Published OnlineFirst July 3, 2014; DOI: 10.1158/1541-7786.MCR-14-0166
Molecular
Cancer
Research
Cell Cycle and Senescence
Viral Oncogene Expression in the Stem/Progenitor Cell
Compartment of the Mouse Intestine Induces
Adenomatous Polyps
enz Robles1, Jean Leon Chong2, Christopher Koivisto2, Anthony Trimboli2,
Maria Teresa Sa
2
Huayang Liu , Gustavo Leone2, and James M. Pipas1
Abstract
Genetic and epigenetic events that alter gene expression and/or protein function or localization are thought to be
the primary mechanism that drives tumorigenesis and governs the clinical behavior of cancers. Yet, a number of
studies have shown that the effects of oncogene expression or tumor suppressor ablation are highly dependent on cell
type. The molecular basis for this cell-type specificity and how it contributes to tumorigenesis are unknown. Here,
expression of a truncated SV40 large T antigen in murine intestinal crypts promoted the formation of numerous
adenomatous polyps in the colon and small intestine. In contrast, when the same T-antigen construct is expressed in
villous enterocytes, the consequences are limited to hyperplasia and dysplasia. The T-antigen–induced polyps show
high levels of the proto-oncogene c-Myc protein even though there is no transport of b-catenin to the nucleus.
Targeting the expression of viral oncogenes to intestinal crypts or villi provides a murine model system for studying
cell-type specific effects in tumorigenesis, and is particularly relevant to the study of APC/b-catenin–independent
pathways contributing to the generation of intestinal polyps.
Implications: This mouse model system describes the formation of colon polyps in the absence of Wnt/b-catenin
signaling. Mol Cancer Res; 12(10); 1355–64. 2014 AACR.
Introduction
The functional unit of the small intestine is composed
of crypts, pouch-like structures containing pluripotent
stem and progenitor cells, and villi, finger-like projections
above the crypts containing differentiated cells and
absorbing food nutrients from the lumen. Crypt cells
divide regularly, and daughter cells then migrate toward
the villi, begin to differentiate and replenish the epithelium. Villi are mainly composed of absorptive cells or
enterocytes (95%), with intercalated enteroendocrine and
goblet cells, which provide regulatory and secretory functions, respectively. Paneth cells, the fourth type of differentiated cells in the small intestine, migrate toward the
bottom of the crypts and provide immune and defensive
roles (1, 2).
The study of intestinal tumorigenesis has taken advantage of several mouse models, which recapitulate and/or
mimic some or many aspects of the disease (3, 4). The most
1
Department of Biological Sciences, University of Pittsburgh. Pittsburgh,
Pennsylvania. 2Department of Human Genetics and Cancer Center, Ohio
State University, Columbus, Ohio.
Corresponding Author: James M. Pipas, University of Pittsburgh, Tennyson and Ruskin, Pittsburgh, PA 15260. Phone: 412-624-4322; Fax: 412624-4759; E-mail: [email protected]
doi: 10.1158/1541-7786.MCR-14-0166
2014 American Association for Cancer Research.
widely used models are based on the ApcMin mouse, in which
intestinal neoplasia and multiple polyps develop upon
mutation of the Apc gene (5–7). Despite the central role
played by the product of the retinoblastoma gene (RB) in
multiple cancers, current models of intestinal tumorigenesis do not address the function of RB in this disease, and
the information available is somewhat controversial. For
instance, an in vitro system using colorectal cancer cells
suggests that RB depletion would prevent proliferation and
the formation of colonic tumors by preventing the degradation of b-catenin mediated by E2F1 (8). In contrast,
several reports have indicated that removal of one or more
pRb proteins from different intestinal compartments results
in ectopic intestinal proliferation and hyperplasia (9–12).
In addition, our analysis of the Catalogue of Somatic
Mutations in Cancer (COSMIC) obtained from the Sanger
Institute [(The COSMIC) database and website, http://
www.sanger.ac.uk/cosmic; ref. 13] performed in May
2014 indicates a significant level of RB alterations present
in large intestinal tumors. After excluding synonymous
(silent) mutations, 101 out of 747 samples (13.5%) contained complex mutations, deletions, insertions, and/or
substitutions of RB. In addition, a significant percentage of
large intestinal tumors show alterations in gene copy number, either in gain (272 out of 486 samples, 56%) or loss
(22 out of 486 samples, 4.5%) of RB (http://cancer.sanger.
ac.uk/cosmic/gene/analysis?ln¼RB1&ln1¼RB1&start¼
1&end¼929&coords¼AA%3AAA&sn¼&ss¼&hn¼&sh¼
www.aacrjournals.org
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
1355
Published OnlineFirst July 3, 2014; DOI: 10.1158/1541-7786.MCR-14-0166
enz Robles et al.
Sa
&mut¼complex&mut¼deletion_frameshift&mut¼deletion_inframe&mut¼insertion_frameshift&mut¼insertion_
inframe&mut¼substitution_missense&mut¼substitution_
nonsense&id¼16#).
Finally, studies of a mouse model developed by us and
others also suggest a yet uncharacterized role for pRb on
intestinal cancer (14–20). Expression of the large T antigen
from SV40 (SVT) in intestinal enterocytes results in hyperplasia and dysplasia and, in this system, tumorigenic induction and practically all the elicited gene expression changes
depend on the ability of SVT to bind and inactivate the pRb
pathway.
To test the response of intestinal stem or progenitor cells to
SVT, we have now used the Villin promoter to initiate
expression of SVT and SVT mutants in intestinal crypts.
