Rhinovirus infection of primary cultures of human
tracheal epithelium: role of ICAM-1 and IL-1b
MASANORI TERAJIMA, MUTSUO YAMAYA, KIYOHISA SEKIZAWA, SHOJI OKINAGA,
TOMOKO SUZUKI, NORIHIRO YAMADA, KATSUTOSHI NAKAYAMA, TAKASHI OHRUI,
TAKEKO OSHIMA, YOSHIO NUMAZAKI, AND HIDETADA SASAKI
Department of Geriatric Medicine, Tohoku University School of Medicine, Sendai 980;
and Virus Center, Clinical Research Division, Sendai National Hospital, Sendai 983, Japan
Terajima, Masanori, Mutsuo Yamaya, Kiyohisa
Sekizawa, Shoji Okinaga, Tomoko Suzuki, Norihiro
Yamada, Katsutoshi Nakayama, Takashi Ohrui, Takeko
Oshima, Yoshio Numazaki, and Hidetada Sasaki. Rhinovirus infection of primary cultures of human tracheal epithelium: role of ICAM-1 and IL-1b. Am. J. Physiol. 273 (Lung
Cell. Mol. Physiol. 17): L749–L759, 1997.—Exacerbations of
asthma are often associated with respiratory infection caused
by rhinoviruses. To study the effects of rhinovirus infection on
respiratory epithelium, a primary target for respiratory
viruses, human rhinovirus (HRV)-2 and HRV-14 were infected to primary cultures of human tracheal epithelial cells.
Viral infection was confirmed by showing that viral titers of
supernatants and lysates from infected cells increased with
time and by polymerase chain reaction. HRV-2 and HRV-14
infections upregulated the expression of intercellular adhesion molecule-1 (ICAM-1) mRNA, the major rhinovirus receptor, on epithelial cells, and they increased the production of
interleukin (IL)-1b, IL-6, IL-8, and tumor necrosis factor
(TNF)-a in supernatants. Antibodies to ICAM-1 inhibited
HRV-14 infection of epithelial cells and decreased the production of cytokines after HRV-14 infection, but they did not alter
HRV-2 infection-induced production of cytokines. IL-1b upregulated ICAM-1 mRNA expression and increased susceptibility to HRV-14 infection, whereas other cytokines failed to
alter ICAM-1 mRNA expression. Furthermore, a neutralizing
antibody to IL-1b significantly decreased viral titers of supernatants and ICAM-1 mRNA expression after HRV-14 infection, but a neutralizing antibody to TNF-a was without effect.
Immunohistochemical studies revealed that both HRV-14
infection and IL-1b increased ICAM-1 expression on cultured
epithelial cells. These findings imply that HRV-14 infection
upregulated ICAM-1 expression on epithelial cells through
increased production of IL-1b, thereby increasing susceptibility to infection. These events may be important for amplification of airway inflammation after viral infection in asthma.
asthma; common cold; airway inflammation; interleukin-1b;
intercellular adhesion molecule-1; polymerase chain reaction
have indicated that asthma attacks are associated with a viral infection in as many as
20–50% of the cases (17). Rhinoviruses cause the majority of common colds, which often provoke wheezing
in patients with asthma (18), and they have also been
associated with exacerbations of chronic bronchitis (11).
Although several mechanisms have been proposed, it is
still uncertain how viral respiratory infections cause an
attack of wheezing in patients with asthma.
Respiratory tract epithelium is the primary target
for respiratory viruses. Respiratory syncytial viruses
cause an increase in interleukin (IL)-8 mRNA expression of the nasal epithelium (4) and the production of
PERSPECTIVE STUDIES
IL-6, IL-8, and granulocyte macrophage colony-stimulating factor (GM-CSF) from a human bronchial epithelial cell line (BEAS-2B; see Ref. 19). Likewise, human
rhinovirus (HRV) infection induces production of IL-6,
IL-8, and GM-CSF from BEAS-2B cells (27). These
cytokines are known to mediate a wide variety of
proinflammatory and immunoregulatory effects (1) and
to play a role in the pathogenesis of airway inflammation in asthma. Subauste et al. (27) demonstrated that
preexposure of BEAS-2B cells to tumor necrosis factor-a (TNF-a) increased susceptibility to HRV-14 infection. However, HRV-14 infection itself failed to increase
susceptibility to infection and intercellular adhesion
molecule-1 (ICAM-1) expression, a major surface receptor for rhinoviruses (7). We speculate that a lack of
increased susceptibility to infection may be due to the
use of the BEAS-2B cell line in the study by Subauste
et al. (27). The BEAS-2B cell was derived from normal human epithelial cells by transfection with an
adenovirus 12-SV40 hybrid virus (25). Although
BEAS-2B cells share many properties in common with
normal epithelial cells (27), transformed cell lines may
lose certain differentiated functions (8), resulting in an
altered response of respiratory epithelial cells to rhinovirus infection.
We therefore investigated whether the primary cultures of the human tracheal epithelial cells (34) can be
infected with rhinoviruses. We also examined whether
rhinovirus infection upregulates ICAM-1 expression on
the cells and increases susceptibility to infection.
METHODS
Media components. Reagents for cell culture media were
obtained as follows: Eagle’s minimum essential medium
(MEM), Dulbecco’s modified Eagle’s medium (DMEM), Ham’s
F-12 medium, fetal calf serum (FCS), and g-globulin-free calf
serum (GGFCS) were from GIBCO-BRL Life Technologies,
Palo Alto, CA; trypsin, EDTA, dithiothreitol, Sigma type XIV
protease, human placental collagen, penicillin, streptomycin,
gentamicin, and amphotericin B were from Sigma Chemical,
St. Louis, MO; and Ultroser G serum substitute (USG) was
from BioSepra, Marlborough, MA.
Human embryonic fibroblast cell culture. Human embryonic fibroblast cells were cultured in the Roux type bottle
(Iwaki Garasu, Chiba, Japan) sealed with a rubber plug in
MEM containing 10% FCS supplemented with 5 3 104 U/l
penicillin and 50 mg/l streptomycin (20). Confluency was
achieved at 7 days, at which time the cells were collected by
trypsinization (0.05% trypsin, 0.02% EDTA). Cells (1.5 3 105
cells/ml) suspended in MEM containing 10% FCS were then
plated in glass tubes (15 3 105 mm; Iwaki Garasu), sealed
with rubber plugs, and cultured at 37°C.
1040-0605/97 $5.00 Copyright r 1997 the American Physiological Society
L749
L750
RHINOVIRUS INFECTION OF AIRWAY EPITHELIAL CELLS
Human tracheal epithelial cell culture. Tracheas for cell
culture were obtained 3–6 h after death from 51 patients
(mean age, 64 6 4 yr; 22 female, 29 male) under a protocol
passed by the Tohoku University Ethics Committee. Twentyfour of the patients were smokers. None had a respiratory
illness, and they died of acute myocardial infarction (n 5 13),
congestive heart failure (n 5 3), malignant tumor other than
lung cancer (n 5 14), rupture of aortic aneurysm (n 5 4), liver
cirrhosis (n 5 3), renal failure (n 5 3), leukemia (n 5 3),
malignant lymphoma (n 5 1), cerebral bleeding (n 5 6), and
cerebral infarction (n 5 1). Tracheas were rinsed in ice-cold
and sterile phosphate-buffered saline (PBS) to remove mucus
and debris, opened longitudinally along the anterior surface,
and mounted in a stretched position in a dissection tray. The
surface epithelium was scored into longitudinal strips and
was pulled off of the submucosa (34). The tissue strips were
rinsed four times in PBS containing 5 mM dithiothreitol and
then two times in PBS alone. The tissue strips were placed
into the conical tubes (Costar, Cambridge, MA) containing
protease (0.4 mg/ml; Sigma type XIV) dissolved in PBS. The
strips were stored overnight in the refrigerator at 4°C. The
enzyme was then competitively inhibited by the addition of
FCS to a final concentration of 2.5%, and small sheets of cells
were dislodged from the epithelial strips by vigorous agitation. The denuded strips were removed, and the sheets of
cells remaining were dispersed by repeated aspiration in a
10-ml pipette.
