Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78
Contents lists available at ScienceDirect
Colloids and Surfaces B: Biointerfaces
journal homepage: www.elsevier.com/locate/colsurfb
Synergistic interaction of platelet derived growth factor (PDGF) with
the surface of PLLA/Col/HA and PLLA/HA scaffolds produces rapid
osteogenic differentiation
Hanumantha Rao Balaji Raghavendran a,∗,1 , Saktiswaren Mohan a,1 ,
Krishnamurithy Genasan a,d,1 , Malliga Raman Murali a , Sangeetha Vasudevaraj Naveen a ,
Sepehr Talebian e , Robert McKean b , Tunku Kamarul a,c,∗
a
Tissue Engineering Group (TEG), National Orthopaedic Centre of Excellence in Research and Learning (NOCERAL), Department of Orthopaedic Surgery,
Faculty of Medicine, University of Malaya, Kuala Lumpur, Malaysia
b
The Electrospinning Company Ltd., Rutherford Appleton Laboratory, Harwell Oxford Didcot, Oxfordshire OX11 0QX, UK
c
Clinical Investigation Centre, Faculty of Medicine, University of Malaya Medical Center, Kuala Lumpur, Malaysia
d
Institute of Translational Medicine, University of Liverpool, Liverpool L69 3GE, UK
e
Department of Mechanical engineering, Engineering Faculty, University of Malaya, 50603 Kuala Lumpur, Malaysia
a r t i c l e
i n f o
Article history:
Received 14 May 2015
Received in revised form
23 November 2015
Accepted 26 November 2015
Available online 28 November 2015
Keywords:
Scaffold
Osteocalcin
Osteoblast
Electrospinning
Bone marrow
a b s t r a c t
Scaffolds with structural features similar to the extracellular matrix stimulate rapid osteogenic differentiation in favorable microenvironment and with growth factor supplementation. In this study, the
osteogenic potential of electrospun poly-l-lactide/hydroxyapatite/collagen (PLLA/Col/HA, PLLA/HA and
PLLA/Col) scaffolds were tested in vitro with the supplementation of platelet derived growth factor-BB
(PDGF-BB). Cell attachment and topography, mineralization, extracellular matrix protein localization,
and gene expression of the human mesenchymal stromal cells were compared between the fibrous
scaffolds PLLA/Col/HA, PLLA/Col, and PLLA/HA. The levels of osteocalcin, calcium, and mineralization
were significantly greater in the PLLA/Col/HA and PLLA/HA compared with PLLA/Col. High expression of
fibronectin, intracellular adhesion molecule, cadherin, and collagen 1 (Col1) suggests that PLLA/Col/HA
and PLLA/HA scaffolds had superior osteoinductivity than PLLA/Col. Additionally, osteopontin, osteocalcin, osterix, Runt-related transcription factor 2 (Runx2), and bone morphogenic protein (BMP2)
expression were higher in PLLA/Col/HA and PLLA/HA compared with PLLA/Col. In comparison with
PLLA/Col, the PLLA/Col/HA and PLLA/HA scaffolds presented a significant upregulation of the genes
Runx2, Col 1, Integrin, osteonectin (ON), bone gamma-carboxyglutamic acid-containing protein (BGALP),
osteopontin (OPN), and BMP2. The upregulation of these genes was further increased with PDGF-BB supplementation. These results show that PDGF-BB acts synergistically with PLLA/Col/HA and PLLA/HA to
enhance the osteogenic differentiation potential. Therefore, this combination can be used for the rapid
expansion of bone marrow stromal cells into bone-forming cells for tissue engineering.
© 2015 Elsevier B.V. All rights reserved.
1. Introduction
Scaffolds provide biological substitutes for tissue engineering
that improve the functions of damaged bone and cartilage [1].
Various natural and synthetic materials have been used for the
∗ Corresponding author at: Tissue Engineering Group (TEG), National Orthopaedic
Centre of Excellence in Research and Learning (N◦ CERAL), Department of
Orthopaedic Surgery, Faculty of Medicine, University of Malaya, 50603 Lembah
Pantai, Kuala Lumpur, Malaysia. Fax: +60 379494642.
E-mail addresses: hbr [email protected] (H.R.B. Raghavendran),
[email protected] (T. Kamarul).
