This information is current as
of June 18, 2017.
Functional Blocking Monoclonal Antibodies
against IL-12p40 Homodimer Inhibit
Adoptive Transfer of Experimental Allergic
Encephalomyelitis
Susanta Mondal, Avik Roy and Kalipada Pahan
J Immunol 2009; 182:5013-5023; ;
doi: 10.4049/jimmunol.0801734
http://www.jimmunol.org/content/182/8/5013
Subscription
Permissions
Email Alerts
This article cites 38 articles, 13 of which you can access for free at:
http://www.jimmunol.org/content/182/8/5013.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2009 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
References
The Journal of Immunology
Functional Blocking Monoclonal Antibodies against IL-12p40
Homodimer Inhibit Adoptive Transfer of Experimental
Allergic Encephalomyelitis1
Susanta Mondal, Avik Roy, and Kalipada Pahan2
M
ultiple sclerosis (MS)3 is the most common human
demyelinating disease of the CNS. Although the etiology is poorly understood, several studies on MS patients suggest that it is a T cell-mediated autoimmune response (1).
Experimental allergic encephalomyelitis (EAE) is an animal model
of MS. Adoptively transferred EAE mimics the relapsing-remitting
MS, the most common form of MS found in patients. In this
model, neuroantigen-specific autoimmune T cells first contact a
naive intact blood-brain barrier (BBB) and are able to extravasate
through the BBB due to their activated status. These cells are retained in the CNS due to presentation of appropriate Ag and undergo further activation (2). This is followed by the recruitment of
non-Ag-specific lymphocytes and activated macrophages from the
blood into this site, accompanied by activation of resident glial
cells and further disruption of the BBB. Detection of a wide variety
of proinflammatory molecules, such as proinflammatory cytokines
(IL-1␤, IFN-␥, IL-6, and TNF-␣), proinflammatory chemokines
Department of Neurological Sciences, Division of Neuroscience, Rush University
Medical Center, Chicago, IL 60612
Received for publication May 30, 2008. Accepted for publication February 11, 2009.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This study was supported by National Institutes of Health Grants (NS39940 and
NS48923).
2
Address correspondence and reprint requests to Dr. Kalipada Pahan, Department of
Neurological Sciences, Rush University Medical Center, 1735 West Harrison Street,
Suite 320, Chicago, IL 60612. E-mail address: [email protected]
3
Abbreviations used in this paper: MS, multiple sclerosis; EAE. experimental
allergic encephalomyelitis; BBB, blood-brain barrier; PLP, proteolipid protein;
iNOS, inducible NO synthase; MBP, myelin basic protein; dpt, day posttransfer;
BSB, blood-spinal cord barrier; MOG, myelin oligodendrocyte glycoprotein; RR,
relapsing-remitting.
Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.0801734
(MCP-1/CCL2 and IP-10/CXCL10), proinflammatory enzymes
(inducible NO synthase (iNOS), cyclooxygenase 2), and proinflammatory transcription factors (NF-␬B and C/EBP) in CNS lesions of MS patients and EAE animals, suggests that a complex
interaction among autoimmune T cells, macrophages, and resident
glial cells initiates a series of inflammatory cascades that ultimately lead to the damage of myelin-synthesizing oligodendrocytes (3–7).
IL-12 plays a critical role in the early inflammatory response to
infection and in the generation of Th1 cells (8). IL-12 consists of
a H chain (p40) and an L chain (p35) linked covalently by disulfide
bonds to give rise to the so-called bioactive heterodimeric (p70)
molecule (9, 10). Recently, p40 has been shown to pair with p19
to form a newly discovered cytokine, IL-23. IL-23 has biological
functions that are similar to as well as distinct from IL-12. For
example, similar to IL-12, IL-23 also enhances the proliferation of
Th1 cells and increases their IFN-␥ production (11–13). However,
in contrast to IL-12, IL-23 aids in the proliferation of memory T
cells (11–13). Apart from forming heterodimers (IL-12 and IL-23),
the p40 subunit is also secreted as monomer (p40) and homodimer
(p402) (9). Because all of these cytokines (IL-12, IL-23, p40, and
p402) contain the common p40 subunit, these cytokines can better
be grouped into the p40 family of cytokines.
Due to the fact that MS and its animal model EAE are T cellmediated autoimmune diseases and that IL-12 is capable of inducing T cell activation and Th1 differentiation, IL-12 has long been
considered essential in MS and EAE (14, 15). For example, IL-12
treatment increased the severity of EAE induced by adoptive transfer of proteolipid protein (PLP)-primed lymph node cells in mice
(16, 17). Furthermore, an Ab to IL-12 prevented the induction or
progression of disease in a murine model of relapsing-remitting
EAE (18, 19). However, recent data demonstrate that the so-called
important role of IL-12 in CNS inflammatory demyelination is
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
IL-12p70 (p40:p35) and IL-23 (p40:p19) are bioactive cytokines and their role in experimental allergic encephalomyelitis (EAE),
an animal model for multiple sclerosis, are becoming clear. On the other hand, the IL-12p40 homodimer (p402) was considered
as an inactive or inhibitory molecule and its functions are poorly understood. To facilitate the studies on p402, we have recently
generated neutralizing mAb against mouse p402. The present study demonstrates the effectiveness of p402 mAb in treating the
disease process of relapsing-remitting EAE in female SJL/J mice. The p402 mAb ameliorated clinical symptoms and disease
progression of EAE in recipient mice and suppressed the generation of encephalitogenic T cells in donor mice. Histological and
blood-brain barrier (BBB) and blood-spinal cord barrier (BSB) permeability studies reveal that p402 mAb effectively inhibited the
infiltration of mononuclear cells into brain and spinal cord and improved the integrity of BBB and BSB in EAE mice. Consequently, p402 mAb also suppressed the expression of proinflammatory molecules, normalized the expression of myelin genes, and
blocked demyelination in the CNS of EAE mice. On the other hand, recombinant mouse p402 increased the infiltration of
mononuclear cells into the CNS, enhanced the permeability through BBB and BSB, stimulated CNS expression of proinflammatory molecules, and aggravated the disease process of EAE. Taken together, our results suggest that p402 participates in the
pathogenesis of EAE and that neutralization of p402 may be beneficial in multiple sclerosis patients. The Journal of Immunology,
2009, 182: 5013–5023.
5014
Materials and Methods
Reagents
Bovine myelin basic protein (MBP), L-glutamine, and 2-ME were obtained
from Invitrogen. FBS and RPMI 1640 were from Mediatech. Heat-killed
Mycobacterium tuberculosis (H37RA) was purchased from Difco. IFA was
obtained from Calbiochem. Solvent Blue 38, cresyl violet acetate, and lithium carbonate were purchased from Sigma-Aldrich.
ralysis; 3.5, forelimb weakness; 4, forelimb paralysis; and 5, moribund or
death.
Treatment with recombinant p402 and Abs against p402
mAbs against p402 (clone a3-1d) were concentrated from hybridoma supernatants by centrifuging in an Amicon Ultra-15 (Mr 50,000 compound)
centrifugal filter device (Millipore) and purified by protein A-Sepharose
(Bio-Rad) as described by us (24). Either from the beginning or from
different stages (onset of acute phase and onset of chronic phase) of EAE,
groups of mice were treated with either recombinant mouse p402 (carrier
free) or mAb a3-1d via i.p. injection. Controls received normal PBS. Statistical analysis was determined by the RS/1 multicomparison procedure
using a one-way ANOVA and Dunnett’s test for multiple comparisons with
a common control group. Differences between means were considered significant when p values were ⬍0.05.
Histological analysis
On 17 dpt (peak of the acute phase), five mice from each of the following
groups (HBSS-control, EAE, EAE mice receiving p402, EAE mice receiving p402 mAb, and EAE mice receiving hamster IgG) were anesthetized.
