.
After treatment, acetylated tubulin staining was mostly confined to the basal bodies and
flagella, indicating that the rootlet microtubules had been almost completely
depolymerized; however, in cells with a depolymerized D4 rootlet, the eyespot retained
its structure, observed by the continued co-positioning of pigment granules and ChR1
photoreceptor, and did not move to an anterior position (Figure 31A). Figure 32B shows
a pey1 cell with an incompletely depolymerized D4 rootlet and the eyespot remaining in a
fixed position. In many cells, the D4 rootlet remained after treatment even though all
other microtubule rootlets had depolymerized (Figure 31C), demonstrating that the D4
rootlet is especially stable and resistant to depolymerization relative to other members of
the tubulin cytoskeleton. In cells from synchronized cultures examined in early G1 phase
104
immediately following cytokinesis, ChR1 was found co-positioned with EYE2 at the
ends of daughter rootlet acetylation (Figure 31D). Interestingly, both wild-type and pey1
cells were observed with rootlet acetylation extending to the posterior of the cells while
the eyespots remained in intermediate positions (Figure 31E). Together, these data
indicate that eyespot positioning becomes independent of the D4 rootlet after being
established, and that the structural organization of the eyespot is not dependent on rootlet
association in interphase.
Figure 31 Eyespot positioning in cold-treated and early G1 phase wild-type and pey1
cells. A: Immunofluorescence micrographs of a wild-type cell treated for 90 minutes at
0°C to depolymerize microtubules. Eyespot structure remains intact and retains
approximately equatorial position as indicated by EYE3 and ChR1 staining (arrow in
merge). B: Immunofluorescence micrographs of a pey1 cell showing incompletely
depolymerized rootlet (arrowhead) while the eyespot retains its position. C:
Immunofluorescence micrographs of a wild-type cell after 90 minutes at 0°C showing D4
rootlet remaining after depolymerization of other microtubule rootlets (arrow). D and E:
Combined immunofluorescence micrographs of wild-type and pey1 cells early postcytokinesis stained for EYE2 (red), ChR1 (green), and AcTub (blue). ChR1 spots are
first seen co-positioned with EYE2 at the end of rootlet acetylation (D). In both wildtype and pey1 cells, a phase was observed in which rootlet acetylation extended to the
posterior of the cells while eyespots remained in an intermediate position (E). Bars, 5 μm.
105
106
DISCUSSION
The organization and placement of cellular organelles is largely dependent on the
guidance of cytoskeletal elements. The basal bodies (centrioles) of the unicellular alga
Chlamydomonas reinhardtii instruct the positioning of the nucleus (Feldman et al. 2007)
and direct the characteristic asymmetric placement of organelles in the cell, such as the
chloroplast, by establishment of cortical polarity (Ehler and Dutcher 1998). The daughter
four-membered (D4) microtubule rootlet, emanating from the vicinity of the daughter
basal body, directs the asymmetric placement of the eyespot, located in wild-type cells at
the cell equator. In addition to its role in positioning the eyespot on the daughter half of
the cell, the D4 rootlet is the major determinant of eyespot positioning on the anteriorposterior axis, and that this positioning is to a large extent fixed following eyespot
assembly.
The characteristic placement of the eyespot near the end of the acetylated track of
the D4 rootlet in wild-type cells is retained in the pey1 mutant, which exhibits variable
microtubule rootlet lengths, the cmu1 mutant, which has supernumerary microtubules of
extended length, and the multiple-eyespot mutant mlt1, in which rootlet length is shorter
than the wild-type average. This correlation is consistent with a role of the D4 rootlet in
directing the placement of the eyespot on the anterior-posterior axis of the cell.
The observation that depolymerization of microtubule rootlets in interphase wildtype cells had no effect on eyespot position demonstrates that eyespot position becomes
independent of the D4 rootlet after a certain point in the cell cycle. The fact that the
eyespot is a stable structure that can be isolated biochemically (Schmidt et al. 2006) may
107
account for its relative immobility once fully assembled. It is possible that the
cytoskeleton contributes to maintaining the position of the eyespot, but observation of the
organelle at longer time points after loss of rootlet association would be required.
Eyespots of the similar species C. eugametos were observed to move in the chloroplast
toward the pyrenoid after cells had been cultured for several days in the microtubuledepolymerizing drug colchicine (Walne 1967), but it is unclear what observed changes in
ultrastructure may have been due to secondary effects of the drug.
The results obtained from synchronized cells observed soon after telophase gave
further evidence that the rootlet directs eyespot formation, as ChR1 and EYE2 staining
first appeared at the proximal tips of the daughter rootlets, the rootlets subsequently
extending to the posterior of the cell while the eyespot remains in an intermediate
position. The D4 rootlet must at some point be “trimmed back” before reaching its
interphase length, and these results point to dynamic properties of the microtubule
rootlets during organization of the cytoskeleton in Chlamydomonas. It is likely that cellcycle control of the expression of eyespot components and kinetic factors regulating
microtubule extension together constitute the defining elements in the final determination
of eyespot placement.
Several mechanisms could account for the aberrant placement of eyespots in the
pey1 mutant: (1) the “fixation time” of the eyespot is delayed, so that eyespot
components would travel to a more posterior position as the rootlet extends before the
organelle coalesces into a sufficiently stable structure; (2) transport and delivery of
chloroplastic eyespot-assembly factors to (or their association with) the D4 rootlet could
108
be delayed, resulting in a scenario similar to that described above; or (3) acetylation and
thus stabilization of the rootlet occurs faster or is otherwise mis-regulated, resulting in
placement of eyespots near the rootlet ends in more posterior positions. The rootlet
phenotype observed in pey1 seems to imply a defect in microtubule regulation rather than
assembly of eyespot proteins, but it is also possible that a transport defect, such as a
mutation in a microtubule-associated motor protein, could affect both processes. The
observation that the length of D4 rootlet acetylation extending beyond the posterior edge
of the eyespot (the “tag”) was more variable in pey1 cells provides further evidence that
the defect in this mutant is due to regulation of acetylated microtubule length. It remains
possible that the lesion in the PEY1 locus does not result in a null mutation, and some of
the phenotypic variability is due to dosage-dependent effects. Definitive answers to
mechanistic questions would require development of markers for live-cell imaging of
eyespot proteins in dividing cells and availability of drugs allowing manipulation of
microtubule acetylation.
The specific roles of the MLT1 and CMU1 loci in cytoskeletal organization are
unclear. The MLT1 gene is predicted to encode a high-molecular weight, low-complexity
protein with no recognized functional domains (JGI C. reinhardtii v 4.0; Protein ID
188661; http://www.chlamy.org), and its subcellular localization has not yet been
determined. The epistasis of mlt1 to pey1, along with the observation that the mlt1
mutation disrupts the normal daughter-directed localization of eyespot components,
implies an upstream effect of MLT1 involving the interaction of eyespot components
with cytoskeletal elements in the basal body region. Preliminary evidence indicates that
109
the CMU1 gene encodes a microtubule-associated non-motile kinesin, which may
function in microtubule +-end capture in a manner similar to interactions with motor
proteins characterized in yeast (Horst et al. 1999).