1
These authors equally contributed toward the work.
http://dx.doi.org/10.1016/j.colsurfb.2015.11.053
0927-7765/© 2015 Elsevier B.V. All rights reserved.
transplantation of stem cells in defective areas to allow the differentiation of these cells into osteogenic or chondrogenic cells. The
use of scaffolds for stem cell transplantation requires the addition
of multiple growth factors or commercially available osteogenic
media for early differentiation [2]. The use of these growth factors is expensive. Many studies, therefore, have explored the use of
biomaterials with the addition of a single growth factor [3].
Mesenchymal stromal cells (MSCs) are used for tissue regeneration due to their ability to replicate and differentiate into various
mesenchymal lineages, including chondrocytes, osteoblasts, and
adipocytes. Substantial advancements have been made to the MSCbased strategies for bone repair and regeneration [4]. Although
the use of in vitro 2D culture flasks has traditionally been advo-
H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78
cated, the use of fibrous scaffolds has now become more common
because of their similarity to the intrinsic extracellular matrix
(ECM) of bone and cartilage. However, many aspects of the use
of fibrous scaffolds remain unclear, including compatibility, choice
of growth factor, material composition, and degradation rate. For
example, an alloplastic material under mechanical strain may not
perform in a manner similar to that of the neighboring host bone
tissues and may lead to structural defects at the implant site or
inflammatory responses [5]. However, in the nano-fibrous environment, the cell-to-cell interactions, transfer of nutrients and
the presence of components like Col and HA provide suitable
surfaces for cell attachment and enhanced mineralization with
growth factor supplementation. The differentiation of MSCs into
an osteogenic lineage is improved by the synergistic actions of
the growth factors, scaffold, and extracellular matrix components
[6]. Numerous soluble and insoluble agents, including dexamethasone [7], BMP 2 [8], and Col 1 [9], encourage MSC differentiation
into osteogenic cells. The MSCs express osteoblast-related genes
and differentiate into osteogenic cells in response to the ECM
proteins, collagen I [10], and HA [11] incorporated scaffolds. This
suggests that the ECM plays a vital role in the differentiation process. Human fetal osteoblast cells supplemented with osteogenic
factors incorporated into the fibrous scaffold can induce osteogenic
differentiation in approximately three weeks [12]. Similarly, the
electrospun poly-l-lactide/hydroxyapatite/collagen (PLLA/Col/HA)
scaffolds using 293 T cells and rabbit bone marrow stem cells produce similar results [13]. Scaffolds using BMP2 stimulation also
have osteoinduction properties. Similarly, the deposition of n-HA
on the PLLA/Col nano-fibers has been reported as a promising strategy for early cell capture [14].
Platelet derived growth factor-BB (PDGF-BB) induces the proliferation, migration, and differentiation of stromal cells [15].
However, there is some controversy regarding the different types
of PDGF, with reports suggesting that some isoforms may hamper
and others may enhance differentiation [16]. PDGF also inhibits
ALP, OC, and type I collagen marker protein of mature osteoblasts
in pre-osteocytic cell lines [17]. Conversely, some studies have
shown no effect of PDGF-BB on the marker activity and mineralization in human stromal cells. Imatinib mesylate-induced blockade
of the PDGFR-beta reduces the differentiation of bone marrow stromal cells [18]. On the other hand, the combination of PDGF-BB
and peptides increases the proliferation, differentiation, and early
calcification of the osteoblasts [19]. A few previous studies have
reported the use of different combinations of PLLA with Col and HA.
One study showed that the encapsulation of PDGF-BB into a microsphere enhances tissue regeneration in vitro and wound healing
in vivo [20]. Although this method has several advantages, some
concerns need to be addressed, such as the initial burst release
within a short time and the deposition of the growth factor on the
degraded microsphere. These concerns limit the use of such methods for routine tissue engineering. Additionally, high calcium (Ca)
content hinders the cellular osteogenic activities of fetal osteoblasts
[21]. To overcome these limitations, a biocomposite nanofibrous
scaffold using 12% nano-HA was fabricated with 8% Col, and blended
with high-molecular–molecular weight PLLA. We hypothesized
that this artificial ECM environment supplemented with the growth
factor PDGF-BB will accelerate mineralization for the rapid differentiation of human bone marrow stromal cells in vitro .