After perfusion with PBS (pH 7.4) and then with 4% (w/v) paraformaldehyde solution in PBS, cerebellum and whole spinal cord were dissected out
from each mouse. The tissues were further fixed and then divided into two
halves: one-half was used for histology analysis whereas the other half was
used for myelin staining as described earlier (25–27). For histological analysis, routine histology was performed to obtain perivascular cuffing and
morphological details of spinal cord and cerebellar tissues of EAE mice.
Paraformaldehyde-fixed tissues were embedded in paraffin and serial sections (4 ␮m) were cut. Sections were stained with the conventional H&E
staining method. Digital images were collected under brightfield setting
using a ⫻40 objective. Slides were assessed in a blinded fashion for inflammation by three examiners in different anatomical compartments (meninges and parenchyma). Inflammation was scored using the following
scale as described: for meninges and parenchyma: 0, no infiltrating cells; 1,
few infiltrating cells; 2, numerous infiltrating cells; and 3, widespread infiltration. For vessels, scoring was as follows: 0, no cuffed vessel; 1, one or
two cuffed vessels per section; 2, three to five cuffed vessels per section and
3, more than five cuffed vessels per section. At least six serial sections of
each spinal cord and cerebellar tissues from each of five mice per group
were scored and statistically analyzed by ANOVA.
Assessment of BBB and blood-spinal cord barrier (BSB)
permeability
HBSS-treated control mice and different groups of EAE mice (n ⫽ 4 in
each group) received 200 ␮l of 20 ␮M Alexa Fluor 680-SE-NIR dye (Invitrogen) via tail vain on 15 dpt (acute phase). After 2 h, mice were
scanned in an Odyssey (ODY-0854; Licor) infrared scanner at 700- and
800-nm channels followed by perfusion with 4% paraformaldehyde. Spinal
cord and different regions of brain were scanned in an Odyssey infrared
scanner. The red background came from an 800-nm filter, whereas the
green signal was from Alexa Fluor 680 dye at the 700-nm channel. The
density of the Alexa Fluor 680 signal was quantified with the help of
Quantity One version 4.6.2 software using the volume contour tool analysis
module.
Induction of EAE
Staining for myelin
Specific pathogen-free female SJL/J mice (3– 4 wk old) were purchased
from Harlan Sprague Dawley. EAE was elicited by passive transfer of
MBP-reactive T cells as described earlier (25–27). Donor mice were immunized s.c. with 400 ␮g of bovine MBP and 60 ␮g of M. tuberculosis in
IFA. Animals were killed 10 –12 days after immunization, and the draining
lymph nodes were harvested. Single-cell suspensions were treated with
RBC lysis buffer (Sigma-Aldrich), washed, and cultured at a concentration
of 4 –5 ⫻ 106 cells/ml in 6-well plates in RPMI 1640 supplemented with
10% FBS, 50 ␮g/ml MBP, 50 ␮M 2-ME, 2 mM L-glutamine, 100 U/ml
penicillin, and 100 ␮g/ml streptomycin. On day 4, cells were harvested and
resuspended in HBSS. A total of 2 ⫻ 107 viable cells in a volume of 200
␮l was injected into the tail vein of naive mice. Pertussis toxin (150 ng/
mouse; Sigma-Aldrich) was injected once via i.p. route on 0 day posttransfer (dpt) of cells. Cells isolated from donor mice immunized with CFA or
IFA alone were not viable after 4 days in culture with MBP and therefore
were not transferred. Animal maintenance and experimental protocols were
approved by the Rush University Medical Center. Animals were observed
daily for clinical symptoms. Experimental animals were scored by a
masked investigator as follows: 0, no clinical disease; 0.5, piloerection; 1,
tail weakness; 1.5, tail paralysis; 2, hind limb weakness; 3, hind limb pa-
Serial longitudinal sections of paraformaldehyde-fixed spinal cords and
coronal sections of paraformaldehyde-fixed cerebellum were stained with
Luxol fast blue for myelin as described earlier (27, 28). Slides were assessed in a blinded fashion for demyelination by three examiners using the
following scale: 0, normal white matter; 1, rare foci; 2, a few areas of
demyelination; and 3, large areas of demyelination. At least six serial sections of each spinal cord and cerebellum from each of five mice per group
were scored and statistically analyzed by ANOVA.
Semiquantitative RT-PCR analysis
Total RNA was isolated from spinal cord and optic nerves by using a
RNeasy mini kit (Qiagen) and from cerebellum by using Ultraspec-II RNA
reagent (Biotecx Laboratories) according to the manufacturer’s protocol.
To remove any contaminating genomic DNA, total RNA was digested with
DNase. Semiquantitative RT-PCR was conducted as described earlier (26,
27) using a RT-PCR kit from BD Clontech. Briefly, 1 ␮g of total RNA was
reverse transcribed using oligo(dT)12–18 as primer and Moloney murine
leukemia virus reverse transcriptase (BD Clontech) in a 20-␮l reaction
mixture. The resulting cDNA was appropriately diluted and diluted cDNA
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
actually due to IL-23 (12, 14). According to Cua et al. (12), p19
(⫺/⫺) mice do not develop EAE.
In contrast, the role of p402 and p40 in the disease process of
EAE is not known. It was known that p402 was inhibitory to bioactive cytokine IL-12 and/or biologically inactive until we demonstrated the induction of NO synthase (iNOS) and TNF-␣ by
p402 in microglia and macrophages (20, 21). We have recently
demonstrated that p402, but not IL-12p70, induces the expression
of IL-16, a leukocyte chemoattractant factor, in microglia and
macrophages (22). Among various stimuli tested, p402 has been
found as the most potent one followed by p40 monomer, IL-16,
and IL-23 in inducing the activation of IL-16 promoter in microglial cells (22). Furthermore, we have also reported that p402, but
not IL-12p70, is capable of inducing the expression of lymphotoxin ␣ in various immune cells (23). Among various stimuli
(p402, IL-12p70, IL-23, TNF-␣, IFN-␥, IL-1␤, LPS, dsRNA,
HIV-1 gp120, and IL-16) tested, p402 has emerged as the most
potent followed by IL-16, LPS, and dsRNA in inducing the activation of Lt-␣ promoter in microglial cells (23). It is often quite
straightforward to consider a knockout mouse model to investigate
the role of a candidate molecule in any disease process. However,
p40⫺/⫺ mice cannot be used in this case because knocking out the
p40 gene will knock out IL-12, IL-23, p402, and p40. Therefore, to
investigate the role of p402 and p40 in EAE, the only feasible
approach is to use neutralizing mAb against these molecules.
Recently, we have generated neutralizing mAbs against mouse
p402 and established a sandwich ELISA to quantify p402 (24). By
direct ELISA, we have demonstrated that Abs produced from
clones a3-1d and d7-12c specifically recognize p402, but not p40,
IL-12, and IL-23 (24). In this study, we demonstrate that the level
of p402 goes up in serum, spleen, brain, and spinal cord of EAE
mice and that p402 mAb a3-1d attenuates clinical symptoms of
EAE by reducing perivascular cuffing, inflammation, and demyelination in adoptively transferred EAE mice. On the other hand,
recombinant p402 aggravated the disease process of EAE by increasing perivascular cuffing. These results raise a possibility that
neutralization of p402 may be a therapeutic step in MS.