As flagellar length is unaffected in pey1 and cmu1, these mutations likely affect
cytoplasmic acetylated microtubules by mechanisms distinct from those involved in
flagellar length regulation. Regulation of acetylation/deacetylation in Chlamydomonas
flagella is mediated by microtubule-associated enzymes (Maruta et al. 1986), and it is
possible that PEY1 affects microtubule acetylation or some other modification. The
rootlet microtubules might also have capping structures such as those found in both
Chlamydomonas and Tetrahymena cilia and flagella (Dentler 1980; Suprenant and
Dentler 1988). The PEY1 gene may encode a microtubule-associated protein that caps
and stabilizes the +-ends of rootlets after these structures have reached a standard length
determined by factors linked to cell cycle control. The absence of a cap may allow for
continued microtubule growth or depolymerization until the steady-state is attained. The
+-end binding, conserved microtubule-associated kinesin EB1 and related proteins have
similar functions in regulating microtubule dynamics during the cell cycle (Su et al. 1995;
Berrueta et al. 1998). Kinesin-8 in budding yeast depolymerizes microtubules by a
length dependent-mechanism, contributing to a regular steady-state length (Varga et al.
2006). However, PEY1 could affect microtubule length by an otherwise unknown
mechanism. Identification of the gene products of the CMU1 and PEY1 loci should
clarify the mechanisms that control the timing of eyespot placement and lend new
insights into the regulation of microtubule length and cytoskeletal organization.
110
CHAPTER 5
PROSPECTIVE FUTURE DIRECTIONS
Gene Identification and Localization of the Mini- and Multi-Eye Proteins
The most important next step in the investigation of factors important for eyespot
biogenesis would be to identify and characterize the MIN2 and MLT2 genes. The
mapping data for these loci presented in this study should assist in this process. Despite
much effort, attempts to determine the localization of the MIN1 and MLT1 proteins have
not been successful. Foreign DNA, including constructs containing tags such as
hemaglutinin (HA) for facilitating antibody detection, are often subject to silencing when
introduced into Chlamydomonas. Overexpression of strong promoters such as
RBCS2/HSP70A (Schroda et al. 2002) in gene constructs may help in overcoming these
obstacles.
Discovery of the identity and localization of MLT2 would be particularly
interesting, as the multifarious phenotype of the mlt2 mutant implies that the protein
could have a regulatory role in transcriptional repression. Once antibodies are available
that detect MIN1, MIN2, and MLT1, it would be interesting to examine the levels of
these proteins and their localization in the mlt2 mutant. Likewise, mapping of the pey1
mutation and identification of the protein product of this locus would clarify the
mechanism of PEY1 action in microtubule length regulation. Experimental manipulation
of microtubule rootlet acetylation, conceivably through targeted knock-down of the
111
recently-identified C. reinhardtii acetyltransferase enzyme, would contribute to our
understanding of the microtubule cytoskeleton and its part in organelle placement.
Functional Analysis of EYE3 and Related Eyespot Kinases
ABC1 kinases are involved in steps of quinone biosynthesis and metabolism in
plants, fungi, and bacteria. More recent evidence suggests of a role for these proteins in
structural stability of lipid-filled plastoglobules in plant chloroplasts. Besides EYE3, two
kinases of this family were identified in the eyespot. Future studies involving RNAiinduced gene silencing could investigate if these other kinases are also involved in
eyespot assembly, or if they serve other functions, perhaps in phosphorylation of
pathway. It would be informative to know if kinase activity of EYE3 is required for
pigment granule biogenesis, but attempts to express a kinase-dead allele of EYE3 have so
far proved unsuccessful (J. Boyd, unpublished). A negative result of such an experiment
would strengthen the hypothesis that EYE3 plays a primarily structural role in pigment
granule stabilization.
Experimental Investigation of Factors Required for Eyespot Disassembly
The question of regulation of eyespot disassembly in Chlamydomonas has not yet
been addressed on a molecular level. Early ultrastructural studies uncovered a sequence
of events of eyespot disintegration beginning with separation of the pigment granule
arrays from the chloroplast envelope and disappearance of the electron-dense region of
plasma membrane (corresponding to the photoreceptor patch), and continuing with
112
movement of eyespot pigment granules deep into the chloroplast (Morel-Laurens and
Bird 1984). In zoospores of the green alga Pleurastrum terrestre, the eyespot granules
were observed to be absorbed into the pyrenoid (Melkonian 1981). It is likely that the
scission of eyespot proteins responsible for structural stability is under control of celldivision-cycle proteins, and along these lines several proteases and peptidases were
identified in the eyespot proteome (Schmidt et al. 2006). A genetic screen for mutants in
which eyespots persist during cell division would necessitate time-consuming and laborintensive microscopy of synchronized dividing cultures. The recent creation of a
TILLING (targeted induced local lesions in genomes) collection may hold promise for
targeted gene knockouts in Chlamydomonas and provide an avenue for investigating
candidate genes by reverse genetics.
The structural complexity of the eyespot, its diverse functions, and the many
factors governing its biogenesis and cellular position make it a fascinating model system
for organelle placement and assembly. Clearly, many facets of the biology of this
organelle remain to be explored, and future investigations will provide insights into the
mechanisms and interactions of several processes important for all cells.
113
CHAPTER 6
MATERIALS AND METHODS
Chlamydomonas strains and media: Chlamydomonas strains used in this study are
listed in Table 8. Chlamydomonas reinhardtii wild-type strains 137c mt+ (CC-125) and
mt- (CC-124), eye1-1 mt+ (CC-1102), Chlamydomonas eugametos E9 (CC-1419), and
Chlamydomonas incerta (CC-3871) were obtained from the Chlamydomonas Stock
Center (University of Minnesota, St. Paul, MN). Strains eye2-1 (CC-4302), eye3-1 (CC4303), min1-1 (CC-4305), and mlt1-1 (CC-4304) were originally obtained following UVmutagenesis of strain 137c mt+ (Lamb et al. 1999). Strains eye2-2 (H9-8) and min1-2
(H6-2) were isolated following ARG7 insertional mutagenesis of strain 137c (Roberts et
al. 2001; Mittelmeier et al. 2008). Strain eye3-2 (F35) was obtained from a screen of
phototaxis-defective mutants following NIT1 insertional mutagenesis of strain g1
(Roberts 1999). Strain min2-1 (59-1; CC-4318) was a spontaneous mutation isolated
following mutagenesis of strain 137c mt+ with the CRY-1 insertion (Nelson et al. 1994).
