Journal of Immunology,
Infection & Inflammatory Diseases
Research Article
Cysteine p Guanidine-Oligodeoxynucleotide Upregulates
Interleukin-6 in Human B-Lymphocytes through Complement
Receptor-2 (CR2/CD21) and Toll-Like Receptor 9 Signaling
This article was published in the following Scient Open Access Journal:
Journal of Immunology, Infection & Inflammatory Diseases
Received January 02, 2017; Accepted February 11, 2017; Published February 17, 2017
Rengasamy Asokan1*, Szakonyi Gerda2 and
Gizinski M. Alison3
Division of Rheumatology, School of Medicine,
University of Colorado Denver, Aurora, CO 80045,
USA
2
Institute of Pharmaceutical Analysis, University of
Szeged, Hungary, Europe
3
University of Arkansas for Medical Sciences, Little
Rock, Arkansas, USA
1
Abstract
Human complement receptor type 2 is a receptor for complement C3d, Epstein Bar
virus- gp350, IgE receptor CD23, Interferon-α (IFN-α) and DNA. It plays a central role in
systemic lupus erythematosus (SLE). The objective of this study was to examine the role
of human CR2 in CpG-induced NF-kB, IL-6 and IFN-α up-regulation in B cell signaling.
We show by using ELISA as well as Surface Plasmon Resonance (SPR) techniques that
CpG and TLR9 binds to CR2. The equilibrium dissociation constant (kd/ka) between the
bindings of CR2 SCR1-4 to CpG and rhu TLR9 was 3.1×10-2/5.4×105 and 1.1×10-2/2.4×106
with a maximal binding constant (KD) of 571 nM and 42 nM respectively. Anti-CR2 an
inhibitory mAb against the first two (SCRs) completely blocked the binding of full-length
CR2 between CpG and TLR9. A significant dose-dependent activation of NF-kB, IL-6
and IFN-α was seen when primary B lymphocytes were treated with CpG however, GC
modification or methylation of CpG led to the loss of its ability to stimulate these signaling
targets. Treatment of B lymphocytes with an inhibitory anti-CR2 mAb or anti-factor B mAb
resulted in 15%, 25%, 33% inhibition of NF-kB, IL-6 and IFN-α respectively indicating
that CR2 is partially involved in CpG binding and activation of above mentioned signaling
proteins. Treatment of B lymphocytes with chloroquine, a known inhibitor of TLR9 signaling,
showed an additive inhibitory effect. These studies indicated that the majority of CpG was
bound through the cell surface TLR9 to activate the IL-6, 79% in contrast to the IFN-α, 42%.
Stimulation of B lymphocytes with lipopolysacchride showed a dose-dependent activation
of IL-6. Chloroquine inhibited LPS-induced IL-6 indicating the inhibition of TLR4 mediated
activation. All these findings demonstrate that CR2 functionally interact with CpG which
mimics bacterial CpG rich DNA and TLR9 on B lymphocytes to activate the cell signaling.
Keywords: Complement Receptor-2, Protein-Protein interactions, Cysteine p
Guanidine-oligodexonucleotide, B-lymphocyte activation assay, Interluekin-6, Systemic
Lupus Erythematosus
Introduction
Human complement receptor type 2 (CR2/CD21) is a multi-functional cell surface
receptor expressed predominantly on B cells and follicular dendritic cells (FDC),
although a subset of peripheral and thymic T cells has also been express CR2 [1,2]. CR2
has been implicated in the pathogenesis of systemic lupus erythematosus (SLE) [3,4].
CR2 has five well-characterized classes of ligands, including complement C3 fragments
such as iC3b, C3dg and C3d [5-9], Epstein-Barr virus viral coat protein, gp350/220 [1013], a low affinity receptor for IgE, CD23 [14], interferon-α (IFN-α) [15] and DNA [16].
*Corresponding Author: Rengasamy Asokan, Ph.D,
Division of Rheumatology Box, B-115,School of
Medicine, University of Colorado Denver, 1775 Aurora
Court, Aurora, CO 80045, USA, Tel: 303-724-7593,
Email: [email protected]
Volume 2 • Issue 1 • 008
CR2 is a 145 kD transmembrane glycoprotein containing 15 or 16 short consensus
repeats (SCRs) followed by a 28 amino acid transmembrane domain and a 34 amino
acid intra cytoplasmic domain. Each SCR’s are composed of 60-70 amino acid in length
and connected by a 4-8 amino acid linker peptide [17,18]. All four ligands i.e. C3d, EBVgp350, IFN-α and DNA binds to the first two SCRs of CR2 receptor [5,7,10,11,15,16,1922]) for CD23 [14,12] except for the low affinity receptor for IgE, CD23 which binds
to an additional site located at SCR domain 5-8. CR2 can act as a B cell co-receptor to
trigger antigen-mediated signal transduction. CR2 co-ligation with surface IgM, using
mAbs [23,24] or with antigen-C3d complex [25] or with anti IgM-C3dg complexes
promoted the release of an intra-cellular calcium [26]. This functional activation is due
to the association of CR2, CD19 and CD81 in a signaling complex [26-28]. In addition
www.scientonline.org
J Immunol Infect Inflam Dis
Citation: Rengasamy Asokan, Szakonyi Gerda, Gizinski M. Alison (2017). Cysteine p Guanidine-Oligodeoxynucleotide Upregulates Interleukin-6 in
Human B-Lymphocytes through Complement Receptor-2 (CR2/CD21) and Toll-Like Receptor 9 Signaling
Page 2 of 12
to this, CR2 ligation independently involved in several functional
events such as homotypic adhesion [29], NF-kB activation [30]
IL-6 generation[31], antigen uptake and presentation to T cells
and actin polymerization [32].
In mice CR2 receptor is encoded by single CR1 gene which
generates two receptors from a common mRNA by alternative
splicing [33,34]. In human two different genes on chromosome
1 generates two different receptors, CR1 and CR2. Cr2 -/- mice
not only have defective antigen presentation but also T cell
dependent and independent immune responses [35] Cr2 -/mice also showed defects in B cell memory and natural antibody
generation [36]. Recent studies also suggest that mouse CR2
plays a major role in maintaining tolerance to self-antigens such
as dsDNA, chromatin and histone complex and the development
of SLE [37], although the molecular mechanism of this function
is unknown.
Bacterial DNA activates the innate immune system. The
bacterial cell wall containing repeating sugar molecules,
the lipopolysaccrides (LPS) or the bacterial-DNA containing
unmethylated CpG motif is the prime structural molecule that can
acts as an activators of the immune cells. CpG motifs are 20 folds
more common in bacterial DNA than in vertebrate DNA. However,
these CpG motifs are suppressed and methylated in eukaryotic
DNA [38]. Mammalian-DNA is generally non-immunogenic
and contains reduced numbers of CpG dinucleotides which are
mostly methylated. In addition, mammalian-DNA has a potential
inhibitory activity on the innate immune system activation
processes through the TLR9. The defective clearance of the
apoptotic dead cell-DNA results in an increased level of nuclear
antigen as a “biological garbage” in the body retaining most of
its hypomethylated DNA fragments. The host cell-DNA in the
circulation is recognized by the TLR9 [39] as well as by B cells.
At present we do not know the presence of any DNA binding
receptor on the surface of B cells and we hypothesized that the
B cell surface CR2 can bind and mediate clearing “biological
garbage” in vivo. These DNA fragments effectively cleared in the
healthy individuals by B cells but it was defective in SLE patients.
Recent studies have also suggested that a synthetic CpG ODN
retain its stimulating capacity similar to bacterial unmethylated
DNA; hence researchers used an identical synthetic CpG ODN to
study the innate immune system activation in B cells [40]. It was
also used as a therapeutic drug for treatment of diseases such
as anti-cancer, allergy, asthma and infectious diseases [41,42].
In addition, recent studies also suggest that the hypomethylated
mammalian genomic self-DNA containing CpG motif mimic like
bacterial DNA to stimulate anti-DNA antibody production but
the mechanism of action is not known [43,44] CpG inhibitory
oligonucleotide efficiently impair TLR9 immune response in
human immune cells [45]. Finally these CpG rich DNA recognize
and binds TLR9 receptor for subsequent cell signaling leading to
biological functions.
TLR9 is a Type I trans membrane glycoprotein with 116 kDa
MW containing 1032 amino acids which shares common structural
feature with other TLR family of proteins. The TLR9 receptors are
expressed on various cells but it is predominately on plamacytoid
precursor, dendritic cells and on B cells and to a lesser extent
also on monocytes. CpG DNA not only directly activates FDCs
but in humans the autoantibody-DNA activates dendritic cells
in cooperation with CD32 and TLR9 [46]. CpG DNA does not
Volume 2 • Issue 1 • 008
stimulate B cells but it can synergies with some antigen and leads
the B cell proliferation and expression [41,47]. CpG and TLR9 play
a protective immune response in lung fibrosis in mice [48].