INHIBITION OF EAE BY p402 mAb
The Journal of Immunology
5015
was amplified using Titanium TaqDNA polymerase and the following
primers: VCAM-1: sense, 5⬘-CAAGGGTGACCAGCTCATGA-3⬘ and antisense, 5⬘-TGTGCAGCCACCTGAGATCC-3⬘; ICAM-1: sense, 5⬘-CT
GGGCTTGGAGACTCAGTG-3⬘ and antisense, 5⬘-GTGTCGAGCTTT
GGGATGGTA-3⬘; P-selectin: sense, 5⬘-ACGAGCTGGACGGACCCG-3⬘
and antisense, 5⬘-GGCTGGCACTCAAATTTACAG-3⬘; iNOS: sense, 5⬘CCCTTCCGAAGTTTCTGGCAGCAGC-3⬘ and antisense, 5⬘-GGCTGT
CAGAGCCTCGTGGCTTTGG3⬘; IL-1␤: sense, 5⬘-CTCCATGAGCTTT
GTACAAGG-3⬘ and antisense, 5⬘-TGCTGATGTACCAGTTGGGG-3⬘;
myelin oligodendrocyte glycoprotein (MOG): sense, 5⬘-CCTCTCCCT
TCTCCTCCTTC-3⬘ and antisense, 5⬘-AGAGTCAGCACACCGGGGTT3⬘; MBP: sense, 5⬘-TGGAGAGATTCACCGAGGAGA-3⬘ and antisense,
5⬘-TGAAGCTCGTCGGACTCTGAG-3⬘; PLP: sense, 5⬘-CTTTGCTTC
CCTGGTGGCCA-3⬘ and antisense, 5⬘-TGTTGGCCTCTGGAACCCCT3⬘; CNPase: sense, 5⬘-CTACCCTCCACGAGTGCAAGA-3⬘ and antisense, 5⬘-AGTCTAGTCGCCACGCTGTCT-3⬘; and GAPDH: sense, 5⬘GGTGAAGGTCGGTGTGAACG3⬘ and antisense, 5⬘-TTGGCTCCACCCT
TCAAGTG-3⬘.
Amplified products were electrophoresed on a 1.8% agarose gel and
visualized by ethidium bromide staining. The relative expression of each
gene with respect to GAPDH was measured after scanning the bands with
a Fluor Chem 8800 Imaging System (Alpha Innotech).
Real-time PCR analysis
Sandwich ELISA for p402
The concentration of p402 was measured in serum and homogenates of
cerebellum, spinal cord, and spleen by a sandwich ELISA as described by
us recently using p402 mAb a3-1d as the coating Ab and p402 mAb d7-12c
as the detection Ab (24). Briefly, for coating, a3-1d mAb (1.3 mg/ml) was
diluted 1/3000 and added to each well (100 ␮l/well) of a 96-well ELISA
plate. The biotinylated p402 mAb d7-12c (2 mg/ml) was diluted 1/3000 and
was used as detection Ab.
Results
Level of p402 in serum, spleen, cerebellum, and spinal cord of
mice with relapsing-remitting EAE (RR-EAE)
Although it is well documented that the mRNA of p40 is overexpressed in CNS tissues of EAE animals, the production of p402 has
not been demonstrated in EAE animals. It is also not known
whether the level of p402 correlates with the disease process of
EAE. Recently, we have generated mAbs against mouse p402 and
demonstrated that Abs produced from clones a3-1d and d7-12c
specifically recognize p402, but not p40, IL-12, and IL-23 (24).
Therefore, we examined the level of p402 in serum, spleen, spinal
cord, and cerebellum of mice at different phases of RR-EAE by
sandwich ELISA as described by us (24). The disease process of
RR-EAE in our experiments shows the onset of acute phase within
8 –10 dpt followed by the acute phase within 14 –16 dpt followed
by the remission phase within 19 –22 dpt (25–27). Therefore, samples (serum, spleen, spinal cord, and cerebellum) were collected
from EAE mice on 8 dpt (onset of acute phase), 15 dpt (acute
phase), and 21 dpt (remission phase) for analysis. Four mice (n ⫽
4) were used for each time point. Control mice receiving only tail
vein injection of HBSS were also included in this experiment. The
level of p402 was significantly higher in serum of EAE mice at the
onset of acute phase and the acute phase compared with HBSS
control (Fig. 1A). However, the serum level of p402 was almost
close to normal during the remission phase (Fig. 1A). Similarly, the
level of p402 was also very high in spleen, cerebellum, and spinal
cord during the acute phase of EAE (Fig. 1B). Although the level
of p402 decreased considerably in serum and spleen during the
FIGURE 1. Level of p402 in serum, spleen, cerebellum, and spinal cord
of mice with different phases of EAE. Female SJL/J mice were induced
EAE by adoptive transfer of MBP-primed T cells. At different phases of the
disease (8 dpt, the onset of acute phase; 15 dpt, the acute phase; 21 dpt, the
remission phase), the level of p402 was measured in serum (A) and homogenates of spleen, cerebellum, and spinal cord (B) by sandwich ELISA.
Four mice (n ⫽ 4) were used for each time point. Results are mean ⫾ SD
of three different assays. ap ⬍ 0.001 vs control serum; bp ⬍ 0.001 vs
control spleen; cp ⬍ 0.001 vs control cerebellum; and dp ⬍ 0.001 vs control
spinal cord.
remission phase, interestingly the cerebellar and spinal cord level
of p402 did not decrease significantly during the same phase of
EAE (Fig. 1B).
The p402 mAb a3-1d inhibits disease progression in adoptively
transferred model of EAE
Because the level of p402 increased in serum and spleen of mice
with RR-EAE, we examined whether neutralization of p402 modulates the progression of disease in adoptively transferred EAE
mice. Because IFN-␥ plays an important role in the disease process
of EAE and MS, before examining mAbs in EAE animals, we
investigated specificities of p402 mAbs (a3-1d) and d7-12c) (24) in
neutralizing IFN-␥ production from mouse naive splenocytes. As
expected, both IL-12p70 (Fig. 2A) and IL-23 (Fig. 2B) induced the
expression of IFN-␥ mRNA (upper panels) and the production of
IFN-␥ protein (lower panel) in naive splenocytes. Interestingly,
p402, the so-called biologically inactive molecule, also induced the
expression of IFN-␥ mRNA and protein (Fig. 2C). In fact, p402
appeared to be a stronger inducer of IFN-␥ than IL-12 and IL-23
(Fig. 2, A–C). In contrast, p40 monomer was unable to induce the
expression of IFN-␥ mRNA and protein in splenocytes (Fig. 2D).
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
It was performed using the Applied Biosystems Prism 7700 Sequence Detection System as described earlier (27, 29) using TaqMan Universal Master mix and optimized concentrations of FAM-labeled probe and forward
and reverse primers according to the manufacturer’s protocol. All primers
and FAM-labeled probes for mouse genes and GAPDH were obtained from
Applied Biosystems. The mRNA expressions of respective genes were
normalized to the level of GAPDH mRNA. Data were processed by the
Applied Biosystems Sequence Detection System 1.6 software and analyzed
by ANOVA.
5016
INHIBITION OF EAE BY p402 mAb
A manuscript describing the IFN-␥-inducing property of p402 in
detail is also under preparation (M. Jana and K. Pahan, unpublished observation).
Earlier we found that mAbs (a3-1d and d7-12c) against p402
block p402-, but not p70- and p40-, induced production of TNF-␣
and nitrite from microglia and macrophages (24). Consistently,
mAbs (a3-1d and d7-12c) neutralized the ability of p402, but not
IL-12p70 and IL-23, to induce the expression of IFN-␥ mRNA
(Fig. 2, A–C, upper panels) and protein (Fig. 2, A–C, lower panel)
in mouse naive splenocytes. On the other hand, normal hamster
IgG had no effect on p402-, p70-, and IL-23-induced expression of
IFN-␥ (Fig. 2). Again, mAbs (a3-1d and d7-12c) and normal IgG
had no effect on the inability of p40 to induce the expression of
IFN-␥ (Fig. 2D). These results again demonstrate that mAbs a3-1d
and d7-12c are specific for p402. Although in cell culture experiments these mAbs are specific for p402, in vivo at 370C, these
mAbs may exhibit cross-reactivity toward p40-containing cytokines. To address this possibility, we examined the effect of mAbs
(a3-1d and d7-12c) on p402- and IL-23-induced expression of
IFN-␥ and iNOS in vivo in the spleen of female SJL/J mice. We
used IL-23 because this heterodimer has been reported to play
a more important role than IL-12 in the disease process of EAE
(14). Within 8 h of i.p. injection, both p402 (Fig. 3A) and IL-23
(Fig. 3B) induced the mRNA expression of IFN-␥ and iNOS in
vivo in spleen. However, mice that received mAbs a3-1d and
d7-12c before p402 treatment showed markedly reduced mRNA
expression of IFN-␥ and iNOS in spleen (Fig. 3A). In contrast,
under similar treatment conditions, mAbs (a3-1d and d7-12c)
had no effect on IL-23-induced splenic mRNA expression of
IFN-␥ and iNOS (Fig. 3B). To check specificity, a group of
mice also received normal hamster IgG along with either p402
or IL-23 and it is evident from Fig. 3 that IgG had no effect on
p402- and IL-23-induced expression of IFN-␥ and iNOS in
spleen. These mAbs (a3-1d and d7-12c) alone also had no effect
on splenic expression of IFN-␥ and iNOS (data not shown).