The mutation in min2-1 is unlinked to the insertion. Strains 33 (CC-4317) and mlt2-1 (28; CC-4320) were isolated following 5-fluorodeoxyuridine-induced mutagenesis of strain
137c mt+. The NIT1 insertional mutant strain cmu1-1 (CC-3945) was obtained from
George Witman (University of Massachusetts Medical Center, Worcester, MA, USA).
Strain 4A (CC-4051) was obtained from Patrice Hamel (The Ohio State University,
Columbus, OH). Strain pey1-1 arg7 was obtained from a genetic screen of clones of
strain 3A (arg7, mt+) after transformation by electroporation with 100 ng of aphVII insert
DNA amplified from plasmid Hyg3 by PCR with primers Aph7-F and Aph7-R (Table 9).
114
Table 8
Chlamydomonas strains used in this study
Strain name
137c mt+
Genotype/ Comments
Wild-type
Reference/Source
Harris (1989)
137c mt-
Wild-type
Harris (1989)
12-18
eye3-1 mt+
Lamb et al. (1999)
H9-8
eye2-2::ARG7 arg7-8 mt+
Roberts et al. (2001)
This study
F35
eye3-2::NIT1 mt
33
eye3-3
This study
59-1
min2-1
This study
12-10
mlt1-1
Lamb et al. (1999)
2-8
mlt2-1
12-12
min1-1 mt
This study
+
Lamb et al. (1999)
+
H6-2
min1-2::ARG7 mt
arg2
arg7-8 mt+
Harris (1989)
arg7
arg7-2 mt-
Harris (1989)
12-18 arg2 mt-
eye3-1 arg7-8 mt-
This study
12-18 arg2 mt+
eye3-1 arg7-8 mt+
This study
3A mt
Wild-type
Harris (1989)
1B mt-
Wild-type
Harris (1989)
4A mt+
Wild-type
CC-4051
cmu1-1 mt+
cmu1-1::NIT1
Horst et al. (1999)
pey1 arg7 mt+
pey1 arg7::APHVII
This study
pey1-1 mt+
out cross of pey1 arg7 mt+ to 137c mt- This study
pey1 mlt1
mlt1 mt- x pey1-1 mt+
This study
eye1-1 mt+
eye1
Hartshorne (1953)
C. incerta
--
CC-3871
C. eugametos
E9, male
CC-1419
+
Mittelmeier et al. (2008)
115
The Arg+ pey1-1 mt+ strain was derived from an out cross of pey1-1 arg7 mt+ to strain
137c mt-. Double mutants were obtained from non-parental ditypes of crosses.
Strains were maintained on solid TAP medium or TAP supplemented with 0.2
mg/mL arginine (for arginine auxotrophic strains). Liquid cultures were grown in
modified Sager and Granick medium I with added Hutner’s trace elements (R medium)
or without acetate (M medium) (Harris 1989), or R medium containing 0.1% sodium
acetate limited for NH4NO3 (0.125 mM) and supplemented with 0.2 mg/mL arginine
(RNA medium).
Generation of antisera: A rabbit polyclonal antiserum was raised against a TrpE-fusion
construct containing residues 75-180 of the EYE2 sequence (for methods see Weber and
Dieckmann 1990). A rabbit polyclonal antiserum was raised against a peptide epitope of
EYE3 (residues 565-572) and purified by affinity chromatography (Pacific Immunology,
La Jolla, CA).
Protein sequence analysis: Analysis of amino acid sequences was conducted using the
ProtParam tool (Swiss Institute of Bioinformatics Expert Protein Analysis System
(ExPASy) http://us.expasy.org/tools/protparam.html). Sequences in Figure 16 were
aligned using ClustalW (Thompson et al. 1994) and shaded using the Multiple Align
Show program (http://www.bioinformatics.org/sms/multi-align.html).
Phototaxis assays: Following overnight growth in M medium, cultures in test tubes were
screened for phototactic ability using the assay described below.
Genetic screen: Approximately 600 strains of Chlamydomonas reinhardtii strain 3A
carrying insertions of either paramomycin-resistance or aphVII (hygromycin-resistance)
116
cassette were screened using a simple assay for phototactic ability. Strains were patched
on solid TAP medium plus arginine and inoculated into 1.2 mL liquid M-N medium in
test tubes. Cultures were grown overnight at 25°C and assayed for phototaxis by
placement in a covered box possessing a narrow slit at the bottom for illumination.
Phototaxis-defective or non-swimming strains were observed by bright field microscopy.
Genetic analysis: Fresh cultures from plates were grown for two days on solid R
medium containing 1/10 of the normal nitrogen source at 25°C under continuous
illumination. Cells were inoculated into 1 mL M-N medium and incubated 4 hours at
25°C. 200 μL of each culture were combined and allowed to mate for one hour under
continuous illumination at 25°C. Mating mixtures were plated on solid R medium
containing 4% agar and kept in the dark for at least 4 days. Dissection and tetrad analysis
were conducted according to standard methods (Harris 1989).
Bright field microscopy: Cells from overnight liquid cultures were spotted onto a
microscope slide, coverslipped, and viewed with a Leica DMRXA microscope using a
Leica planapochromat 100x, 1.4 numerical aperture oil immersion objective with a 1.6 x
optivar and bright field optics. Images were captured with a QImaging (Burnaby, BC,
Canada) Retiga EX-cooled CCD camera driven by Universal Imaging (Downingtown,
PA, USA) MetaMorph v.6.1.2 software.
Immunofluorescence microscopy: Cells were resuspended in 200 μL autolysin and
incubated at room temperature with gentle shaking for 30 minutes. Cells were pelleted
(2700g, 5 minutes), resuspended in phosphate-buffered saline (PBS), spotted onto polylysine-coated multiwell slides, allowed to settle, and fixed in -20°C methanol for 30
117
seconds. Samples were incubated sequentially at room temperature for 30 minutes in
block buffer (1X PBS + 1% bovine serum albumin) and 30 minutes in block + 0.1%
Triton X-100. Samples were incubated in primary antibodies overnight at 4°C, washed 4
x 10 minutes in block buffer, and incubated for 2 hours at room temperature in
appropriate secondary antibodies diluted in block buffer. Samples were washed 3 x 10
minutes in wash buffer (1X PBS + 0.1% Tween-20) and 1 x in PBS, blotted, and allowed
to air-dry. Slides were coverslipped with MOWIOL® 4-88 mounting reagent
(Calbiochem, La Jolla, CA) and allowed to set overnight at 30°C. Polyclonal rabbit antiChR1 serum (gift of P. Berthold and P. Hegemann) and anti-EYE2 serum were purified
using a MelonTM Gel IgG spin purification kit (Pierce, Rockford, IL) at a dilution of 1:10.
