Am J Physiol Gastrointest Liver Physiol 288: G1179 –G1189, 2005. First published December 9, 2004; doi:10.1152/ajpgi.00411.2004. Hepatic triglyceride contents are genetically determined in mice: results of a strain survey Xiaobo Lin, Pin Yue, Zhouji Chen, and Gustav Schonfeld Department of Medicine, Washington University School of Medicine, St. Louis, Missouri Submitted 13 September 2004; accepted in final form 7 December 2004 fatty liver; genetics of hepatic steatosis; lipogenesis; fatty acid oxidation; very low-density lipoprotein NONALCOHOLIC FATTY LIVER DISEASE (NAFLD) is highly prevalent (9, 20). Although it resembles alcoholic fatty liver histopathologically, NAFLD, by definition, develops in the absence of alcohol abuse (9). The majority of patients with NAFLD are affected with various aspects of the metabolic syndrome, i.e., obesity, hypertension, insulin resistance, Type 2 diabetes mellitus, and hyperlipidemia (4). In the setting of insulin resistance, hepatic lipogenesis may be stimulated sufficiently to overcome the adaptive capacities of the liver to secrete more VLDL and result in the accumulation of triglycerides (TG) in the liver (33). On the other hand, insulin resistance may be the consequence of chronic lipid accumulation in insulin-sensitive tissues. For example, muscle- and liver-specific overexpression of lipoprotein lipase causes TG accumulation in muscle and liver as well as impairment of insulin signaling and action in the respective tissues (17). A Address for reprint requests and other correspondence: G. Schonfeld, 660 S. Euclid, Campus Box 8046, St. Louis, MO 63110 (E-mail: [email protected]). http://www.ajpgi.org strong relationship between fatty liver and insulin resistance also is established in patients (26, 27). NAFLD poses a major health problem because it may lead to steatohepatitis, cirrhosis, and liver failure. The pathophysiological mechanisms by which steatosis may progress to steatohepatitis, fibrosis, and cirrhosis remain unclear, but steatosis appears to be an essential precursor (10). Thus controlling hepatic TG levels may be important in reducing the risk of developing chronic liver disease. Fatty liver is due to an imbalance between the availability of hepatic TG for export and the disposal system of the liver (1, 20, 36). Both genetic and environmental factors are likely to be important. The major sources of hepatic fatty acids (FA) for TG assembly are those synthesized de novo in the liver and free FAs (FFA) derived from plasma. Genes involved in de novo lipogenesis are controlled by sterol regulatory elementbinding protein (SREBP)-1c (40), a mediator of both nutritional stimulus and insulin action in hepatic lipogenesis (16). Mice overexpressing SREBP-1a develop severe fatty liver due to overproduction of cholesterol and FAs (32). Elevated levels of FFA in plasma, such as those in fasting, increase delivery of FFA to the liver, which may cause excessive hepatic TG accumulation despite an accompanying increased FA oxidation (15). The major disposal routes for hepatic FAs and TG are composed of the export of hepatic TG via VLDL (39) and the oxidation of component FAs in mitochondria, peroxisomes, and microsomes (41). Here too, both genetic and environmental factors are important. For example, the impaired capacity for FA -oxidation on fasting in peroxisome proliferatoragonist receptor (PPAR)-␣ null mice results in the accumulation of hepatic TG (18). A defective VLDL transport system that impairs hepatic lipid-exporting capacity also may result in fatty liver. This is seen in abetalipoproteinemia, caused by mutations in microsomal triglyceride transfer protein that is essential in the assembly of chylomicrons and VLDL particles (37), and in familial hypobetalipoproteinemia due to truncation-specifying mutations in apolipoprotein (apo)B, the indispensable structural protein in the formation and secretion of VLDL (6, 31, 35). Thus the major genes for developing fatty liver, identified to date, are selected genes in the FA synthetic and oxidative pathways and in the VLDL export system. However, modifier genes (22, 23) as yet not identified may be contributing to the development of steatosis. This is suggested by the finding that engineered apoB gene mutation-bearing mice (e.g., apoB⫹/38.9 and apoB⫹/27.6 heterozygotes) produced on mixed C57BL/ The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 0193-1857/05 $8.00 Copyright © 2005 the American Physiological Society G1179 Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 18, 2017 Lin, Xiaobo, Pin Yue, Zhouji Chen, and Gustav Schonfeld. Hepatic triglyceride contents are genetically determined in mice: results of a strain survey. Am J Physiol Gastrointest Liver Physiol 288: G1179 –G1189, 2005. First published December 9, 2004; doi:10.1152/ajpgi.00411.2004.—To assess whether genetic factor(s) determine liver triglyceride (TG) levels, a 10-mouse strain survey of liver TG contents was performed. Hepatic TG contents were highest in BALB/cByJ, medium in C57BL/6J, and lowest in SWR/J in both genders. Ninety and seventy-six percent of variance in hepatic TG in males and females, respectively, was due to strain (genetic) effects. To understand the physiological/biochemical basis for differences in hepatic TG among the three strains, studies were performed in males of the BALB/cByJ, C57BL/6J, and SWR/J strains. In vivo hepatic fatty acid (FA) synthesis rates and hepatic TG secretion rates ranked BALB/cByJ ⬇ C57BL/6J ⬎ SWR/J. Hepatic 1-14C-labeled palmitate oxidation rates and plasma -hydroxybutyrate concentrations ranked in reverse order: SWR/J ⬎ BALB/cByJ ⬇ C57BL/6J. After 14 h of fasting, plasma-free FA and hepatic TG contents rose most in BALB/ cByJ and least in SWR/J. -Hydroxybutyrate concentrations rose least in BALB/cByJ and most in SWR/J. Adaptation to fasting was most effective in SWR/J and least in BALB/cByJ, perhaps because BALB/ cByJ are known to be deficient in SCAD, a short-chain FA oxidizing enzyme. To assess the role of insulin action, glucose tolerance test (GTT) was performed. GTT-glucose levels ranked C57BL/6J ⬎ BALB/cByJ ⬇ SWR/J. Thus strain-dependent (genetic) factors play a major role in setting hepatic TG levels in mice. Processes such as FA production and hepatic export in VLDL on the one hand and FA oxidation on the other, explain some of the strain-related differences in hepatic TG contents. Additional factor(s) in the development of fatty liver in BALB/cByJ remain to be demonstrated. G1180 GENETICS OF LIVER TRIGLYCERIDE LEVEL IN MICE MATERIALS AND METHODS Mice and Diet Ten inbred strains of mice (6 wk old), AKR/J (AKR), BALB/c, C3H/HeJ (C3H), C57BL, C57BL/6ByJ (C57BLBY), DBA/1LacJ (DBA), 129/SVJ, NZB/B1NJ (NZB), PL/J (PL), and SWR, of both genders were purchased from Jackson Laboratory (Bar Harbor, ME). AKR males were not studied because only AKR females were available from the supplier. Mice were housed in a room maintained at 24°C with a 12:12-h light-dark cycle (6:00 AM to 6:00 PM). All mice were given Purina mouse chow 5053 containing 4.5% fat, 20.0% protein, and 54.8% carbohydrate (LabDiet). Food was removed in the beginning of the light cycle, and mice were fasted for 4 – 6 h, except in the fasting experiment where times are indicated. Mice were 11–12 wk of age when killed. All animal procedures were performed in accordance with guidelines of Washington University’s Animal Studies Committee and approved by the IACUC of Washington University. Analytical Procedures Body fat (%) was assessed on anesthetized living mice by dualenergy X-ray absorptiometry with the use of a small animal densitometer (Lunar) (3). Plasma samples were assayed for triglycerides, total cholesterol, and free cholesterol as described (7, 19). Lipids were extracted from liver and assayed for TG (7). Hepatic TG levels were somehow lower in the three strains compared with their counterparts during the survey carried out at 4 – 6 h of fasting, probably due to the use of a different TG analysis kit from a supplier, which systematically did yield lower hepatic TG levels when used on the surveyed livers (data not shown). The same kit was used for all of the fasting experiment. Cellular protein contents were determined as described (7). Hepatic TG contents were expressed as milligrams of lipid per gram of protein. Plasma FFA were analyzed by an enzymatic method (Wako). Blood glucose was determined using a B-glucose analyzer (Hemocue, Ängelholm, Sweden). The Core Laboratory of the General Clinical Research Center at Washington University analyzed plasma -hydroxybutyrate (BHB) concentration. Mice were weighed and killed. Blood was obtained from the inferior vena cava. Livers were excised, washed in cold PBS, weighed, cut into pieces that were then frozen in liquid nitrogen, and stored at ⫺80°C until further analysis. Glucose Tolerance Tests After mice were fasted for 5 h, mice received an intraperitoneal injection of 10% D-glucose (0.75 g/kg body wt) for glucose tolerance. Blood (⬃10 l) was drawn from the tail vein at 0, 30, 60, and 120 min and assayed for glucose. In Vivo Measurement of FA Synthesis Mice were injected with [1-14C]acetate (0.25 Ci/ml) at 25 Ci/30 g body wt and killed after 1.0 h. Liver (300 mg) was excised and digested in potassium hydroxide. After extraction of the nonsaponifiable lipids with petroleum ether, the sample solution containing the saponified lipids was acidified with sulfuric acid and FAs were extracted with petroleum ether as described (11). The radioactivity in total FAs was determined by scintillation counting. The FA synthesis rates are reported as disintegrations per hour per milligram of liver. Determination of In Vivo Hepatic TG Secretion Rates Hepatic production of VLDL-TG was measured after injection (intravenous) of Triton WR1339 (500 mg/kg body wt) on mice fasted for 4 h (7). Tail vein blood samples were taken at the specified times after injection for TG measurement and measured as described above. Determination of FA Oxidation in Primary Cultures of Hepatocytes Primary mouse hepatocytes were isolated as described (7). Cells (1.0 ⫻ 106) were cultured in a flask for 2 h in 4 ml DMEM containing 10% FBS, and medium was then changed to DMEM containing 5% FBS. After an overnight culture, cells were washed three times with PBS. To determine FA oxidation, 14C-labeled palmitate (0.25 Ci/ml) was added to the medium. At the end of 2-h incubation, a portion of the cell medium (250 l) was removed to determine acid-soluble products (ASP) as described (13). A septum and center well were then fitted into the flask. Sodium hydroxide (2 N, 0.25 ml) was injected onto the filter paper placed in the center well to capture CO2. Hydrochloric acid (6 N, 2 ml) was injected into the medium to release 14 CO2. Both ASP and 14CO2 were counted. Two separate flasks treated in the same way without the 14C-labeled palmitate were used for assay of cellular protein. Total FA oxidation activity was obtained by adding the counts of 14CO2 and ASP and expressed as DPM per hour per microgram of cellular protein. Short-chain Acyl-CoA Dehydrogenase Mutation Assay A PCR assay was used to distinguish between the wild-type and mutant alleles for the structural gene of short-chain acyl-CoA dehydrogenase (SCAD), which employs oligonucleotide primers that flank a 278-bp deletion in the mutant allele to produce PCR products of 870 and 592 bp for the wild-type and mutant alleles for SCAD, respectively (38). Responses of Liver TG Levels to Fasting To determine whether there was a differential susceptibility of the fasting raising effect on liver TG levels, male mice of BALB/c, C57BL, and SWR were killed at 0, 6, and 14 h of fasting. Liver TG contents, plasma FFA, and BHB concentrations were determined as described in Analytical Procedures. A separate kit (Thermo Electron, Melbourne, Australia) was used to determine hepatic TG levels, because Wako discontinued its TG kit used in this study. The latter kit, although yielding precise results, deviated systematically downward from the Wako kit, yielding somewhat lower values for the fasting study (see RESULTS). mRNA Expression Profiling Dual-channel microarray analysis was performed on total liver RNA pooled from each strain (male, n ⫽ 5 for each strain). Extracted RNA was further purified using RNeasy spin columns (Qiagen, AJP-Gastrointest Liver Physiol • VOL 288 • JUNE 2005 • www.ajpgi.org Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 18, 2017 6JX129/SVJ genetic backgrounds manifest significantly elevated hepatic TG on average, but interindividual variation is high (7, 8, 31), probably reflecting the heterogeneity of the genetic backgrounds. Indeed, although groups of these mice on average contain 50% C57BL/6J and 50% 129/SVJ genes, the genetic complements of individual animals may deviate materially from the 50/50 mean (P. Yue, X. Lin, and G. Schonfeld, unpublished observation). Interindividual variation of hepatic TG levels should be significantly smaller in congenic strains bearing apoB truncation-producing mutations than in the apoB mutation-bearing mice of 50/50% C57BL/6J and 129/SVJ mixed background. To identify potentially useful parental strains for the production of congenic mice, we performed a mouse-strain survey of liver TG levels in 10 inbred strains, the results of which form the bulk of this presentation. Significant strain-related differences in hepatic TG contents were found. To ascertain which physiological, biochemical processes may play roles in determining the differences in liver TG contents among the selected strains, experiments, including hepatic mRNA expression profiling, were performed in the strains with the highest [BALB/cByJ (BALB/c)], middle [C57BL/6J (C57BL)], and lowest [SWR/J (SWR)] hepatic TG contents. GENETICS OF LIVER TRIGLYCERIDE LEVEL IN MICE G1181 Valencia, CA) following the manufacturer’s protocol. Purified RNA was quantitated by ultraviolet absorbance at 260 and 280 nm and assessed qualitatively using Bioanalyzer 2100 (Agilent, Palo Alto, CA). Three comparison pairs (BALB/c vs. C57BL, BALB/c vs. SWR, C57BL vs. SWR) were set up comparing against each pair of two strains of mice. In each pair, 5 g of purified total RNA were