Here we report that the CpG rich DNA as well as the CpG ODN
containing specific CpG motif binds to the CR2. In SLE, IL-6 gene
is over expressed and contributes to the disease pathogenesis.
CpG ODN was used to characterize the human IL-6, human IFN-α
and NF-kB up-regulation using human primary B cells derived
from PBMCs. We found that the CpG ODN binds to cell surface
CR2 receptors and activated the cell signaling. This binding as
well as cell signaling was specific because anti-CR2 inhibitory
antibody inhibited these interactions. This study suggested that
CR2 functionally interacted with the CpG in B cell signaling.
Materials and Methods
Purification of human CR2 SCR1-4, SCR1-15, complement C3d, EBV-gp350 and Bir A recombinant proteins
Human CR2 SCR1-4-BCCP was prepared as we have described
earlier [15,16]. Human CR2 SCR1-15 produced in baculoviral Sf 9
cells was prepared as described in previously published methods
[49]. EBV-gp350 protein was produced and purified as described
earlier [50]. Bir A enzyme was prepared and biotinylated as
described earlier [15,16,51]. The purity of all recombinant
proteins were determined using non-reducing SDS-PAGE and
Western blot analysis as described in the method [15,16]. The
absorption coefficient for each protein calculated at A280 was
used to determine protein concentrations. These recombinant
proteins were used for protein-protein interaction studies by
ELISA and surface Plasmon Resonance Analysis (SPR).
Source of Cysteine p Guanidine-Oligodeoxynucleotide
2006 and recombinant human TLR9
B-class CpG ODN 2006-TCGTCGTTTTGTCGTTTTGTCGTT
and GpC ODN 2006 -5′-TGCTGCTTTTGTGCTTTTGTGCTT--3′
negative control was obtained from (Operon Biotechnologies
Inc, Huntsville, AL). The class B, CpG ODN 2006 was used to
examine the binding of CR2-CpG in solution phase ELISA and by
the SPR. We further characterized the relative role of cell surface
CR2 in CpG induced NF-KB p50, human IL6 and human IFN-α up
regulation using human primary B cells derived from PBMCs of
healthy control subjects.
A truncated recombinant human toll-like receptor 9
(rhuTLR9) (Abonova corporation, Taiwan), containing first 215
amino acid from n-terminal side with 38.87 kDa protein, was
used to examine the bindings between TLR9 and bacterial DNA
(Micrococus luteus) (CpG-rich DNA) (Sigma, St Louis, MO) and
human CR2 receptors.
Examination of specific interactions between CR2 and
CpG ODN 2006
ELISA was used to determine the specific binding between
CR2 and CpG ODN 2006. A 96 well ELISA plate (Costar) was precoated, overnight at 4ºC, with CpG ODN (2 µg/ml) in sodium
bicarbonate buffer (pH 9.0). Bovine serum albumin (BSA) (2 µg/
ml) was used a negative control. After washing three times with
ELISA plates were blocked for one hour with 1XPBS (1% BSA and
0.05% Tween 20). Different concentrations (2, 1, 0.5 and 0.25 µg /
ml) of human CR2-SCR1-15 were then added to the wells followed
www.scientonline.org
J Immunol Infect Inflam Dis
Citation: Rengasamy Asokan, Szakonyi Gerda, Gizinski M. Alison (2017). Cysteine p Guanidine-Oligodeoxynucleotide Upregulates Interleukin-6 in
Human B-Lymphocytes through Complement Receptor-2 (CR2/CD21) and Toll-Like Receptor 9 Signaling
Page 3 of 12
by incubation for 1 hour at 37ºC. After washing three times,
human CR2 SCR1-15 bound to the CpG-ODN was detected using
a mouse anti-CR2 mAb, HB5 (dilution 1:1000). Goat anti-mouse
(HRP-conjugated) (Jackson Immuno Research Laboratories)
was used as a secondary antibody (dilution 1:1000). Color was
developed using ABTS, and stopped using 2M H2S04. The OD was
measured at an absorbance of 405 nm.
In order to determine whether the first two SCRs of CR2
receptor were directly involved in binding to the CpG ODN,
human CR2-SCR1-15 was pre-incubated for 1 hour at 37°C with
an inhibitory anti-CR2 mAb, called 171. In parallel, an irrelevant,
inhibitory anti-factor B mAb, called 1379 was also used as a
negative control. Various concentrations (10, 20, 30 and 40 µg/
ml) of 171 and 1379 were used to inhibit SCRs1-2 of human CR2SCR1-15 [49]. Pre-mixed and pre-incubated samples of human
CR2-SCR1-15, 171 and 1379 were then added to the CpG ODN
pre-coated ELISA plate followed by incubation for 1 hour at 37°C.
The amount of CR2 SCR1-15 bound to the CpG ODN was detected
and measured as mentioned above by using an identical set of
primary and secondary antibodies.
The percent inhibition was calculated by using the
following formula
1-[(Average Experimental OD - Background OD)/ (Maximum
Average OD - Background OD)] x 100
The interactions between human CR2 SCR1-15 and CpG ODN
were also confirmed by SPR technique (Picataway, NA) with
known ligand C3d and gp350 using 1250 RU of CR2 SCR 1-4 BCCP
on SA chip as described earlier [15,16].
Examination of specific interaction between CR2 with
TLR9
Dose-dependent binding of human CR2 SCR1-15 to the adherent
human recombinant TLR9 (hurTLR9) was examined using ELISA.
ELISA plates were pre-coated with a constant amount of hurTLR9 (2
µg/ml) or BSA (2 µg/ml) in biocarbonate buffer (pH 9.0) overnight
at 4ºC. BSA was used as a negative control. Plates were then washed
and blocked with 1XPBS containing 1% BSA and Tween 20. Various
concentrations of human CR2 SCR1-15 (2, 1, 0.5 and 0.25 µg/ml)
added to the plate. In parallel, human CR2 SCR 1-15 pre-incubated
with various concentrations of 171 mAb or chloroquine (10, 5, 2.5
and 1.25 µg/ml final concentrations) for one hour and then added to
the TLR9 pre-coated plate followed by incubation for 1 hour at 37ºC.
After washing again, human CR2 SCR1-15 bound to the TLR9 was
detected using anti-CR2 mAb, HB5 (dilution 1:1000). HB5 antibody
specifically recognizes CR2 SCRs, 3-4. Goat anti-mouse was used as
a secondary antibody (dilution 1:1000) (Jackson ImmunoResearch
Laboratories). Color was developed using ABTS, and the OD was
measured at an absorbance of 405 nm.
The interactions between human CR2 SCR1-15 and hurTLR9
were also confirmed by SPR technique (Picataway, NA) with
known ligand C3d and gp350 using 1250 RU of CR2 SCR 1-4 BCCP
on SA chip as described earlier [15,16].
Examination of interactions between CR2 and TLR9
and/ or bacterial DNA
Dose-dependent binding of human CR2 SCR1-15 to plate
bound hurTLR9 followed by Micrococcus luteus DNA was studied
Volume 2 • Issue 1 • 008
using the ELISA. A 2 µg/ml hurTLR9 in biocarbonate buffer (pH
9.0) was immobilized on 96 well ELISA plates for overnight at
4ºC. ELISA plates were then washed and blocked with 1XPBS
Tween 20 containing 1% BSA. Subsequently 2 µg/ml Micrococcus
luteus DNA was added to the wells in PBS containing 50 mM NaCl
(pH 7.4) and allowed to incubate for 1 hr binding at 37ºC. After
washing in 1XPBS, Tween 20 containing 1% BSA, a serially diluted
human CR2 SCR1-15 protein (2, 1, 0.5 and 0.25 µg/ml) was added
to the wells and incubated for 1hr. After washing again, human CR2
SCR1-15 bound to Micrococcus lutues DNA was detected using a
primary anti-CR2 mAb, HB5 (dilution 1:1000) and secondary goat
anti-mouse antibody (dilution 1:1000). Color was developed using
ABTS, and the OD was measured at an absorbance of 405 nm.
Purification of human primary B-lymphocytes from
PBMCs
Human blood was collected from healthy subjects according
to the University of Colorado Denver pre-approved COIMRP
protocol. B cells were purified from the PBMCs using a B cell
enrichment kit (Stem Cell Technology). The purity of isolated B
cells was determined by flowcytometry technique using CD20 and
CD14 mAb. The purity of B cells was ~95%. Purified B cells were
cultured at a density of 1 × 106 cells/ml in RPMI 1640 medium
supplemented with L-glutamine (1.5 mM), Penicillin (100 U/ml),
Streptomycin (100 mM) and 2% FBS at 37ºC, 5% CO2.