Cells were pelleted (200 g, 10 min) and suspended in
DMEM-Ham’s F-12 containing 5% FCS (50:50 vol/vol). Cell
counts were made using a hemocytometer, and estimates of
viability were done using trypan blue and by measuring the
amount of lactate dehydrogenase (LDH) in the medium as
previously reported (2). The cells were then plated at 5 3 105
viable cells/ml in glass tubes coated with human placental
collagen (34). This medium was replaced by DMEM-Ham’s
F-12 containing 2% USG on the first day after plating. The
glass tubes were sealed with rubber plugs and were cultured
at 37°C. Cell culture media were supplemented with 105 U/l
penicillin, 100 mg/l streptomycin, 50 mg/l gentamicin, and 2.5
mg/l amphotericin B.
We screened 16 kinds of viruses (e.g., influenza types A, B,
and C, parainfluenza virus, adenovirus, rhinovirus, and
respiratory syncytial virus) in supernatants of cultured human tracheal epithelial cells before rhinovirus infection using
the method described previously (20) and used the epithelial
cell sheets without contamination by any viruses. Furthermore, we confirmed cilia beating on the epithelial cells and
the absence of fibroblasts in glass tubes using the inverted
microscope (MIT-2; Olympus, Tokyo, Japan). Finally, to determine whether cultured cells can form tight junctions, we
performed parallel cultures of human tracheal epithelial cells
on Millicell CM inserts (0.45-µm pore size and 0.6-cm2 area;
Millipore Products Division, Bedford, MA) to measure electrical resistance and short-circuit current using Ussing chamber methods (34). When cells cultured under these conditions
become differentiated and form tight junctions without contamination of fibroblasts, they have values of .40 V · cm2 for
resistance and .10 µA/cm2 for short-circuit current (34).
Therefore, cultured human tracheal epithelial cells were
judged as cells able to form tight junctions and were used for
the following experiments when cells on Millicell CM inserts
had high resistance (.40 V · cm2) and high short-circuit
current (.10 µA/cm2).
Viral stocks. HRV-2 and HRV-14 were prepared in our
laboratory from the patients with common colds (20). Stocks
of HRV-14 and HRV-2 were generated by infecting human
embryonic fibroblast cells cultured in glass tubes in 1 ml of
MEM supplemented with 2% GGFCS, 50 U/ml penicillin, and
50 µg/ml streptomycin at 33°C. The cells were incubated for
several days in glass tubes in 1 ml of MEM supplemented
with 2% GGFCS until cytopathic effects were obvious, after
which the cultures were frozen at 280°C, thawed, and
sonicated. The virus-containing fluid so obtained was frozen
in aliquots at 280°C. The content of viral stock solutions was
determined using the human embryonic fibroblast cell assay
described below.
Detection and titration of viruses. Rhinoviruses were detected by exposing confluent human embryonic fibroblast
cells in glass tubes to serial 10-fold dilutions of viruscontaining medium or lysates in MEM supplemented with 2%
GGFCS. Glass tubes were then incubated at 33°C for 7 days,
and the cytopathic effects of viruses on human embryonic
fibroblast cells were observed using an inverted microscope
(MIT; Olympus) as reported previously (20). The amount of
specimen required to infect 50% of human embryonic fibroblast cells (TCID50) was determined.
Viral infection of human tracheal epithelial cells. Medium
was removed from confluent monolayers of human tracheal
epithelial cells and was replaced with 1 ml of DMEM-Ham’s
F-12 containing 2% USG. Rhinovirus was added at a concentration of 105 TCID50 /ml. After a 1-h incubation at 33°C, the
viral solution was removed, and the cells were rinsed one time
with 1 ml of PBS. The cells were then fed with DMEM-Ham’s
F-12 containing 2% USG supplemented with 105 U/l penicillin, 100 mg/l streptomycin, 50 mg/l gentamicin, and 2.5 mg/l
amphotericin B and were cultured at 33°C with rolling in the
incubator (HDR-6-T; Hirasawa, Tokyo, Japan). Supernatants
were removed at various times after infection and were stored
at 280°C for the determination of viral content. Viral titers of
the material used for infection and of the supernatants
removed at the end of the infection period were also determined to estimate the maximal amount of viral uptake that
had occurred during the exposure period. As an additional
control for nonspecific adherence of virus, the content of
inocula after a 1-h incubation in empty glass tubes was also
assessed. Finally, cell-associated viral content was analyzed
using sonicated human tracheal epithelial cells. Viral content
in the supernatant and cell-associated viral content are
expressed as TCID50 units per milliliter and as TCID50 units
per 106 cells, respectively.
Effects of antibodies to ICAM-1 on rhinovirus infection.
Confluent human tracheal epithelial cells were incubated for
30 min at 37°C with medium alone, with medium containing
either of the two mouse monoclonal anti-human antibodies to
ICAM-1 [84H10 (100 µg/ml; Immunotech, Marseille, France)
or RR1 (100 µg/ml; a gift from Boehringer Ingelheim, Ridgefield, CT; see Ref. 14)], or with medium containing an
isotype-matched mouse immunoglobulin G1 (IgG1) control
monoclonal antibody (100 µg/ml; Chemicon International).
Both 84H10 and RR1 are IgG1 isotypes and recognize the
ICAM-1 functional domain. After excess antibodies were
washed off, the monolayers were exposed to HRV-2 (105
TCID50 /ml) or HRV-14 (105 TCID50 /ml) for either 15 or 60 min
before rinsing and adding fresh DMEM-Ham’s F-12 containing 2% USG supplemented with 105 U/l penicillin, 100 mg/l
streptomycin, 50 mg/l gentamicin, and 2.5 mg/l amphotericin
B. The viral content of this medium was then assessed at
various times after infection.
Detection of rhinovirus RNA and cytokine mRNA by reverse
transcription-polymerase chain reaction. Human tracheal
epithelial cells cultured in the glass tubes were lysed by the
addition of RNazol (0.2 ml/106 cells; BIOTECX, Houston, TX)
and were transferred into Eppendorf tubes. The cell homogenates were mixed with a 10% volume of chloroform, shaken
RHINOVIRUS INFECTION OF AIRWAY EPITHELIAL CELLS
vigorously for 15 s, placed on ice for 15 min, and centrifuged
at 12,000 g for 15 min at 4°C. The upper aqueous phase
containing RNA was collected and mixed with an equal
volume of isopropanol. Pellets of RNA were obtained by
centrifugation at 12,000 g for 15 min at 4°C, dissolved in a
water, and stored at 280°C before use.
Polymerase chain reaction (PCR) was performed as previously described (4, 10). Briefly, 2 µg of RNA from each aliquot
of human tracheal epithelial cells were dissolved in a 100-µl
buffer containing the reagents for the reverse transcriptase
(RT) reaction with the following composition: 50 mM tris(hydroxymethyl)aminomethane (Tris) · HCl (pH 8.3), 75 mM KCl,
3 mM MgCl2, 10 mM dithiothreitol, 5 U/µl Moloney murine
leukemia virus RT (GIBCO-BRL Life Technologies), 0.5 mM
deoxynucleoside 58-triphosphate (dNTP; Takara, Ohtsu, Japan), 1 U/µl ribonuclease inhibitor (Promega, Madison, WI),
and 5 µM random hexamers (Pharmacia Biotech, Uppsala,
Sweden). The RT reaction was performed for 60 min at 37°C,
followed by 95°C for 10 min. The resulting cDNA was frozen
at 280°C until use in the PCR. For each sample, 5 µl of RT
mixture were added to a 45-µl PCR mixture consisting of 10
mM Tris · HCl buffer (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2
mM dNTP, and 1.25 units Taq polymerase (Takara). Primer
pairs for the rhinovirus and cytokines were present at 2 ng/µl.