For fluorescence microscopy, EYE2, EYE3, and ChR1 antibodies were directly
conjugated to fluorophores (Alexa Fluor® 488, Alexa 594, or allophycocyanin) using
Zenon® rabbit IgG labeling kits (Invitrogen, Carlsbad, CA) according to the protocol
provided by the manufacturer. Monoclonal anti-acetylated α-tubulin (Clone 6-11B-1,
Sigma, St. Louis, MO) was detected with goat anti-mouse secondary antibodies
conjugated to Alexa Fluor® 568 at a dilution of 1:1000 or Cy5 (Molecular Probes) at a
dilution of 1:200.
Samples were viewed on a DeltaVision RT inverted epifluorescence microscope
(Applied Precision, Eugene, OR) with an Olympus TH4 1.4 numerical aperture 100x
objective with an 1.6x optivar at 24°C using appropriate filters. Images were captured
using a CoolSnapTM HQ CCD camera (Photometrics, Tucson, AZ), deconvolved using
the SoftWorx imaging program (Applied Precision), and combined in NIH ImageJ. For
118
images in Figure 24, images from consecutive intervals of Z-sections for each channel
were stacked, the Z-projections were taken, and images for each channel were combined.
Electron microscopy: Wild-type cells were fixed at room temperature in 2%
formaldehyde with microwaving at 100W in 1 minute intervals and 2.5% glutaraldehyde
with microwaving. Samples were stained with 0.25% OsO4 for 15 minutes, washed with
deionized water, dehydrated in an alcohol series with a final 1x propylene oxide step, and
embedded in 812 resin. Sections were cut with a Leica UltraCutTM microtome, mounted
on formovar-coated nickel grids, and counter-stained with lead nitrate. Samples were
viewed on a Philips transmission electron microscope at 80 mV.
Peptide blocking: Solutions of affinity-purified anti-EYE3 (0.08 mg/mL in block buffer
(1x phosphate-buffered saline + 1% bovine serum albumin)) were incubated at room
temperature for 30 minutes with continuous agitation either with or without 1 mg/mL
immunizing peptide. Wild-type cells prepared for immunofluorescence as described
above were incubated in either anti-EYE3 (0.08 mg/mL) or anti-EYE3 blocked with
immunizing peptide and labeled with 1:1500 donkey anti-rabbit Alexa Fluor® 488
(Molecular Probes) secondary for visualization.
Measurements: Eyespot diameters were measured using the Straight Line tool in NIH
ImageJ, converted to micrometers, and areas were calculated in Microsoft Excel. Wildtype and pey1 cells were stained for EYE3 detected with donkey anti-rabbit Alexa-488conjugated secondary (Molecular Probes) as described previously, and eyespot position
was measured in immunofluorescence micrographs of cell fields using the Angle tool in
ImageJ. The angle from the anterior pole of each cell to the approximate center of the
119
fluorescent spot stained with anti-EYE3 was defined as Θeye using the center point of the
cell as reference. Eyespot distance from the end of the D4 rootlet was measured as a
straight line from the anterior pole to the end of staining in cells double-stained for ChR1
and acetylated tubulin by immunofluorescence using the Straight Line Segment tool in
ImageJ. For measurements of flagellar length, cells of strains 4A mt+ (wild-type), pey1
mt+, and cmu1 mt+ were stained anti-acetylated α-tubulin and detected with a goat antimouse Alexa-488-conjugated secondary antibody (Molecular Probes) according to the
protocol described previously, and individual flagella were measured. Measurements of
rootlet distances and cell lengths were performed similarly with cells double-labeled with
anti-acetylated α-tubulin detected with a goat-anti-mouse Alexa-488 secondary at a
dilution of 1:1000 and anti-ChR1 either directly conjugated to Alexa-594 or detected with
a donkey anti-rabbit Alexa-594 secondary at a dilution of 1:1000. Lengths and distances
were measured using the Straight Line Segment tool in ImageJ, and the measurements
were converted to micrometers in Microsoft Excel.
Cold treatment. Cultures were grown overnight in liquid M medium and cells were
pelleted by centrifugation. Cells were resuspended in autolysin and incubated for 30
minutes at room temperature with gentle shaking, pelleted by centrifugation, and
resuspended in small volumes of PBS (approximately 50 μL/culture). Cell suspensions
were then incubated on ice for 90 minutes, spotted on poly-lysine-coated slides, and fixed
and stained for immunofluorescence microscopy as described above.
120
Culture synchronization: Strains were cultured on solid M medium for one week on a
12:12 light dark cycle at 25°C. Dividing cells were harvested for microscopy by scraping
directly from the plate approximately 30 minutes after the start of the dark cycle.
Immunoblotting: Whole-cell extracts from 2 mL cultures grown overnight in M
medium were prepared by resuspending pelleted samples in 200 μL 4x Laemmli buffer
(250 mM Tris-Cl [pH 6.8], 40% glycerol, 20% β-mercaptoethanol, 8% sodium dodecyl
sulfate (SDS), 0.024% bromophenol blue) (Laemmli 1970) with added protease inhibitors
(5 μg/mL aprotinin, 5 μg/mL leupeptin, 1 μg/mL pepstatin A, and 1.0 mM
phenylmethylsulfonyl fluoride (PMSF)) and boiling at 100°C for 5 minutes. Proteins
were separated by polyacrylamide gel electrophoresis using standard 10%
polyacrylamide-SDS gels, and transferred overnight onto polyvinylidene difluoride
membranes (Pall Corp., Ann Arbor, MI) using a standard protocol. Blots were blocked in
5% nonfat dry milk (NFDM) for one hour at room temperature and incubated overnight
at 4°C in primary antibodies (1:500 rabbit polyclonal anti-EYE2, 1:5,000 rabbit
polyclonal anti-ChR1, and 1:10,000 mouse anti-tubulin (clone B-5-1-2; Sigma, St. Louis,
MO)) in 1% NFDM in TBS-T (10 mM Tris-Cl, 150 mM NaCl, 0.5% Tween-20). Blots
were probed with goat anti-rabbit horseradish peroxidase at a dilution of 1:5,000 and/or
goat anti-mouse horseradish peroxidase (Pierce, Rockford, IL) at a dilution of 1:10,000 in
1% NFDM-TBS-T for 2 hours at room temperature. After multiple washes with TBS-T,
blots were incubated with SuperSignal substrates (Pierce) for one minute and exposed to
CL-X Posure film (Thermo Scientific, Rockford, IL).