Effect of CpG ODN 2006 on B-lymphocytes for IL-6 generation in vitro
To examine the effect of CpG ODN, B cells were cultured with
medium containing different concentrations of CpG ODN (0.125,
0.25, 0.5 and 1.0 µg/ml) or its negative control for 24 hrs. After
24 hrs, supernatant obtained for the culture were harvested and
human IL-6 was measured by ELISA (Biosource, CA).
To measure the specific role of cell surface CR2 in IL-6 release,
B cells 1×106 cells/ml were pre-treated with anti-CR2 mAb, 171 (1
and 10 µg/ml) or anti-factor B control antibody (1 and 10 µg/ml)
for 1hr. Later on these cells were cultured in medium containing
CpG (0.125 µg/ml) for an additional 24 hrs. The absolute levels of
IL-6 in the supernatants, collected after 24 hrs, were measured
by using ELISA.
To characterize the relative role of TLR9 in human IL-6
release, a known inhibitor of TLR9 signaling, chloroquine was
used. B cells 1×106 cells/ml were pre-treated with anti-CR2
antibody, mAb 171 (10 µg/ml), chloroquine (10 µg/ml), or antiCR2 antibody mAb 171 with chloroquine or appropriate controls
for 1 hr. Cells were then transferred to a 12-well tissue culture
plate, and CpG ODN (0.125 µg/ml) was added. The absolute levels
of IL-6 in the supernatants, collected after 24 hrs, were measured
by using ELISA.
Effect of CpG ODN 2006 on B-lymphocytes for IFN-α
generation in vitro
Purified B cells were cultured at a density of 1×106 cells/
ml in 12-well tissue culture flat-bottom plates as mentioned
above. B cells were cultured with medium containing different
concentrations of CpG ODN (0.125, 0.25, 0.5 and 1.0 µg/ml) or
its negative control for 24 hrs. The absolute levels of IFN-α, in
the supernatants collected after 24 hrs, were measured by using
ELISA (Biosource, CA).
www.scientonline.org
J Immunol Infect Inflam Dis
Citation: Rengasamy Asokan, Szakonyi Gerda, Gizinski M. Alison (2017). Cysteine p Guanidine-Oligodeoxynucleotide Upregulates Interleukin-6 in
Human B-Lymphocytes through Complement Receptor-2 (CR2/CD21) and Toll-Like Receptor 9 Signaling
Page 4 of 12
To characterize the relative role of CR2 and TLR9 in IFN-α
release, a known inhibitor of TLR9 signaling, chloroquine was
used. B cells 1×106 cells/ml were pre-treated with anti-CR2
antibody mAb 171 (10 µg/ml), chloroquine (10 µg/ml), or antiCR2 antibody mAb 171 with chloroquine or appropriate controls
for 1 hr. Cells were then transferred to 12 well tissue culture
plates, and CpG ODN 2006 (0.125 µg/ml) was added. After 24
hrs, culture supernatants obtained were utilized to measure the
absolute levels of IFN-α by ELISA.
Effect of LPS on B-lymphocytes for IL-6 generation in
vitro
B cells at a density of 1×106 cells/ml were cultured in the
presence of different concentrations (0.00625, 0.0125, and
0.025 µg/ml) of LPS (E. coli 0111 : B4) (Chemicon International,
Temecula, CA) for 36 hrs. After 36 hrs, cell supernatants obtained
were utilized to determine the absolute levels of IL-6 by ELISA
(Biosource, CA).
To characterize the role of cell surface CR2 in LPS mediated
IL-6 release, B cells 1×106 cells/ml were pre-treated with antiCR2 mAb 171 (10 µg/ml) for 1 hr, transferred to 12 well tissue
culture plates and then LPS (0.025 µg/ml) was added and
cultured for 36 hrs. After 36 hrs, culture supernatants obtained
were utilized to measure the human IL-6.
To characterize the relative role of TLR9 in human IL-6 release,
a known inhibitor of TLR9 signaling, chloroquine was used. B cells
1×106 cells/ml were pre-treated with anti-CR2 antibody mAb 171
(10 µg/ml), chloroquine (10 µg/ml), or anti-CR2 antibody mAb
171 with chloroquine or appropriate controls for 1 hr. Cells were
then transferred to 12 well tissue culture plates, and LPS (0.025
µg/ml) was added. After 36 hrs, culture supernatants obtained
were utilized to measure the absolute levels of human IL-6.
Effect of CpG ODN 2006 on B-lymphocytes for NF-kB
activation
To determine the activation of NF-kB p50 induced by CpG
ODN, purified B cells (1×108 cells/ml) were stimulated with
different concentrations of CpG ODN (0.125, 0.25, 0.5 and 1 µg/
ml) of for 24hrs. Cell lysates were used to quantify NF-kB p50 by
ELISA (Biosource, CA).
To characterize the specific role of cell surface CR2 in the NFkB activation, B cells (1×108 cells/ml) were pre-treated with antiCR2 mAb 171 (10 µg/ml) for 1 hr, transferred to a 12-well plate
followed by the addition of CpG ODN (0.125 µg/ml) and cells
were incubated for 24 hrs. Cell lysates were used to quantify NFkB p50 by ELISA.
To characterize the relative role of TLR9 in NF-kB activation,
a known inhibitor of TLR9 signaling, chloroquine was used.
B cells (1×108 cells/ml) were pre-treated with anti-CR2 mAb
171 (10 µg/ml), chloroquine (10 µg/ml), or anti-CR2 mAb 171
with chloroquine or appropriate controls for 1 hr, transferred
to 12 well tissue culture plates and then CpG ODN 2006 (0.125
µg/ml) was added and cultured for 24 hrs, and then cell lysate
supernatant quantitated for NF-kB p50 by ELISA.
Statistical Analysis
Analyses were performed using two tail Student’s t test.
Volume 2 • Issue 1 • 008
Results
Recombinant proteins preparations and characterization for binding studies
The ligand binding site within the amino-terminal two short
consensus repeats (SCR) of CR2 has previously been reported
for C3d, EBV-gp350, IFN-α, DNA and CD23 [7,12,15,16,22]
respectively. To study these CR2-CpG ODN 2006 and TLR9
interactions in comparison to known protein ligands C3d and
EBV-gp350, we utilized one previously described form of soluble
recombinant CR2 containing SCRs 1-15, which interacts with
C3d and EBV-gp350 [6,15]. In addition, for this current study
we used a newly generated form of soluble recombinant CR2
SCR 1-4 with BCCP, a biotinylation site, at the carboxyterminus
region. The addition of the SCR3-4 domain allowed us to detect
binding of this protein to ligands with the non-ligand-blocking
mAb HB5, which reacts with the SCR3-4 domain. In addition,
the incorporation of a biotinylation site at the carboxy-terminus
allowed us to reproducibly orient the ligand binding domain of
CR2 to a SA chip, as previously described [51]. We utilized the
mammalian cells NSO and HEK 293 cells to express CR2 SCR14-BCCP, and proteins were purified using mAb HB5-Sepharose
affinity column as described earlier [15,16]. The same protein
was used for this study. The ligands C3d were expressed in E.
coli and purified as described earlier [6,21]. EBV-gp350 was also
expressed and purified using an established method [50]. In the
present CR2-ligand interaction studies, CpG ODN 2006 and TLR9
were commercially obtained. The B-class CpG ODN 2006 was
used to induce human primary B-lymphocytes to characterize the
relative role of cell surface CR2 and cell surface TLR9 in human
IL6, human IFN-α and NF-KB p50 in B cell signaling. All the other
reagents prepared as mentioned in the material and methods
section.
Dose-dependent binding of human CR2 SCR 1-15 to
CpG ODN 2006
To study whether CR2 SCR1-15 binds to CpG ODN 2006
we performed by ELISA. Figure 1A demonstrates the results of
binding of CR2 with CpG ODN 2006 or BSA as a control, is first
bound to an ELISA plate. Subsequently, decreasing doses of
CR2 SCR1-15 was added, followed by washing and detection of
bound CR2 by anti-CR2 mAb HB5. These results demonstrate a
remarkable consistency in which highly specific interactions and
dose-dependent interactions are readily detected with CpG ODN
2006 tested.
Previous studies using inhibitory mAbs as well as crosscompetition of ligands have demonstrated that the binding
sites for C3d and EBV-gp350 overlap within the SCR1-2 domain
[49,52]. In the next experiments, we determined whether an antiCR2 mAbs generated to and reactive with the SCR1-2 domain that
we had previously created [49] would inhibit the binding of CpG
ODN 2006 to CR2. As shown in Figure 1B, a very similar pattern of
inhibition was found when comparing the relative ability of mAbs
to block CpG ODN 2006 binding to CR2 as found when comparing
them to C3d and EBV- gp350 as reported previously [15,16,49].