converted to cDNA that was labeled either with Cy3 or Cy5, which were hybridized to mouse Oligo Array (Sigma 65-mer Probe Set) containing 21,676 transcripts. In “dye-flip” experiments with the same pair of comparison, the dye labeling was reversed. Oligonucleotide array analysis was performed by the Genomic Core Facility of Digestive Diseases Research Core Center at Washington University in St. Louis, MO. All protocols were performed as recommended by Genisphere (Hatfield, PA). Array images were scanned on an Axon scanner. Array data were extracted and analyzed using GenePix Pro 4.1 software from Axon Instruments. Further analysis was performed by using BRB-Array Tools (version 3.1, http://linus.nci.nih.gov/BRB-ArrayTools.html) according to the instructions provided. Differential gene expression between two of the three strains (BALB/c, SWR, and C57BL) was done by using class comparison expression analysis. sequence-detection system using SYBR Green dye binding to the PCR product (5). Primer Express 2.0 software was used to design amplimers for both genes of interest and GAPDH, the latter of which was used for normalization in RT-PCR. Quantitative Real-Time RT-PCR Liver TG levels, averaged on both genders, varied over a sixfold range among the strains, from 49.7 ⫾ 5.5 mg/g protein (SWR) to 316.5 ⫾ 25.8 (BALB/c; Fig. 1, A and B). Liver TG contents showed similar strain-related differences across both genders. The presence of the SCAD mutation was confirmed in All statistic analyses were conducted using SAS (version 9, SAS Institute, Cary, NC). Data are expressed as means ⫾ SD. ANOVA (PROC GLM) followed by either Duncan’s multiple tests or t-tests were performed for comparisons between treatments as appropriate with an overall ␣-level of 0.01 or 0.05 as indicated. Pearson’s correlation was performed using SAS Proc CORR using data from all 10 strains. The total variance (Vtotal) in the general linear model was partitioned into variance due to “environment” (Venv) and variance due to strain or genetic effects (Vstrain), where Vstrain/Vtotal gave an estimate of Vtotal explained by strain effect, an indication of heritability (12). RESULTS Hepatic TG Levels Fig. 1. Strain survey. Hepatic triglyceride (TG) levels of male (A) and female (B) mice of 10 different strains. Values are means ⫾ SD, n ⫽ 5 for each gender and strain. The multiple comparisons of means were obtained using Duncan’s multiple range test with an overall ␣ of 0.01. Mean values with different lowercase letters differ from each other (P ⬍ 0.01). AJP-Gastrointest Liver Physiol • VOL 288 • JUNE 2005 • www.ajpgi.org Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 18, 2017 Total RNA from male BALB/c, C57BL, and SWR each was pooled and digested with RNase-free DNase, followed by purification with RNeasy Mini Kit (Qiagen). mRNAs of interest were quantified by fluorescence RT-PCR with an Applied Biosystems GeneAmp 5700 Statistics G1182 GENETICS OF LIVER TRIGLYCERIDE LEVEL IN MICE Table 1. Strain survey: body and liver weights and body fat BW, g Strain BALB/c C57BL C57BLBY 129/SVJ AKR NZB PL DBA C3H SWR Body Fat, % Male Female a 25.3⫾2.7 27.4⫾0.7a 27.6⫾3.2a 25.0⫾1.8a NA 26.5⫾3.3a 24.1⫾2.0ab 24.6⫾1.1ab 26.0⫾0.7a 20.8⫾2.8b Male bc Female c 20.9⫾1.7 18.4⫾0.8cde 19.0⫾2.2cd 20.3⫾2.0bcd 26.8⫾1.7a 22.3⫾0.4b 15.7⫾0.6f 18.3⫾0.8de 19.7⫾1.0cd 16.5⫾0.4ef LW, g 12.2⫾1.4 13.5⫾2.2c 13.7⫾0.6c 13.7⫾0.8c NA 15.3⫾2.1bc 20.9⫾3.1a 18.5⫾4.5ab 14.3⫾1.0c 12.2⫾1.9c LB, % Male abc Female a 16.4⫾3.8 15.4⫾2.6bcd 13.0⫾0.9cd 14.5⫾1.7bcd 19.5⫾2.9a 12.3⫾1.1d 18.1⫾1.8ab 12.1⫾1.4d 12.5⫾1.6cd 12.8⫾1.4cd 1.49⫾0.05 1.20⫾0.06bc 1.31⫾0.20ab 0.98⫾0.10cd NA 1.03⫾0.20cd 0.95⫾0.07d 1.07⫾0.04cd 1.17⫾0.06bcd 1.13⫾0.07bcd Male b 1.08⫾0.08 0.80⫾0.08cd 0.94⫾0.12bc 0.75⫾0.15d 1.32⫾0.13a 1.00⫾0.03b 0.67⫾0.08d 0.77⫾0.06d 0.94⫾0.11bc 0.64⫾0.03d Female a 5.3⫾0.2 4.4⫾0.1b 4.7⫾0.2b 3.9⫾0.2c NA 3.8⫾0.3c 3.9⫾0.2c 4.4⫾0.1b 4.5⫾0.2b 4.7⫾0.2b 5.2⫾0.2a 4.3⫾0.3cd 5.0⫾0.2ab 3.6⫾0.4e 4.9⫾0.3ab 4.5⫾0.2bc 4.3⫾0.5cd 4.2⫾0.4cd 4.8⫾0.4abc 3.9⫾0.1de both BALB/c males and females (data not shown), but it was not detected in any of the other strains (data not shown). ranging from 9.3 ⫾ 1.0 mg/dl for BALB/c to 23.8 ⫾ 2.0 mg/dl for NZB; Table 2). Body Weight, Body Fat, Liver Weight, and Liver-to-Body Weight Ratio Plasma BHB and Glucose Concentrations Body weights ranged from 25.3 ⫾ 2.7 g in BALB/c males to 20.8 ⫾ 2.8 g in SWR males. Among females, AKR were heaviest (26.8 ⫾ 1.7 g), and PL were the lightest (24.1 ⫾ 2.0 g; Table 1). Body fat contents were highest in AKR females (males were not available), followed by PL of both genders (Table 1). BALB/c and SWR males and NZB females were among the lowest. With respect to liver-to-body weight ratio, BALB/c males and females ranked at the top, and 129/SVJ ranked at the bottom (Table 1). Plasma Lipids Plasma TG concentrations varied approximately threefold, ranging from 59.2 ⫾ 16.6 (C57BLBY) to 173.8 ⫾ 12.4 mg/dl (BALB/c) for males and from 61.1 ⫾ 17.5 (C57BL) to 203.8 ⫾ 22.7 mg/dl (PL) in females (Table 2). Plasma TC ranged ⬃2.5-fold, from 70.6 ⫾ 5.0 (C57BLBY) to 153.1 ⫾ 4.7 mg/dl (NZB) for males and from 63.3 ⫾ 7.7 (C57BLBY) to 164.8 ⫾ 10.1 mg/dl (C3H) in females (Table 2). The range of concentrations for plasma-free cholesterol was greater in males (4.3fold difference ranging from 6.1 ⫾ 1.0 mg/dl for BALB/c to 26.2 ⫾ 1.1 mg/dl for NZB) than in females (2.6-fold difference Plasma BHB concentrations were alike in males (although male SWR had the highest level numerically) but differed among strains in females (Table 3). SWR had the highest concentration, whereas PL had the lowest. Significant differences in glucose concentration existed among the strains of both genders. The C57BL strain had the highest plasma glucose concentrations for both males and females (Table 3). Correlation and Variance Component Analysis Many of the parameters reported above have been shown to correlate with liver fat in humans (31). Therefore, a series of correlations was sought in an attempt to identify correlates of hepatic fat in mice. Correlations between body weight and hepatic TG were significant only in males (data not shown). Correlations between body fat and hepatic TG were significant only in females. Hepatic TG level was significantly and positively correlated with liver-to-body weight ratio for both males and females (Table 4). Hepatic TG was positively correlated with plasma TG only in males. No significant correlations existed between hepatic TG and TC (Table 4). However, hepatic TG level was negatively correlated with plasma-free cholesterol level for both genders (Table 4). No significant Table 2. Strain survey: plasma lipid concentrations Plasma TG, mg/dl Plasma TC, mg/dl Plasma FC, mg/dl Strain Male Female Male Female Male Female BALB/c C57BL C57BLBY 129/SVJ AKR NZB PL DBA C3H SWR 173.8⫾12.4a 88.1⫾4.2de 59.2⫾16.6e 153.9⫾16.3ab NA 113.8⫾8.4cd 71.6⫾11.5e 125.5⫾29.9bcd 139.0⫾32.7abc 95.9⫾13.6de 171.3⫾33.9ab 61.1⫾17.5d 125.2⫾20.0bc 152.3⫾59.8abc 178.2⫾18.8ab 69.0⫾16.3d 203.8⫾22.7a 113.8⫾19.4cd 177.2⫾48.0ab 174.3⫾14.6ab 88.4⫾10.0c 84.7⫾4.3c 70.6⫾5.0d 108.3⫾9.8b NA 153.1⫾4.7a 81.3⫾2.9cd 