121
Identification of APHVII insertion flanking sequence: Genomic DNA was isolated
from 100 mL of a pey1 culture grown to mid-log phase in R medium using a standard
protocol. Restriction enzyme site-directed amplification PCR (RESDA-PCR) was carried
out after the method of González-Ballester et al. (2005) with the following modifications:
primers Aph7-R4 and Aph7-R2 (Table 9) specific to the Hyg3 insertion cassette were
used for the first and second rounds of amplification, respectively. PhusionTM longtemplate Taq DNA polymerase (Finnzymes, Espoo, Finland) was used in all reactions
with buffer 2 supplied from the manufacturer and one-fifth volume Q buffer (Qiagen,
Baltimore, MD) added to the reaction mixtures. Amplification with degenerate primers
DegAluI and DegTaqI (Table 9) yielded distinct bands of approximately 1700 bp. After
second-round amplification of the bands, the amplicon was excised and cloned into
pGEM T-Easy vector (Promega, Madison, WI) and sequenced using primers T7 and SP6
(Table 9). A BLAST search of the Chlamydomonas genome identified 108 nt and 32 nt
of sequence flanking the insertion that yielded hits on chromosome 3.
DNA sequencing: Automated DNA sequencing was performed at the DNA sequencing
facility of the Laboratory of Molecular Systematics and Evolution, University of Arizona
(Tucson, AZ).
122
Table 9
Oligonucleotides used in this study
Primer
Aph7-F
Sequence (5′ to 3′)
TCGATATCAAGCTTCTTTCTTGC
Aph7-R
AAGCTTCCATGGGATGACG
Aph7-R4
TAGGAATCATCCGAATCAATACG
Aph7-R2
GCTATTTAAACAGCGCTCG
DegAluI
CCAGTGAGCAGAGTGACGIIIIINNSWCAGCTT
DegTaqI
CCAGTGAGCAGAGTGACGIIIIINNSWGTCGAA
Q0
CCAGTGAGCAGAGTGACG
T7
TAATACGACTCACTATAGGG
SP6
TATTTAGGTGACACTATAG
.
123
Oligonucleotide synthesis: The oligonucleotides used in this study are listed in Table 9.
Oligonucleotides were synthesized by SigmaGenosys Biotechnologies (The Woodlands,
TX).
Figure preparation: Figures were prepared using Adobe Illustrator (Adobe Systems)
and Microsoft Word (Microsoft). Micrographs were minimally adjusted for brightness
and contrast using NIH ImageJ software, cropped in Adobe Photoshop, and reduced from
the original size in Adobe Illustrator. Figure 26 was drawn in Inkscape (open-source
vector drawing program).
124
APPENDIX A
REACTIVITY OF CHLAMYDOMONAS REINHARDTII EYESPOT
ANTIBODIES IN OTHER CHLAMYDOMONAS SPECIES
Reactivity of antibodies to Chlamydomonas reinhardtii EYE2, EYE3, and ChR1 were
tested by immunofluorescence staining in the closely-related species C. incerta (Harris
2009) and the distantly-related C. eugametos, which exhibits rRNA sequence divergence
with C. reinhardtii comparable to differences among the major Chlorophyte lineages
(Jupe et al. 1988; Buchheim et al. 1990). Figure 32 shows EYE3 and ChR1 staining in C.
incerta (A) and C. eugametos (B). Micrographs on the right panels are combined with
acetylated tubulin staining. The EYE2 antibody also reacts in both species (arrows, C).
These results demonstrate that the EYE2, EYE3, and ChR1 antibodies used in this study
are reactive across a broad range of Chlamydomonas species and are indicative that
eyespot proteins are highly conserved in this genus. A 56 kDa protein in the green alga
Spermatozopsis similis reacts with Chlamydomonas EYE2 antiserum (Dieckmann 2003),
providing evidence that homologs of Chlamydomonas eyespot proteins described in this
study are found in other genera of green algae and function similarly in eyespot assembly.
125
A
C. incerta
EYE3
ChR1
B
C. eugametos
EYE3
ChR1
EYE3 ChR1 AcTub
C
C. eugametos
C. incerta
C. eugametos
EYE2
EYE2
Figure 32 Reactivity of Chlamydomonas reinhardtii eyespot
antibodies in C. incerta and C. eugametos.
126
REFERENCES
Austin, J. R., Frost, E., Vidi, P.-A., Kessler, F., and Staehelin, L. A. (2006).
Plastoglobules are lipoprotein subcompartments of the chloroplast that are permanently
coupled to thylakoid membranes and contain biosynthetic enzymes. Plant Cell 18: 16931703.
Barsel, S.-E., Wexler, D. E., and Lefebvre, P. A. (1988). Genetic analysis of long
flagella mutants of Chlamydomonas reinhardtii. Genetics 118:637-648.
Bateman, A., and Bycroft, M. (2000). The structure of a LysM domain from E. coli
membrane-bound lytic murein transglycosylase D (MltD). J. Mol. Biol. 299:1113-1119.
Beisson, J., and Jerka-Dziadosz, M. (1999). Polarities of the centriolar structure:
morphogenetic consequences. Biol. Cell 91:367-378.
Berman, S. A., Wilson, N. F., Haas, N. A., and Lefebvre, P. A. (2003). A novel MAP
kinase regulates flagellar length in Chlamydomonas. Curr. Biol. 13:1145-1149.
Berrueta L., Kraeft, S. K., Tirnauer, J. S., Schuyler, S. C., Chen, L.B., Hill, D.E.,
Pellman, D., and Bierer, B. E. (1998). The adenomatous polyposis coli-binding protein
EB1 is associated with cytoplasmic and spindle microtubules. Proc. Natl. Acad. Sci. USA
95:10596-10601.
Berthold, P., Tsunoda, S. P., Ernst, O. P., Mages, W., Gradmann, D., and
Hegemann, P. (2008). Channelrhodopsin-1 initiates phototaxis and photophobic
responses in Chlamydomonas by immediate light-induced depolarization. Plant Cell
20:1665-1677.
Bornens, M. (2008). Organelle positioning and cell polarity. Nat Rev. Mol. Cell Biol.
9:874-886.
Boyd, J. S., Mittelmeier, T. M., Lamb, M. R., and Dieckmann, C. L. (2011).
Thioredoxin-family protein EYE2 and ser/thr kinase EYE3 play interdependent roles in
eyespot assembly. Mol. Biol. Cell DOI: 10.1091/mbc.E10-11-0918.
Bréhélin, C., Kessler, F., and van Wijk, K. J. (2007). Plastoglobules: versatile
lipoprotein particles in plastids. Trends Plant Sci. 12:260-266.
Buchheim, M. A., Turmel, M., Zimmer, E. A., and Chapman, R. L. (1990).
Phylogeny of Chlamydomonas (Chlorophyta) based on cladistic analysis of nuclear 18S
rRNA sequence data. J. Phycol. 26:689-699.
127
Coyne, B., and Rosenbaum, J. L. (1970). Flagellar elongation and shortening in
Chlamydomonas. II. Re-utilization of flagellar proteins. J. Cell Biol. 47:777-781.