These results suggest that CpG ODN 2006 bind to a closely related
site on CR2 SCR1-2.
www.scientonline.org
J Immunol Infect Inflam Dis
Citation: Rengasamy Asokan, Szakonyi Gerda, Gizinski M. Alison (2017). Cysteine p Guanidine-Oligodeoxynucleotide Upregulates Interleukin-6 in
Human B-Lymphocytes through Complement Receptor-2 (CR2/CD21) and Toll-Like Receptor 9 Signaling
Page 5 of 12
A
CpG ODN 2006
BSA
A 405
1.5
1.0
100
% Inhibition
2.0
0.5
B
75
mAb 171
50
25
0.0
2
1
0.5
0
0.25
CR2 (µg/ml)
0
10
20
30
mAb 171 (µg/ml)
40
50
Figure 1: Dose-dependent binding measured by ELISA of CR2 SCR1-15 to its plate-bound CpG ODN 2006 (A) and competion ELISA measuring relative ability
of anti-CR2 mAb 171 to block full length CR2 SCR1-15 binding to plate bound CpG ODN 2006 (B). Binding was measured using anti-CR2 mAb HB5 that will
bind to CR2 SCR 3-4. Mean ±SD for three experiments is shown.
1.2
A
100
TLR9
1.0
BSA
% Inhibition
75
0.8
A 405
B
0.6
0.4
mAb 171
50
25
0.2
0
0.0
2
1
0.5
CR2 (µg/ml)
0
0.25
1.00
20
30
mAb 171 (µg/ml)
40
50
CR2
CR2+Chloroquine
0.75
A 405
10
C
0.50
0.25
0.00
10
5
2.5
Chloroquine (µg/ml)
1.25
Figure 2: Dose-dependent binding measured by ELISA of CR2 SCR1-15 to its plate-bound TLR9 (A), competition ELISA measuring relative ability of anti-CR2
mAb 171 (B) chloroquine (C) to block full length CR2 SCR1-15 binding to plate bound TLR9. Binding was measured using anti-CR2 mAb HB5 that will bind to
CR2 SCR 3-4. Mean ±SD for three experiments is shown.
Dose-dependent binding of human CR2 SCR 1-15 to
TLR9
To study whether CR2 SCR1-15 binds to TLR9 we performed
by ELISA. Figure 2A demonstrates the results of binding of CR2
with TLR9 or BSA as a control, is first bound to an ELISA plate.
Subsequently, decreasing doses of CR2 SCR1-15 was added,
followed by washing and detection of bound CR2 by anti-CR2
mAb HB5. These results demonstrate a remarkable consistency
in which highly specific interactions and dose-dependent
interactions are readily detected with TLR9 tested.
In the next set of experiments, we determined whether an antiCR2 mAbs generated to and reactive with the SCR1-2 domain that
we had previously created [49] would inhibit the binding of CR2 to
TLR9. As shown in Figure 2B, a very similar pattern of inhibition
Volume 2 • Issue 1 • 008
was found when comparing the relative ability of mAbs to block
TLR9 binding to CR2 as found when comparing them to C3d
and EBV-gp350 as reported previously [15,16,49]. These results
suggest that TLR9 binds to a closely related site on CR2 SCR1-2.
To see the relative role of CR2-TLR9 binding, a known
TLR9 inhibitor, chloroquine was used. Figure 2C, demonstrate
remarkable inhibition. These results clearly suggested that both
anti-CR2 mAb 171 and chloroquine blocks the CR2-TLR9 binding.
Kinetic analysis of the interaction of CR2 SCR1-4 with
CpG ODN 2006 and TLR 9 by SPR
In this study, we have examined the interaction of CR2 with
CpG ODN 2006 and TLR9 by Surface Plasmon Resonance using
a Biacore 3000 using surface-attached CR2 SCR1-4 on SA chip.
In these experiments, carboxyterminal biotin-tagged CR2 SCR1-
www.scientonline.org
J Immunol Infect Inflam Dis
Citation: Rengasamy Asokan, Szakonyi Gerda, Gizinski M. Alison (2017). Cysteine p Guanidine-Oligodeoxynucleotide Upregulates Interleukin-6 in
Human B-Lymphocytes through Complement Receptor-2 (CR2/CD21) and Toll-Like Receptor 9 Signaling
Page 6 of 12
4-BCCP on a SA chip was used and the known ligands human
C3d and EBV-gp350 were included as solution phase analytes to
compare with CpG ODN 2006 and TLR9. Measured and calculated
were the association and dissociation rates as well as the KD for
each of the ligands (Figures 3A-3D, Table 1).
In these experiments, we examined the interaction of
CpG ODN 2006 and TLR9 as a solution phase analyte to the
immobilized CR2 SCR1-4-BCCP on a SA chip. We found that the
binding reaction was dose-dependent but not saturable at the
highest tested concentration of 125 nM. The tested ligands the
CpG ODN 2006 and TLR9 gave the maximal kD of 571 and 42 nM
respectively. These values are comparable to C3d and EBV-gp350,
which demonstrated dose-dependent binding that, was saturable
at the highest tested concentration of 125 nM and with a kD 286
and 392 nM, respectively (Figure 3A-3D, Table 1).
Ligand
Analytea
kd1(1/s/kal(1/Ms)b
KD1c
X2d
CR2
Complement C3d
6.6×10-2/2.3×105
0.286µM
3.1
CR2
EBV-gp350
3.1×10-2/7.9×104
0.392µM
2.8
CR2
CpG ODN 2006
3.1×10-2/5.4×105
0.571µM
6.9
CR2
TLR9
1.1×10-2/2.4×106
0.042µM
10.0
a.Experiments performed at 50m M NaCl(Average values represent from 3
determinations).
b. Ka,on rate;kd,off rate.
c. Equilibrium dissociation constant (kd/ka).
d. Chi -square goodness -of-fit parameter.
Table 1: Kinetic values for the binding of C3d,EBV-gp350,CpG ODN 2006 and
TLR9 to the immobilized biotinylated CR2 SCR 1-4 using surface plasmon
resonance.
(A)
We used BIA evaluation software version 3.1 to evaluate
whether these ligand-receptor pairs exhibited simple 1:1 binding
or whether more than one binding site could be detected. The data
analysis revealed that the binding reaction of the experimental
curve (colored line) does not fit well to a simple 1:1 Langmuir
binding model but rather fits to a two-site binding model (solid
lines). These analyses suggest the presence of one high affinity
binding site and a second much lower (2-3 logs or greater
difference) affinity binding site in the CR2 SCR1-4 domain. For
this interaction, we report only the higher affinity binding site
KD1 values (Table 1). chi2 values are the goodness of fit parameter
describing how precisely the experimental curve fits to the
proposed binding model. The chi2 values range from 2.8 – 10.0
(Table 1) and show that a two-site binding model fits well to the
experimental data.
Dose-dependent binding of human CR2 SCR 1-15 with
TLR9 and Micrococcus luteus DNA
In this experiment to see whether CR2 SCR1-15 binds to plate
bound TLR9 and Micrococcus lutes DNA. Figure 4 demonstrate
dose-dependent binding of CR2 SCR-15 to plate bound TLR9Micrococus luteus DNA or BSA control. These results demonstrate
a remarkable consistency in which highly specific interactions
and dose-dependent interactions are readily detected with CpG
rich Micrococcus lutes DNA tested. Here CpG rich Micrococcus
lutes DNA act as bridging molecule between the plates bound
TLR9 and solution phase CR2.
(B)
Complement C3d
800
720
560
480
125 nM
62.5 nM
30 nM
15 nM
400
320
240
160
Resp. Diff. (RU)
Resp. Diff. (RU)
640
480
240
120
0
0
125 nM
62.5 nM
30 nM
15 nM
360
80
0
EBV-gp350
600
60 120 180 240 300 360 420 480 540 600
0
60 120 180 240 300 360 420 480 540 600
Time (Seconds)
Time (Seconds)
(C)
(D)
ODN 2006
250
TLR9
400
360
320
150
100
125 nM
62.5 nM
30 nM
50
Resp. Diff. (RU)
Resp. Diff. (RU)
200
280
240
200
125 nM
62.5 nM
30 nM
160
120
80
40
0
0
0
50
100
150
200
250
300
350
400
450
0
50
100
150
200
250
300
350
400
450
Time (Seconds)
Time (Seconds)
Figure 3: Surface plasmon resonance sensograms demonstrating the association and dissociation of protein ligands C3d (A) EBV-gp350 (B) CpG ODN 2006
(C) and TLR9 (D) with immobilized biotinylated CR2 SCR1-4 BCCP. Nanomolar concentrations of injected analyte are indicated at the right hand side of each
sensogram. Solid lines are the result of global fitting analysis, and the colored lines are the normalized experimental sensogarm kinetic data.