Sequences of the PCR primer pairs used in these experiments
are shown in Table 1. The PCR was performed in an automated thermal cycler (MJ Research, Watertown, MA), and 10
µl of the reaction were removed at 30 cycles for each sample.
Samples were separated on a 2% agarose gel (FMC BioProd-
Table 1. Polymerase chain reaction primer sequences
Target
Sequence
HRV
Sense
Antisense
b-Actin
Sense
Antisense
IL-1b
Sense
Antisense
IL-4
Sense
Antisense
IL-5
Sense
Antisense
IL-6
Sense
Antisense
IL-8
Sense
Antisense
IL-10
Sense
Antisense
GM-CSF
Sense
Antisense
TNF-a
Sense
Antisense
IFN-g
Sense
Antisense
Ref. No.
Base Pair
10
182–197
547–562
24
Sequence (58–38)
GCACTTCTGTTTCCCC
CGGACACCCAAAGTAG
835–857 CCTTCCTGGGCATGGAGTCCTGT
1,015–1,036 GGAGCAATGATCTTGATCTTCA
15
88–112
454–478
AAACAGATGAAGTGCTCCTTCCAGG
TGGAGAACACCACTTGTTGCTCCA
35
91–110
371–390
CCTCTGTTCTTCCTGCTAGC
CCGTTTCAGGAATCGGATCA
3
40–60
181–202
GAGCCATGAGGATGCTTCTGC
GGAATCCTCAGAGTCTCATTGG
9
42–60
345–366
CTTCTCCACAAGCGCCTTC
GCAAGTCTCCTCATTGAATCCA
16
147–173
341–365
TCTGCAGCTCTGTGTGAAGGTGCAGTT
AACCCTCTGCACCCAGTTTTCCTTG
30
323–349
648–674
CTGAGAACCAAGACCCAGACATCAAGG
CAATAAGGTTTCTCAAGGGGCTGGGTC
33
153–175
329–350
ACTGCTGCTGAGATGAATGAAAC
TGCACAGGAAGTTTCCGGGGTT
23
327–346
632–651
CAGAGGGAAGAGTTCCCCAG
CCTTGGTCTGGTAGGAGACG
6
190–213
447–466
CCTTAAGAAATATTTTAATGCAGG
GTCAGTTACCGAATAATTAG
HRV, human rhinovirus; IL, interleukin; GM-CSF, granulocyte
macrophage colony-stimulating factor; TNF-a, tumor necrosis factor-a; IFN-g, interferon-g.
L751
ucts, Rockland, ME) and were stained for 30 min in 1 µg/ml
ethidium bromide. The DNA bands were visualized on a
ultraviolet illuminator and were photographed with type 667
positive/negative film (Polaroid, Cambridge, MA).
For rhinovirus and each cytokine, mRNA expressions in
human tracheal epithelial cells were examined before and at
1, 3, and 5 days after HRV-14 infection.
Cytokine assays. In the preliminary study, we found that
the mRNA of IL-1b, IL-6, IL-8, TNF-a, and GM-CSF were
expressed in cultured human tracheal epithelial cells before
and after HRV-14 infection. To determine the effects of HRV-2
or HRV-14 infection on the production of cytokines, we
measured the amount of IL-1b, IL-6, IL-8, and TNF-a released from human tracheal epithelial cells into the culture
medium before and at 1, 3, and 5 days after HRV-2 or HRV-14
infection. We also measured the amount of GM-CSF and
IL-1a in the supernatants of human tracheal epithelial cells
before and after HRV-14 infection and the amount of IL-1b
and TNF-a in the viral stocks. Proteins of IL-1a, IL-1b, IL-6,
IL-8, TNF-a, and GM-CSF were measured by specific enzymelinked immunosorbent assays (ELISA). Sensitivities of the
assays were 10 pg/ml for the IL-1a and IL-1b ELISA kit
(Ohtsuka, Tokushima, Japan), the IL-6 ELISA kit (Toray,
Tokyo, Japan), and the IL-8 ELISA kit (Toray), 4 pg/ml for the
TNF-a ELISA kit (Ohtsuka), and 2 pg/ml for the GM-CSF
ELISA kit (Genzyme, Cambridge, MA). We used an average
value of replicate cultures from the same trachea (n 5 3) for
the analysis of cytokine production.
To determine the effects of antibodies to ICAM-1 on production of cytokines induced by HRV-2 or HRV-14, confluent
human tracheal epithelial cells were incubated for 30 min
with medium alone or with a medium containing either
84H10 (100 µg/ml) or RR1 (100 µg/ml) at 37°C before HRV-2
or HRV-14 infection. We also tested the effects of an isotypematched mouse IgG1 control monoclonal antibody (Chemicon
International) at the same concentration as antibodies to
ICAM-1 on production of cytokines induced by HRV-2
or HRV-14.
Northern blot analysis. Northern blot analysis was done as
described previously (26). Equal amounts of total RNA (10 µg)
extracted from human tracheal epithelial cells, as determined
spectrophotometrically, were subjected to electrophoresis in
1% agarose-formaldehyde gel. The gel was then transferred
via capillary action onto a nylon membrane (Hybond-N1;
Amersham Life Science). The membrane was hybridized with
[a-32P]dCTP (3,000 Ci/mmol; Amersham)-labeled human
ICAM-1 cDNA (1.8-kb Xba I fragment; British Bio-technology,
Oxon, UK) with a random-prime labeling kit (Random Primer;
Takara). Hybridization with a radiolabeled probe was performed overnight at 42°C. After high-stringency washing
was performed (13 standard saline citrate, 0.1% sodium
dodecyl sulfate, 60°C), autoradiographic detection of the
hybridized probe was performed by exposing Kodak Scientific
Imaging film for 48–72 h at 270°C. Quantitation of autoradiographic bands was accomplished with an image analyzer (Bio
Imaging Analyzer, BAS-2000; Fuji Photo Film) and was
expressed as the intensity of the ICAM-1/b-actin bands. We
used an average value of replicate cultures from the same
trachea (n 5 3) for analysis of the intensity of the ICAM-1/bactin bands.
To study the effects of HRV-2 or HRV-14 infection on the
mRNA expression of ICAM-1 in human tracheal epithelial
cells, cells were examined 1, 3, and 5 days after HRV-14
infection and 5 days after HRV-2 infection.
To determine the mechanisms responsible for upregulation
of ICAM-1 mRNA expression after HRV-14 infection, we
tested the effects of either IL-1b (200 pg/ml; Ohtsuka), IL-6
L752
RHINOVIRUS INFECTION OF AIRWAY EPITHELIAL CELLS
(100 pg/ml; Genzyme), IL-8 (100 pg/ml; Collaborative Research, Bedford, MA), or TNF-a (10 pg/ml; Genzyme) on
ICAM-1 mRNA expression in human tracheal epithelial cells.
The concentration of each cytokine chosen was matched to a
net increase in the culture medium after HRV-14 infection,
and cells were incubated overnight with each cytokine.