Materials and Methods
Transgenic mice production
Mice expressing SV40 T antigen or the truncation mutant
N136 under the control of the rat intestinal fatty acidbinding protein promoter (IFABP) have been previously
described (15, 21). The construction of transgenic mice
expressing SVT, SVTN136, and SVTE107,108K under the
control of the villin promoter was achieved by replacing
the IFABP promoter in previously described constructs with
a new villin promoter. In particular, regulatory sequences
from the mouse villin promoter (the 3.5Kb upstream from
the transcription start site) were amplified by PCR with Pfu
Ultra II (Stratagene) using specific primers which also added
restriction sites (50 -CCGCGGGCGGCCGCGAATTCGACACTGTGGTCCCAGCACTGGGGA and 50 - GGTACCCTCGAGGTCGACAGATCTTAGGAAGTTGTGGCAA), at 55 C annealing. The resulting 3.5-Kb product
was digested with Not I/SalI and ligated to the 5.4Kb
NotI/SalI fragment from either IFABP.SVT; IFABP.
SVTN136 or IFABP.SVTE107,108K, which contained the
respective SV40 oncogenes and the plasmid backbone
(21), thus effectively replacing the IFABP promoter with
the villin promoter. All SVT constructs were derived from the
early region of SV40 and thus can potentially express small
t antigen. The mutant SVTE107,108K was previously referred
as TAg3213 (21). The 6.5-Kb fragment resulting from
BamHI/HaeII digestion and containing the villin promoter
and SV40 oncogene was used to microinject into pronuclei of
1-cell mouse embryos. Generation of the transgenic mice was
performed at the Genetically Engineered Mouse Modeling
Core at Ohio State University (Columbus, OH; http://
cancer.osu.edu/research/cancerresearch/sharedresources/
genetically_engineered_mouse_modeling/pages/index.aspx).
Mouse genotyping was determined by 30 cycles of PCR
amplification with specific primers (50 -TTTGGAGGCTTCTGGGATGC/50 -TCCTTGGGGTCTTCTACCTTTCTC), at 54 C annealing temperature, which generated a
537-bp product in the presence of the transgene. All lines
were maintained by crosses to nontransgenic FVB mice. All
work involving mice was approved by both University of
Pittsburgh (Pittsburgh, PA) and Ohio State University
1356
Mol Cancer Res; 12(10) October 2014
Institutional Animal Care and Use Committees and followed NIH guidelines.
IHC and apoptosis assays
The mouse intestines were removed from the abdominal
cavity, opened along their cephalocaudal axis, and washed
with PBS. Intestine was divided into proximal, middle,
distal, colon, and cecum sections and "swiss rolls" were
prepared and fixed in formalin. Paraffin embedding followed
conventional techniques and 5-mm-thick histologic sections
were subjected to specific antibodies to detect SV40 T
antigen (PAb416); c-myc [N262 (sc-764), Santa Cruz
Biotechnology); MMP7 (D4H5, Cell Signaling Technology); b-catenin (BD Transduction Laboratories 610154), and
p53 (PAb242). Antigen–antibody complexes were detected
with specific biotinilated secondary antibodies followed by
streptavidin-peroxidase [ABC Elite Rabbit Kit (Vector
Labs); ARK kit plus Mouse on Mouse (DAKO)] according
to the manufacturer's instructions. Development of the
peroxidase reaction was performed with DAB substrate
(DAKO). Stained sections of murine intestines were photographed under a Axio Vert.A1 Zeiss microscope.
Apoptosis was measured in 5-mm-thick histologic sections by TUNEL (terminal deoxynucleotidyl transferase–
mediated dUTP nick end labeling) assay following standard protocols (Research Histology Services, University of
Pittsburgh).
Results
Generation of transgenic mice expressing a viral
oncogene in intestinal crypts
Expression of full-length SVT in intestinal crypts seems to
be extremely deleterious to the mice, as suggested by our
inability to generate founder mice or transgenic progeny
expressing consistently the oncogene in crypts (Table 1). In
fact, high expression of SVT in murine crypts was only
achieved in one founder mouse, which was moribund and
had to be sacrificed at 2.7 months. This mouse showed
chimeric patches of expression in crypts and villi, and the
expression of SVT correlated with an abnormal hyperplastic
and dysplastic phenotype, villi branching, areas resembling
early polyps, and carcinoma (Fig. 1A to C). An associated
lymphoma and carcinoma also showed partial transgene
expression (data not shown), and additional anomalies were
observed as well, such as liver hyperplasia and spleen
enlargement.
Role of pRb proteins in intestinal tumorigenic induction
The retinoblastoma family of proteins comprises three
closely related regulators of the cell cycle, the product of the
RB gene (pRb), p107 and p130 (22). Two SVT proteins,
SVT and SVTN136 (Fig. 1E), induce intestinal hyperplasia
and dysplasia when expressed in enterocytes (19), and both
are able to interfere effectively with the pRb pathway by
binding the components via a functional LXCXE motif
(Fig. 1E). Thus, intestinal tumorigenesis could depend on
the integrity of the pRb pathway. To examine the role of pRb
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
Published OnlineFirst July 3, 2014; DOI: 10.1158/1541-7786.MCR-14-0166
Induction of Adenomatous Polyps by a Viral Oncogene
Table 1. Summary and details of founder mice used in this study
Construct
Villin SVT
(7 founders)
Transgene expression
and number of mice
Expression
details
Chimeric expression from
bottom of crypts to tips of
villi (2 mice)
High
expression
(1 mouse)
Low
expression
(1 mouse)
Undetectable (3 mice)
Died before analysis
(2 mice)
Villin SVTN136
(11 founders)
Chimeric expression from
bottom of crypts to tips of
villi. Both nuclear and cytop
(7 mice)
Note: abnormal
areas always
correlated with
same areas of
transgene
expression
Undetectable (3 mice)
Died before analysis
(1 mouse)
Villin
SVTE107, 108K
(4 founders)
Offspring
produced?