Taken together, these results clearly demonstrate that mAbs
(a3-1d and d7-12c) are specific for p402 both in cell culture and
in vivo in animals.
Next, to examine the role of p402 in the disease process of EAE,
we used p402 mAb a3-1d. Mice were treated with p402 mAb a3-1d
in two different groups. In the first group, mice were treated with
p402 mAb (100 ␮g/mouse) from the onset of acute phase (8 dpt).
The results in Fig. 4A clearly show that the inhibitory effect of the
p402 mAb on the clinical symptoms was observed within 4 days of
treatment (from 12 dpt). There was further marked inhibition on
subsequent days of treatment and this inhibition was maintained
throughout the duration of the experiment (Fig. 4A). On the other
hand, treatment of EAE mice with p402 from the onset of acute
phase increased clinical symptoms (Fig. 4A). In the second group,
p402 mAb treatment began from the onset of the relapsing phase
(19 dpt) and was continued until 49 dpt. Fig. 4B clearly shows that
the p402 mAb, in this instance, also halted the disease progression.
Similar to the first instance, the inhibitory effect of p402 mAb was
manifested only after 4 or 5 days of treatment (23 or 24 dpt). The
EAE disease severity was always below or around stage 0.5 from
26 dpt until the end of the study (49 dpt; Fig. 4B). In contrast, p402
treatment from the onset of the relapsing phase increased disease
severity (Fig. 4B). These results clearly suggest that p402 plays an
important role in the disease process of EAE and that p402 mAb
can control the ongoing RR-EAE when administered either early
(at the onset of acute disease) or late (at the onset of relapsing
disease).
Effect of recombinant p402 and p402 mAb a3-1d on the
encephalitogenicity of MBP-primed T cells
Because MBP-primed T cells are encephalitogenic and adoptive
transfer of these T cells induces EAE, we were interested in
investigating whether p402 mAb was capable of inhibiting the
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 2. Effect of p402 mAbs
(a3-1d and d7-12c) on p402-, p40-, IL12p70-, and IL-23-induced expression of
IFN-␥ in mouse naive splenocytes.
Splenocytes isolated from naive female
SJL/J mice received different concentrations (100 and 200 ng/ml) of either mAbs
(a3-1d and d7-12c) or control IgG for 15
min followed by stimulation with 10
ng/ml mouse rIL-12p70 (A), IL-23 (B),
p402 (C), or p40 (D). After 6 h of stimulation, the mRNA expression of IFN-␥
was examined by semiquantitative RTPCR (upper panel). After 18 h of stimulation, concentrations of IFN-␥ were
measured in supernatants by ELISA
(lower panel). Results are mean ⫾ SD of
three different assays. ap ⬍ 0.001 vs control splenocytes and bp ⬍ 0.001 vs p402stimulated splenocytes.
The Journal of Immunology
5017
The p402 mAb a3-1d inhibits the generation of encephalitogenic
T cells in vivo in donor mice
FIGURE 3. Effect of p402 mAbs (a3-1d and d7-12c) on p402- and IL23-induced expression of IFN-␥ and iNOS in vivo in spleen of naive female SJL/J mice. Mice (n ⫽ 3 in each group) received mAbs a3-1d and
d7-12c (200 ␮g/mouse, i.p.) followed by treatment with 200 ng/mouse of
either p402 (A) or IL-23 (B) via i.p. injection. Control mice received only
equal volume of saline (i.p.). After 8 h, spleens were isolated and the
mRNA expression of IFN-␥ and iNOS was examined by semiquantitative
RT-PCR (upper panels). The relative expression of IFN-␥ and iNOS with
respect to GAPDH (lower panel) was measured after scanning the bands
with a Fluor Chem 8800 Imaging System. Results are mean ⫾ SD of three
different mice. ap ⬍ 0.001 vs control spleen and bp ⬍ 0.001 vs p402-treated
spleen.
encephalitogenicity of MBP-primed T cells. T cells from lymph
nodes of donor mice were treated with MBP in the presence of
either recombinant p402 or p402 mAb and these p402-treated and
p402 mAb-treated MBP-primed T cells were adoptively transferred to recipient mice. Another group of mice received only
MBP-primed T cells as positive control. Our result showed that
groups of mice that received p402 mAb-treated MBP-primed T
cells exhibited significantly reduced clinical symptoms and disease
severity (Fig. 5A) compared with mice receiving only MBPprimed T cells. In contrast, mice receiving recombinant p402treated MBP-primed T cells displayed increased clinical symptoms
and disease severity (Fig. 5A) compared with mice receiving only
MBP-primed T cells. These results clearly suggest that p402 stimulates while p402 mAb inhibits the encephalitogenicity of MBPprimed T cells.
Because in vitro treatment of MBP-primed T cells with p402 mAb
inhibited the encephalitogenicity of MBP-primed T cells, we next
investigated whether p402 mAb treatment in donor mice is capable
of inhibiting the generation of encephalitogenic T cells in vivo.
Therefore, donor mice were treated with p402 mAb once on 2 days
after injection) and T cells from these donor mice were primed
with MBP for 4 days and transferred adoptively to recipient mice.
In the control group, EAE was induced by adoptive transfer of
MBP-primed T cells from donor mice that received only PBS. Our
results showed that mice that received T cells from p402 mAbtreated donor mice exhibited dramatically less clinical symptoms
and disease severity compared with the control EAE group (Fig.
5B). On the other hand, mice receiving T cells from recombinant
p402-treated donor mice displayed a greater degree of clinical
symptoms and disease severity compared with the control EAE
group (Fig. 5B). These results suggest that p402 plays an important
role in the generation of encephalitogenic T cells and that neutralization of p402 by mAb suppresses the production of encephalitogenic T cells in donor mice.
The p402 mAb a3-1d inhibits infiltration of mononuclear cells
into the CNS of mice with RR-EAE
Because p402 mAb inhibited the disease process of adoptively
transferred EAE, we were prompted to investigate the mechanistic
details by which p402 mAb was capable of doing so. It is believed
that EAE as well as MS is caused by infiltration of autoreactive T
cells and associated mononuclear cells, like macrophages, into the
CNS followed by broad-spectrum inflammatory events. We investigated whether p402 mAb attenuated infiltration in adoptively
transferred EAE mice. Mice receiving either recombinant p402 or
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 4. Treatment of adoptively transferred EAE in SJL/J mice by
p402 and mAb against p402. EAE was induced in female SJL/J mice by
adoptive transfer of MBP-primed T cells. Group of EAE mice (n ⫽ 6) were
treated with p402 (200 ng/mouse), p402 mAb a3-1d (100 ␮g/mouse), or
normal hamster IgG (100 ␮g/mouse) from the onset of acute phase (8 dpt)
(A) and the onset of relapsing phase (18 dpt) (B). Mice were examined for
clinical symptoms for the next 30 days.