Effects of neutralizing antibodies to IL-1b and TNF-a on
HRV-14 infection and ICAM-1 mRNA expression. To determine the role of endogenous IL-1b in viral infection and
ICAM-1 expression, confluent human tracheal epithelial cells
were preincubated using a monoclonal mouse anti-human
IL-1b (10 µg/ml; Genzyme) or an isotype-matched mouse IgG1
control monoclonal antibody (Chemicon International), at the
same concentration for 5 days. We also tested the effects of a
monoclonal mouse anti-human TNF-a (10 µg/ml, 5 days;
Genzyme) on viral infection and ICAM-1 expression. Viral
titers in the supernatants collected during 3–5 days and the
expression of ICAM-1 mRNA 5 days after HRV-14 infection
(105 TCID50 /ml) were measured in confluent human tracheal
epithelial cells preincubated with each antibody.
Effects of IL-1b on susceptibility to HRV-14 infection. To
examine whether IL-1b increases the susceptibility to HRV-14
infection, confluent human tracheal epithelial cells were
preincubated with or without IL-1b (200 pg/ml) for 24 h. The
epithelial cells were then exposed to serial 10-fold dilutions of
HRV-14 for 1 h at 33°C. The presence of HRV-14 in supernatants collected during 1–3 days after infection was determined using the human embryonic fibroblast cell assay
described above to assess whether infection occurred at each
dose of HRV-14 used. This index of susceptibility to infection,
defined as the minimum dose of HRV-14 that could induce
infection, was compared with the susceptibility of control
cells that were not preincubated with IL-1b (27).
Immunohistochemical analysis. Immunohistochemical
analysis for ICAM-1 expression in human tracheal epithelial
cells was done as described previously (21). Human tracheal
epithelial cells were cultured on Vitrogen gels on Millicell
inserts (0.45 µm pore size and 0.6 cm2 area; Millipore
Products Division; see Ref. 34). Cell sheets were fixed in
periodate-lysine-paraformaldehyde at 4°C for 2 h. After a
wash in sucrose (10, 15, or 20%)-PBS, they were embedded in
optimum cutting temperature compound (Miles Laboratories,
Naperville, IL) in liquid nitrogen and were stored at 270°C
until use. The staining was performed using an alkaline
phosphatase-anti-alkaline phosphatase (APAAP) method.
Cryostat sections (6 µm) were incubated with 75% heatinactivated normal human AB serum (Sigma) in Tris-buffered
saline (pH 7.6) containing 0.05 M Tris base, 0.15 M NaCl, 0.01
M N-2-hydroxyethylpiperazine-N8-2-ethanesulfonic acid, and
0.01% saponin (TBS[H 1 S]; Sigma) for 1 h at room temperature and then with 20% normal rabbit serum (Dako) in
TBS[H 1 S] for 20 min at room temperature to block nonspecific binding of the first and second antibodies. The sections
were overlaid with 4 µg/ml of the antibody 84H10 (Immunotech) or with an isotype-matched mouse monoclonal antibody
with the irrelevant specificity (Chemicon International) in
TBS[H 1 S] containing 1% bovine serum albumin (TBS[H 1
S]-BSA, fraction V; Sigma). After overnight incubation at 4°C,
the sections were incubated with anti-mouse immunoglobulin
rabbit immunoglobulins (Dako) diluted 40 times with
TBS[H 1 S]-BSA for 30 min at room temperature followed by
incubation with soluble complexes of alkaline phosphatase and
mouse monoclonal anti-alkaline phosphatase (Dako) diluted
60 times with TBS[H 1 S]-BSA for 30 min at room temperature. After one more repeat of these procedures, the sections
were developed by exposure to substrate for 8 min with the
fast red substrate system (Dako) according to the manufacturer’s protocol and were counterstained with hematoxylin.
To study the effects of HRV-14 infection on ICAM-1 expression in human tracheal epithelial cells, HRV-14 was added at
a concentration of 105 TCID50 /ml to the mucosal side of cell
sheets cultured on Millicell inserts. After a 1-h incubation at
33°C, the viral solution was removed, and both sides of the
cell sheets were rinsed with PBS. Before immunohistochemical studies, cell sheets were cultured for 2 days at 33°C.
We also tested the effects of either IL-1b (200 pg/ml;
Ohtsuka), IL-6 (100 pg/ml; Genzyme), IL-8 (100 pg/ml; Collaborative Research), or TNF-a (10 pg/ml; Genzyme) on ICAM-1
expression in human tracheal epithelial cells. Cells were incubated overnight with each cytokine. In addition, we tested
a 10 ng/ml concentration of IL-1b as a positive control (29).
Statistical analysis. Results are expressed as means 6 SE.
Statistical analysis was performed using a one-way analysis
of variance (ANOVA), and multiple comparisons were made
using Bonferroni’s method. Significance was accepted at P ,
0.05; n refers to the number of donors from which cultured
epithelial cells were used.
Fig. 1. Viral titers in supernatants of human tracheal epithelial cells
obtained at different times after exposure to 105 TCID50 /ml of human
rhinovirus (HRV)-14 (s) and HRV-2 (r). TCID50 is the amount of
specimen required to infect 50% of human embryonic fibroblast cells.
A: viral titers in supernatants collected at sequential times during
the first 24 h after infection. B: viral titers of HRV-14 (open bars) and
HRV-2 (filled bars) in supernatants collected during 1–3 days, 3–5
days, and 5–7 days after infection. Results are reported as means 6
SE from 7 samples.
RHINOVIRUS INFECTION OF AIRWAY EPITHELIAL CELLS
L753
Fig. 2. Time course of replication of
rhinovirus RNA from human tracheal
epithelial cells after HRV-14 infection
detected by reverse transcription-polymerase chain reaction. b-Actin was used
as a housekeeping gene. M, fX174/
Hinc II fragment molecular weight
markers. Data are representative of 3
different experiments.
RESULTS
Rhinovirus infection of human tracheal epithelial
cells. Exposing confluent human tracheal epithelial cell
monolayers to HRV-2 or HRV-14 (105 TCID50 /ml) consistently led to infection. Collection of culture medium at
differing times after viral exposure revealed no detectable virus at 1 h after infection. Both HRV-2 and
HRV-14 were detected in culture medium 6 h after
infection, and the viral content progressively increased
between 6 and 24 h after infection (Fig. 1A). Evidence of
Fig. 3. Time course of release of cytokines into
supernatants of human tracheal epithelial cells after
HRV-14 (A) and HRV-2 (B) infection (r). (s) Sham
infection (control). IL, interleukin; TNF-a, tumor
necrosis factor-a. Results are reported as means 6
SE from 7 samples. Significant differences from
corresponding control values are indicated by * P ,
0.05 and ** P , 0.01.
L754
RHINOVIRUS INFECTION OF AIRWAY EPITHELIAL CELLS
continuous viral production was obtained by the demonstration that the viral titers of supernatants collected
during 1–3 days, 3–5 days, and 5–7 days after infection
each contained significant levels of HRV-2 or HRV-14
(Fig. 1B). Analysis of the levels of cell-associated virus
(the virus detectable in sonicates of the human tracheal
epithelial cells) followed a similar time course to that
observed in the medium. The viral titers of cellassociated HRV-14 were 0.0 6 0.0 log TCID50 units at 1
h, 0.1 6 0.1 log TCID50 units at 6 h, 0.8 6 0.1 log TCID50
units at 12 h, 2.2 6 0.3 log TCID50 units at 24 h, 2.5 6
0.3 log TCID50 units at 3 days, 2.2 6 0.3 log TCID50
units at 5 days, and 1.6 6 0.3 log TCID50 units at 7 days
(n 5 7 each). In both cell supernatants and lysates,
viral titer levels increased significantly with time
(P , 0.05 in each case by ANOVA). Viral titers at 24 h
after HRV-14 infection in cells from smokers did not
differ significantly from those in nonsmokers (3.2 6 0.3
log TCID50 units in smokers vs. 3.3 6 0.3 log TCID50
units in nonsmokers; P . 0.50). Human tracheal cell
viability, as assessed by the exclusion of trypan blue,
was consistently .96% in HRV-14-infected culture.