Volume 2 • Issue 1 • 008
www.scientonline.org
J Immunol Infect Inflam Dis
Citation: Rengasamy Asokan, Szakonyi Gerda, Gizinski M. Alison (2017). Cysteine p Guanidine-Oligodeoxynucleotide Upregulates Interleukin-6 in
Human B-Lymphocytes through Complement Receptor-2 (CR2/CD21) and Toll-Like Receptor 9 Signaling
Page 7 of 12
1.5
Dose-dependent activation of human IL-6 by CpG ODN
2006 from human primary B-lymphocytes and inhibition by anti-CR2 mAb 171 and chloroquine
TLR-9 + Micrococus luteus DNA
BSA
Purified human primary B-lymphocytes were treated with
CpG ODN 2006—TCGTCGTTTTGTCGTTTTGTCGTT and negative
control GpC ODN 2006-5′-TGCTGCTTTTGTGCTTTTGTGCTT--3′.
Figure 5A demonstrate a nice, dose-dependent activation
of human IL-6 was found that was specific to CpG, but as GC
modification or methylation of CpG led to loss of its potent ability
to stimulate human IL-6 secretion.
A 405
1.0
0.5
0.0
2
1
0.5
To characterize the relative role of cell surface CR2 in
human IL6 release, treatment of B-lymphocytes with anti CR2
inhibitory mAb 171 or control antibody, resulted mAb 171 blocks
the release of human IL-6 by 25% indicated that CR2 partially
involved in CpG binding and activation of human IL-6 compared
to control anti-factor B antibody (Figure 5B; p < 0.05.). Treatment
of B-lymphocytes with Chloroquine a known inhibitor of TLR9
signaling showed additive inhibitory effect indicated that CpG
0.25
CR2 (µg/ml)
Figure 4: Dose-dependent binding measured by ELISA of CR2 SCR 1-15
to its plate bound TLR9 and Micrococus luteus DNA. Binding was measured
using anti-CR2 mAb HB5 that will bind to CR2 SCR3-4. Mean ± SD for three
experiments is shown.
250
200
A
140
Human IL-6 (pg/ml)
Human IL-6 (pg/ml)
300
GpC
CpG
150
100
50
0
B
IL-6
120
*
100
80
60
40
20
0
100
C
Human IL-6 (pg/ml)
IL-6
80
*
60
40
20
*
0
Figure 5A: Dose-dependent activation of human primary B-lymphocytes by CpG ODN2006 and control ODN. Human primary B lymphocytes were seeded at 1×106
cells/ml and stimulated different concentration of ODN for 24hrs and supernatant quantitated for human IL-6 ELISA. Mean ± SD of three experiments is shown.
Figure 5B: Anti-CR2 mAb 171 inhibition of human IL-6 upon stimulation with CpG ODN2006 from human primary B-lymphocytes. Mean ± SD of three
experiments is shown. * p<0.05.
Figure 5C: Anti-CR2 mAb 171 and chloroquine inhibition of human IL-6 upon stimulation with CpG ODN2006 from human primary B–lymphocytes. Mean ± SD
of three experiments is shown. Significance relative to the CpG stimulated controls was *p<.0001.
Volume 2 • Issue 1 • 008
www.scientonline.org
J Immunol Infect Inflam Dis
Citation: Rengasamy Asokan, Szakonyi Gerda, Gizinski M. Alison (2017). Cysteine p Guanidine-Oligodeoxynucleotide Upregulates Interleukin-6 in
Human B-Lymphocytes through Complement Receptor-2 (CR2/CD21) and Toll-Like Receptor 9 Signaling
Page 8 of 12
predominantly (79%) binds through cell surface TLR9 in order to
activate the human IL-6 compared to anti-CR2 mAb 171 or other
appropriate controls (Figure 5C; p < 0.0001).
Dose-dependent activation of human IFN-α by CpG
ODN 2006 from human primary B-lymphocytes and
Inhibition by anti-CR2 mAb 171 and chloroquine
Purified
human
primary
B-lymphocytes
were
treated
with
dose-dependent
CpG
ODN
2006-TCGTCGTTTTGTCGTTTTGTCGTT and negative control
GpC
ODN
2006-5′-TGCTGCTTTTGTGCTTTTGTGCTT--3′
concentrations. Resulted a nice, dose-dependent activation of
human IFN-α was found that was specific to CpG (Figure 6A), as
but GC modification or methylation of CpG led to loss of its potent
ability to stimulate human IFN-α secretion (data not shown).
To characterize the relative role of cell surface CR2 in human
IFN-α release, treatment of B cells with anti CR2 inhibitory mAb
171, resulted mAb 171 blocks the release of human IFN-α by
33% indicated that CR2 partially involved in CpG binding and
activation of human IFN-α compared to CpG simulation (Figure
6B; p < 0.05).. Treatment of B-lymphocytes with Chloroquine a
known inhibitor of TLR9 signaling showed additive inhibitory
effect indicated that CpG partially binds (42%) through cell
surface TLR9 in to order activate the human IFN-α, (Figure 6B; p
< 0.0001). compared to anti-CR2 mAb 171 or other appropriate
controls. The inhibition profile reveals that in addition to CR2 and
TLR9 pathway, the CPG ODN 2006 could bind to other receptor
such as DEC-205, a multilectin receptor for CpG mediated cell
signaling.
Dose-dependent activation of human IL-6 by LPS (E.
coli 0111:B4) from human primary B-lymphocytes and
0.20
0.15
0.10
0.05
0.00
Purified human primary B-lymphocytes were treated with
a positive control LPS (0.00625, 0.0125, 0.025 µg/ml final
concentrations) showed a nice dose-dependent activation of
human IL-6, compared to media alone (Figure 7A). In the next
experiment treatment of anti-CR2 mAb 171 did not block the
human IL-6 release indicated that LPS does not activate through
cell surface CR2 (Figure 7B). Further we tested using chloroquine,
to see any additive effect as we have done for the CpG ODN 2006
and resulted predominant inhibition was observed. Results
demonstrate that LPS can act through only TLR4 receptor to
induce human IL-6 release from B cells (Figure 7C; p < 0.0001).
This chloroquine not only blocks the CpG-TLR9 binding but also
LPS-TLR4 binding as evidenced from the data.
Dose and time-dependent activation of NF-kBp50 by
CpG ODN 2006 from human primary B-lymphocytes
and inhibition by anti-CR2 mAb 171 and chloroquine
In this experiment we performed dose-dependent activation
of NF-kB p50 by CpG ODN 2006 by ELISA. Result showed a nice
dose-dependent activation of NF-KB p50 was observed in the
cell lysate supernatant as detected by ELISA analysis, indicating
the appropriate signaling for further release of human IL6
(Figure 8A). To see whether anti-CR2 mAb 171 blocks the NFkB p50 expression demonstrates mAb 171 blocks the NF-kB p50
expression partially (15%) (Figure 8B; p < 0.05).. Furthermore, to
see the relative role of TLR9 in NF-kB p50 activation, chloroquine,
partially blocks as like anti-CR2 mAb 171 (data not shown).
Discussion
In a previous study we have reported that different forms of
DNA binds to CR2/CD21 among which CpG-rich bacterial DNA
A
0.5
IFN- α
Human IFN-α (A450)
Human IFN-α (A450)
0.25
inhibition by anti-CR2 mAb 171 and chloroquine
B
0.4
0.3
IFN- α
*
*
0.2
0.1
0.0
Figure 6A: Dose-dependent activation of human primary B-lymphocytes by CpG ODN2006 and control ODN. Human primary B lymphocytes were seeded at
1×106 cells/ml and stimulated different concentration of ODN for 24hrs and supernatant quantitated for human IFN-α ELISA. Mean ± SD of two experiments
is shown..
Figure 6B: Anti-CR2 mAb 171 and chloroquine inhibition of human IFN-α upon stimulation with CpG ODN2006 from human primary B–lymphocytes. Mean ±
SD of two experiments is shown. Significance relative to the CpG stimulated controls was * p<0.05; *p<.0001.
Volume 2 • Issue 1 • 008
www.scientonline.org
J Immunol Infect Inflam Dis
Citation: Rengasamy Asokan, Szakonyi Gerda, Gizinski M. Alison (2017). Cysteine p Guanidine-Oligodeoxynucleotide Upregulates Interleukin-6 in
Human B-Lymphocytes through Complement Receptor-2 (CR2/CD21) and Toll-Like Receptor 9 Signaling
Page 9 of 12
80
A.