Dentler, W. L. (1980). Structures linking the tips of ciliary and flagellar microtubules to
the membrane. J. Cell Sci. 42:207-220.
Deruère, J., Römer, S., D’Harlingue, A., Backhaus, R. A., Kuntz, M., and Camara,
B. (1994). Fibril assembly and carotenoid overaccumulation in chromoplasts: A model
for supramolecular lipoprotein structures. Plant Cell 6:119-133.
Dieckmann, C. L. (2003). Eyespot placement and assembly in the green alga
Chlamydomonas. BioEssays 25:410-416.
Do, T. Q., Hsu, A. Y., Jonanssen, T., Lee, P. T., and Clarke, C. F. (2001). A defect in
coenzyme Q biosynthesis is responsible for the respiratory deficiency in Saccharomyces
cerevisiae abc1 mutants. J. Biol. Chem. 276:18161-18168.
Dutcher,S. K. (2003). Elucidation of basal body and centriole functions in
Chlamydomonas reinhardtii. Traffic 4:443-451.
Ehler, L. L., and Dutcher, S. K. (1998). Pharmacological and genetic evidence for a
role of rootlet and phycoplast microtubules in the positioning and assembly of cleavage
furrows in Chlamydomonas reinhardtii. Cell Motil. Cytoskeleton 40:193-207.
Ellenberg, J., Siggia, E. D., Moreira, J. E., Presley, J. F., Worman, H. J., and
Lippincott-Schwartz, J. (1997). Nuclear membrane dynamics and reassembly in living
cells: Targeting of an inner nuclear membrane protein in interphase and mitosis. J. Cell
Biol. 138:1193-1206.
Feldman, J. L., Geimer, S., and Marshall, W. F. (2007). The mother centriole plays an
instructive role in defining cell geometry. PLoS Biology 5:1284-1297.
Foster, K. W., and Smyth, R. D. (1980). Light antennas in phototactic algae. Microbiol.
Rev. 44:572-630.
Geimer, S., and Melkonian, M. (2004). The ultrastructure of the Chlamydomonas
reinhardtii basal apparatus: identification of an early marker of radial asymmetry
inherent in the basal body. J. Cell Sci. 117:2663-2674.
Geimer, S., and Melkonian, M. (2005). Centrin scaffold in Chlamydomonas reinhardtii
revealed by immunoelectron microscopy. Euk. Cell 4:1253-1263
128
González-Ballester, D., de Montaigu, A., Galván, A., and Fernández, E. (2005).
Restriction enzyme site-directed amplification PCR: a tool to identify regions flanking a
marker DNA. Anal. Biochem. 340:330-335.
Goodenough, U. W., and Weiss, R. L. (1978). Interrelationships between microtubules,
a striated fiber, and the gametic mating stucture of Chlamydomonas reinhardtii. J. Cell
Biol. 76:430-438.
Harris, E. H. (1989). The Chlamydomonas Sourcebook: A Comprehensive Guide to
Biology and Laboratory Use. San Diego: Academic Press.
Harris, E. H. (2009). The Chlamydomonas sourcebook, 2nd ed., Volume 1. San Diego:
Academic Press. 444 p.
Hartshorne, J. N. (1953). The function of the eyespot in Chlamydomonas. New Phytol.
52:292-297.
Hegemann, P., Neumeier, K., Hegemann, U., and Kuehnle, E. (1990). The role of
calcium in Chlamydomonas photomovement responses as analysed by calcium channel
inhibitors. Photochem. Photobiol. 52:575-583.
Hegemann, P. (1997). Vision in microalgae. Planta 203:265-274.
Holmes, J. A., and Dutcher, S. K. (1989). Cellular asymmetry in Chlamydomonas
reinhardtii. J. Cell Sci. 94:273-285.
Horst, C. J., Fishkind, D. J., Pazour, G. J., and Witman, G. B. (1999). An insertional
mutant of Chlamydomonas reinhardtii with defective microtubule positioning. Cell Motil.
Cytoskeleton 44:143-154.
Inouye, I. (2000). Flagella and Flagellar Apparatuses of Algae In: Ultrastructure of
Microalgae, ed. Berner, T., Boca Raton: CRC Press, pp. 99-133.
Jupe, E. R., Chapman, R. L., and Zimmer, E. A. (1988). Nuclear ribosomes, RNA
genes, and algal phylogeny- the Chlamydomonas example. Biosystems 21:223-230.
Kamiya, R., and Witman, G. (1984). Submicromolar levels of calcium control the
balance of beating between the two flagella in demembranated models of
Chlamydomonas. J. Cell Biol. 98:97-107.
Keady, B. T., Le, Y. Z., and Pazour, G. J. (2011). IFT20 is required for opsin
trafficking and photoreceptor outer segment development. Mol. Biol. Cell 22:921-930.
129
Kessler, F., and Vidi, P.-A. (2007). Plastoglobule lipid bodies: their functions in
chloroplasts and their potential for applications. Adv. Biochem. Engin. Biotechnol.
107:153-172.
Knogge, W., and Scheel, D. (2006). LysM receptors recognize friend and foe. Proc. Natl.
Acad. Sci. USA 103:10829-10830.
Kreimer, G. (1994). Cell biology of phototaxis in flagellated green algae. Int. Rev. Cytol.
148:229-310.
Kreimer, G. (2001). Light reception and signal modulation during photoorientation of
flagellate green algae. In: Häder, D.-P., and Lebert, M., eds. Photomovement. Amsterdam:
Elsevier, pp. 193-227.
Kreimer, G. (2009). The green algal eyespot apparatus: a primordial visual system and
more? Curr. Genetics 55:19-43.
Laemmli, U. K. (1970). Cleavage of structural proteins during assembly of the head of
bacteriophage T4. Nature 227:680-685.
Lamb, M. R., Dutcher, S. K., Worley, C. K., and Dieckmann, C. L. (1999). Eyespotassembly mutants in Chlamydomonas reinhardtii. Genetics 153:721-729.
LeDizet, M., and Piperno, G. (1986). Cytoplasmic microtubules containing acetylated
α-tubulin in Chlamydomonas reinhardtii: spatial arangement and properties. J. Cell Biol.
103:13-22.
Marbois, B., Gin, P., Faull, K. F., Poon, W. W., Lee, P. T., Strahan, J., Shepherd, J.
N., and Clarke, C. F. (2005). Coq3 and Coq4 define a polypeptide complex in yeast
mitochondria for the biosynthesis of coenzyme Q. J. Biol. Chem. 280:20231-20238.
Marbois, B., Gin, P., Gulmeziana, M., and Clarke, C. F. (2009). The yeast Coq4
polypeptide organizes a mitochondrial protein complex essential for coenzyme Q
biosynthesis. Biochim. Biophys. Acta 1791:69–75.