76.4⫾4.2cd 114.2⫾4.3b 83.5⫾6.5cd 86.5⫾17.3cd 73.1⫾7.0de 63.3⫾7.7e 99.2⫾9.8c 69.5⫾0.7de 124.2⫾16.7b 96.8⫾4.5c 66.6⫾4.5e 164.8⫾10.1a 73.5⫾9.1de 6.1⫾1.0d 8.0⫾0.8d 13.5⫾0.3c 11.2⫾0.8c NA 26.2⫾1.1a 14.2⫾0.5c 12.6⫾0.4c 18.2⫾0.6b 11.6⫾0.6c 9.3⫾1.0c 9.4⫾1.0c 9.7⫾0.7c 13.0⫾0.7bc 10.3⫾1.7c 23.8⫾2.0a 17.0⫾0.9b 13.0⫾0.7bc 22.1⫾1.9a 15.6⫾0.8b Values are means ⫾ SD (n ⫽ 5 males and 5 females for each strain). Duncan’s multiple tests were used to compare the differences of means with an overall ␣ ⫽ 0.01. Values in the same column with different superscripts are different (P ⬍ 0.01). TG, triglycerides; TC, total cholesterol; FC, free cholesterol. AJP-Gastrointest Liver Physiol • VOL 288 • JUNE 2005 • www.ajpgi.org Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 18, 2017 Values are means ⫾ SD (n ⫽ 5 males and 5 females for each strain). Duncan’s multiple tests were used to compare the differences of means with an overall ␣ ⫽ 0.01. Values in the same column with different superscripts are different (P ⬍ 0.01). BW, body wt; LW, liver wt; LB, liver-to-body wt ratio; NA, not applicable. G1183 GENETICS OF LIVER TRIGLYCERIDE LEVEL IN MICE Table 3. Strain survey: plasma BHB and glucose concentrations Blood BHB, mM Strain BALB/c C57BL C57BLBY 129/SVJ AKR NZB PL DBA C3H SWR Male 0.87⫾0.13 0.88⫾0.19 0.94⫾0.16 1.03⫾0.31 NA 0.77⫾0.25 0.87⫾0.18 0.69⫾0.71 0.69⫾0.18 1.12⫾0.35 Glucose, mg/dl Female Male abc 0.86⫾0.21 1.08⫾0.20ab 0.84⫾0.10abc 0.86⫾0.29abc 0.71⫾0.12bc 0.80⫾0.19bc 0.63⫾0.18c 0.83⫾0.21abc 0.82⫾0.12abc 1.20⫾0.31a Female d 132.2⫾17.6 198.0⫾13.6a 173.8⫾9.9abc 154.2⫾22.2cd NA 182.9⫾12.9ab 186.0⫾22.2ab 169.9⫾6.2abc 160.4⫾9.4bc 163.7⫾16.3bc 129.4⫾8.6ef 188.3⫾34.2a 184.6⫾9.5ab 142.5⫾12.5def 151.7⫾5.6cde 150.1⫾8.8cde 176.1⫾5.5abc 159.2⫾10.5bcd 142.7⫾8.8def 119.8⫾10.4f correlations existed between hepatic TG levels and plasma BHB concentrations (Table 4). Thus univariate analysis did not identify any consistent covariates of hepatic TG except for the liver-to-body weight ratio. We next examined how much the differences among strains were due to “environmental” effects versus strain (genetic) effects, using variance component analysis. On two-way ANOVA to assess the effects of strains and gender, there were significant differences in plasma lipids and plasma BHB and glucose concentrations among 10 strains (Tables 1–3). An overall gender effect was observed for plasma TG levels in the mouse strains. When the total liver TG variance was partitioned into Venv and Vstrain, significant strain effect was observed in both genders [P ⬍ 0.001]. Interstrain variation explained ⬃90% of total hepatic TG variation in males and ⬃76% of total variation in females. Physiological/Biochemical Studies on Male BALB/c, C57BL, and SWR Hepatic lipogenesis, TG secretion, and FA oxidation. In vivo rates of hepatic lipogenesis, measured by [1-14C]-acetate incorporation were similar in BALB/c and C57BL, but smaller in SWR (Fig. 2A). Rates of liver TG secretion, quantified by Triton WR-1339 injection, were similar in BALB/c and C57BL and lower in SWR (Fig. 2B). FA -oxidation rates, determined in primary hepatic cell cultures, were similar in BALB/c and C57BL and higher in SWR (Fig. 2C). These data suggest that SWR livers synthesize FAs at a lesser rate and oxidize them at a faster rate than the other two strains, leaving less TG for hepatic accumulation. Clearly, low levels of hepatic TG in SWR are not due to enhanced export from the liver. Responses to fasting: liver TG levels, plasma FFA, and BHB concentrations. Mean hepatic TG contents in the fed state were BALB/c⬎C57BL⬎SWR (same rank order as noted during the 10-strain survey). Hepatic TG contents rose significantly with fasting in BALB/c and C57BL at 6 and 14 h, but in SWR, only at 14 h (Table 5). Mean fasting-induced rises (⌬14 – 0 h) were ⬃80 mg/g in SWR, ⬃200 mg/g in C57BL, and ⬃230 mg/g in BALB/c (P ⬍ 0.01 for the overall trend). Rises also were largest for BALB/c, at 6 h, i.e., the livers of BALB/c and C57 BL were less able to “adapt” to fasting than SWR. Table 4. Strain survey: correlation between hepatic TG and metabolic parameters Hepatic TG BF P LB P BHB P PTG P PTC P PFC P Male Female ⫺0.268 0.0791 0.568 ⬍0.0001 0.096 0.5455 0.418 0.0065 ⫺0.158 0.3242 ⫺0.459 0.0025 0.246 0.0501 0.469 ⬍0.0001 0.121 0.3403 ⫺0.075 0.5534 ⫺0.196 0.1196 ⫺0.502 ⬍0.0001 BF, body fat; PTG, plasma total triglycerides; PTC, plasma total cholesterol; PFC, plasma-free cholesterol. Pearson’s correlation was performed using SAS Proc CORR on all mice (n ⫽ 5 males and 5 females for each strain). AJP-Gastrointest Liver Physiol • VOL 288 • JUNE 2005 • www.ajpgi.org Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 18, 2017 Values are means ⫾ SD (n ⫽ 5 males and 5 females for each strain). Duncan’s multiple tests were used to compare the differences of means with an overall ␣ ⫽ 0.01. Values in the same column with different superscripts are different (P ⬍ 0.01). BHB, -hydroxybutyrate. In the fed state, FFA concentrations were highest in SWR and rose in all strains with fasting, reaching the highest level in BALB/c at 14 h. The rise in FFA levels reflects the stimulatory effect of fasting on lipolytic rates in adipose tissue, balanced by rates of uptake by liver, muscle, and other tissues (25). It is not clear whether the largest fasting-induced rise in BALB/c is due to more rapid lipolysis, slower rate of removal from plasma, or slower rate of hepatic oxidation perhaps due to the deficiency of SCAD. In the fed state, BHB levels were highest in SWR. With fasting, levels rose in all strains, but rises were greatest in SWR and least in BALB/c. These data are compatible with a greater capacity by livers of SWR to adapt to fastinginduced FFA mobilization by most effectively enhancing FA oxidation among the three strains, thus limiting hepatic TG accumulation. Glucose tolerance. Responses to the glucose tolerance test were similar between male and female; thus results were combined for both genders. Glucose levels were highest in C57BL in response to glucose loading (Fig. 3). Levels were similar in BALB/c and SWR. Hepatic gene expression profiling. A 2.5-fold or greater difference in gene expression was considered a notable change. Expressed transcripts were analyzed in pairwise comparison between two strains of mice. Eight transcripts were overexpressed, and 14 were underexpressed in C57BL relative to BALB/c (Table 6). Ten were overexpressed, and 13 were underexpressed in C57BL relative to SWR (Table 7). Fifteen genes were overexpressed, and 12 were underexpressed in SWR relative to BALB/c (Table 8). When one strain was compared with two others, three transcripts [metallothionein 1 (MT1), MHC class II H2-IA-␣ gene (q haplotype), and hemoglobin-␣, adult chain 1] were upregulated, and four [selenium binding protein 1 (SELENBP1), hemolytic complement, G0/G1 switch gene 2, and adult male kidney cDNA, RIKEN full-length enriched] were downregulated in SWR compared with both C57BL and BALB/c. Three transcripts [stearoylcoenzyme A desaturase 1 (SCD1), serum amyloid A1, and MHC class I H-2K1-k pseudogene] were more expressed, and one [RIKEN cDNA 4933406L18 gene (4933406L18Rik)] was less expressed in C57BL compared with both SWR and G1184 GENETICS OF LIVER TRIGLYCERIDE LEVEL IN MICE BALB/c. Four transcripts (SELENBP1, phosphatidylethanolamine binding protein, amino levulinate synthase, and 18-day embryo cDNA, RIKEN full-length enriched) were overexpressed in BALB/c relative to both SWR and C57BL, and three [0-day neonate head cDNA, RIKEN full-length enriched, clone MGC:19436 IMAGE:3495833, and growth arrest specific 5] were underexpressed. It is worth noting that SCD-1 was 3.2- to 3.6-fold overexpressed in C57BL relative to both BALB/c and SWR. This is compatible with the relative glucose intolerance exhibited by this strain (see Fig. 3) that may lead to increased synthesis of FAs. To confirm that the large-scale analysis had correctly identified differentially expressed transcripts, four transcripts were selected for validation by RT-PCR. Results were similar to those obtained from gene-expression profiling (Table 9). Primer pairs used also are listed in Table 9. DISCUSSION Although, as mentioned above, genetic manipulation of genes involving the FA biosynthetic, oxidation, and VLDL-TG exporting pathways has produced fatty livers (18, 30, 32), here we provide evidence of a significant genetic contribution to hepatic TG contents in inbred mice. The 10 mouse strains were of similar age and were maintained under currently accepted identical environmental conditions and diet. The highest liver TG levels were obtained in both male and female BALB/c, whereas the lowest ones were in SWR, showing six- to sevenfold difference between the two extremes (Fig. 1). ANOVA analysis indicated that strain-related effects per se accounted for the majority of the interstrain variation of hepatic TG level. The genetic bases for the interstrain differences in hepatic TG are not clear, with the possible exception of BALB/c, which were SCAD deficient (see below). However, significant strainrelated effects on hepatic TG were seen even when BALB/c were left out of the ANOVA calculation. In an attempt to identify metabolic covariates of liver TG, we performed a series of correlation analyses. Only liver-tobody weight ratios were significantly and positively correlated with liver TG in both genders. The other parameters of body weight, body fatness and plasma metabolites such as glucose, BHB, plasma TG were not consistently correlated across strains and genders (Table 4). Thus the parameters of adiposity or insulin action that correlate with liver fat in humans (31, 34) appear not to be correlated in mice, for reasons that are not clear. The negative correlation of hepatic TG with plasma-free cholesterol remains unexplained. Table 5. Effects of fasting on hepatic TG, plasma FFA, and BHB levels in 3 strains Hepatic TG, mg/g protein FFA, mM BHB, mM Strain 0h 6h 14 h 0h 6h 14 h 0h 6h 14 h BALB/c C57BL SWR 159.3⫾20.1cA 53.2⫾5.7cB 32.6⫾4.6bC 247.3⫾33.5bA 116.0⫾32.0bB 56.7⫾13.8bC 391.5⫾36.1aA 247.1⫾11.1aB 113.6⫾21.2aC 0.24⫾0.08cB 0.25⫾0.04bAB 0.34⫾0.06bA 0.80⫾0.12bA 0.43⫾0.14bB 0.36⫾0.05bB 1.39⫾0.31aA 0.95⫾0.18aB 0.80⫾0.09aB 0.63⫾0.10bAB 0.50⫾0.10bB 0.78⫾0.23bA 0.75⫾0.19bAB 0.56⫾0.03bB 0.80⫾0.04bA 0.97⫾0.12aB 1.13⫾0.17aB 1.70⫾0.18aA Values are means ⫾ SD. Male mice were killed after being fasted for 0 (BALB/c, n ⫽ 6; C57BL, n ⫽ 6; and SWR, n ⫽ 3), 6 (BALB/c, n ⫽ 3; C57BL, n ⫽ 3; and SWR, n ⫽ 3), or 14 h (BALB/c, n ⫽ 3; C57BL, n ⫽ 3; and SWR, n ⫽ 3). FFA, free fatty acids, Duncan’s multiple tests were used to compare the differences of means with an overall ␣ ⫽ 0.05. Lower-case superscripts refer to differences across the rows, i.e. related to increasing duration of fasting within the same strain. Upper case superscripts refer to columns, i.e. same duration of fasting across the 3 strains. Different superscript letters indicate significant differences (P ⬍ 0.05). AJP-Gastrointest Liver Physiol • VOL 288 • JUNE 2005 • www.ajpgi.org Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 18, 2017 Fig. 2. Three-strain physiological/biochemical studies. Rates of hepatic fatty acid synthesis (A), TG secretion (B), and oxidation (C) were studied in males of the BALB/c, C57BL, and SWR strains. Values are means ⫾ SD. For rates of hepatic fatty acid synthesis n ⫽ 7 for each strain, for TG secretion, n ⫽ 8 for each strain, and for fatty acid oxidation, n ⫽ 3 for each strain. The multiple comparisons of means were obtained using Duncan’s multiple-range test with an overall ␣ of 0.01. Means differ from each other among strains with different lowercase letters (P ⬍ 0.01). G1185 GENETICS OF LIVER TRIGLYCERIDE LEVEL IN MICE Table 6. Differential gene expression: C57BL vs. BALB/c Parametric P Value Fold Difference GB acc Description Transcripts upregulated in C57BL vs. BALB/c Immune response 0.0004651 0.001183 Acute phase response 0.0004773 Lipid metabolism 0.0014558 cDNA or unknown 0.004716 0.001354 0.0038124 2.61e-05 9.98 2.66 X57330 M27134 mRNA for Qa-2 antigen. MHC class I H-2K1-k pseudogene 3.60 NM_009117 serum amyloid A 1 (SAA1) 3.62 NM_009127 stearoyl-Coenzyme A desaturase 1 (SCD1) 10.42 10.00 8.53 7.85 BC003986 AK014743 BC011511 NM_013525 clone IMAGE:3491638 0 day neonate head cDNA, RIKEN full-length enriched clone MGC:19436 IMAGE:3495833 growth arrest specific 5 (GAS5) Transcripts downregulated in C57BL vs. BALB/c Acute phase response 0.0017946 0.001338 0.0018503 Immune response 0.0008274 Lipid metabolism 0.0012252 0.0036857 Transcriptional factors 0.0012464 Heme synthesis 0.0010088 Steroid binding 0.0034141 cDNA or unknown 0.0001068 0.0001021 0.0001142 0.0022098 0.0015055 0.32 0.30 0.39 NM_009150 NM_019414 NM_010361 selenium binding protein 1 (SELENBP1) selenium binding protein 2 (SELEBP2) glutathione S-transferase, theta 2 (GSTT2) 0.34 X16203 Q5 class I MHC gene 0.28 0.04 NM_018858 NM_021304 phosphatidylethanolamine binding protein (PBP) alpha/beta hydrolase-1 (LOC57742) 0.28 NM_009883 CCAAT/enhancer binding protein (C/EBP), beta 0.29 M63245 amino levulinate synthase (ALAS-H) 0.33 NM_007618 corticosteroid binding globulin (CBG) 0.20 0.18 0.21 0.31 0.38 AK013108 AK003567 NM_028740 AK007895 AK012224 10, 11 days embryo cDNA, RIKEN full-length enriched 18 days embryo cDNA, RIKEN full-length enriched RIKEN cDNA 4933406L 18 gene (4933406L 18Rik) 10-day-old male pancreas cDNA, RIKEN full-length 11 days embryo cDNA, RIKEN full-length enriched Hepatic gene expression profiling and analysis were performed from pooled total liver RNA (n ⫽ 5 each strain, male), as described in MATERIALS AND METHODS. A 2.5-fold difference or greater was considered a notable change. GB acc, GenBank accession number. AJP-Gastrointest Liver Physiol • VOL 288 • JUNE 2005 • www.ajpgi.org Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 18, 2017 Fig. 3. Three-strain glucose tolerance tests (GTT). Both genders of the BALB/c, C57BL, and SWR strains were used. Because the response to the glucose load was similar between genders, results were combined within each strain. Values are means ⫾ SD, n ⫽ 5 for each strain and gender. The multiple comparisons of means were obtained using Duncan’s multiple-range