80
Human IL-6 (pg/ml)
Human IL-6 (pg/ml)
IL-6
60
40
20
B
IL-6
60
40
20
0
0
70
C
Human IL-6 (pg/ml)
60
IL-6
50
40
30
20
*
10
0
Figure 7A: Dose-dependent activation of human primary B-lymphocytes by LPS. Human primary B lymphocytes were seeded at 1×106 cells/ml and stimulated
different concentration of LPS for 36hrs and supernatant quantitated for human IL-6 ELISA. Mean ± SD of three experiments is shown.
Figure 7B: Anti-CR2 mAb 171 inhibition of human IL-6 upon stimulation with LPS from human primary B-lymphocytes. Mean ± SD of three experiments is shown.
Figure 7C: Anti-CR2 mAb 171 and chloroquine inhibition of human IL-6 upon stimulation with LPS from human primary B–lymphocytes. Mean ± SD of three
experiments is shown. Significance relative to the CpG stimulated controls was *p<.0001.
0.3
A
0.20
NF-kB p50
B
NF-kB p50
0.2
0.1
0.0
NF-kB p50 (A450)
NF-kB p50 (A450)
*
0.15
0.10
0.05
0.00
Figure 8A: Dose-dependent activation of human primary B-lymphocytes by CpG ODN 2006. Primary B lymphocytes were seeded at 1×108 cells/ml and stimulated
with different concentration of CpG for 24hrs and then cell lysate supernatant quantitated for NF-kB p50 by ELISA. Mean ± SD of two experiments is shown.
Figure 8B: Anti-CR2 mAb 171 inhibition of NF-KB p50 upon stimulation with CpG ODN 2006. Mean ± SD of two experiments is shown. Significance relative to
the CpG stimulated controls was * p < 0.05.
Volume 2 • Issue 1 • 008
www.scientonline.org
J Immunol Infect Inflam Dis
Citation: Rengasamy Asokan, Szakonyi Gerda, Gizinski M. Alison (2017). Cysteine p Guanidine-Oligodeoxynucleotide Upregulates Interleukin-6 in
Human B-Lymphocytes through Complement Receptor-2 (CR2/CD21) and Toll-Like Receptor 9 Signaling
Page 10 of 12
binds at higher affinity [16]. Recently another group has shown
the binding of complement receptor 1 (CR1, CD35) to CpG-DNA by
flowcytometry analysis [53]. CpG DNA acts as immune response
modifier in innate immunity [54]. Bacterial DNA plays a major
role as potential factor in the innate immune system activation
through a continual apoptotic process of host immune cells by
virulent pathogenic attack. In this context, the bacterial cell wall
containing repeating sugar molecules, the lipopolysaccrides
(LPS) or the bacterial-DNA containing unmethylated CpG motif is
the prime structural molecule that can act as an activator of the
immune cells which does not exist in mammalian cells as effective
as in bacteria. In bacteria at least a 20 fold greater frequent
content of CpG motif exist in its structure than in mammaliansDNA. Use of CpG ODN mimics like a bacterial CpG rich DNA. CpG
ODN has been used for the immunotherapeutic purpose to treat
several disease such as anti-cancer, allergy, asthma and infectious
disease [41,42]. These studies were encourage us to think how
bacterial CpG rich DNA/CpG motif/CpG ODN when they interact
with human primary B-lymphocytes cell surface CR2/CD21 in vivo
and what is the consequences in terms of binding stohiometry,
cell signaling, biological functions and disease pathogenesis.
Since bacterial DNA binds to CR2/CD21 at higher affinity
[16], in this study we have utilized a B-class CpG ODN 2006 which
mimics like bacterial DNA binding with CR2 as well as to induce
human primary B-lymphocytes for the up regulation of NF-kB
p50, human IL6 and human IFN-α. Recently [55] reported that
using CpG ODN 2006, 1982, 2395, 2216, and 2243 to induce
to release human IL6 and human IFN-α from human primary
B-lymphocytes. Among which CpG ODN 2006 and 2395 gave
maximal release of human IL6. In this study we utilized CpG ODN
2006 to characterize the relative role of cell surface CR2/CD21 in
NF-kB p50, human IL6 and human IFN-α in B cell signaling.
Human IL6 was over expressed in SLE patients [56]. We
characterize the relative role of cell surface CR2 in human IL6 up
regulation in the pathogenesis of SLE. We found that CR2 binds
to plate bound CpG ODN 2006 and TLR9 dose-dependently by
ELISA. In a surface Plasmon resonance analysis CR2 bind to CpG
ODN 2006 and TLR9 dose-dependently and gave a maximal KD
of 571nM and 42 nM respectively. These binding was blocked
by anti-CR2 inhibitory mAb171 indicated that CpG ODN 2006
and TLR9 binds at first two SCR as like the well-known ligands
binding tested before for C3d and EBV-gp350 proteins [15,16,49]
and chloroquine blocking TLR9. Similar study has been reported
by [57] that both mouse and human DEC-205 a multilectin cell
surface receptor binds to CpG ODN by ELISA and SPR. In the
current study, interestingly, a dose-dependent binding of CR2
SCR1-5 was observed to the plate-bound TLR9 and CpG rich
Micrococcus lutes DNA, suggesting that CpG rich Micrococcus lutes
DNA, act as bridging molecules between TLR9 and CR2. CpG-CR2
binding might play a potential role in therapeutic importance.
In in vivo a tiny amount of a molecule/trigger is substantial in
activating the cell signaling leading to biological function and
disease pathogenesis.
Since CR2-CpG ODN 2006 binding was substantial by ELISA
and SPR analysis further we used this CpG ODN 2006 to induce
human primary B-lymphocytes dose-dependently to induce
human IL6 release, resulted nice dose-dependent activation.
GC modification or methylation leads to loss of it potent ability
to stimulate the human IL6 release. Subsequently an anti-CR2
Volume 2 • Issue 1 • 008
inhibitory mAb 171 blocks this release by 25% indicating that
CR2 is partially involved in activation of human IL6 as reported
earlier for EBV-gp350 protein activation of human IL6 is through
CR2/CD21 receptor dependent fashion from human primary B
cells [31].
Subsequently, to characterize the relative role of TLR9 in
CpG ODN 2006 binding and subsequent activation, chloroquine,
a known inhibitor of TLR9 was utilized revealed chloroquine
block the 79% of human IL-6 release confirming that CpG ODN
2006 can bind through cell surface TLR9 predominantly to
induce human IL-6 release. CpG DNA signaling was more special
and complex. A previous report suggested that inhibitors of
endosomal maturation like chloroquine were able to block CpG
DNA signaling [58]. Another study suggested that CpG signaling
is a two-step process, 1) first CpG-DNA hast to be taken up via
a receptor mediated process (cell surface/cellular receptors).
This step is independent of the presence of CpG motifs yet can be
modified by backbone modifications and other sequence motifs.
2) Subsequently endosomes undergo maturation and then CpG
motif recognition takes place via TLR9 which is delivered to
the late endosome for the ER as assed by experiments using
fluorescent fusion protein [59]. In this current study in addition
to cellular TLR9, a cell surface TLR9 receptor is exists. This
presence was stained with FITC-labelled-anti-TLR9 antibody by
flowcytometry analysis (data not shown) and a cell surface CR2
can play coordinated role in taken up of the CpG DNA by these
receptor in order to activate other cellular signaling events
including NF-kB p50, human IL-6 and human IFN-α. It has been
reported that the presence of cell surface TLR9 in human hepato
cellular carcinoma cells [60] which is consistent that presence of
cell surface TLR9 from B-lymphocytes which is consistent with
the current study that the possibility of CpG ODN predominantly
binds with B cell surface TLR9 to activate the NF-kB p50, human
IL6 and human IFN-α.
Role of CpG ODN 2006 in human IFN-α release showed a nice
dose-dependency from human primary B-lymphocytes. Inhibition
with anti-CR2 mAb 171 and chloroquine resulted, which is
not completely blocks the IFN-α release indicated that the cell
surface CR2 (33%) and TLR9 (42%) receptors plays partial role.
In addition CpG ODN 2006 could activate other receptors such
as a mutilectin dendritic cells and B-cell surface receptor DEC205 as reported by others [57] for impairment of this receptor
resulted unable to make IL12 in mice. But we do not know about
the additive human IFN-α release observed in this study after
blocking these two potential pathways, possibly which may be a
DEC-205 B-cell surface receptor dependent process.
By contrast, a positive control, LPS from E. coli 0111:B4
induce the dose-dependent human IL-6 release as reported by
other study [61] but anti-CR2 inhibitory mAb 171 did not block
this release as like it does for CpG ODN 2006, indicating that LPS
can bind only through cell surface TLR4 receptor to mediate the
cell signaling. Chloroquine, a known inhibitor of TLR9 signaling
blocks the LPS induced TLR4 signaling of human IL-6 release as
reported for other study that chloroquine protects mice from
challenge with CpG ODN and LPS by decreasing pro-inflammatory
cytokine release [62].