Maruta, H., Greer, K., and Rosenbaum, J. L. (1986). The acetylation of alpha-tubulin
and its relationship to the assembly and disassembly of microtubules. J. Cell Biol.
103:571-579.
McVittie, A. (1972). Flagellum mutants of Chlamydomonas reinhardtii. J. Gen.
Microbiol. 71:525-540.
Melkonian, M. (1981). Fate of eyespot lipid globules after zoospore settlement in the
green alga Pleurastrum terrestre Fritsch et John. Br. Phycol. J. 16:247-255.
130
Melkonian, M. (1984). Flagellar apparatus ultrastructure in relation to green algal
classification In: Irvine, D. E. G. and D. M. John (eds.) Systematics of the green algae.
London: Academic Press, pp. 75-120.
Melkonian, M., and Robenek, H. (1980). Eyespot membranes of Chlamydomonas
reinhardtii: a freeze-fracture study. J. Ultrastruct. Res. 72:90-102.
Melkonian, M., and Robenek, H. (1984). The eyespot apparatus of flagellated green
algae: a critical review. In: Progress in Phycological Research vol. 3., ed. F. E. Round
and D. J. Chapman, Bristol: Biopress Ltd., 193-268.
Mittelmeier, T. M., Berthold, P., Danon, A., Lamb, M. R., Levitan, A., Rice, M., and
Dieckmann, C. L. (2008). C2 domain protein MIN1 promotes eyespot organization in
Chlamydomonas reinhardtii. Euk. Cell 7:2100-2112.
Mittelmeier, T. M., Boyd, J. S., Lamb, M. R., and Dieckmann, C. L. (2011).
Asymmetric properties of the Chlamydomonas reinhardtii cytoskeleton direct rhodopsin
photoreceptor localization. J. Cell Biol DOI: 10.1083/jcb.201009131.
Merchant, S. S., Prochnik, S. E., Vallon, O., Harris, E. H., Karpowicz, S. J., Witman,
G. B., Terry, A., Salamov, A., Fritz-Laylin, L. K., Marechal-Drouard, L., Marshall,
W. F., Qu, L. H., Nelson, D. R., Sanderfoot, A. A., Spalding, M. H., Kapitonov, V. V.,
Ren, Q. H., Ferris, P., Lindquist, E., Shapiro, H., Lucas, S. M., Grimwood, J.,
Schmutz, J., Cardol, P., Cerutti, H., Chanfreau, G., Chen, C. L., Cognat, V., Croft,
M. T., Dent, R., Dutcher, S., Fernandez, E., Fukuzawa H., Gonzalez-Balle, D.,
Gonzalez-Halphen, D., Hallmann, A., Hanikenne, M., Hippler, M., Inwood, W.,
Jabbari, K., Kalanon, M., Kuras, R., Lefebvre, P. A., Lemaire, S. D., Lobanov, A. V.,
Lohr, M., Manuell, A., Meir, I., Mets, L., Mittag, M., Mittelmeier, T., Moroney, J.
V., Moseley, J., Napoli, C., Nedelcu, A. M., Niyogi, K., Novoselov, S. V., Paulsen, I.
T., Pazour, G., Purton, S., Ral, J. P., Riano-Pachon, D. M., Riekhof, W., Rymarquis,
L., Schroda, M., Stern, D., Umen, J., Willows, R., Wilson, N., Zimmer, S. L., Allmer,
J., Balk, J., Bisova, K., Chen, C. J., Elias, M., Gendler, K., Hauser, C., Lamb, M. R.,
Ledford, H., Long, J. C., Minagawa, J., Page, M. D., Pan, J. M., Pootakham, W.,
Roje, S., Rose, A., Stahlberg, E., Terauchi, A. M., Yang, P. F., Ball, S., Bowler, C.,
Dieckmann, C. L., Gladyshev, V. N., Green, P., Jorgensen, R., Mayfield, S., MuellerRoeber, B., Rajamani, S., Sayre, R. T., Brokstein, P., Dubchak, I., Goodstein, D.,
Hornick, L., Huang, Y. W., Jhaveri, J., Luo, Y. G., Martinez, D., Ngau, W. C. A.,
Otillar, B., Poliakov, A., Porter, A., Szajkowski, L., Werner, G., Zhou, K. M.,
Grigoriev, I. V., Rokhsar, D. S., and Grossman, A. R. (2007). The Chlamydomonas
genome reveals the evolution of key animal and plant functions. Science 318:245-251.
Moestrup, Ø., (1978). On the phylogenetic validity of the flagellar apparatus in green
algae and other chlorophyll A and B containing plants. Biosystems 10:117-144.
131
Morel-Laurens, N. M. L., and Feinleib, M. E. (1983). Photomovement in an “eyeless”
mutant of Chlamydomonas. Photochem. and Photobiol. 37:189-194.
Nagel, G., Ollig, D., Fuhrmann, M., Kateriya, S., Musti, A. M., Bamberg, E., and
Hegemann, P. (2002). Channelrhodopsin-1: a light-gated proton channel in green algae.
Science 296:2395-2398.
Nagel, G., Szellas, T., Huhn, W., Kateriya, S., Adeishvili, N., Berthold, P., Ollig, D.,
Hegemann, P., and Bamberg, E. (2003). Channelrhodopsin-2, a directly light-gated
cation-selective membrane channel. Proc. Natl. Acad. Sci. USA 100:13940-13945.
Nakamura, S., Ogihara, H., Jinbo, K., Tateishi, M., Takahashi, T., Yoshimura, K.,
Kubota, M., Watanabe, M., and Nakamura, S. (2001). Chlamydomonas reinhardtii
Dangeard (Chlamydomonadales, Chlorophyceae) mutant with multiple eyespots. Phycol.
Res. 49:115-121.
Nelson, J. A., Savereide, P. B., and Lefebvre, P. A. (1994). The CRY1 gene in
Chlamydomonas reinhardtii: structure and use as a dominant selectable marker for
nuclear transformation. Mol. Cell Biol. 14:4011-4019.
Nunnari, J., and Walter, P. (1996). Regulation of organelle biogenesis. Cell 84:389-394.
Nultsch, W. (1983). The photocontrol of movement in Chlamydomonas. Symp. Soc. Exp.
Biol. 36:521-539.
Ohad, I., Goldberg, I., Broza, R., Schuldiner, S., and Gan-Zvi, E. (1969). Changes in
lipid and pigment composition and photosynthetic activity during formation of
chloroplast lamellae in a mutant of Chlamydomonas reinhardtii, y-1. In: Metzner, H. (ed.)
Progress in Photosynthesis Research, Vol. 1. Tübingen: International Union of Biological
Sciences, pp. 284-295.