Likewise, HRV-14 infection did not alter the amount of
LDH in the supernatants (29 6 3 IU/l before vs. 33 6 3
IU/l 5 days after infection; P . 0.20, n 5 7). HRV-14
infection also had no effect on cell numbers. Cell counts
24 h after infection were not significantly different
(1.7 6 0.1 3 106 in noninfected cells vs. 1.7 6 0.2 3 106
in infected cells; P . 0.50, n 5 7).
Detection of viral RNA by PCR. Further evidence of
HRV-14 infection of human tracheal epithelial cells and
of viral replication was provided by PCR analysis (Fig.
2). In each of three experiments, RNA extracted from
uninfected cells did not produce any detectable PCR
product at 381 bp (0 h). A faint product was observable
in RNA extracted from cells 6 h after infection followed
by a progressive increase in viral RNA until 3 days after infection.
Effects of rhinovirus infection on cytokine production.
Human tracheal epithelial cells were screened for
mRNA expression of various cytokines. PCR analysis
revealed mRNA expression for IL-1b, IL-6, IL-8, TNF-a,
and GM-CSF before and after cells were exposed to
HRV-14 (105 TCID50 /ml). However, mRNA for IL-4,
IL-5, IL-10, and interferon-g were not detectable in
human tracheal epithelial cells before and after HRV-14
infection in all seven experiments (data not shown).
Figure 3 shows the time course of IL-1b, IL-6, IL-8, and
TNF-a production in supernatants of human tracheal
epithelial cells after HRV-14 (Fig. 3A) or HRV-2 (Fig.
3B) infection. Because viral infection did not alter cell
numbers (see above), all cytokine values are reported in
picograms per milliliter of supernatant. Basal secretion
was quite high with IL-8, relatively high with IL-6, but
low or negligible with IL-1b and TNF-a. However,
secretion of IL-1b, IL-6, IL-8, and TNF-a all increased
in response to both HRV-2 and HRV-14, although, in
terms of absolute levels, IL-1b (195 6 15 pg/ml in
HRV-2 and 145 6 15 pg/ml in HRV-14) and IL-6 (185 6
22 pg/ml in HRV-2 and 120 6 14 pg/ml in HRV-14)
predominated. Of the cytokines measured, GM-CSF
Fig. 4. Release of cytokines into supernatants of human tracheal
epithelial cells in the presence of monoclonal antibodies of RR1 (filled
bars) and 84H10 (stippled bars) to intercellular adhesion molecule-1
(ICAM-1) mouse purified immunoglobulin G1 (IgG1) monoclonal
antibody (hatched bars) or absence of an antibody (control; open
bars). Results are reported as means 1 SE from 7 samples. Significant differences from viral infection alone are * P , 0.05 and ** P ,
0.01. Effects of monoclonal antibodies to ICAM-1 and mouse IgG1
monoclonal antibody were examined at the maximal production of
each cytokine after HRV-14 (A) and HRV-2 (B) infection.
RHINOVIRUS INFECTION OF AIRWAY EPITHELIAL CELLS
and IL-1a levels were not changed by HRV-14 infection
(140 6 10 pg/ml before vs. 165 6 18 pg/ml after in
GM-CSF and 12 6 2 pg/ml before vs. 13 6 2 pg/ml after
in IL-1a; P . 0.20, n 5 7).
In contrast to supernatants of human tracheal epithelial cells, neither IL-1b nor TNF-a was detectable in
viral stocks.
Effects of antibodies to ICAM-1 on rhinovirus infection and cytokine production. Incubation of cells with
both mouse monoclonal antibodies to ICAM-1 completely blocked HRV-14 infection, as assessed by the
absence of detectable viral titers in the supernatants
recovered 24 h after 15 min of HRV-14 exposure
(2.2 6 0.2 log TCID50 units in control, 0 6 0 log TCID50
units in 84H10, and 0 6 0 log TCID50 units in RR1).
Likewise, viral titers 24 h after 60 min of HRV-14
exposure were significantly decreased by 84H10
(1.7 6 0.3 log TCID50 units; P , 0.01, n 5 7) and RR1
(1.9 6 0.3 log TCID50 units; P , 0.01, n 5 7) from control values (3.3 6 0.1 log TCID50 units; n 5 7). These
treatments also significantly inhibited increases in
IL-1b, IL-6, IL-8, and TNF-a production induced by
HRV-14 infection (Fig. 4A). However, an isotypematched IgG1 control monoclonal antibody failed to
alter viral titers in the supernatants 24 h after 15 min
of viral exposure (2.3 6 0.2 log TCID50 units; P . 0.50,
n 5 7) and 60 min of viral exposure (3.3 6 0.2 log
TCID50 units; P . 0.50, n 5 7). Likewise, IgG1 control
monoclonal antibody did not inhibit increases in IL-1b,
IL-6, IL-8, and TNF-a production induced by HRV-14
infection (Fig. 4A). In contrast to HRV-14, viral titers in
the supernatants recovered 24 h after 15 min of HRV-2
exposure were not altered by 84H10 (2.4 6 0.2 log
TCID50 units; P . 0.50, n 5 7) and RR1 (2.3 6 0.2 log
TCID50 units; P . 0.50, n 5 7) from control values
L755
(2.3 6 0.2 log TCID50 units; n 5 7) and from values of
IgG1 control monoclonal antibody treatment (2.2 6 0.3
log TCID50 units; n 5 7). Neither 84H10, RR1, nor IgG1
control monoclonal antibody altered increases in production of IL-1b, IL-6, IL-8, and TNF-a induced by HRV-2
infection (Fig. 4B).
Effect of rhinovirus infection on ICAM-1 mRNA expression. The baseline expression of ICAM-1 was constant
in confluent human tracheal epithelial cell sheets, and
the coefficient of variation was small (9.8%; n 5 22).
Neither smoking habit nor cause of death influenced
the baseline expression of ICAM-1 mRNA. Exposure of
human tracheal epithelial cells to HRV-14 (Fig. 5A) or
HRV-2 (Fig. 5B) caused increases in ICAM-1 mRNA
compared with sham exposure (control). Human tracheal epithelial cells 5 days after HRV-14 (Fig. 5C) or
HRV-2 (Fig. 5D) infection were shown to overexpress
ICAM-1 mRNA twofold compared with those 5 days
after a sham exposure. IL-1b (200 pg/ml) increased
ICAM-1 mRNA to the levels similar to those induced by
rhinovirus infection expressed as the intensity of the
ICAM-1/b-actin bands (0.49 6 0.03 scan units; P , 0.01,
n 5 7). However, neither IL-6 (100 pg/ml), IL-8 (100
pg/ml), nor TNF-a (10 pg/ml) altered the levels
(0.23 6 0.03 scan units in IL-6, 0.22 6 0.03 scan units
in IL-8, and 0.21 6 0.03 scan units in TNF-a; P . 0.20,
n 5 7) compared with sham exposure (0.21 6 0.02 scan
units; n 5 7).