5018
p402 mAb from 8 dpt (onset of the acute phase) were sacrificed on
15 dpt. H&E staining (Fig. 6A) in cerebellar sections of EAE mice
showed widespread infiltration of inflammatory cells into the cerebellum. Treatment of EAE mice with p402 resulted in increased
infiltration of inflammatory cells into the cerebellum. In contrast,
p402 mAb treatment markedly inhibited the infiltration of inflammatory cells into the cerebellum of EAE mice (Fig. 6A). In contrast, control IgG had no effect on inflammatory infiltration into the
cerebellum. Quantitation of relative level of inflammation in Fig.
6B shows that p402 mAb dramatically reduced infiltration and the
appearance of cuffed vessels in both cerebellum and spinal cord
sections of RR-EAE mice. On the other hand, p402 treatment enhanced infiltration and the appearance of cuffed vessels in cerebellum and spinal cord (Fig. 6B).
Infiltration is mediated by adhesion molecules like ICAM-1,
VCAM-1, P-selectin, and so forth, which are expressed in the endothelium of BBB as well as in glial cells in CNS parenchyma. As
observed in patients with MS, the brain, spinal cord, and optic
nerve are affected in RR-EAE in female SJL/J mice. Therefore, we
examined the effect of p402 mAb on the expression of adhesion
molecules in cerebellum, spinal cord, and optic nerve of EAE
mice. Our semiquantitative RT-PCR data revealed marked expression of these adhesion molecules in the spinal cord (Fig. 7A), cerebellum (Fig. 7B), and optic nerve (Fig. 7C) of EAE mice com-
FIGURE 6. Effect of p402 and p402 mAb on the infiltration of mononuclear cells into the CNS of EAE mice. A, Cerebellar sections isolated
from HBSS-treated normal, control EAE (15 dpt), p402-treated EAE (15
dpt receiving p402 from 8 dpt), p402 mAb-treated EAE (15 dpt receiving
p402 mAb from 8 dpt), and control IgG-treated EAE (15 dpt receiving
control IgG from 8 dpt) mice were stained with H&E. Digital images were
collected under brightfield setting using a ⫻40 objective. B and C, Infiltration and cuffed vessel in cerebellar and spinal cord sections were represented quantitatively by using a scale as described in Materials and
Methods. Data are expressed as the mean ⫾ SD of five different mice. ap ⬍
0.001 vs EAE.
pared with control mice. Consistent with the stimulation in
infiltration, treatment of EAE mice with p402 resulted in increased
expression of ICAM-1, VCAM-1, and P-selectin in the spinal cord,
cerebellum, and optic nerve as compared with untreated EAE mice
(Fig. 7). However, treatment of EAE mice with p402 mAb, but not
control IgG, resulted in effective inhibition of these contact molecules in the spinal cord, cerebellum, and optic nerve of EAE mice
(Fig. 7).
The p402 mAb a3-1d preserves the integrity of the BBB and
BSB in mice with RR-EAE
BBB and BSB are membranic structures that act primarily to protect the brain and the spinal cord, respectively, from chemicals in
the blood, while still allowing some essential molecules to enter. It
is known that during active MS and EAE, BBB and BSB break
down in a section of the brain and spinal cord, respectively, due to
widespread inflammation, thereby allowing different blood molecules and toxins to enter into the CNS. We investigated whether
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 5. Effect of p402 and p402 mAb on the encephalitogenicity of
MBP-primed T cells. A, T cells isolated from MBP-immunized donor mice
were treated with MBP and either p402 (10 ng/ml), p402 mAb a3-1d (100
ng/ml), or control IgG (100 ng/ml). After 4 days, EAE was induced in
female SJL/J recipient mice by adoptive transfer of either MBP-primed T
cells, p402-treated MBP-primed T cells, p402 mAb-treated MBP-primed T
cells, or control IgG-treated MBP-primed T cells. B, Donor mice were
immunized with MBP, IFA, and M. tuberculosis. From the second day of
immunization, mice were treated with either p402 (200 ng/mouse), p402
mAb (100 ␮g/mouse), or control IgG (100 ␮g/mouse). On day 12 of immunization, mice were sacrificed, and total lymph node cells were further
primed with MBP (50 ␮g/ml) for 4 days. A total of 2 ⫻ 107 viable MBPprimed T cells was adoptively transferred to naive recipient mice. Six mice
were used in each group. Mice were examined for clinical symptoms every
day until 30 dpt.
INHIBITION OF EAE BY p402 mAb
The Journal of Immunology
FIGURE 7. Effect of p402 and p402 mAb on the expression of adhesion
molecules in the spinal cord, cerebellum, and optic nerve of EAE mice.
Spinal cord (A), cerebellum (B), and optic nerve (C) of HBSS-treated normal, control EAE (15 dpt), p402-treated EAE (15 dpt receiving p402 from
8 dpt), p402 mAb-treated EAE (15 dpt receiving p402 mAb from 8 dpt),
and control IgG-treated EAE (15 dpt receiving control IgG from 8 dpt)
mice were analyzed for mRNA expression of ICAM-1, VCAM-1, and
P-selectin by semiquantitative RT-PCR. Four mice were used in each
group. Results represent three independent experiments.
neutralization of p402 modulated the integrity of BBB and BSB.
We injected an infrared dye (Alexa Fluor 680) via tail vein and, 2 h
after the injection, live mice were scanned in an Odyssey infrared
scanner. As evidenced from Fig. 8A ( first lane), infrared signals
were not visible on areas over the brain and the spinal cord in
control HBSS-injected mice. In contrast, in EAE mice, some infrared signals were detected on areas over the brain and the spinal
cord (Fig. 8A, second column), suggesting a possible breakdown of
BBB and BSB. Treatment of EAE mice with recombinant p402
markedly increased the appearance of infrared signals over the
brain and spinal cord (Fig. 8A, cf lane 3 with lane 2). On the other
hand, p70 treatment did not increase the entry of infrared dye into
the CNS of EAE mice as evident from infrared signals over the
brain and spinal cord (Fig. 8A, cf the last lane with the second
lane). These results suggest a greater breakdown of BBB and BSB
in the presence of p402, but not p70. Consistently, p402 mAb a3-1d
strongly inhibited the entry of infrared dye into the CNS (Fig. 8A,
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 8. Effect of p402 and
p402 mAb on the integrity of BBB
and BSB in EAE mice. A, HBSStreated control mice and different
groups of EAE mice (n ⫽ 4 in each
group) received 200 ␮l of 20 ␮M Alexa Fluor 680-SE-NIR dye (Invitrogen) via the tail vain on 15 dpt (acute
phase). After 2 h, mice were scanned
in an Odyssey (ODY-0854; Licor) infrared scanner at the 700- and 800-nm
channels. Mice were perfused with
4% paraformaldehyde. Spinal cord
(B) and different regions of brain (C)
were scanned in an Odyssey infrared
scanner. The red background came
from an 800-nm filter, whereas the
green signal was from Alexa Fluor
680 dye at the 700-nm channel. D,
The density of the Alexa Fluor 680
signal in different parts of the brain
was quantified with the help of Quantity One, version 4.6.2 software, using
the volume contour tool analysis
module. Data are expressed as the
mean ⫾ SD of four different mice.
a
p ⬍ 0.001 vs EAE.
5019
5020
INHIBITION OF EAE BY p402 mAb
cf lane 4 with lane 2). However, control IgG did not influence the
entry of infrared dye into the CNS of EAE mice as evidenced by
the aligning of infrared signals over the spinal cord and brain (Fig.
8A, cf lane 5 with lane 2).