test with an overall ␣ of 0.01. Means differ from each other among strains with different lowercase letters (P ⬍ 0.01). To understand some of the physiological/biochemical processes underlying the strain-related differences in hepatic TG, we studied mice representing the highest (BALB/c), middle range (C57BL), and the lowest (SWR) levels of hepatic TG. Males were used because they were more readily available, and we saw similar strain differences in hepatic TG in both genders. Glucose tolerance, reflecting insulin action, was studied in the 4- to 6-h fasted state. Processes contributing to hepatic TG levels such as hepatic FA synthesis and oxidation and hepatic TG transport were studied (7, 9, 15, 20) in the fed state. Finally, responses of hepatic TG to 6 and 14 h of fasting were compared with the fed state. We attempt to explain the differences among the three strains in terms of the relative rates of the above processes we studied. SWR showed significantly lower rates of hepatic lipogenesis (Fig. 2A) and TG secretion (Fig. 2B) and higher rates of FA oxidation (Fig. 2C) than both the BALB/c and C57BL strains, whereas these parameters were similar in BALB/c and C57BL. These data suggest that SWR may maintain lower hepatic TG levels than the other two strains by presenting smaller TG loads to the VLDL export system. Clearly, because hepatic TG export was low, liver TG levels were not low because export was increased. SWR livers also have more efficient capacities to resist the hepatic TG-raising effects of fasting (Table 5). G1186 GENETICS OF LIVER TRIGLYCERIDE LEVEL IN MICE Table 7. Differential gene expression: C57BL vs. SWR Parametric P Value Fold Difference GB acc Description Transcripts upregulated in C57BL vs. SWR 3.26 NM_009127 stearoyl-Coenzyme A desaturase 1 (SCD1) 2.57 2.63 3.20 3.27 4.05 M23894 NM_013819 M27134 NM_010406 NM_008059 PYS-2 histocompatibility 2, M region locus 3 (H2-M3), MHC class I H-2K1-k pseudogene hemolytic complement (HC) G0/G1 switch gene 2 (G0S2) 3.27 4.36 NM_009117 NM_009150 serum amyloid A 1 (SAA1) selenium binding protein 1 (SELENBP1) 2.55 2.82 AK003407 AK002480 18 days embryo cDNA, RIKEN full-length enriched adult male kidney cDNA, RIKEN full-length enriched Transcripts downregulated in C57BL vs. SWR Signal transduction 2.68e-05 Transcriptional factors 0.0028646 Nucleic acid binding 0.0009634 Immune response 0.0040761 0.0001713 0.000482 Lipid metabolism 0.0019276 0.0018488 0.0005654 cDNA 0.0012349 0.0014501 0.0043909 0.0030628 0.13 NM_013602 metallothionein 1 (MT 1) 0.28 NM_020255 peroxisome proliferative activated receptor, gamm 0.32 NM_007447 angiogenin (ANG) 0.30 0.25 0.28 K01925 AF071431 NM_008218 MHC class II H2-IA-alpha gene (q haplotype) Beta globin hemoglobin alpha, adult chain 1 (HBA-A1) 0.32 0.35 0.31 AF047725 NM_010004 NM_007815 CYP2C38 cytochrome P450, 2c40 (CYP2C40) cytochrome P450, 2c29 (CYP2C29) 0.29 0.37 0.39 0.39 AK004319 NM_028740 AK004939 AK009784 18 days embryo cDNA, RIKEN full-length enriched RIKEN cDNA 4933406L 18 gene (4933406L 18Rik) adult male liver cDNA, RIKEN full-length enriched adult male tongue cDNA, RIKEN full-length enriched Hepatic gene expression profiling and analysis were performed from pooled total liver RNA (n ⫽ 5 each strain, male), as described in MATERIALS AND METHODS. A 2.5-fold difference or greater was considered a notable change. They appear to accomplish this by keeping plasma FFA levels low, which may indicate relatively low rates of lipolysis in adipose tissue and less delivery of FFA substrate to hepatic TG production, and BHB levels high, which may indicate efficient rates of ketogenesis. Both processes would tend to reduce the amounts of hepatic TG loads available for export via the VLDL system during fasting, compared with BALB/c and C57BL strains. Glucose levels were highest in C57BL in the survey (Table 3) and during the glucose tolerance test (Fig. 3). The relatively high expression level of the SCD-1 gene in C57BL (Tables 6 and7) is compatible with the relatively high rates of hepatic FA synthesis and the relative glucose intolerance of C57BL. These data suggest that although livers of C57BL may produce higher amounts of hepatic TG (certainly relative to SWR), the presence of adequate VLDL-TG export rates and FA oxidation rates was able to restrain hepatic TG contents. It is possible that the accumulation of hepatic TG over time, in C57BL, may further contribute to the increasing glucose intolerance with age (4, 26), but high levels of hepatic TG do not explain the absence of glucose intolerance in BALB/c. It is possible that not all causes of fatty liver produce insulin resistance. SCAD is a mitochondrial enzyme that catalyzes the first reaction in the -oxidation of short-chain FAs. BALB/c mice bear a spontaneous deletion in SCAD gene and develop fatty liver after 18 h of fasting (28, 29). However, it is worth noting that in the fed state, whereas BALB/c had considerably higher hepatic TG levels than C57BL, the two strains had similar rates of hepatic FA synthesis, hepatic TG secretion, and similar concentrations of plasma FFA and BHB. Similar rates of long-chain FA -oxidation, as measured by using 14C-labeled palmitate as the substrate, were also found between C57BL and BALB/c. This raises questions as to whether the SCAD mutation is sufficient to explain the higher hepatic TG contents in BALB/c in the fed state. It is possible that static measurements of plasma concentrations do not adequately reflect the deficiency in the action of SCAD. Plasma levels of FFA are determined by relative rates of lipolysis in adipose tissue (input) and rates of uptake by the liver, muscle, and other organs (output) (25). Plasma BHB concentrations are determined by relative rates of ketogenesis in liver (input) and ketone body uptake by brain and other organs (output) (21). It is impossible from the present experiments to determine whether the similar plasma levels of the two metabolites in fed BALB/c and C57BL reflect similar rates in input or output. It is conceivable that the rates of input and output differ in the two strains, but the balance between the two rates resulted in similar plasma levels. For example, if rates of AJP-Gastrointest Liver Physiol • VOL 288 • JUNE 2005 • www.ajpgi.org Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 18, 2017 Lipid metabolism 0.0004591 Immune response 0.0033534 0.0019176 0.0008779 0.0003951 0.0008195 Acute phase response 0.0004732 0.0007113 cDNA 0.0012738 0.0022096 G1187 GENETICS OF LIVER TRIGLYCERIDE LEVEL IN MICE Table 8. Differential gene expression: SWR vs. BALB/c Parametric P Value Fold Difference GB acc Description Transcripts upregulated in SWR vs. BALB/c 2.654 NM_010634 Fatty acid binding protein 5, epidermal (FABP5), 3.04 2.535 2.539 K01925 M19689 NM_008218 MHC class II H2-IA-alpha gene (q haplotype) MHC class I H-2 (q-haplotype) classic transplantation hemoglobin alpha, adult chain 1 (HBA-A1) 19.496 NM_013602 Metallothionein 1 (MT1) 3.518 J03953 glutathione transferase GT9.3 3.358 AF171080 histone macroH2A1.2 variant mRNA 2.712 NM_010324 glutamate oxaloacetate transaminase 