Furthermore, NF-kB p50 up regulation was analyzed by ELISA
and western blots analysis. Resulted a nice dose-dependent
www.scientonline.org
J Immunol Infect Inflam Dis
Citation: Rengasamy Asokan, Szakonyi Gerda, Gizinski M. Alison (2017). Cysteine p Guanidine-Oligodeoxynucleotide Upregulates Interleukin-6 in
Human B-Lymphocytes through Complement Receptor-2 (CR2/CD21) and Toll-Like Receptor 9 Signaling
Page 11 of 12
activation was observed by ELISA. This activation was inhibited
by anti-CR2 mAb 171 to 15% and chloroquine partially (data not
shown). These results clearly demonstrate that CpG-motif/CpG
rich DNA/CpG ODN can bind through cell surface CR2 and cell
surface TLR9 to activate NF-kB p50 cell signaling. The interaction
of CpG DNA and TLR9 holds many promises for the therapeutic
intervention such as vaccination, anti-tumor immunity, asthma
and certain infectious disease [47]. Similarly the potential
interaction of cell surface CR2 to CpG-motif/bacterial CpG
rich DNA/CpG ODN promises many functional significant and
possible roles in therapeutic applications in CR2 mediated
disease pathogenesis.
Finally, the present study clearly demonstrated that CR2 could
play a partial role in CpG-motif/bacterial CpG rich DNA/CpG
ODN mediated immune response in vivo. The B class CpG ODN
used in this study can mimics like bacterial CpG rich DNA might
be optimal system in the immune therapy to treat inflammatory
cytokines in SLE pathogenesis. In addition to that CR2 could play
a direct role in clearing the native endogenous as well as invaded
disease causing pathogenic CpG rich bacterial DNA in vivo as
innate immune response against the threat of pathogenic attack.
Conclusion
CR2/CD21 partially plays a role in responding to CpG-motif/
bacterial CpG rich DNA/CpG ODN. The TLR9 predominantly plays
a role in responding to CpG binding. Thus the current study clearly
revealed that the cell surface CR2 and cell surface TLR9 play an
overlapping cell signaling mechanism from primary B-lymphocytes
in order to stimulate human IL6, human IFN-α and NF-kBp50. The
specific use of CpG ODN may be a potent therapeutic drug to treat
SLE by controlling the over expression of human IL6 gene and
other inflammatory cytokines in SLE pathogenesis.
Acknowledgements
This work was supported by the NIH R0-1 AI31105 to V.
Michael Holers and Lupus Research Institute to V. Michael
Holers and R.A. We thank Dr. John D. Lambris (Department of
Pathology and Laboratory Medicine, University of Pennsylvania,
Philadelphia, PA) for providing BirA expressing clone. Dr. Paul J.
Cachia (Manager Biophysisc Core Facility, UCD) for suggestions
during initial BIAcore data analysis; Dr. Joshua M. Thurman
(Division of Nephrology and Hypertension, UCD) for providing
anti-factor B mAb. CR2 and EBV-gp350 baculoviral clones were
grown in the tissue culture core of the University of Colorado
Denver cancer center facility.
Conflict of Interest
The authors have no financial conflict of interest.
References
5. Iida K, Nadler L, Nussenzweig V. Identification of the membrane receptor for
the complement fragment C3d by means of a monoclonal antibody. J Exp
Med. 1983;158(4):1021-1033.
6. Guthridge JM, Rakstang JK, Young KA, et al. Structural studies in solution
of the recombinant N-terminal pair of short consensus/complement repeat
domains of complement receptor type 2 (CR2/CD21) and interactions with its
ligand C3dg. Biochemistry. 2001;40(20):5931-5941.
7. Hannan JP, Young KA, Guthridge JM. Mutational analysis of the complement
receptor type 2 (CR2/CD21)-C3d interaction reveals a putative charged
SCR1 binding site for C3d. J Mol Biol . 2005;346(3):845-858.
8. Kovacs JM, Hannan JP, Eisenmesser EZ, Holers VM. Mapping of the
C3d ligand binding site on complement receptor 2 (CR2/CD21) using
nuclear magnetic resonance and chemical shift analysis. J Biol Chem.
2009;284(14):9513-9520.
9. Kovacs JM, Hannan JP, Eisenmesser EZ, Holers VM. Biophysical
investigations of complement receptor 2 (CD21 and CR2)-ligand interactions
reveal amino acid contacts unique to each receptor-ligand pair. J Biol Chem.
2010;285(35):27251-27258.
10.Fingeroth JD, Weis JJ, Tedder TF, Strominger JL, Biro PA, Fearon DT.
Epstein-Barr virus receptor of human B lymphocytes is the C3d receptor CR2.
Proc Natl Acad Sci U S A. 1984;81(14):4510-4514.
11.Szakonyi G, Klein MG, Hannan JP. Structure of the Epstein-Barr virus major
envelope glycoprotein. Nature Structural & Molecular Biology. 2006;13:9961001.
12.Young KA, Chen XS, Holers VM, Hannan JP. Isolating the Epstein-Barr virus
gp350/220 binding site on complement receptor type 2 (CR2/CD21). J Biol
Chem. 2007;282(50):36614-36625.
13.Young KA, Herbert AP, Barlow PN, Holers VM, Hannan JP. Molecular basis
of the interaction between complement receptor type 2 (CR2/CD21) and
Epstein-Barr virus glycoprotein gp350. J Virol . 2008;82(22):11217-11227.
14.Aubry JP, Pochon S, Gauchat JF, et al. CD23 interacts with a new functional
extracytoplasmic domain involving N-linked oligosaccharides on CD21. J
Immunol. 1994;152(12):5806-5813.
15.Asokan R, Hua J, Young KA, Gould HJ, et al. Characterization of human
complement receptor type 2 (CR2/CD21) as a receptor for IFN-alpha: a
potential role in systemic lupus erythematosus. J Immunol. 2006;177(1):383394.
16.Asokan R, Banda NK, Szakonyi G, Chen XS, Holer VM. Human complement
receptor 2 (CR2/CD21) as a receptor for DNA: implications for its roles in the
immune response and the pathogenesis of systemic lupus erythematosus
(SLE). Mol Immunol . 2013;53(1-2):99-110.
17.Fujisaku A, Harley JB, Frank MB, Gruner BA , Frazier B, Holers VM. Genomic
organization and polymorphisms of the human C3d/Epstein-Barr virus
receptor. J Biol Chem. 1989;264(4):2118-2125.
18.Weis JJ, Toothake LE, Smith JA, Weis JH, Fearon DH. Structure of the
human B lymphocyte receptor for C3d and the Epstein-Barr virus and
relatedness to other members of the family of C3/C4 binding proteins. J Exp
Med. 1988;167(3): 1047-1066.
19.Weis JJ, Tedder TF, Fearon DT. Identification of a 145,000 Mr membrane
protein as the C3d receptor (CR2) of human B lymphocytes. Proc Natl Acad
Sci U S A. 1984;81(3):881-885.
20.Nemerow GR, Wolfert R, McNaughton ME, Cooper NR. Identification and
characterization of the Epstein-Barr virus receptor on human B lymphocytes
and its relationship to the C3d complement receptor (CR2). J Virol.
1985;55(2):347-351.
1. Ahearn JM, Fearon DT. Structure and function of the complement receptors,
CR1 (CD35) and CR2 (CD21). Advances in Immunology. 46:183-219.
21.Szakonyi G, Guthridge JM, D Li, Young K, Holers VM, Chen XS. Structure
of complement receptor 2 in complex with its C3d ligand. Science.
2001;292(5522):1725-1728.
2. Holers VM. Complement. In Principals and Practices of Clinical Immunology.
R. Rich, ed. Mosby, St. Louis: 21. 21-21.28.
22.Aubry JP, Pochon S, Graber P, Jansen KU, Bonnefoy JY. CD21 is a ligand for
CD23 and regulates IgE production. Nature. 1992;358(6386):505-507.
3. Prodeus AP, Goerg S, Shen LM, et al. A critical role for complement in
maintenance of self-tolerance. Immunity. 1998;9(5):721-731.
23.Carter RH, Fearon DT. CD19:lowering the threshold for antigen receptor
stimulation of B lymphocytes. Science. 256(5053):105-107.
4. Wu X, Jiang N, Deppong CJ, et al. A role for the Cr2 gene in modifying
autoantibody production in systemic lupus erythematosus. J Immunol.
2002;169(3):1587-1592.
24.Carter RH, Spycher MO, Hoffman R, Fearon DT. Synergistic interaction
between complement receptor type 2 and membrane IgM on B lymphocytes.
J Immunol. 1988;141(2):457-463.