69
containing HA nanoparticles (Sigma–Aldrich, USA) and/or bovine
Col (Type I) (Sigma–Aldrich, USA), with an average fiber diameter
of 200–950 nm. The procedure used has been described elsewhere
[10].
2.2. Bone marrow stromal cell culture
Human bone marrow stromal cells were isolated using our
standard laboratory protocol. The isolated cells were cultured in
the DMEM medium (Invitrogen, Carlsbad, CA, USA) supplemented
with 10% stem cell specified fetal bovine serum (FBS, Invitrogen),
100 U/ml penicillin (Sigma–Aldrich, USA), and 100 mg/ml streptomycin (Sigma–Aldrich). The cells were cultivated in tissue culture
flasks at 37 ◦ C in a humidified atmosphere of 5% CO2 . Once the
cells achieved 80% confluence, they were detached using Versene®
for two minutes followed by Trypsin (Cell Applications, San Diego,
CA, USA) and then passaged. The cells used in this study were
obtained from a control donor (28- to 40-year age group) and were
placed in continuous cultures without re-cryopreservation until
they reached the predetermined passages.
2.3. Cell seeding
Prior to the cell seeding, the scaffolds were sterilized using 70%
ethanol for 20–30 min, and rinsed thrice in a phosphate buffered
saline (PBS) and twice in the growth medium. Subsequently, the
human mesenchymal stromal cells were detached until passage
3 and seeded onto the scaffolds in 6-well plates with a cell density of 104 or 105 /cm2 , respectively. The medium was changed at
predetermined points in time (0, 4, 8, and 12 days). The samples
were collected and the cells were treated with PDGF-BB in varying
concentrations (25, 50, and 100 ng/ml), as well as one minimal optimal concentration (50 ng/ml), which induced a significant release
of osteogenic markers.
2.4. Alizarin red staining
Alizarin red (AR) staining was used to monitor the degree of
mineralization. Scaffolds loaded with the cells were fixed with 95%
ethanol for 10 min, washed with sterile water, and incubated with
0.1% AR stain and Tris–HCl solution at 37 ◦ C for 30 min. Random
visual fields were selected for data analysis.
2.5. Osteocalcin assay
Osteocalcin (OC) assay was performed using a commercial ELISA
kit (IBL International, Germany). The assay method used a monoclonal antibody directed against the epitopes of human OC. The
calibrators and samples reacted with the captured monoclonal antibody coated onto the microtiter well. Using a monoclonal antibody,
OC was labeled with horse radish peroxidase (HRP). After the incubation period was over and the sandwich had been formed, the
plates were washed and plates were incubated with the chromogenic solution (TMB substrate). The reaction was stopped using
the stop solution provided in the kit, and the substrate turnover
was read at 450 nm using a 96-well plate reader (BioTek, USA).
2. Materials and methods
2.6. Fluorescence microscopy
2.1. Fabrication of electrospun scaffolds
The scaffolds seeded with bone marrow stromal cells were
stained with Hoechst 33,342 blue (Invitrogen, USA) and analyzed
with a fluorescence microscope (Nikon C-HGFI, Japan) after 10 min
of incubation at room temperature.
Electrospun scaffold sheets were prepared using high molecular weight poly(L-lactide) (PL18, Purac, The Netherlands) solutions
70
H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78
Table 1
Forward and reverse primers of genes.
2.9. Statistical analysis
Name
Sequence
Length
Col 1 F
Col 1 R
OPN F
OPN R
BGLAP F
BGLAP R
RUNX2 F
RUNX2 R
BMP2 F
BMP2 R
Integrin F
Integrin R
Osteonectin F
Osteonectin R
CCCGCAGGCTCCTCCCAG
AAGCCCGGATCTGCCCTATTTAT
CAGCCAGGACTCCATTGACTCGA
CCACACTATCACCTCGGCCATCA
GGAGGGCAGCGAGGTAGTGAAGA
GCCTCCTGAAAGCCGATGTGGT
CCGCCATGCACCACCACCT
CTGGGCCACTGCTGAGGAATTT
TGGCCCACTTGGAGGAGAAACA
CGCTGTTTGTGTTTGGCTTGACG
TGGGCGCTACTGTCATTTGGG
CTGGCATCGGGTAGCTAGAGGC
TTGCAATGGGCCACATACCT
GGGCCAATCTCTCCTACTGC
18
23
23
23
23
22
19
22
22
23
21
22
20
20
2.7. Immunocytochemistry
For immunofluorescence staining, the cells on each substrate
were fixed with 4% (w/v) paraformaldehyde (PFA) (Sigma) in
1 × PBS for 15 min at room temperature. To permeabilize the cells,
0.1% (v/v) Triton-X 100 (Sigma) in 1 × PBS was added for 5 min
and washed thrice with the PBS. To block nonspecific binding, the
cells were incubated with 2% (v/v) goat serum (Sigma) in 1 × PBS
for 30 min at room temperature and washed thrice with the PBS.