Effects of neutralizing antibodies to IL-1b and TNF-a
on viral infection and ICAM-1 mRNA expression. The
monoclonal mouse anti-human IL-1b (10 µg/ml) significantly decreased HRV-14 titers of supernatant collected during 3–5 days (Fig. 6A) and inhibited ICAM-1
mRNA expression in human tracheal epithelial cells
(Fig. 6B). In contrast, neither the monoclonal mouse
Fig. 5. Northern blot analysis demonstrating increases
in ICAM-1 mRNA levels of human tracheal epithelial
cells 1, 3, and 5 days after HRV-14 infection (A) and 5
days after HRV-2 infection (B) compared with sham
infection (control). b-Actin was used as a housekeeping
gene. C and D: expression of ICAM-1 mRNA in human
tracheal epithelial cells 5 days after HRV-14 infection
(C) and HRV-2 infection (D; filled bars). Open bars,
sham infection (control). ICAM-1 mRNA is normalized
to constitutive expression of b-actin mRNA. Results are
reported as means 1 SE from 7 samples. Significant
differences from corresponding control values are indicated by ** P , 0.01.
L756
RHINOVIRUS INFECTION OF AIRWAY EPITHELIAL CELLS
(Fig. 7C) or 10 ng/ml (Fig. 7D) mimicked HRV-14 infection, with a stronger staining observed in the latter.
In contrast, treatment with either IL-6, IL-8, or TNF-a
failed to alter ICAM-1 expression in the human tracheal epithelial cells (not shown).
DISCUSSION
Fig. 6. HRV-14 titers in supernatants collected during 3–5 days (A)
and expression of ICAM-1 mRNA (B) in human tracheal epithelial
cells 5 days after HRV-14 infection in the presence of neutralizing
antibodies to IL-1b (a-IL-1b; 10 µg/ml; filled bars), TNF-a (a-TNF-a;
10 µg/ml; stippled bars), or mouse IgG1 monoclonal antibody (IgG1; 10
µg/ml; hatched bars) and absence of an antibody (control; open bars).
ICAM-1 mRNA is normalized to constitutive expression of b-actin
mRNA. Results are reported as means 1 SE from 7 samples.
Significant differences from HRV-14 infection alone are indicated by
** P , 0.01.
anti-human TNF-a (10 µg/ml) nor mouse IgG1 control
monoclonal antibody (10 µg/ml) altered viral titers of
supernatant (Fig. 6A) and ICAM-1 mRNA expression
(Fig. 6B).
Effects of IL-1b on susceptibility to HRV-14 infection.
Pretreatment of the human tracheal epithelial cells for
24 h with IL-1b (200 pg/ml) increased the susceptibility
of cells to HRV-14 infection, decreasing by 10-fold the
minimum dose of virus necessary to cause infection
(1.1 6 0.1 log TCID50 units in IL-1b vs. 2.2 6 0.2 log
TCID50 units in control; P , 0.01, n 5 7).
Immunohistochemical analysis. Figure 7 shows
ICAM-1 expression in the human tracheal epithelial
cells, which was detected as a red color. HRV-14 infection (Fig. 7B) increased ICAM-1 expression in both
apical and basolateral sides compared with sham infection, which caused staining only on the basolateral side
(Fig. 7A). Treatment with IL-1b at either 200 pg/nl
Primary cultures of human airway epithelial cells
are thought to be important for characterizing viral
infection in the airway and for advancing our knowledge of airway inflammation (8). Respiratory viral
infection of primary cultures of human nasal epithelial
cells were reported previously, but these cultures contained a significant number of fibroblasts (32), making
it difficult to interpret the results obtained. We report
rhinovirus infection of primary cultures of the human
tracheal epithelial cells that do not contain other cell
types such as fibroblasts (34). However, it should be
noted here that this model system has significant
differences from airway epithelial cells in vivo.
Viral infection of cultured human tracheal epithelial
cells and subsequent viral replication were confirmed
by showing the increased viral content in the culture
medium of infected cells with time, assessed by the
cytopathic effects of this medium on human embryonic
fibroblast cells, and by showing that the cytopathic
effects of human tracheal epithelial cell lysates also
increased with time after infection. Viral replication
was also detected by PCR of viral RNA after reverse
transcription into DNA. A progressive increase in viral
RNA, observed until 3 days after infection, was detected by a pronounced band on PCR compared with the
absence of any signal in RNA extracted from uninfected
cells. Infections of human tracheal epithelial cells with
HRV-2 and HRV-14 were consistently observed when
confluent monolayers were exposed to virus. However,
HRV-14 infection failed to influence both cell numbers
and cell viability. This is in agreement with previous
studies showing the lack of cytotoxicity on epithelial
cells in rhinovirus infection (27, 32).
Infection of the respiratory epithelium by viruses has
been shown to cause increased production of cytokines
(19, 27). Subauste et al. (27) demonstrated that infection of BEAS-2B cells with HRV-14 induced an increased production of IL-6, IL-8, and GM-CSF. The
present study is in agreement with a previous study
showing the enhanced production of IL-6 and IL-8
within 24 h after infection (27). However, infection of
human tracheal epithelial cells with HRV-2 and HRV-14
also caused increases in the production of IL-1b and
TNF-a, which differed significantly from HRV-14 infection of BEAS-2B cells (27). Although an increase in
TNF-a production after infection was subtle and that in
IL-8 was ,30% from the baseline, there was a large
amount of IL-1b production from human tracheal epithelial cells in the present study, which was maximal at
3 days and was sustained up to 5 days after infection.
IL-1b is a potent inflammatory cytokine that induces
growth and differentiation of T and B lymphocytes,
other cytokine productions, prostaglandin E2 synthesis,
and degranulation from neutrophils (1). IL-1b also
RHINOVIRUS INFECTION OF AIRWAY EPITHELIAL CELLS
L757
Fig. 7. ICAM-1 expression in human tracheal epithelial cells cultured for 2 days after sham infection (A; control) or
HRV-14 infection (B) and that treated with either 200 pg/ml (C) or 10 ng/ml (D) concentration of IL-1b. Cells
expressing ICAM-1 are stained as red and are indicated by arrows (bar 5 20 µm and magnification 5 3100).
causes increases in ICAM-1 expression on both epithelial and vascular endothelial cells (1, 5, 29). Increases
in ICAM-1 expression on vascular endothelial cells
promote the adhesion of neutrophils, monocytes, and
lymphocytes to these cells (5). Likewise, upregulation
of ICAM-1 on HeLa cells is associated with the increased binding of major group rhinoviruses (28).
The specificity of the infection process for primary
cultures of human tracheal epithelial cells by HRV-14
was confirmed by demonstrating that infection could be
blocked using antibodies to ICAM-1 but not by an
isotype-matched IgG1 monoclonal antibody. Furthermore, antibodies to ICAM-1 failed to block HRV-2
infection, a minor group of rhinoviruses that do not use
ICAM-1 as its receptor. However, inhibition became
less consistent at longer incubation times (e.g., 1 h),
presumably because of the high affinity of the virus for
its receptor and of the requirement for very few viral
particles to enter the cell to induce infection (27). In
addition, we showed that antibodies to ICAM-1 significantly inhibited the production of IL-1b, IL-6, IL-8, and
TNF-a induced by HRV-14 but that HRV-2-induced
effects on cytokine production were not altered by
antibodies to ICAM-1. However, antibodies to ICAM-1
could not achieve complete inhibition of cytokine production induced by HRV-14 infection, which may be also
due to longer incubation times described above. Furthermore, we showed that rhinovirus infection and IL-1b at
the experimentally measured concentration in supernatants upregulated ICAM-1 expression assessed by increases in ICAM-1 mRNA using Northern blot analysis,
whereas an increase in ICAM-1 mRNA was two times
the control and relatively small compared with the
study on respiratory syncytial virus infection of human
pulmonary type II-like epithelial (A549) cells (22).