1, soluble 4.103 15.253 7.764 3.505 2.944 4.522 3.036 AK014743 BC011511 AK004796 NM_024223 AJ278735 NM_013525 AJ279951 0 day neonate head cDNA, RIKEN full-length enriched Clone MGC:19436 IMAGE:3495833 adult male lung cDNA, RIKEN full-length enriched RIKEN cDNA 0610010I23 gene (0610010I23Rik) hypothetical protein (ORF1), 1975 BP growth arrest specific 5 (GAS5) Hypothetical protein, clone mv10 Transcripts downregulated in SWR vs. BALB/c Xenobiotic metabolism 0.0015764 0.0006006 Lipid metabolism 0.0012188 Immune response 2.13e-05 0.0003417 Acute phase response 0.0002434 Heme biosynthesis 0.0019222 cDNA or unknown 0.0005279 0.0016523 0.0005856 0.0020696 0.0015822 0.385 0.315 NM_032541 NM_009676 hepcidin antimicrobial peptide (HAMP) aldehyde oxidase 1 (AOX1) 0.312 NM_018858 phosphatidylethanolamine binding protein (PBP) 0.145 0.316 NM_008059 NM_010406 G0/G1 switch gene 2 (G0S2) hemolytic complement (HC) 0.148 NM_009150 selenium binding protein 1 (SELENBP1) 0.158 M63245 amino levulinate synthase (ALAS-H) 0.215 0.324 0.229 0.385 0.359 AK020099 AK003665 AK003567 AK002480 AB054000 adult male olfactory brain cDNA, RIKEN full-leng 18 days embryo cDNA, RIKEN full-length enriched 18 days embryo cDNA, RIKEN full-length enriched adult male kidney cDNA, RIKEN full-length enriched Cg10671-like Hepatic gene expression profiling and analysis were performed from pooled total liver RNA (n ⫽ 5 each strain, male), as described in MATERIALS AND METHODS. A 2.5-fold difference or greater was considered a notable change. lipolysis and tissue uptake are both higher in BALB/c, FFA levels in plasma could remain similar to C57BL levels, but the higher hepatic uptake of FFA in BALB/c could result in higher levels of hepatic TG, not explainable by the SCAD defect alone. The fasting experiment appeared to support an FA -oxidation defect in BALB/c mice (the least rise in plasma BHB levels in response to fasting). However, this reflected more of a defect in the fasting situation, consistent with Table 9. mRNA levels by real-time PCR analysis Accession Number Primers (5⬘ to 3⬘) BALB/c C57BL SWR Stearoyl-CoA desaturase 1: SCD1 Genes NM_009127 1.0 5.2 2.4 Aldehyde oxidase 1: AOX1 NM_009676 1.0 0.9 0.2 Metallothionein 1: MT1 NM_013602 1.0 2.5 13.2 Cytochrome P450, 2c29: CYP2C29 NM_007815 1.0 0.1 1.1 GAPDH M32599 Forward primer, GTTGGCTCCATCCATTGC; Backward primer, AACCATGGGAAGCCAAGTTT Forward primer, CACGCTGTAGGCTGGTTT; Backward primer, CCTCCAGGTAGAACTTGAAAA Forward primer, CGTGCTGTGCCTGATGTG; Backward primer, GGAAGACGCTGGGTTGGT Forward primer, AAGAACATCAGCCAATCC; Backward primer, TTCACCGCTTCATACCC Forward primer, TGGCCTTCCGTGTTCCT; Backward primer, AGGCGGCACGTCAGATC NA NA NA Liver total RNA was isolated and pooled from 5 male mice from each strain. Quantitative real-time PCR was performed from the pooled total RNA as described in MATERIALS AND METHODS. AJP-Gastrointest Liver Physiol • VOL 288 • JUNE 2005 • www.ajpgi.org Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 18, 2017 Lipid metabolism 0.0009032 Immune response 0.0055601 0.0020473 0.0019972 Signal transduction 2.1e-06 Acute phase response 0.0002479 DNA binding 0.001726 Amino acid metabolism 0.0006943 cDNA or unknown 0.0001433 0.0055816 2.33e-05 0.0009285 0.0010505 7.89e-05 0.0010782 G1188 GENETICS OF LIVER TRIGLYCERIDE LEVEL IN MICE 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. GRANTS 20. This work was supported by grants from The Alan and Edith Wolf charitable fund, and National Institutes of Health (NIH) Grants R37-HL424460 and RO1-HL-59515. Support from the following sources also is greatly appreciated: the General Clinical Research Center (NIH Grant 5MO1RR00036), the Diabetes Research and Training Center (5P60DK20579), the Clinical Nutrition Research Unit (DK-56341), the Digestive Diseases Research Care Center (1P30DK-52574), and ROI HL-52139 (to Z. Chen). 21. 22. 23. 24. REFERENCES 1. Angulo P. Nonalcoholic fatty liver disease. N Engl J Med 346: 1221– 1231, 2002. 2. Beattie JH, Wood AM, Newman AM, Bremner I, Choo KH, Michalska AE, Duncan JS, and Trayhurn P. Obesity and hyperleptinemia in metallothionein (-I and -II) null mice. Proc Natl Acad Sci USA 95: 358 –363, 1998. 3. Bernal-Mizrachi C, Weng S, Li B, Nolte LA, Feng C, Coleman T, Holloszy JO, and Semenkovich CF. Respiratory uncoupling lowers 25. 26. 27. AJP-Gastrointest Liver Physiol • VOL blood pressure through a leptin-dependent mechanism in genetically obese mice. Arterioscler Thromb Vasc Biol 22: 961–968, 2002. Bugianesi E, Zannoni C, Vanni E, Marzocchi R, and Marchesini G. Non-alcoholic fatty liver and insulin resistance: a cause-effect relationship? Dig Liver Dis 36: 165–173, 2004. Bustin SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 25: 169 –193, 2000. Castellano G, Garfia C, Gomez-Coronado D, Arenas J, Manzanares J, Colina F, and Solis-Herruzo JA. Diffuse fatty liver in familial heterozygous hypobetalipoproteinemia. J Clin Gastroenterol 25: 379 –382, 1997. Chen Z, Fitzgerald RL, Averna MR, and Schonfeld G. A targeted apolipoprotein B-38.9-producing mutation causes fatty livers in mice due to the reduced ability of apolipoprotein B-389 to transport triglycerides. J Biol Chem 275: 32807–32815, 2000. Chen Z, Fitzgerald RL, and Schonfeld G. Hypobetalipoproteinemic mice with a targeted apolipoprotein (Apo) B-27.6-specifying mutation: in vivo evidence for an important role of amino acids 1254 –1744 of ApoB in lipid transport and metabolism of the apoB-containing lipoprotein. J Biol Chem 277: 14135–14145, 2002. Day CP. Pathogenesis of steatohepatitis. Best Pract Res Clin Gastroenterol 16: 663– 678, 2002. Day CP and James OF. Steatohepatitis: a tale of two “hits”? Gastroenterology 114: 842– 845, 1998. Entenman C. General procedures for separating lipid components of tissue. Methods Enzymol 3: 299 –317, 1957. Falconer DS and MacKay TFC. Introduction to Quantitative Genetics. Essex, England: Longman, 1996. Froyland L, Madsen L, Vaagenes H, Totland GK, Auwerx J, Kryvi H, Staels B, and Berge RK. Mitochondrion is the principal target for nutritional and pharmacological control of triglyceride metabolism. J Lipid Res 38: 1851–1858, 1997. Giometti CS, Liang X, Tollaksen SL, Wall DB, Lubman DM, Subbarao V, and Rao MS. Mouse liver selenium-binding protein decreased in abundance by peroxisome proliferators. Electrophoresis 21: 2162– 2169, 2000. Kersten S, Seydoux J, Peters JM, Gonzalez FJ, Desvergne B, and Wahli W. Peroxisome proliferator-activated receptor alpha mediates the adaptive response to fasting. J Clin Invest 103: 1489 –1498, 1999. Kim JB, Sarraf P, Wright M, Yao KM, Mueller E, Solanes G, Lowell BB, and Spiegelman BM. Nutritional and insulin regulation of fatty acid synthetase and leptin gene expression through ADD1/SREBP1. J Clin Invest 101: 1–9, 1998. Kim JK, Fillmore JJ, Chen Y, Yu C, Moore IK, Pypaert M, Lutz EP, Kako Y, Velez-Carrasco W, Goldberg IJ, Breslow JL, and Shulman GI. Tissue-specific overexpression of lipoprotein lipase causes tissuespecific insulin resistance. Proc Natl Acad Sci USA 98: 7522–7527, 2001. Le May C, Pineau T, Bigot K, Kohl C, Girard J, and Pegorier JP. Reduced hepatic fatty