Positive
progenie?
Very unhealthy,
harvested at 2.7 mo.
Intestinal dyspiasia,
carcinoma and
lymphoma.
Hyper/dysplastic
patches
Yes
No
Yes
Yes
Normal
Not determined
Yes
Yes
No
Yes
(from one
founder)
Founder morphology
Very high
expression
(1 mouse)
Hyper/dysplastic
areas, several small
polyps, elongated
crypts, hyperplastic
Peyer patches.
Abnormal areas
correlating with
staining.
Good
Hyper/dysplastic
expression
patches correlating
(2 mice)
with staining. Long villi,
extensive branching
Very high
Hyper/dysplasia,
expression.
branching, multiple
High
polyps in small and
percentage of
large intestine,
tissue
decreased number of
expressing the goblets in polyp areas,
transgene
elongated crypts,
(1 mouse)
hyperplastic Peyer
patches. Large
sarcoma around the
right-hind leg. Enlarged
spleen with multiple
megakariocytes
Very high
Hyper/dysplastic
expression, low areas, some polyps
percentage of
tissue
expressing the
transgene
(1 mouse)
Low
Hyperplastic and
expression
dysplastic patches,
(2 mice)
long villi, fused crypts.
One very sick mouse
had liver cancer
Normal
Not determined
Transgene expression
limited to top of crypts
and villi, absent from
bottom crypts. Hyper/
dysplastic intestines
Transgene expression
limited to top of crypts
and villi, absent from
bottom crypts. Hyper/
dysplastic intestines
No
Yes
No
Yes
Yes (only one
pup)
Yes
No
Yes (from one
mouse)
Yes
Yes (1 mouse)
Yes
No
No
Not analyzed (2 mice)
Normal
Yes
Yes (from
2 founders)
Undetectable (1 mouse)
Low/mid expression
(1 mouse)
Normal
Normal
Yes
Yes
No
No
www.aacrjournals.org
Transgene expression and morphology
of progeny
Very sick. Died
prior to analysis
(1.7 months)
Very low expression
from bottom of
crypts. Normal
Transgene expression
from the bottom of
the crypts. Normal
morphology
Mol Cancer Res; 12(10) October 2014
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
1357
Published OnlineFirst July 3, 2014; DOI: 10.1158/1541-7786.MCR-14-0166
enz Robles et al.
Sa
C
A
B
D
E
hsc70
J
pRb
LxCxE
p53
OBD Zn+ ATPase
HR
NLS
SVT
SVTN136
SVTE107,108K
Figure 1. SVT expression in the crypts induces intestinal tumorigenesis, while an SVT mutant unable to disrupt the pRb pathway fails to produce a
phenotype. IHC staining of intestinal murine sections with an antibody specific for SVT and mutant derivatives, indicated by brown color, reveals
expression of the transgene driven by the Villin promoter. A, Villin-driven expression of SVT initiates at the bottom of the crypts and extends toward
the tips of the villi (see detail in C). Expression of the transgene correlates with the appearance of abnormal intestinal areas as shown in serial
sections stained for SVT (A) or H&E (B), and include one polyp (blue arrows). D, histologic section from the proximal intestinal region of a 6-month-old
E107,108K
E107,108K
transgenic male carrying Villin.SVT
. Expression of the SVT
transgene extends from the bottom of the crypts to the tip of the villi,
but nevertheless produces no discernible anomalies or tumorigenic phenotype in the mice. E, top, schematic diagram of the different protein
domains and motifs within SVT (in light gray: J domain, LXCXE motif, nuclear localization signal, origin binding-, Zn-, ATPase-, and host range domains)
and the cellular partners they bind (in dark gray: hsc70, pRb proteins, p53). Bottom, SVT mutants used in this study (full length –SVT-, N-terminal
truncation -N136-, mutant defective for pRb binding –E107,108K-).
proteins in the induction of adenomatous polyps, we targeted the expression to intestinal crypts of a full-length
mutant T antigen unable to disrupt the pRb pathway
(SVTE107,108K; Fig. 1E). In contrast with our previous efforts
to generate mice expressing SVT and SVTN136, two lines of
transgenic mice were readily established and characterized
containing the SVTE107,108K transgene (Table 1). Strong
nuclear expression of the corresponding protein was detected
from the bottom of the crypts all the way to the top of the villi
along the intestinal axis (Fig. 1C), confirming that the Villin
promoter efficiently directs the expression of the transgene to
the intestinal crypts, and subsequently to enterocytes. The
SVTE107,108K-expressing mice developed and survived normally, had no indications of an abnormal intestinal phenotype (Fig. 1D), and showed no tumorigenesis.
In contrast, we generated seven transgenic founders
expressing the truncated SVTN136 oncogene, which retains
the ability to disrupt the pRb pathway but is unable to
interact with p53 (Fig. 1E). All of these founders presented a
chimeric phenotype, and only some portions of the intestine
showed expression of the transgene (Fig. 2B and D; Table 1).
The percentage of chimerism varied between founders, but
transgene expression always extended from the bottom of the
crypts to the tips of the villi (Fig. 2B), and higher SVTN136
levels correlated with a more evident abnormal phenotype.
1358
Mol Cancer Res; 12(10) October 2014
Transgene expression was present both in the nuclei and
cytoplasm (Fig. 2D), as expected from a small protein
product able to pass freely through the nuclear pores.
Unlike villi-restricted expression of SVTN136, which
results in hyper/dysplasia (Fig. 2A; ref. 19), crypt-expression
of SVTN136 produced dysplasia and also induced formation
of numerous polyps along the small and large intestine (Fig.