To confirm these results further, mice were sacrificed and the
spinal cord and different parts of the brain (frontal cortex, midbrain, and cerebellum) were scanned for infrared signals in an
Odyssey infrared scanner. Consistent with live mice results, we did
not notice much infrared signal in the spinal cord and different
parts of the brain in control HBSS-treated mice (Fig. 8, B–D, lane
1), but a significant amount of infrared dye was visible in CNS
tissues of EAE mice (Fig. 8, B–D, lane 2). Again, treatment of
EAE mice by p402 markedly stimulated the entry of infrared dye
into the spinal cord and different parts of the brain (Fig. 8, B–D, cf
lane 3 with lane 2). Conversely, neutralization of p402 by mAb
a3-1d markedly attenuated the entry of infrared dye into the spinal
cord and different parts of the brain (Fig. 8, B–D, cf lane 4 with
lane 2). As observed after scanning live mice (Fig. 8A, lane 6), p70
treatment of EAE mice did not increase the entry of infrared dye
into the spinal cord and different parts of the brain (Fig. 8, B–D, cf
lane 6 with lane 2). Taken together, these results suggest that p402
plays an important role in the breakdown of BBB and BSB and
that its neutralization preserves the integrity of BBB and BSB in
EAE mice.
Suppression of proinflammatory molecules in CNS tissues of
mice with RR-EAE by p402 mAb a3-1d
Because the infiltration of mononuclear cells was inhibited and the
integrity of BBB and BSB was maintained upon neutralization of
p402, we next examined whether the p402 mAb a3-1d was capable
of inhibiting the expression of proinflammatory molecules in the
CNS of EAE mice. We used semiquantitative RT-PCR (Fig. 9, A,
C, and E) and quantitative real-time PCR (Fig. 9, B, D, and F) to
analyze the expression of proinflammatory genes in the spinal
cord, cerebellum, and optic nerve. Marked expression of proin-
flammatory molecules like iNOS and IL-1␤ was observed in the
spinal cord (Fig. 9, A and B), cerebellum (Fig. 9, C and D), as well
as in the optic nerve (Fig. 9, E and F) of EAE mice as compared
with control mice. However, treatment of EAE mice with p402
mAb a3-1d dramatically reduced the expression of these proinflammatory molecules in the spinal cord, cerebellum, and optic
nerve of EAE mice (Fig. 9).
The p402 mAb a3-1d inhibits demyelination in mice with
RR-EAE
It is believed that infiltration of blood mononuclear cells, breakdown of BBB and BSB, and associated neuroinflammation play an
important role in CNS demyelination observed in MS patients and
EAE animals. Therefore, we examined whether neutralization of
p402 protected EAE mice from demyelination. Our semiquantitative RT-PCR data reveal marked loss of myelin genes like MBP,
MOG, PLP, and CPAs in the spinal cord (Fig. 10A), cerebellum
(Fig. 10B), and optic nerve (Fig. 10C) of EAE mice compared with
HBSS-treated control mice. Again, treatment of EAE mice with
p402 led to further loss of myelin gene expression in the spinal
cord, cerebellum, and optic nerve (Fig. 10, cf lane 3 with lane 2).
However, significant restoration (almost to the control level) of
myelin gene mRNA expression in the spinal cord, cerebellum, and
optic nerve was observed in p402 mAb a3-1d-treated EAE mice
(Fig. 10, cf lane 4 with lane 2). In contrast, control IgG was unable
to restore the expression of myelin genes in EAE mice (Fig. 10, cf
lane 5 with lane 2).
To confirm this finding further, we stained longitudinal sections
of spinal cord and coronal sections of cerebellum by Luxol fast
blue for myelin and observed widespread demyelination zones in
the white matter of spinal cord (Fig. 11, A and D) and brain (Fig.
11, B and C) of EAE mice compared with that of HBSS-treated
control mice. Again, treatment of RR-EAE mice with p402 led to
further loss of myelin in spinal cord (Fig. 11, A and D) and brain
(Fig. 11, B and C). However, treatment of RR-EAE mice with p402
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 9. Effect of p402 and p402 mAb
on the expression of proinflammatory molecules in the spinal cord, cerebellum, and optic nerve of EAE mice. Spinal cord (A and
B), cerebellum (C and D), and optic nerve (E
and F) of HBSS-treated normal, EAE (15
dpt), p402-treated EAE (15 dpt receiving
p402 from 8 dpt), p402 mAb-treated EAE
(15 dpt receiving p402 mAb from 8 dpt), and
control IgG-treated EAE (15 dpt receiving
control IgG from 8 dpt) mice were analyzed
for mRNA expression of iNOS and IL-1␤ by
semiquantitative RT-PCR (A, C, and E) and
quantitative real-time PCR (B, D, and F).
Data are expressed as the mean ⫾ SD of four
different mice. ap ⬍ 0.001 vs EAE.
The Journal of Immunology
5021
Taken together, these results suggest that neutralization of p402
inhibits demyelination in the CNS of RR-EAE mice.
Discussion
FIGURE 10. Effect of p402 and p402 mAb on the expression of myelinspecific genes in the spinal cord, cerebellum, and optic nerve of EAE mice.
Spinal cord (A), cerebellum (B), and optic nerve (C) of HBSS-treated normal, EAE (15 dpt), p402-treated EAE (15 dpt receiving p402 from 8 dpt),
p402 mAb-treated EAE (15 dpt receiving p402 mAb from 8 dpt), and control IgG-treated EAE (15 dpt receiving control IgG from 8 dpt) mice were
analyzed for mRNA expression of MBP, MOG, PLP, and CNPase by semiquantitative RT-PCR. Four mice were used in each group. Results represent three independent experiments.
FIGURE 11. Effect of p402 and p402 mAb on demyelination in the spinal cord and cerebellum of EAE mice. Longitudinal sections of spinal cord
(A) and coronal sections of cerebellum (B) isolated from HBSS-treated
normal, EAE (15 dpt), p402-treated EAE (15 dpt receiving p402 from 8
dpt), p402 mAb-treated EAE (15 dpt receiving p402 mAb from 8 dpt), and
control IgG-treated EAE (15 dpt receiving control IgG from 8 dpt) mice
were stained with Luxol fast blue. Digital images were collected under
brightfield settings using a ⫻40 objective. Demyelination in the spinal cord
(C) and cerebellum (D) was represented quantitatively by using a scale as
described in Materials and Methods. Data are expressed as the mean ⫾ SD
of five different mice. ap ⬍ 0.001 vs EAE.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
mAb a3-1d remarkably restored the myelin level in both spinal
cord (Fig. 11, A and D) and brain (Fig. 11, B and C). On the other
hand, control IgG had no effect on the loss of myelin in spinal cord
(Fig. 11, A and D) and brain (Fig. 11, B and C) of RR-EAE mice.
Although MS could be monophasic, the majority of MS patients
(⬎80%) experience relapsing-remitting symptoms. The relapsingremitting disease course begins with an acute phase peak followed
by multiple relapses of chronic phases that gradually decrease in
number and intensity. The relapsing-remitting model of EAE (RREAE) is a widely used model for studying the disease process of
RR-MS and, in particular, is very much effective for examining
novel therapeutic approaches against RR-MS. The role of IL-12
and IL-23, heterodimeric bioactive cytokines containing p40 as a
subunit, in the disease process of EAE is becoming clear (9, 12,
30). However, dendritic cells, macrophages, and microglia, cells
that are able to secrete heterodimeric IL-12 or IL-23, always produce an excess of p40 as p402 (9, 24). Again, several reports (9, 31,
32) indicate that the level of p40 mRNA in the CNS of patients
with MS is much higher than in the CNS of control subjects,
whereas the level of p35 mRNA is about the same or decreases
compared with that of controls. Similarly, in mice with EAE, an
animal model of MS, expression of p40, but not p35, mRNA increases in brain and spinal cord (33). These studies suggest that
p40 may have a key function as a homodimer not just as part of
either the p40:p35 heterodimer forming IL-12 or the p40:p19 heterodimer forming IL-23. However, it was known that p402 was
biologically inactive until we demonstrated the induction of NO
synthase (iNOS) and TNF-␣ by p402 in microglia and macrophages (20, 21). Recently, we have generated functional blocking
mAbs against mouse p402 in the hamster (24) to understand biological functions of p402 further in vivo in animals. In the present
study, we delineate the first evidence that functional blocking
mAbs against p402, a so-called biologically inactive molecule, inhibits the disease process of RR-EAE. Our conclusion is based on
the following observations. First, p402 mAb a3-1d inhibited the
progression of adoptively transferred RR-EAE when administered
either from the onset of the acute phase or from the onset of the
relapsing phase. In contrast, normal hamster IgG had no effect on
the progression of RR-EAE. Converse to the neutralization of
p402, recombinant p402 increased disease severity when administered either in the early or late stage of the disease process. Second,
adoptive transfer of MBP-primed T cells, but not p402 mAbtreated MBP-primed T cells, induced the clinical symptoms of
EAE in female SJL/J mice. However, treatment of MBP-primed T
cells with recombinant p402 augmented the encephalitogenicity of
MBP-primed T cells. Third, treatment of donor mice with p402
mAb a3-1d also inhibited the generation of encephalitogenic T
cells. In contrast, treatment of donor mice with recombinant p402
stimulated the generation of encephalitogenic T cells.