Similar to ICAM-1 mRNA levels, however, both HRV-14
infection and IL-1b increased ICAM-1 expression on
epithelial cells as shown by immunohistochemical
analysis, and IL-1b increased susceptibility to HRV-14
infection. Furthermore, enhancement of ICAM-1 mRNA
expression by HRV-14 infection was almost entirely
blocked by the antibody to IL-1b, and the anti-IL-1b
antibody significantly inhibited HRV-14 infection, confirming the role of the endogenous IL-1b in viral
infection and ICAM-1 expression in the present study.
Although TNF-a is reported to upregulate the expression of ICAM-1 on epithelial cells (27), the present
study failed to show the expression. Furthermore, the
antibody to TNF-a did not alter HRV-14 infection or
ICAM-1 mRNA expression. Lack of TNF-a-induced
effects on ICAM-1 mRNA expression is probably due to
a small amount of TNF-a production from human
tracheal epithelial cells in response to HRV-14 infection. Although IL-1a is reported to be induced by A549
cells in response to respiratory syncytial virus infection
(22), HRV-14 did not alter IL-1a production in the
present study. The discrepancy may be explained by
differences in the species of virus and cultured cells.
Upregulation of ICAM-1 expression on epithelial
cells and the production of cytokines from these cells
in response to rhinovirus infection may be relevant to
the pathogenesis of airway inflammation associated
with colds and mechanisms of viral exacerbations of
asthma. IL-6 induces antibody production in B cells
and T cell activation and differentiation (1). IL-8 is a
major chemoattractant for neutrophils and stimulates
neutrophils to cause enzyme release and production of
reactive oxygen metabolites (12). Neutrophils and lymphocytes are shown to be predominant cell types in the
nasal mucosa during rhinovirus infection (13). Like-
L758
RHINOVIRUS INFECTION OF AIRWAY EPITHELIAL CELLS
wise, upregulation of ICAM-1 could increase susceptibility to major group rhinoviruses (7, 28) and could lead
cells adjacent to infected cells to infection when viruses
are released from the cells originally infected. Furthermore, chronic antigen challenge is shown to increase
ICAM-1 expression on airway epithelium, which may
be related to airway inflammation in asthma (31).
Inflammatory conditions such as asthma, smoking, and
ozone exposure in which ICAM-1 expression is increased on respiratory epithelial surfaces may cause a
predisposition to rhinovirus infection through increasing expression of the major group of rhinovirus receptors. The rhinovirus infection would enhance airway
inflammation by recruiting neutrophils and, potentially, other inflammatory cells, causing increased mediator release and exacerbation of the underlying reactive airway diseases.
In summary, we have shown, for the first time, that
rhinovirus is infectious in primary cultures of human
tracheal epithelial cells. Rhinovirus infection upregulates ICAM-1 expression on epithelial cells. Rhinovirus
infection induces an increased production of cytokines
that regulate the acute phase reaction of airway inflammation. Of these, IL-1b is able to upregulate ICAM-1
expression and to increase the susceptibility to HRV-14
infection, and the antibody to IL-1b inhibited both viral
infection and ICAM-1 expression. Furthermore, antibodies to ICAM-1 reduce the production of cytokines
induced by HRV-14 infection. These findings suggest
that rhinoviruses per se amplify their infection by the
overexpression of ICAM-1 on epithelial cells through
the production of IL-1b, resulting in a further increase
in the production of inflammatory cytokines. A recent
report has also demonstrated a similar IL-1a-dependent autocrine mechanism in respiratory syncytial
virus infection of A549 cells (22). Thus these processes
may be relevant to airway inflammation induced by
respiratory viruses and viral exacerbations of asthma.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
We thank Grant Crittenden for English correction and Akira
Ohmi, Michiko Okamoto, and Minako Tada for technical assistance.
Address for reprint requests: H. Sasaki, Dept. of Geriatric Medicine, Tohoku University School of Medicine, Aoba-ku Seiryo-machi
1-1, Sendai 980, Japan.
17.
Received 16 September 1996; accepted in final form 24 June 1997.
18.
REFERENCES
1. Akira, S., T. Hirano, T. Taga, and T. Kishimoto. Biology of
multifunctional cytokines: IL 6 and related molecules (IL 1 and
TNF). FASEB J. 4: 2860–2867, 1990.
2. Amador, E., L. E. Dorfman, and W. E. C. Wacker. Serum lactic
dehydrogenase activity: an analytical assessment of current
assays. Clin. Chem. 9: 391–399, 1963.
3. Azuma, C., T. Tanabe, M. Konishi, T. Kinashi, T. Noma, F.
Matsuda, Y. Yaoita, K. Takatsu, L. Hammarstrom, C. I. E.
Smith, E. Severinson, and T. Honjo. Cloning of cDNA for
human T-cell replacing factor (interleukin-5) and comparison
with the murine homologue. Nucleic Acids Res. 14: 9149–9158,
1986.
4. Becker, S., H. S. Koren, and D. C. Henke. Interleukin-8
expression in normal nasal epithelium and its modulation by
infection with respiratory syncytial virus and cytokines tumor
necrosis factor, interleukin-1, and interleukin-6. Am. J. Respir.
Cell Mol. Biol. 8: 20–27, 1993.
5. Cavender, D. E., D. O. Haskard, B. Joseph, and M. Ziff.
Interleukin 1 increases the binding of human B and T lympho-
19.
20.
21.
22.
cytes to endothelial cell monolayers. J. Immunol. 136: 203–207,
1986.
Devos, R., H. Cheroutre, Y. Taya, W. Degrave, H. van
Heuverswyn, and W. Fiers. Molecular cloning of human
immune interferon cDNA and its expression in eukaryotic cells.
Nucleic Acids Res. 10: 2487–2501, 1982.
Greve, J. M., G. Davis, A. M. Meyer, C. P. Forte, S. C. Yost, C.
W. Marlor, M. E. Kamarck, and A. McClelland. The major
human rhinovirus receptor is ICAM-1. Cell 56: 839–847, 1989.
Gruenert, D. C., W. E. Finkbeiner, and J. H. Widdicombe.
Culture and transformation of human airway epithelial cells.
Am. J. Physiol. 268 (Lung Cell. Mol. Physiol. 12): L347–L360,
1995.
Hirano, T., K. Yasukawa, H. Harada, T. Taga, Y. Watanabe,
T. Matsuda, S. Kashiwamura, K. Nakajima, K. Koyama, A.
Iwamatsu, S. Tsunasawa, F. Sakiyama, H. Matsui, Y. Takahara, T. Taniguchi, and T. Kishimoto. Complementary DNA
for a novel human interleukin (BSF-2) that induces B lymphocytes to produce immunoglobulin. Nature (Lond.) 324: 73–76,
1986.
Johnston, S. L., G. Sanderson, P. K. Pattemore, S. Smith, P.
G. Bardin, C. B. Bruce, P. R. Lambden, D. A. J. Tyrrell, and
S. T. Holgate. Use of polymerase chain reaction for diagnosis of
picornavirus infection in subjects with and without respiratory
symptoms. J. Clin. Microbiol. 31: 111–117, 1993.
Lambert, H. P., and H. Stern. Infective factors in exacerbations
of bronchitis and asthma. Br. Med. J. 3: 323–327, 1972.
Leonard, E. J., and T. Yoshimura. Neutrophil attractant/
activation protein-1 (NAP-1 [interleukin-8]). Am. J. Respir. Cell
Mol. Biol. 2: 479–486, 1990.
Levandowski, R. A., C. W. Weaver, and G. G. Jackson. Nasal
secretion leukocyte populations determined by flow cytometry
during acute rhinovirus infection. J. Med. Virol. 25: 423–432,
1988.