2E). A sharp correlation was always apparent between
expression of SVTN136 in particular groups of cells and/or
intestinal regions and the appearance and severity of the
tumorigenic phenotype, indicating that the effects of
SVTN136 were cell autonomous (Fig. 2C and D). However,
our attempts to establish transgenic lines from chimeric
SVTN136 founders were not successful. The founders produced either, (i) no positive progeny; (ii) progeny presenting
extremely low levels of SVTN136 expression and showing no
discernible phenotype or; (iii) very limited number of
positive and very sick progeny (two pups) which died before
analysis. A summary of the results is shown in Table 1.
Role of p53 and p53-dependent apoptosis in intestinal
tumorigenesis
One of the main controllers of tumorigenesis is the cellular
p53 tumor suppressor, which plays roles in DNA repair, cellcycle progression, and apoptosis. Disruption of the pRb
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
Published OnlineFirst July 3, 2014; DOI: 10.1158/1541-7786.MCR-14-0166
Induction of Adenomatous Polyps by a Viral Oncogene
Figure 2. Expression of an SVT
mutant in the intestinal crypts
leads to polyp formation. A–C,
histologic sections from proximal
regions of murine intestines
N136
showing the presence of SVT
as detected with a specific
antibody, indicated by brown
N136
color: Although SVT
transgene
expression driven by the IFABP
N136
) is
promoter (IFABP. SVT
restricted to the villi and results in
hyperplasia (A), expression driven
by the Villin promoter (Villin.
N136
SVT
) initiates from the crypts
and results in overt dysplasia,
neoplasia, and polyp formation (B–
D). Analysis of serial sections from
N136
Villin.SVT
mice by hematoxilin
N136
and eosin staining (E) or SVT
immunostaining (D) indicates a
clear correlation between
transgene expression and
neoplastic phenotype.
A
C
pathway and other stimuli in normal cells triggers a p53response aimed to avert abnormal proliferation. SVT is able
to counteract the p53 response by directly binding, stabilizing, and inhibiting p53, therefore preventing growth
arrest or apoptosis and contributing to abnormal cell
proliferation.
In the small intestine, we have previously shown that the
expression SVT and SVT mutants in enterocytes does not
result in upregulation or disruption of p53 and p53-target
genes (16, 19), and disruption of the p53 pathway is not
required to induce intestinal tumorigenesis in this transgenic system (16). However, apoptosis and p53 are absent
in normal intestines but, unlike in villi cells, g radiation
triggers a robust p53 response in normal crypt cells (23).
This suggests that expression of SVT and SVT mutants in
crypts might affect p53 in a cell-specific manner, and
prompted us to examine the levels of p53 and apoptosis
in Villin-driven SVT-expressing transgenic mice. As
described above, intestinal polyps were present following
expression of SVTN136 in crypts, but not in villi (Fig. 1),
and we observed that, in crypts, expression of SVTN136
sufficed to increase the levels of apoptosis (Fig. 3A and B).
Apoptosis was restricted to the areas of SVTN136 expression,
but was absent in normal, nonexpressing areas. Expression
of SVTN136, which lacks a functional p53-binding domain,
in crypts did not raise the levels of p53 significantly (Fig.
3D), either in areas expressing the transgene or those
lacking it (Fig. 3C). In sharp contrast, expression in the
crypts of SVT proteins containing a functional p53 domain
binding (SVT and SVTE107,108K) did raise the levels of p53
considerably (Fig. 3F and data not shown). In this case,
upregulation of, presumably inactive, p53 was found in a
large subset of cells expressing the transgene, including the
intestinal crypts and tumors present in the SVT founder
(Fig. 3E and F and data not shown).
www.aacrjournals.org
B
D
E
Molecular characterization of SVTN136-induced
intestinal polyps
We then investigated the properties of intestinal polyps in
SVTN136-expressing mice. Intestinal homeostasis, tumorigenesis, and polyp formation have been linked to the
canonical Wnt pathway and, in particular, to the nuclear
translocation of b-catenin and activation of downstream
target genes like c-myc (24–31). However, mice expressing
SVTN136 in the crypts showed a similar pattern of b-catenin
localization as control mice; that is, no nuclear b-catenin
was found in either normal or abnormal intestinal areas, or
in polyps or other dysplastic regions produced by the
transgene (Fig. 4A). In contrast, normal nuclear localization
of b-catenin in crypt cells was present in all cases (Fig. 4B).
We then monitored the expression of c-myc, a target of
b-catenin frequently amplified and/or overexpressed in premalignant and malignant stages of human colorectal carcinomas (31, 32), but whose expression remains restricted to the
crypt compartment in normal intestinal epithelium (33).
Despite the absence of nuclear b-catenin in abnormal areas,
we found that SVTN136 mice contained high levels of c-myc in
hyperplastic villi as well as in polyps (Figure 4C and D). Areas
of increased c-myc expression corresponded to areas of
expression of the SVTN136 (Fig. 4C and F). Furthermore,
the expression of MMP7 (Fig. 4E), an additional b-catenin
target (34), was also increased in morphologically abnormal
intestinal areas expressing SVTN136. Our results suggest that
high levels of c-myc expression and/or other b-catenin targets
can be achieved independently of nuclear b-catenin status,
and that polyp formation can be attained without nuclear
localization of b-catenin.
Discussion
We have developed a model system to induce intestinal
tumorigenesis that relies on the expression of a potent
Mol Cancer Res; 12(10) October 2014
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
1359
Published OnlineFirst July 3, 2014; DOI: 10.1158/1541-7786.MCR-14-0166
enz Robles et al.