Volume 2 • Issue 1 • 008
www.scientonline.org
J Immunol Infect Inflam Dis
Citation: Rengasamy Asokan, Szakonyi Gerda, Gizinski M. Alison (2017). Cysteine p Guanidine-Oligodeoxynucleotide Upregulates Interleukin-6 in
Human B-Lymphocytes through Complement Receptor-2 (CR2/CD21) and Toll-Like Receptor 9 Signaling
Page 12 of 12
25.Dempsey PW, Allison ME, Akkaraju S, Goodnow CC, Fearon DT. C3d of
complement as a molecular adjuvant: bridging innate and acquired immunity.
Science. 1996;271(5247):348-350.
26.Henson SE, Smith D, Boackle SA, Holers VM, D. R. Karp. Generation of
recombinant human C3dg tetramers for the analysis of CD21 binding and
function. J Immunol Methods. 2001;258(1-2):97-109.
27.Nichols C, Guthridge JM, Karp DR, Molina H, Fletcher DR, Holers VM.
Gamma-glutamyl transpeptidase, an ecto-enzyme regulator of intracellular
redox potential, is a component of TM4 signal transduction complexes. Eur J
Immunol. 1998;28(12):4123-4129.
transgenic mice. Exp Biol Med (Maywood). 2014;239(6):715-723.
44.Patole PS, Zecher D, Pawar RD, HJ Grone, Schlondorff D, Anders HJ. G-rich
DNA suppresses systemic lupus. J Am Soc Nephrol. 2005;16(11):3273-3280.
45.Rommler F, Hammel M, Waldhuber A, et al. Guanine-modified inhibitory
oligonucleotides efficiently impair TLR7- and TLR9-mediated immune
responses of human immune cells. Plos One .2015;10(2).
46.Means TK, Latz E, Hayashi F, Murali MR, Golenbock DT, Luster. Human
lupus autoantibody-DNA complexes activate DCs through cooperation of
CD32 and TLR9. J Clin Invest. 2005;115(2):407-417.
28.Tedder TF, Zhou LJ, Engel P. The CD19/CD21 signal transduction complex of
B lymphocytes. Immunol Today. 1994;15(9):437-442.
47.Klinman DM. Immunotherapeutic uses of CpG oligodeoxynucleotides. Nat
Rev Immunol. 2004;4(4):249-258.
29.Bradbury LE, Kansas GS, Levy S, Evans RL, Tedder TF. The CD19/
CD21 signal transducing complex of human B lymphocytes includes the
target of antiproliferative antibody-1 and Leu-13 molecules. J Immunol.
1992;149(9):2841-2850.
48.Chen J, Tian, Mei Z, et al. The effect of the TLR9 ligand CpGoligodeoxynucleotide on the protective immune response to radiationinduced lung fibrosis in mice. Mol Immunol. 2016;80:33-40.
30.Sugano N, Chen W, Roberts ML, Cooper NR. Epstein-Barr virus binding to
CD21 activates the initial viral promoter via NF-kappaB induction. J Exp Med
1997;186(5):731-737.
31.D’Addario M, Libermann TA, Xu J, Ahmad A, Menezes J. Epstein-Barr Virus
and its glycoprotein-350 upregulate IL-6 in human B-lymphocytes via CD21,
involving activation of NF-kappaB and different signaling pathways. J Mol
Biol. 2001;308(3):501-514.
32.Melamed I, Stein L, Roifman CM. Epstein-Barr virus induces actin
polymerization in human B cells. J Immunol . 1994;153(5):1998-2003.
33.Kurtz CB, O’Toole E, Christensen SM, Weis JH. The murine complement
receptor gene family. IV. Alternative splicing of Cr2 gene transcripts predicts
two distinct gene products that share homologous domains with both human
CR2 and CR1. J Immunol. 1990;144(9):3581-3591.
34.Molina H, Kinoshita T, Inoue K, Carel JC, Holers VM. A molecular and
immunochemical characterization of mouse CR2. Evidence for a single gene
model of mouse complement receptors 1 and 2. J Immunol. 1990;145(9):29742983.
49.Guthridge JM, Young K Gipson MG, et al. Epitope mapping using the
X-ray crystallographic structure of complement receptor type 2 (CR2)/
CD21: identification of a highly inhibitory monoclonal antibody that directly
recognizes the CR2-C3d interface. J Immunol . 167(10):5758-5766.
50.Hedrick JA, Lao Z, Lipps SG, et al . Characterization of a 70-kDa, EBV
gp350/220-binding protein on HSB-2 T cells. J Immunol. 1994;153(10):44184426.
51.Sarrias MR, Franchini S, Canziani G, et al. Kinetic analysis of the interactions
of complement receptor 2 (CR2, CD21) with its ligands C3d, iC3b, and the
EBV glycoprotein gp350/220. J Immunol. 2001.167(3):1490-1499.
52.Martin DR, Yuryev A, Kalli KR, Fearon DT, Ahearn JM. Determination of
the structural basis for selective binding of Epstein-Barr virus to human
complement receptor type 2. J Exp Med. 1991;174(6):1299-1311.
53.Lepse N, Van Bommel MR, Daha CG, Kallenberg, Heeringa P. Complement
receptor 1 (CR1, CD35) binds CpG-DNA. Molecular Immunology.
2011;48:1666-1733.
54.Dalpke AH, Heeg K. CpG-DNA as immune response modifier. Int J Med
Microbiol. 2004;294(5):345-354.
35.Ahearn JM, Fischer MB, Croix D, et al. Disruption of the Cr2 locus results in
a reduction in B-1a cells and in an impaired B cell response to T-dependent
antigen. 1996;4(3):251-262.
55.VollmerJ, Weeratna R, Payette P, et al. Characterization of three CpG
oligodeoxynucleotide classes with distinct immunostimulatory activities. Eur
J Immunol. 34(1):251-262.
36.Chen Z, Koralov SB, Gendelman M, Carroll MC, Kelsoe G. Humoral immune
responses in Cr2-/- mice: enhanced affinity maturation but impaired antibody
persistence. J Immunol. 2000;164(9):4522-4532.
56.Clark DN, Markham, Sloan CS, Poole BD.Cytokine inhibition as a strategy for
treating systemic lupus erythematosus. Clin Immunol. 2013;148(3):335-343.
37.Boackle SA , HolersVM , Chen X, Szakonyi G, Karp DR, Wakeland EK, Morel
L. 2001. Cr2, a candidate gene in the murine Sle1c lupus susceptibility locus,
encodes a dysfunctional protein. Immunity. 2001;15(5):775-785.
38.Krieg A M. CpG motifs in bacterial DNA and their immune effects. Annual
Review of Immunology .2002;20(1):709-760.
39.Pasare C, Medzhitov R. Toll-like receptors and acquired immunity. Semin
Immunol. 2004;16(1):23-26.
40.Krieg AM. CpG DNA: a pathogenic factor in systemic lupus erythematosus?
Journal of Clinical Immunology. 1995;15(6):284-292.
41.Klinman D. Does activation of the innate immune system contribute to the
development of rheumatoid arthritis?. Arthritis Rheum. 2003;48(3):590-593.
42.Krieg AM. 2006. Therapeutic potential of Toll-like receptor 9 activation. Nature
Reviews Drug Discovery. 2006;5:471-484.
43.Lee TP, Huang JC, Liu CJ, et al. Interactions of surface-expressed TLR-4
and endosomal TLR-9 accelerate lupus progression in anti-dsDNA antibody
57.Lahoud MH, Ahmet F, Zhang JG, et al. DEC-205 is a cell surface receptor for
CpG oligonucleotides. Proc Natl Acad Sci U S A. 2012;109(40):16270-16275.
58.Hacker H, Mischak H, Miethke T, et al. CpG-DNA-specific activation of antigenpresenting cells requires stress kinase activity and is preceded by non-specific
endocytosis and endosomal maturation. EMBO J. 1998;17(21):6230-6240.
59.Latz E, Visintin A, Espevik T, Golenbock DT. Mechanisms of TLR9 activation.
Journal of Endotoxin Research. 2004;10(6):406-412.
60.Tanaka J, Sugimoto K, Shiraki K, et al. Functional cell surface expression
of toll-like receptor 9 promotes cell proliferation and survival in human
hepatocellular carcinomas. Int J Oncol. 2010;37(4):805-814.
61.Hobbs MV, McEvilly RJ, Koch RJ, Cardenas GJ, Noonan DJ. Interleukin-6
production by murine B cells and B cell lines. Cell Immunol. 1991;132(2):442450.
62.Hong Z, Jiang Z, Liangxi W, et al. Chloroquine protects mice from challenge
with CpG ODN and LPS by decreasing proinflammatory cytokine release. Int
Immunopharmacol .2004;4(2):223-234.
Copyright: © 2017 Rengasamy Asokan, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Volume 2 • Issue 1 • 008
www.scientonline.org
J Immunol Infect Inflam Dis