Makgoba, M. W., M. E. Sanders, G. E. Ginther Luce, M. L.
Dustin, T. A. Springer, E. A. Clark, P. Mannoni, and S.
Shaw. ICAM-1 a ligand for LFA-1-dependent adhesion of B, T
and myeloid cells. Nature (Lond.) 331: 86–88, 1988.
March, C. J., B. Mosley, A. Larsen, D. P. Cerretti, G. Braedt,
V. Price, S. Gillis, C. S. Henney, S. R. Kronheim, K. Grabstein, P. J. Conlon, T. P. Hopp, and D. Cosman. Cloning,
sequence and expression of two distinct human interleukin-1
complementary DNAs. Nature (Lond.) 315: 641–647, 1985.
Matsushima, K., K. Morishita, T. Yoshimura, S. Lavu, Y.
Kobayashi, W. Lew, E. Appella, H. F. Kung, E. J. Leonard,
and J. J. Oppenheim. Molecular cloning of a human monocytederived neutrophil chemotactic factor (MDNCF) and the induction of MDNCF mRNA by interleukin 1 and tumor necrosis
factor. J. Exp. Med. 167: 1883–1893, 1988.
Minor, T. E., E. C. Dick, J. W. Baker, J. J. Ouellette, M.
Cohen, and C. E. Reed. Rhinovirus and influenza type A
infections as precipitants of asthma. Am. Rev. Respir. Dis. 113:
149–153, 1976.
Nicholson, K. G., J. Kent, and D. C. Ireland. Respiratory
viruses and exacerbations of asthma in adults. Br. Med. J. 307:
982–986, 1993.
Noah, T. L., and S. Becker. Respiratory syncytial virus-induced
cytokine production by a human bronchial epithelial cell line.
Am. J. Physiol. 265 (Lung Cell. Mol. Physiol. 9): L472–L478,
1993.
Numazaki, Y., T. Oshima, A. Ohmi, A. Tanaka, Y. Oizumi, S.
Komatsu, T. Takagi, M. Karahashi, and N. Ishida. A microplate method for isolation of viruses from infants and children
with acute respiratory infections. Microbiol. Immunol. 31: 1085–
1095, 1987.
Ohkawara, Y., K. Yamauchi, N. Maruyama, H. Hoshi, I.
Ohno, M. Honma, Y. Tanno, G. Tamura, K. Shirato, and H.
Ohtani. In situ expression of the cell adhesion molecules in
bronchial tissues from asthmatics with air flow limitation: in
vivo evidence of VCAM-1/VLA-4 interaction in selective eosinophil infiltration. Am. J. Respir. Cell Mol. Biol. 12: 4–12, 1995.
Patel, J. A., M. Kunimoto, T. C. Sim, R. Garofalo, T. Eliott, S.
Baron, O. Ruuskanen, T. Chonmaitree, P. L. Ogra, and F.
Schmalstieg. Interleukin-1a mediates the enhanced expression
of intercellular adhesion molecule-1 in pulmonary epithelial cells
RHINOVIRUS INFECTION OF AIRWAY EPITHELIAL CELLS
23.
24.
25.
26.
27.
28.
29.
infected with respiratory syncytial virus. Am. J. Respir. Cell Mol.
Biol. 13: 602–609, 1995.
Pennica, D., G. E. Nedwin, J. S. Hayflick, P. H. Seeburg, R.
Derynck, M. A. Palladino, W. J. Kohr, B. B. Aggarwal, and
D. V. Goeddel. Human tumor necrosis factor: precursor structure, expression and homology to lymphotoxin. Nature (Lond.)
312: 724–729, 1984.
Pnote, P., S. Y. Ng, J. Engel, P. Gunning, and L. Kedes.
Evolutionary conservation in the untranslated regions of actin
mRNAs: DNA sequence of a human beta-actin cDNA. Nucleic
Acids Res. 12: 1687–1696, 1984.
Reddel, R. R., Y. Ke, B. I. Gerwin, M. G. McMenamin, J. F.
Lechner, R. T. Su, D. E. Brash, J.-B. Park, J. S. Rhim, and
C. C. Harris. Transformation of human bronchial epithelial cells
by infection with SV40 or adenovirus-14 SV40 hybrid virus, or
transfection via strontium phosphate coprecipitation with a
plasmid containing SV40 early region genes. Cancer Res. 48:
1904–1909, 1988.
Sambrook, J., E. F. Fritsch, and T. Maniatis. Molecular
Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory, 1989, vol. 4.
Subauste, M. C., D. B. Jacoby, S. M. Richards, and D.
Proud. Infection of a human respiratory epithelial cell line with
rhinovirus. Induction of cytokine release and modulation of
susceptibility to infection by cytokine exposure. J. Clin. Invest.
96: 549–557, 1995.
Tomassini, J. E., D. Graham, C. M. DeWitt, D. W. Lineberger, J. A. Rodkey, and R. J. Colonno. cDNA cloning
reveals that the major group rhinovirus receptor on HeLa cells is
intercellular adhesion molecule 1. Proc. Natl. Acad. Sci. USA 86:
4907–4911, 1989.
Tosi, M. F., J. M. Stark, C. W. Smith, A. Hamedani, D. C.
Gruenert, and M. D. Infeld. Induction of ICAM-1 expression
30.
31.
32.
33.
34.
35.
L759
on human airway epithelial cells by inflammatory cytokines:
effects on neutrophil-epithelial cell adhesion. Am. J. Respir. Cell
Mol. Biol. 7: 214–221, 1992.
Vieira, P., R. De Waal-Malefyt, M.-N. Dang, K. E. Johnson,
R. Kastelein, D. F. Fiorentino, J. E. DeVries, M.-G. Roncarolo, T. R. Mosmann, and K. W. Moore. Isolation and
expression of human cytokine synthesis inhibitory factor cDNA
clones: homology to Epstein-Barr virus open reading frame
BCRFI. Proc. Natl. Acad. Sci. USA 88: 1172–1176, 1991.
Wegner, C. D., R. H. Gundel, P. Relly, N. Haynes, L. G. Letts,
and R. Rothlein. Intercellular adhesion molecule-1 (ICAM-1) in
the pathogenesis of asthma. Science 247: 456–459, 1990.
Winther, B., J. M. Gwaltney, and J. O. Hendley. Respiratory
virus infection of monolayer cultures of human nasal epithelial
cells. Am. Rev. Respir. Dis. 141: 839–845, 1990.
Wong, G. G., J. S. Witek, P. A. Temple, K. M. Wilkens, A. C.
Leary, D. P. Luxenberg, S. S. Jones, E. L. Brown, R. M. Kay,
E. C. Orr, C. Shoemaker, D. W. Golde, R. J. Kaufman, R. M.
Hewick, E. A. Wang, and S. C. Clark. Human GM-CSF:
molecular cloning of the complementary DNA and purification of
the natural and recombinant proteins. Science 228: 810–815,
1985.
Yamaya, M., W. E. Finkbeiner, S. Y. Chun, and J. H.
Widdicombe. Differentiated structure and function of cultures
from human tracheal epithelium. Am. J. Physiol. 262 (Lung Cell.
Mol. Physiol. 6): L713–L724, 1992.
Yokota, T., T. Otsuka, T. Mosmann, J. Banchereau, T.
DeFrance, D. Blanchard, J. E. De Varies, F. Lee, and K.-I.
Arai. Isolation and characterization of a human interleukin
cDNA clone, homologous to mouse B-cell stimulatory factor 1,
that expresses B-cell- and T-cell-stimulating activities. Proc.
Natl. Acad. Sci. USA 83: 5894–5898, 1986.