Sa
A
B
C
D
E
F
N136
Figure 3. Apoptotic response to SVT
expression and induction of p53 in different intestinal compartments. IHC staining of serial sections from
N136
chimeric mice reveal that the extensive apoptosis measured by TUNEL assay (A, brown staining) correlates with the presence of the
SVT
N136
N136
transgene (B, brown staining). Apoptosis is evident in areas of SVT
expression (red arrowheads) and is absent in normal areas lacking SVT
N136
expression (blue arrowheads). Expression of p53 and the appropriate transgene was monitored in serial sections from SVT
(C and D) and SVT
N136
expression, even in crypts (C, blue arrows) is not able to raise and/or stabilize substantially the levels of p53 (D, arrows).
(E and F) mice. SVT
In contrast, expression of full-length SVT (E) raises significantly the levels of p53 (F).
oncogene, the large T antigen from SV40 (SVT), in different
compartments within the intestinal epithelium. We have
previously shown that the expression of SVT in the differentiated cells of the villi induces hyperplasia and dysplasia,
but tumorigenesis does not proceed further under those
conditions (16). Although the major cellular targets of SVT
are the tumor suppressor p53 and the pRb proteins (pRb,
p107 and p130), SVT induction of intestinal tumorigenesis
in the villi is completely dependent on the disruption of the
pRB pathway (17–19) but does not require p53 inactivation
(16). SVT interferes with all three pRb proteins, therefore
our results are consistent with those of other authors suggesting that the ablation of at least two members of the pRb
family (pRb/p130 or pRb/p107) is required to induce
ectopic proliferation in the villi (9). In contrast, we and
others have shown that removal of pRb from the crypt
pluripotent progenitor cells is sufficient for enterocyte proliferation (10–12). We thus aimed to understand whether
tumorigenic induction is dependent on which cell type the
oncogene, or other alteration, is first expressed, and have
generated transgenic mice that express different viral oncogenes first in intestinal crypts, and subsequently in the
resulting villi.
We found that the expression of SVT in intestinal crypts
seems to be extremely deleterious to the mice. In contrast,
mice expressing a mutant T antigen unable to disrupt the
1360
Mol Cancer Res; 12(10) October 2014
pRb pathway (SVTE107,108K) developed normally and
showed no obvious phenotype, although transgenic expression was strong in both progenitor and differentiated cells.
These results indicate that SVT-mediated intestinal tumorigenesis requires disruption of the pRb pathway. Expression
of the truncated SVTN136 in the crypts was also very
detrimental to the mice and we were unable to establish
transgenic lines. However, seven transgenic founders presenting a chimeric phenotype were generated and fully
analyzed. Crypt expression of SVTN136 produced dysplasia
and also induced formation of numerous polyps along the
small and large intestine. These results are in clear contrast
with those previously obtained upon expression of SVTN136
restricted to intestinal villi, where mice developed hyperplasia but never showed polyp formation.
On the basis of our previous results (11), plus those
presented in this manuscript, we propose a model to explain
how Rb affects intestinal proliferation (Fig. 5): The E2F
activators E2F1-2-3 contribute to maintain proliferation in
the crypts by activating specific promoters. As crypt cells
migrate up the villi, activation of the E2F target genes is
initially prevented by the binding of underphosphorylated
pRb to E2F1-2-3. Final growth arrest in the villi is achieved
by active repression of the promoters via p130/E2F4 (21) as
part of the DREAM complex (35). In agreement with this
model, cell-cycle re-entry in the villi requires the loss of
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
Published OnlineFirst July 3, 2014; DOI: 10.1158/1541-7786.MCR-14-0166
Induction of Adenomatous Polyps by a Viral Oncogene
A
B
D
C
F
E
N136
Figure 4. SVT
expression in crypts induces morphologic changes and correlates with increased levels of c-myc without altering the localization of
b-catenin. The presence of different antigens [b-catenin (A and B); c-myc (C and D); MMP7 (E), and SVTN136 (F)] was revealed by IHC of murine
N136
mice show that b-catenin nuclear staining is absent in dysplastic or polyp
intestines and is indicated by brown color. Sections from Villin.SVT
areas (A), while the normal nuclear localization is evident in intestinal crypts (B). Increased levels of c-myc protein are apparent in abnormal regions (C)
N136
and polyps (D). As shown by comparison between serial sections (C and F), the areas of c-myc expression (C) correlate to areas of SVT
N136
expression (F). The presence of MMP7 in adjacent morphologically normal and abnormal areas of Villin.SVT
intestines is shown in E: Although
MMP7 staining is restricted to the bottom of the crypts in normal intestinal areas (red arrows), it extends up the crypts and into the villi in abnormal
N136
transgene (not shown).
areas (blue arrows), which also express the SVT
multiple Rb family members (9), and disruption of all pRb
proteins by SVT or SVTN136 bypasses growth restriction,
allowing E2F activators to drive gene expression and induce
ectopic proliferation (14, 15, 19, 21). Also in agreement with
this model, expression of SVT mutants unable to disrupt the
pRb pathway in the villi neither induces intestinal proliferation nor upregulation of E2F target genes (17–19), and
expression in the crypts fails to induce tumorigenesis (this
manuscript).
We next examined the levels of p53 and apoptosis in
mice expressing SVT in intestinal crypts. Disruption of
the pRb pathway induces p53-dependent apoptosis, and
SVT counteracts this response by targeting p53 directly.
This binding results in p53 stabilization and cells expressing SVT contain high amounts of p53. However, p53
bound by SVT is unable to induce growth arrest or
apoptosis. Although some SVT-induced tumorigenesis
models (36–38) rely on p53 inactivation, expression of
full-length SVT antigen or an amino terminal truncation
in villi neither accumulates p53 nor requires p53 to induce
hyperplasia and dysplasia (16). However, and unlike
enterocytes that do not show increased p53 levels or
activity in response to DNA damage or T-antigen expres-
www.aacrjournals.org
sion, normal crypt progenitor cells exhibit a robust p53
response following g radiation (23). We thus postulated
that expression of SVT and SVT mutants in crypts might
affect p53 in a cell-specific manner.