Although we have not tested whether p402 mAb entered into the
CNS through leaky BBB and BSB during the acute phase of EAE,
our results suggest that p402 is indeed produced within the CNS
during the onset of acute phase and the acute phase itself. Quantitation of p402 by a sandwich ELISA (24) shows that the level of
p402 increased in the serum, spleen, spinal cord, and cerebellum
during the onset of the acute phase and the acute phase of EAE. As
expected, during the remission phase, the level of p402 decreased
in serum and spleen of EAE mice almost close to the control level.
However, the level of p402 did not decrease significantly in cerebellum and spinal cord during the remission phase of EAE. In the
CNS, activated glial cells, mainly microglia, are supposed to produce p402. Our results suggest that although clinical symptoms
were low during the remission phase, activated microglia in spinal
cord and brain of EAE mice were still producing p402. Recently,
5022
stops demyelination. Although the disease process of MS is not
exactly the same as EAE, the local concentration of p402 present
in peripheral and CNS microimmune organs of MS patients may
differ from what we have observed in peripheral and CNS tissues
of RR-EAE mice and the in vivo condition of the cerebellum,
spinal cord, and optic nerve of RR-EAE mice may not truly resemble the in vivo situation of these organs in MS patients, our
results suggest that neutralization of p402 by the functional blocking mAb may be a therapeutic strategy against MS.
Disclosures
The authors have no financial conflict of interest.
References
1. Martin, R., H. F. McFarland, and D. E. McFarlin. 1992. Immunological aspects
of demyelinating diseases. Annu. Rev. Immunol. 10: 153–187.
2. Becher, B., I. Bechmann, and M. Greter. 2006. Antigen presentation in autoimmunity and CNS inflammation: how T lymphocytes recognize the brain. J. Mol.
Med. 84: 532–543.
3. Benveniste, E. N. 1997. Role of macrophages/microglia in multiple sclerosis and
experimental allergic encephalomyelitis. J. Mol. Med. 75: 165–173.
4. Du, C., M. W. Khalil, and S. Sriram. 2001. Administration of dehydroepiandrosterone suppresses experimental allergic encephalomyelitis in SJL/J mice. J. Immunol. 167: 7094 –7101.
5. Parkinson, J. F., B. Mitrovic, J. E. Merrill. 1997. The role of nitric oxide in
multiple sclerosis. J. Mol. Med. 75: 174 –186.
6. Pahan, K., and M. Schmid. 2000. Activation of nuclear factor-␬B in the spinal
cord of experimental allergic encephalomyelitis. Neurosci. Lett. 287: 17–20.
7. Bruck, W., and C. Stadelmann. 2003. Inflammation and degeneration in multiple
sclerosis. Neurol. Sci. 24(Suppl. 5): S265–S267.
8. Hsieh, C. S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O’Garra, and
K. M. Murphy. 1993. Development of TH1 CD4⫹ T cells through IL-12 produced by Listeria-induced macrophages. Science 260: 547–549.
9. Gately, M. K., L. M. Renzetti, J. Magram, A. S. Stern, L. Adorini, U. Gubler,
D. H. Presky. 1998. The interleukin-12/interleukin-12-receptor system: role in
normal and pathologic immune responses. Annu. Rev. Immunol. 16: 495–521.
10. Kobayashi, M., M. N. Kweon, H. Kuwata, R. D. Schreiber, H. Kiyono,
K. Takeda, and S. Akira. 2003. Toll-like receptor-dependent production of IL12p40 causes chronic enterocolitis in myeloid cell-specific Stat3-deficient mice.
J. Clin. Invest. 111: 1297–1308.
11. Oppmann, B., R. Lesley, B. Blom, J. C. Timans, Y. Xu, B. Hunte, F. Vega,
N. Yu, J. Wang, K. Singh, et al. 2000. Novel p19 protein engages IL-12p40 to
form a cytokine: IL-23, with biological activities similar as well as distinct from
IL-12. Immunity 13: 715–725.
12. Cua, D. J., J. Sherlock, Y. Chen, C. A. Murphy, B. Joyce, B. Seymour, L. Lucian,
W. To, S. Kwan, T. Churakova, et al. 2003. Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain. Nature
421: 744 –748.
13. Lankford, C. S., and D. M. Frucht. 2003. A unique role for IL-23 in promoting
cellular immunity. J. Leukocyte Biol. 73: 49 –56.
14. Touil, T., D. Fitzgerald, G. X. Zhang, A. Rostami, and B. Gran. 2006. Pathophysiology of interleukin-23 in experimental autoimmune encephalomyelitis.
Drug News Perspect. 19: 77– 83.
15. Smith, T., A. K. Hewson, C. I. Kingsley, J. P. Leonard, and M. L. Cuzner. 1997.
Interleukin-12 induces relapse in experimental allergic encephalomyelitis in the
Lewis rat. Am. J. Pathol. 150: 1909 –1917.
16. Constantinescu, C. S., B. Hilliard, E. Ventura, M. Wysocka, L. Showe, E. Lavi,
T. Fujioka, P. Scott, G. Trinchieri, and A. Rostami. 2001. Modulation of susceptibility and resistance to an autoimmune model of multiple sclerosis in prototypically susceptible and resistant strains by neutralization of interleukin-12 and
interleukin-4, respectively. Clin. Immunol. 98: 23–50.
17. Issazadeh, S., A. Ljungdahl, B. Hojeberg, M. Mustafa, and T. Olson. 1995. Cytokine production in the central nervous system of Lewis rats with experimental
autoimmune encephalomyelitis: dynamics of mRNA expression for interleukin10, interleukin-12, cytolysin, tumor necrosis factor ␣ and tumor necrosis factor ␤.
J. Neuroimmunol. 61: 205–212.
18. Leonard, J. P., K. E. Waldburger, and S. J. Goldman. 1995. Prevention of experimental allergic encephalomyelitis by antibodies against interleukin-12.
J. Exp. Med. 181: 381–386.
19. Constantinescu, C. S., M. Wysocka, B. Hilliard, E. S. Ventura, E. Lavi,
G. Trinchieri, and Rostami, A. 1998. Antibodies against IL-12 prevent superantigen-induced and spontaneous relapses of experimental autoimmune encephalomyelitis. J. Immunol. 161: 5097–5104.
20. Jana, M., S. Dasgupta, R. N. Saha, X. Liu, and K. Pahan. 2003. Induction of
tumor necrosis factor ␣ (TNF-␣) by interleukin-12 p40 monomer and homodimer
in microglia and macrophages. J. Neurochem. 86: 519 –528.
21. Pahan, K., F. G. Sheikh, X. Liu, S. Hilger, M. McKinney, and T. M. Petro. 2001.
Induction of nitric-oxide synthase and activation of NF-␬B by interleukin-12 p40
in microglial cells. J. Biol. Chem. 276: 7899 –7905.
22. Jana, M., and K. Pahan. 2009. IL-12 p40 homodimer, but not IL-12 p70, induces
the expression of IL-16 in microglia and macrophages. Mol. Immunol. 46:
773–783.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
we have found that p402, but not IL-12p70, the bioactive cytokine,
is capable of inducing the expression of IL-16, a T cell chemoattractant factor, in microglia and astroglia (22). Therefore, it is possible that during the remission phase, microglial p402 may play a
very important role in transducing the chemoattractive signal via
IL-16 for the next relapse.