acid oxidation in fasting PPARalpha null mice is due to impaired mitochondrial hydroxymethylglutaryl-CoA synthase gene expression. FEBS Lett 475: 163–166, 2000. Lin X, Schonfeld G, Yue P, and Chen Z. Hepatic fatty acid synthesis is suppressed in mice with fatty livers due to targeted apolipoprotein B38.9 mutation. Arterioscler Thromb Vasc Biol 22: 476 – 482, 2002. Malnick SD, Beergabel M, and Knobler H. Non-alcoholic fatty liver: a common manifestation of a metabolic disorder. QJM 96: 699 –709, 2003. Mitchell GA, Kassovska-Bratinova S, Boukaftane Y, Robert MF, Wang SP, Ashmarina L, Lambert M, Lapierre P, and Potier E. Medical aspects of ketone body metabolism. Clin Invest Med 18: 193–216, 1995. Nadeau JH. Modifier genes and protective alleles in humans and mice. Curr Opin Genet Dev 13: 290 –295, 2003. Nadeau JH. Modifier genes in mice and humans. Nat Rev Genet 2: 165–174, 2001. Ntambi JM. The regulation of stearoyl-CoA desaturase (SCD). Prog Lipid Res 34: 139 –150, 1995. Owen OE, Reichard GA Jr, Patel MS, and Boden G. Energy metabolism in feasting and fasting. Adv Exp Med Biol 111: 169 –188, 1979. Petersen KF, Befroy D, Dufour S, Dziura J, Ariyan C, Rothman DL, DiPietro L, Cline GW, and Shulman GI. Mitochondrial dysfunction in the elderly: possible role in insulin resistance. Science 300: 1140 –1142, 2003. Petersen KF, Oral EA, Dufour S, Befroy D, Ariyan C, Yu C, Cline GW, DePaoli AM, Taylor SI, Gorden P, and Shulman GI. Leptin 288 • JUNE 2005 • www.ajpgi.org Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 18, 2017 the development of fatty liver on 18 h of fasting in this strain (29). One way to settle these issues would be to examine another BALB/c strain with intact SCAD function. We have studied another BALB/c strain available from Jackson Laboratories: the BALB/cJ strain. Hepatic TG contents of male BALB/cJ in fact are lower, resembling those of SWR. However, the two BALB/c strains also differ in at least 43 of ⬃300 microsatellite markers genotyped across the genome (http://www.cidr.jhml. edu/mouse/mouse.html). Thus, at this time, it is not possible unequivocally to ascribe the excess hepatic TG in the fed state to the SCAD deficiency alone. It remains to be investigated whether any other factor(s) besides SCAD mutation causes fatty liver in this mouse strain. We performed a gene expression survey expecting to find additional explanations for the interstrain differences in hepatic TG contents. Most of the differences in hepatic gene expression remain to be explained. However, as noted, the relative overexpression of the SCD-1 transcript in C57BL was useful in explaining the contribution of presumed increased palmitate desaturation to oleate to the higher hepatic TG levels in C57BL (Tables 6 and 7) (24). It is not clear whether high hepatic FA synthesis with lower SCD1 mRNA level in BALB/c results from a lower oxidation rate of newly synthesized FA. MT1 has been linked to the regulation of energy balance in mice, because mice deficient in both MT1 and MT2 were obese (2). SWR had the highest level of expression in MT1 when compared with both C57BL and BALB/c, consistent with the lowest body weight of SWR in the three strains. Mouse hepatic SELENBP1 was decreased in response to peroxisome proliferators such as ciprofibrate (14). The lowest expression of hepatic SELENBP1 in SWR relative to both C57BL and BALB/c may be related to the highest hepatic FA oxidation in SWR. Another consideration is that differential gene expression may be the consequence, rather than the cause of differences in liver TG levels. For example, hepatic TG accumulation may raise the level of reactive oxygen products in liver (1) stimulating alterations in the expression levels of mRNAs of acute phase reactant molecules. In conclusion, results of these studies have demonstrated a significant genetic contribution to hepatic TG contents in inbred mice. They also helped identify potential parental strains for construction of congenic strains bearing apoB truncations. Breeding is in progress. GENETICS OF LIVER TRIGLYCERIDE LEVEL IN MICE 28. 29. 30. 31. 32. 34. 35. Tarugi P, Lonardo A, Ballarini G, Grisendi A, Pulvirenti M, Bagni A, and Calandra S. Fatty liver in heterozygous hypobetalipoproteinemia caused by a novel truncated form of apolipoprotein B. Gastroenterology 111: 1125–1133, 1996. 36. Teli MR, James OF, Burt AD, Bennett MK, and Day CP. The natural history of nonalcoholic fatty liver: a follow-up study. Hepatology 22: 1714 –1719, 1995. 37. Wetterau JR, Aggerbeck LP, Bouma ME, Eisenberg C, Munck A, Hermier M, Schmitz J, Gay G, Rader DJ, and Gregg RE. Absence of microsomal triglyceride transfer protein in individuals with abetalipoproteinemia. Science 258: 999 –1001, 1992. 38. Wood P, Hinsdale ME, and Kelly CL. Molecular detection of the Bcd-1 null allele in BALB/cByJ mice by polymerase chain reaction: a simple assay for genetic monitoring. Mouse Genome 91: 342–344, 1993. 39. Yao Z and McLeod RS. Synthesis and secretion of hepatic apolipoprotein B-containing lipoproteins. Biochim Biophys Acta 1212: 152–166, 1994. 40. Yokoyama C, Wang X, Briggs MR, Admon A, Wu J, Hua X, Goldstein JL, and Brown MS. SREBP-1, a basic-helix-loop-helix-leucine zipper protein that controls transcription of the low density lipoprotein receptor gene. Cell 75: 187–197, 1993. 41. Yu S, Rao S, and Reddy JK. Peroxisome proliferator-activated receptors, fatty acid oxidation, steatohepatitis and hepatocarcinogenesis. Curr Mol Med 3: 561–572, 2003. AJP-Gastrointest Liver Physiol • VOL 288 • JUNE 2005 • www.ajpgi.org Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 18, 2017 33. reverses insulin resistance and hepatic steatosis in patients with severe lipodystrophy. J Clin Invest 109: 1345–1350, 2002. Reue K and Cohen RD. Acads gene deletion in BALB/cByJ mouse strain occurred after 1981 and is not present in BALB/cByJ-fld mutant mice. Mamm Genome 7: 694 – 695, 1996. Schiffer SP, Prochazka M, Jezyk PF, Roderick TH, Yudkoff M, and Patterson DF. Organic aciduria and butyryl CoA dehydrogenase deficiency in BALB/cByJ mice. Biochem Genet 27: 47–58, 1989. Schonfeld G. Familial hypobetalipoproteinemia: a review. J Lipid Res 44: 878 – 883, 2003. Schonfeld G, Patterson BW, Yablonskiy DA, Tanoli TS, Averna M, Elias N, Yue P, and Ackerman J. Fatty liver in familial hypobetalipoproteinemia: triglyceride assembly into VLDL particles is affected by the extent of hepatic steatosis. J Lipid Res 44: 470 – 478, 2003. Shimano H, Horton JD, Hammer RE, Shimomura I, Brown MS, and Goldstein JL. Overproduction of cholesterol and fatty acids causes massive liver enlargement in transgenic mice expressing truncated SREBP-1a. J Clin Invest 98: 1575–1584, 1996. Silverman JF, Pories WJ, and Caro JF. Liver pathology in diabetes mellitus and morbid obesity. Clinical, pathological, and biochemical considerations. Pathol Annu 24: 275–302, 1989. Tanoli T, Yue P, Yablonskiy D, and Schonfeld G. Fatty liver in familial hypobetalipoproteinemia: roles of the APOB defects, intra-abdominal adipose tissue, and insulin sensitivity. J Lipid Res 45: 941–947, 2004. G1189
© Copyright 2026 Paperzz