We found that crypt expression of SVTN136, which
disrupts the pRb pathway but lacks a functional p53-binding
domain, sufficed to increase the levels of apoptosis, which
was restricted to the areas of transgene expression. However,
this expression did not raise the levels of p53 significantly,
suggesting that either apoptosis was not mediated by p53 or
that the levels of p53 were insufficient to allow for IHC
detection. We believe this second possibility unlikely as, in
sharp contrast, crypt expression of SVT proteins containing a
functional p53 domain binding (SVT and SVTE107,108K)
did raise the levels of p53 considerably. Our results show
that SVT effects on the p53 response depend on the cell
type where the transgene was initially expressed and that
crypt/progenitor cells are able to express p53 in response to T
antigen. This study indicates that different cell types respond
in a very different way to oncogenic stimuli, and that the final
outcome of a particular mutation or oncogenic disruption
will depend on the context, cell type, developmental and/or
proliferative state, where the mutation originally took place.
Mol Cancer Res; 12(10) October 2014
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
1361
Published OnlineFirst July 3, 2014; DOI: 10.1158/1541-7786.MCR-14-0166
enz Robles et al.
Sa
Villus
Growth
arrest
p130
pRb
E2F4
Enterocytes
Differentiation
zone
Transition
P
P
pRb
Crypt
P
E2F1-2-3
pRb
E2F1-2-3
Figure 5. Diagram of the villi-crypt
intestinal unit and model for the
control of intestinal proliferation by
the Rb/E2F pathway. Inactive
hyperphosphorylated pRb allows
E2F-mediated S-phase
progression and proliferation in
stem and progenitor cells within the
crypts. As cells migrate upwards to
differentiate and form the
quiescent villi, transient repression
of cell-cycle gene transcription is
first mediated by pRb binding to
E2F activators in the promoters of
E2F-target genes. Promoters then
become permanently repressed by
p130-E2F4 DREAM complexes at
the final stages of differentiation
and growth arrest.
Proliferation
What molecular mechanisms mediate the formation of
intestinal polyps in SVTN136-induced tumorigenesis? Multiple lines of evidence indicate a central role of the canonical
Wnt pathway, nuclear translocation of b-catenin, and activation of its downstream target genes (e.g., c-myc; ref. 24) in
intestinal homeostasis, tumorigenesis, and polyp formation
(25–29). In addition, most adenocarcinomas and neoplasms
of the colon show nuclear localization of b-catenin (30).
Nevertheless, deregulation of target genes controlled by the
b-catenin pathway was not observed in hyper/dysplastic
murine intestines where the expression of SVT or
SVTN136 was restricted to intestinal villi (19). However,
tumorigenesis in crypt-expressing SVTN136 mice did show
not only hyper/dysplasia but further progressed to polyp
formation. We thus examined the status of b-catenin and
some of its targets upon SVTN136 expression in the crypts.
Surprisingly, we found no increase or changes in the nuclear
localization of b-catenin along the intestines, including
abnormal and dysplastic areas or polyps. Although this result
was somewhat unexpected, a small percentage of human
adenocarcinomas have no mutations on Apc or b-catenin,
and is tempting to speculate that mice expressing SVTN136
in the crypts could serve as an adequate model system for
those tumors. Even more unexpected was the finding that
SVTN136 mice expressed high levels of c-myc, a transcriptional target of b-catenin, in hyperplastic villi and polyps.
This result was particularly intriguing because the c-myc
gene is frequently amplified and/or overexpressed in premalignant and malignant stages of human colorectal carcinomas (31, 32), although c-myc expression is restricted to
the crypt compartment in normal intestinal epithelium (33).
Furthermore, the expression of MMP7, an additional
b-catenin target (34), was also increased in intestinal areas
1362
Mol Cancer Res; 12(10) October 2014
expressing SVTN136. We conclude that SVTN136 induces
high levels of c-myc expression and possibly other b-catenin
targets independently of nuclear b-catenin status, and that
polyp formation can be attained without nuclear localization
of b-catenin.
Other pathways, such as rapid protein degradation, can
control c-myc independently of b-catenin nuclear localization (39). One possibility is that SVTN136 prevents c-myc
degradation and thus results in its accumulation.
A subset (10%–12%) of human adenocarcinomas contains no mutations of Apc or b-catenin but still shows high
expression levels of c-myc, indicating that regulation of
c-myc in these tumors is independent of the Apc/b-catenin
pathway. Our results indicate that SVTN136 uses alternative
mechanism/s, independent of upstream regulation by Wnt,
to activate b-catenin targets and contribute to the formation
of polyps in the small and large intestine. Thus, SVTN136
expression in crypts seems to mimic the subset of colorectal
tumors that lack Apc/b-catenin mutations.
At present, we do not know what b-catenin–independent
mechanisms induce polyp formation. Our recent work
indicates that control of normal (wt crypts) and ectopic
(RBKO villi) intestinal proliferation depends on a combination of two different pathways controlled by pRB, the E2F
activators, and c-myc (Liu et al; submitted for publication).
In agreement, induction of tumorigenesis in our model
system depends on an intact LXCXE motif and, presumably,
deregulation of pRb proteins. We hypothesize that disruption of pRb in the crypts by SVTN136 results in c-myc
expression changes that contribute to polyp formation
independently of b-catenin. Ectopic c-myc expression is
necessary but not sufficient to induce intestinal polyps
(40). Thus, our results suggest that additional cellular
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
Published OnlineFirst July 3, 2014; DOI: 10.1158/1541-7786.MCR-14-0166
Induction of Adenomatous Polyps by a Viral Oncogene
proteins targeted by SVTN136 contribute to the induction of
polyps. These targets will be the focus of future investigations and could allow us to design specific therapies matched
to genetic background of particular adenocarcinomas.