Poon, W. W., Davis, D. E., Ha, H. T., Jonassen, T., Rather, P. N., and Clarke, C. F.
(2000). Identification of Escherichia coli ubiB, a gene required for the first
monooxygenase step in ubiquinone biosynthesis. J. Bacteriol. 182:5139-5146.
Preble, A. M., Giddings, T. H., and Dutcher, S. K. (2001). Extragenic bypass
suppressors of mutations in the essential gene BLD2 promote assembly of basal bodies
with abnormal microtubules in Chlamydomonas reinhardtii. Genetics 157:163-181.
Qin, H., Diener, D. R., Geimer, S., Cole, D. G., and Rosenbaum, J. L. (2004).
Intraflagellar transport IFT cargo: IFT transports flagellar precursors to the tip and
turnover products to the cell body. J. Cell Biol. 164:255-266.
132
Renninger, S., Dieckmann, C. L., and Kreimer, G. (2006). Toward a protein map of
the green algal eyespot: analysis of eyespot globule-associated proteins. Phycologia 45:
199-212.
Ringo, D. L. (1967). Flagellar Motion and Fine Structure of Flagellar Apparatus in
Chlamydomonas. J. Cell Biol. 33:543-571.
Roberts, D. G. W. (1999). Characterization of the EYE2 gene required for eyespot
assembly in Chlamydomonas reinhardtii. Ph.D. dissertation, University of Arizona.
Roberts, D. G. W., Lamb, M. R., and Dieckmann, C. L. (2001). Characterization of
the EYE2 gene required for eyespot assembly in Chlamydomonas reinhardtii. Genetics
158:1037-1049.
Rosenbaum, J. L., Moulder, J. E., and Ringo, D. L. (1969). Flagellar elongation and
shortening in Chlamydomonas. The use of cyclohexamide and colchicine to study the
synthesis and assembly of ciliary and flagellar proteins. J. Cell Biol. 41:600-619.
Rüffer, U., and Nultsch, W. (1991). Flagellar Photoresponses of Chlamydomonas Cells
Held on Micropipettes-2: Change in Flagellar Beat Pattern. Cell Motil. Cytoskeleton
18:269-278.
Schmidt, M., Geßner, G., Luff, M., Heiland, I., Wagner, V., Kaminski, M., Geimer,
S., Eitzinger, N., Reißenweber, T., Voytsekh, O., Fiedler, M., Mittag, M., and
Kreimer, G. (2006). Proteomic analysis of the eyespot of Chlamydomonas reinhardtii
provides novel insights into its components and tactic movements. Plant Cell 18:19081930.
Schroda, M., Beck, C. F., and Vallon, O. (2002). Sequence elements within an HSP70
promoter construct counteract transcriptional transgene silencing in Chlamydomonas.
The Plant Journal 31:445-455.
Simkin, A. J., Gaffé, J., Alcaraz, J.-P., Carde, J.-P., Bramley, P. M., Fraser, P. D.,
and Kuntz, M. (2007). Fibrillin influence on plastid ultrastructure and pigment content
in tomato fruit. Phytochemistry 68:1545-1556.
Sineshchekov, O. A., and Govorunova, E. G. (2001). Electrical events in
photomovement of green flagellated algae. In: Häder, D.-P. and Jori, G. (eds.)
Photomovement. Comprehensive Series in Photosciences Vol. 1. Amsterdam: Elsevier,
pp. 245-280.
Sineshchekov, O. A., Jung, K. H., and Spudich, J. L. (2002). Two rhodopsins mediate
phototaxis to low- and high-intensity light in Chlamydomonas reinhardtii. Proc. Natl.
Acad. Sci. USA 99:8689-8694.
133
Stearns, T. (2001). Centrosome duplication: a centriolar pas de deux. Cell 105:417-420.
Stephens, R. E. (1989). Quantal tektin synthesis and ciliary length in sea urchin embryos.
J. Cell Sci. 92:403-413.
Strittmatter, P., Soll, J., and Bölter, B. (2010). The chloroplast import machinery: a
review. Methods Mol. Biol. 619:307-321.
Su, L. K., Burrell, M., Hill, D. E., Gyuris, J., Brent, R., Wiltshire, R., Trent, J.,
Vogelstein, B,, and Kinzler, K. W. (1995). APC binds to the novel protein EB1. Cancer
Res. 55:2972-2977.
Suprenant, K. A. and Dentler, W. L. (1988). Release of intact microtubule-capping
structures from Tetrahymena cilia. J. Cell Biol. 107:2259-2269.
Tam, L.-W., Wilson, N. F., and Lefebvre, P. A. (2007). LF2 encodes a CDK-related
kinase that regulates flagellar length and assembly in Chlamydomonas. J. Cell Biol.
176:819-829.
Tauche, A., Krause-Buchholz, U., and Rödel, G. (2008). Ubiquinone biosynthesis in
Saccharomyces cerevisiae: the molecular organization of O-methylase Coq3p depends on
Abc1p/Coq8p. FEMS Yeast Res. 8:1263-1275.
Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994). Improved sensitivity of
profile searches through the use of sequence weights and gap extension. Comput. Appl.
Biosci. 10:19-29.
Varga, V., Helenius, J., Tanaka, K., Hyman, A. A., Tanaka, T. U., and Howard, J.
(2006). Yeast kinesin-8 depolymerizes microtubules in a length-dependent manner. Nat.
Cell Biol. 8:957-962.
Wagner, V., Ullmann, K., Mollwo, A., Kaminski, M., Mittag, M., and Kreimer, G.
(2008). The phosphoproteome of a Chlamydomonas reinhardtii eyespot fraction includes
key components of the light signaling pathway. Plant Physiology 146:772-788.
Walne, P. L. (1967). The effects of colchicine on cellular organization in
Chlamydomonas. II. Ultrastructure. Amer. J. Bot. 54:564-577.
Weber, E. R., and Dieckmann, C. L. (1990). Identification of the CBP1 polypeptide
from mitochondrial extracts of Saccharomyces cerevisiae. J. Biol. Chem. 265:1594-1600.
Witman G. B. (1993). Chlamydomonas phototaxis. Trends Cell Biol. 3:403-408.
134
Ytterberg, A. J., Peltier, J.-B., and van Wijk, K. J. (2006). Protein profiling of
plastoglobules in chloroplasts and chromoplasts. A surprising site for differential
accumulation of metabolic enzymes. Plant Physiology 140:984-997.
Zaal, K. J. M., Smith, C. L., Polishchuk, R. S., Altan, N., Cole, N. P., Ellenberg, J.,
Hirschberg, K., Presley, J. F., Roberts, T. H., Siggia, E., Phair, R. D., and
Lippincott-Schwartz, J. (1999). Golgi membranes are absorbed into and reemerge from
the ER during mitosis. Cell 99:589-601.