Infiltration of leukocytes into the CNS is a key neuroinflammatory event in EAE as well as MS. Our results demonstrate that the
functional blocking mAb against p402 markedly inhibits the infiltration of mononuclear cells into the CNS of EAE mice. Although
the exact mechanism of leukocyte invasion is not completely understood, this process most likely involves the expression of the
endothelial VCAM-1 and ICAM-1 (34), which is temporally correlated with the onset of clinical signs. Up-regulation of ICAM-1
and VCAM-1 was reported on cerebral vessels during EAE preceding the perivascular infiltration by lymphocytes and the onset
of disease (35). Our studies have firmly shown that p402 mAb
down-regulates the expression of ICAM-1 and VCAM-1 in the
CNS of EAE mice. Importance of selectins in the extravasation of
T lymphocytes into the CNS is also evident when complete inhibition of rolling and arrest of Th1 cells in the inflamed brain of
EAE mice was observed with anti-E- and P-selectin Abs (36).
Interestingly, neutralization of p402 was also found to suppress the
expression of P-selectin in the spinal cord, cerebellum, and optic
nerve of EAE mice.
In addition to the infiltration of mononuclear cells, we have also
found that the BBB and BSB are compromised in EAE and that an
infrared dye enters into the spinal cord and different parts of the
brain during the acute phase. Interestingly, the permeability
through BBB and BSB increased upon treatment with p402 and
decreased upon neutralization of p402, suggesting an important
role of p402 in the breakdown of BBB and BSB integrities. NO, a
major mediator in immune and autoimmune functions, has been
also shown to increase the permeability of BBB, allowing substances to enter into the brain passively, leading to vasogenic
edema and secondary brain damage (37). Although the precise
molecular mechanisms for NO-induced breakdown of the BBB are
not completely understood, in a cell culture model of the BBB, NO
leads to a rapid breakdown in model barrier integrity and results in
a reduction in endothelial cell ATP content and GAPDH activity
(38). It is important to note that p402 alone is capable of inducing
the expression of iNOS in cultured microglia via the activation of
NF-␬B (21). Consistently, the expression of iNOS in vivo in spinal
cord, cerebellum, and optic nerve of EAE mice was stimulated by
p402 and inhibited by p402 mAb (Fig. 9). Additionally, p402 could
also increase the expression of adhesion molecules (ICAM-1 and
VCAM-1) in glial cells and endothelial cells via the activation of
NF-␬B. Therefore, these proinflammatory molecules being induced by p402 may guide inflammatory leukocytes into and
through the CNS, thus contributing to their multiplication and finally to BBB disruption. Therefore, the protective effect of p402
mAb against the leukocyte invasion into the CNS and the breakdown of BBB and BSB could be mediated through the neutralization of p402 and thereby the inhibition of iNOS and proinflammatory molecules.
Current MS treatments include IFNs, corticosteroids, and cytotoxic immunosuppressive agents which are often associated with a
number of side effects and unsatisfactory outcomes (39). Our results demonstrate that p402 mAb attenuates the clinical symptoms
of RR-EAE, inhibits the encephalitogenicity of MBP-primed T
cells, blocks the infiltration of mononuclear cells into the CNS,
suppresses the expression of adhesion molecules and proinflammatory molecules in the CNS, restores the integrity of BBB and
BSB, normalizes the expression of myelin genes in the CNS, and
INHIBITION OF EAE BY p402 mAb
The Journal of Immunology
32. Fassbender, K., A. Ragoschke, S. Rossol, A. Schwartz, O. Mielke, A. Paulig, and
M. Hennerici. 1998. Increased release of interleukin-12p40 in MS: association
with intracerebral inflammation. Neurology 51: 753–758.
33. Bright, J. J., B. F. Musuro, C. Du, and S. Sriram. 1998. Expression of IL-12 in
CNS and lymphoid organs of mice with experimental allergic encephalitis.
J. Neuroimmunol. 82: 22–30.
34. Weller, R. O., B. Engelhardt, and M. J. Phillips. 1996. Lymphocyte targeting of
the CNS: a review of afferent and efferent CNS-immune pathways. Brain Pathol.
6: 275–288.
35. Steffen, B. J., E. C. Butcher, and B. Engelhardt. 1994. Evidence for involvement
of ICAM-1 and VCAM-1 in lymphocyte interaction with endothelium in experimental autoimmune encephalomyelitis in the central nervous system in the SJL/J
mouse. Am. J. Pathol. 145: 189 –201.
36. Piccio, L., B. Rossi, L. Colantonio, R. Grenningloh, A. Gho, L. Ottoboni,
J. W. Homeister, E. Scarpini, M. Martinello, C. Laudanna, et al. 2005. Efficient
recruitment of lymphocytes in inflamed brain venules requires expression of cutaneous lymphocyte antigen and fucosyltransferase-VII. J. Immunol. 174:
5805–5813.
37. Thiel, V. E., and K. L. Audus. 2001. Nitric oxide and blood-brain barrier integrity. Antioxid. Redox. Signal. 3: 273–278.
38. Hurst, R. D., S. Azam, A. Hurst, and J. B. Clark. 2001. Nitric-oxide-induced
inhibition of glyceraldehyde-3-phosphate dehydrogenase may mediate reduced
endothelial cell monolayer integrity in an in vitro model blood-brain barrier.
Brain Res. 894: 181–188.
39. Miller, A. 1997. Current and investigational therapies used to alter the course of
disease in multiple sclerosis. South. Med. J. 90: 367–375.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
23. Jana, M., and K. Pahan. 2009. Induction of lymphotoxin-␣ by interleukin-12 p40
homodimer, the so-called biologically inactive molecule, but not IL-12 p70. Immunology. In press.
24. Dasgupta, S., M. Bandopadhyay, and K. Pahan. 2008. Generation of functional
blocking monoclonal antibodies against mouse p40 homodimer and monomer.
Hybridoma 27: 141–151.
25. Dasgupta, S., Y. Zhou, M. Jana, N. L. Banik, and K. Pahan. 2003. Sodium
phenylacetate inhibits adoptive transfer of experimental allergic encephalomyelitis in SJL/J mice at multiple steps. J. Immunol. 170: 3874 –3882.
26. Dasgupta, S., M. Jana, Y. Zhou, Y. K. Fung, S. Ghosh, and K. Pahan. 2004.
Antineuroinflammatory effect of NF-␬B essential modifier-binding domain peptides in the adoptive transfer model of experimental allergic encephalomyelitis.
J. Immunol. 173: 1344 –1354.
27. Brahmachari, S., and K. Pahan. 2007. Sodium benzoate, a commonly-used food
additive, modifies T cells at multiple steps and suppresses experimental allergic
encephalomyelitis. J. Immunol. 179: 275–283.
28. Dasgupta, S., A. Roy, M. Jana, D. M. Hartley, K. Pahan. 2007. Gemfibrozil
ameliorates relapsing-remitting experimental autoimmune encephalomyelitis independent of PPAR-␣. Mol. Pharmacol. 72: 934 –946.
29. Brahmachari, S., Y. K. Fung, and K. Pahan, K. 2006. Induction of glial fibrillary
acidic protein expression in astrocytes by nitric oxide. J. Neurosci. 26:
4930 – 4939.
30. Brahmachari, S., and K. Pahan. 2008. Role of cytokine p40 family in multiple
sclerosis. Minerva Med. 99: 105–118.
31. Constantinescu, C. S., D. B. Goodman, B. Hilliard, M. Wysocka, and
J. A. Cohen. 2000. Murine macrophages stimulated with central and peripheral
nervous system myelin or purified myelin proteins release inflammatory products.
Neurosci. Lett. 287: 171–174.
5023