In summary, we have found that the molecular consequences and tumorigenic phenotype caused by T-antigen
expression in the intestine depend on the initial subset of
cells in which the transgene is expressed. SVTN136 only
induces polyp formation when targeted to the proliferating
cells of the crypts. Expression of SVT in crypts, but not in
villi, is able to increase—and, presumably, inactivate—the
levels of p53. Our results indicate that disruption of the pRb
and/or p53 pathways has different consequences in different
subsets of cells and could help to explain why the role of
pRb in intestinal tumorigenesis has not been completely
established. In addition, we have shown that intestinal
tumorigenesis could arise independent of b-catenin nuclear
localization. Identification of the redundant/cooperating
pathways operating in this system could lead us to valuable
insights to evaluate and treat different cancers.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Authors' Contributions
Conception and design: M.T. Saenz Robles, J.L. Chong, G. Leone, J.M. Pipas
Development of methodology: M.T. Saenz Robles
Acquisition of data (provided animals, acquired and managed patients, provided
facilities, etc.): M.T. Saenz Robles, J.L. Chong, C. Koivisto, A. Trimboli, H. Liu
Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): M.T. Saenz Robles, J.L. Chong, C. Koivisto, G. Leone, J.M. Pipas
Writing, review, and/or revision of the manuscript: M.T. Saenz Robles, J.L. Chong,
C. Koivisto, H. Liu, G. Leone, J.M. Pipas
Administrative, technical, or material support (i.e., reporting or organizing data,
constructing databases): J.L. Chong, G. Leone, J.M. Pipas
Study supervision: M.T. Saenz Robles, J.M. Pipas
Grant Support
This work was supported by NIH grant R01CA098956 (to J.M. Pipas).
The costs of publication of this article were defrayed in part by the payment of
page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received March 28, 2014; revised May 16, 2014; accepted June 16, 2014;
published OnlineFirst July 3, 2014.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Clevers H. The intestinal crypt, a prototype stem cell compartment.
Cell 2013;154:274–84.
van der Flier LG, Clevers H. Stem cells, self-renewal, and differentiation
in the intestinal epithelium. Ann Rev Physiol 2009;71:241–60.
Tong Y, Yang W, Koeffler HP. Mouse models of colorectal cancer. Chin
J Cancer 2011;30:450–62.
Karim BO, Huso DL. Mouse models for colorectal cancer. Am J Cancer
Res 2013;3:240–50.
Moser AR, Pitot HC, Dove WF. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science 1990;
247:322–4.
Clarke AR. Cancer genetics: mouse models of intestinal cancer.
Biochem Soc Trans 2007;35:1338–41.
Cheung AF, Carter AM, Kostova KK, Woodruff JF, Crowley D, Bronson
RT, et al. Complete deletion of Apc results in severe polyposis in mice.
Oncogene 2010;29:1857–64.
Morris EJ, Ji JY, Yang F, Di Stefano L, Herr A, Moon NS, et al. E2F1
represses beta-catenin transcription and is antagonized by both pRB
and CDK8. Nature 2008;455:552–6.
Haigis K, Sage J, Glickman J, Shafer S, Jacks T. The related retinoblastoma (pRb) and p130 proteins cooperate to regulate homeostasis
in the intestinal epithelium. J Biol Chem 2006;281:638–47.
Yang HS, Hinds PW. pRb-mediated control of epithelial cell proliferation and Indian hedgehog expression in mouse intestinal development. BMC Dev Biol 2007;7:6.
enz Robles MT, Nair V, Ferrey A, Hagan JP,
Chong JL, Wenzel PL, Sa
et al. E2f1–3 switch from activators in progenitor cells to repressors in
differentiating cells. Nature 2009;462:930–4.
Guo J, Longshore S, Nair R, Warner BW. Retinoblastoma protein (pRb),
but not p107 or p130, is required for maintenance of enterocyte
quiescence and differentiation in small intestine. J Biol Chem 2009;
284:134–40.
Bamford S, Dawson E, Forbes S, Clements J, Pettett R, Dogan A, et al.
The COSMIC (Catalogue of Somatic Mutations in Cancer) database
and website. Br J Cancer 2004;91:355–8.
Kim SH, Roth KA, Coopersmith CM, Pipas JM, Gordon JI. Expression
of wild-type and mutant simian virus 40 large tumor antigens in villusassociated enterocytes of transgenic mice. Proc Natl Acad Sci U S A
1994;91:6914–8.
Kim SH, Roth KA, Moser AR, Gordon JI. Transgenic mouse models
that explore the multistep hypothesis of intestinal neoplasia. J Cell Biol
1993;123:877–93.
www.aacrjournals.org
16. Markovics JA, Carroll PA, Robles MT, Pope H, Coopersmith CM, Pipas
JM. Intestinal dysplasia induced by simian virus 40 T antigen is
independent of p53. J Virol 2005;79:7492–502.
17. Chandrasekaran C, Coopersmith CM, Gordon JI. Use of normal and
transgenic mice to examine the relationship between terminal differentiation of intestinal epithelial cells and accumulation of their cell cycle
regulators. J Biol Chem 1996;271:28414–21.
enz Robles MT, Pipas JM. Enterocyte proliferation and
18. Rathi AV, Sa
intestinal hyperplasia induced by simian virus 40 T antigen require a
functional J domain. J Virol 2007;81:9481–9.
enz Robles MT, Cantalupo PG, Whitehead RH, Pipas
19. Rathi AV, Sa
JM. Simian virus 40 T-antigen-mediated gene regulation in enterocytes is controlled primarily by the Rb-E2F pathway. J Virol 2009;
83:9521–31.
enz Robles MT, Rathi AV, Beerman RW, Pat20. Cantalupo PG, Sa
terson WH, Whitehead RH, et al. Cell-type specific regulation of
gene expression by simian virus 40 T antigens. Virology 2009;386:
183–91.
enz Robles MT, Markovics JA, Chong JL, Opavsky R, Whitehead
21. Sa
RH, Leone G, et al. Intestinal hyperplasia induced by simian virus 40
large tumor antigen requires E2F2. J Virol 2007;81:13191–9.
22. Henley SA, Dick FA. The retinoblastoma family of proteins and their
regulatory functions in the mammalian cell division cycle. Cell Div
2012;7:10.
23. Coopersmith CM, Gordon JI. g-Ray-induced apoptosis in transgenic
mice with proliferative abnormalities in their intestinal epithelium:
re-entry of villus enterocytes into the cell cycle does not affect their
radioresistance but enhances the radiosensitivity of the crypt by
inducing p53. Oncogene 1997;15:131–41.
24. He TC, Sparks AB, Rago C, Hermeking H, Zawel L, da Costa LT, et al.
Identification of c-MYC as a target of the APC pathway. Science
1998;281:1509–12.
25. de Lau W, Barker N, Clevers H. WNT signaling in the normal intestine
and colorectal cancer. Front Biosci 2007;12:471–91.
26. Radtke F, Clevers H, Riccio O. From gut homeostasis to cancer. Curr
Mol Med 2006;6:275–89.
27. Pinto D, Gregorieff A, Begthel H, Clevers H. Canonical Wnt signals are
essential for homeostasis of the intestinal epithelium. Genes Dev
2003;17:1709–13.
28. Fevr T, Robine S, Louvard D, Huelsken J. Wnt/beta-catenin is essential
for intestinal homeostasis and maintenance of intestinal stem cells.
Mol Cell Biol 2007;27:7551–9.
Mol Cancer Res; 12(10) October 2014
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
1363
Published OnlineFirst July 3, 2014; DOI: 10.1158/1541-7786.MCR-14-0166
enz Robles et al.
Sa
29. Van der Flier LG, Sabates-Bellver J, Oving I, Haegebarth A, De Palo M,
Anti M, et al. The intestinal Wnt/TCF signature. Gastroenterology
2007;132:628–32.
30. Iwamoto M, Ahnen DJ, Franklin WA, Maltzman TH. Expression of betacatenin and full-length APC protein in normal and neoplastic colonic
tissues. Carcinogenesis 2000;21:1935–40.
31. Melhem MF, Meisler AI, Finley GG, Bryce WH, Jones MO, Tribby II,
et al. Distribution of cells expressing myc proteins in human colorectal epithelium, polyps, and malignant tumors. Cancer Res 1992;
52:5853–64.
32. Finley GG, Schulz NT, Hill SA, Geiser JR, Pipas JM, Meisler AI.
Expression of the myc gene family in different stages of human
colorectal cancer. Oncogene 1989;4:963–71.
33. Sansom OJ, Meniel VS, Muncan V, Phesse TJ, Wilkins JA, Reed KR,
et al. Myc deletion rescues Apc deficiency in the small intestine. Nature
2007;446:676–9.
34. Dey N, Young B, Abramovitz M, Bouzyk M, Barwick B, De P, et al.
Differential activation of Wnt-beta-catenin pathway in triple negative
breast cancer increases MMP7 in a PTEN dependent manner. PLoS
ONE 2013;8:e77425.
1364
Mol Cancer Res; 12(10) October 2014
35. Sadasivam S, DeCaprio JA. The DREAM complex: master coordinator
of cell cycle-dependent gene expression. Nat Rev Cancer 2013;
13:585–95.
36. Bowman T, Symonds H, Gu L, Yin C, Oren M, Van Dyke T. Tissuespecific inactivation of p53 tumor suppression in the mouse. Genes
Dev 1996;10:826–35.
enz Robles MT, Symonds H, Chen J, Van Dyke T. Induction versus
37. Sa
progression of brain tumor development: differential functions for the
pRB- and p53-targeting domains of simian virus 40 T antigen. Mol Cell
Biol 1994;14:2686–98.
enz Robles MT, Jacks T, Van
38. Symonds H, Krall L, Remington L, Sa
Dyke T. p53-dependent apoptosis in vivo: impact of p53 inactivation on tumorigenesis. Cold Spring Harb Symp Quant Biol 1994;
59:247–57.
39. Farrell AS, Sears RC. MYC degradation. Cold Spring Harb Perspect
Med 2014;4.
40. Finch AJ, Soucek L, Junttila MR, Swigart LB, Evan GI. Acute overexpression of Myc in intestinal epithelium recapitulates some but not
all the changes elicited by Wnt/beta-catenin pathway activation. Mol
Cell Biol 2009;29:5306–15.
Molecular Cancer Research
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.
Published OnlineFirst July 3, 2014; DOI: 10.1158/1541-7786.MCR-14-0166
Viral Oncogene Expression in the Stem/Progenitor Cell
Compartment of the Mouse Intestine Induces Adenomatous Polyps
Maria Teresa Sáenz Robles, Jean Leon Chong, Christopher Koivisto, et al.
Mol Cancer Res 2014;12:1355-1364. Published OnlineFirst July 3, 2014.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
doi:10.1158/1541-7786.MCR-14-0166
This article cites 39 articles, 19 of which you can access for free at:
http://mcr.aacrjournals.org/content/12/10/1355.full.html#ref-list-1
This article has been cited by 1 HighWire-hosted articles. Access the articles at:
/content/12/10/1355.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at
[email protected].
To request permission to re-use all or part of this article, contact the AACR Publications Department at
[email protected].
Downloaded from mcr.aacrjournals.org on June 18, 2017. © 2014 American Association for Cancer Research.