The cells were incubated with primary antibodies at 4 ◦ C for 3 h.
The following primary antibodies (anti-FN antibody [IST-9]) were
used for incubation (1:1000; Abcam, England): Fibronectin (FN),
collagen 1 (Col 1), intrcellular adhesion molecules (ICAM− 1), Cadherin, osteopontin (OPN), osteocalcin (OC), Osterix, Runt-related
transcription factor 2 (Runx2), and bone morphogenetic protein
(BMP2). After the incubation, the cells were washed thrice with
1 × PBS for 5 min each. Chicken polyclonal secondary antibody was
added to Anti-Mouse IgG H&L (FITC) (ab6810) (1:500; Abcam, England), and 1 × PBS was added for double-staining. These cells were
incubated for 1 h at room temperature. The cell nuclei were counterstained using Hoechst dye. The fluorescence and confocal signals
were observed under a fluorescence microscope (Nikon C-HGFI,
Japan), and the images were analyzed with the NIS-elemental imaging software.
2.8. Real-time PCR
The degree of gene expression and the total RNA extracted
from the hMSCs cultured on the substrates (n = 8) were quantified with the RNeasy Mini Kit (Qiagen, Chatsworth, CA, USA).
The concentration of RNA harvested was determined by measuring the absorbance at 260 nm using a NanoPhotometerTM (Implen,
Germany). The first-strand cDNA was synthesized with 25 ng pure
RNA, using the SuperScript® III First Strand Synthesis Kit according to the manufacturer’s instructions. Osteogenic differentiation
was evaluated with quantitative real-time PCR (qRT-PCR) using a
StepOnePlusTM Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with SYBR® green qPCR gene expression assays
for the osteogenic genes. The relative expression levels of the
target genes were determined using the comparative Ct method
by normalization to the endogenous reference (glyceraldehyde 3phosphate dehydrogenase). The relative gene expression involved
in the osteogenic and chondrogenic differentiation of the hMSCs
cultured on each substrate was normalized to the markers of osteogenesis in the hMSCs cultured on the control substrate. The forward
and reverse primers used for this experiment are shown in Table 1.
The values obtained were expressed as the mean and standard
deviation (SD). Statistical differences were determined using analysis of variance (ANOVA) and least significant difference (LSD). SPSS
version 10 was used for analyzing the data. The differences were
considered statistically significant if the value of p was <0.05.
3. Results and discussion
Bone marrow stromal cells play a key role in bone homeostasis by proliferating, migrating, and differentiating in response
to stimuli [1]. These cells may potentially be used to treat several bone disorders [22]. PDGF-BB-one of the many stimulants for
bone marrow stromal cells—is a potent mitogen that induces the
proliferation and migration of cells. In contrast to the effect of PDGFBB on bone marrow stromal cells, previous studies have shown
decreased expression of alkaline phosphatase and OC with PDGFBB [17]. PDGF-BB does not suppress alkaline phosphatase in the
osteogenic differentiation medium in the PDGF receptor deleted
pre-clinical model [23]. In this study, we tested whether the incorporation of PDGF-BB into the nano-fibrous scaffold culture system
induces differentiation of the human bone marrow stromal cells
to osteogenic-like cells. The fluorescence microscopy images of the
bone marrow stromal cells cultured on fabricated scaffolds supplemented with PDGF-BB are shown in Fig. 1a. After 12 days in the
culture, Hoechst staining for DNA revealed cells adhering to the
scaffold. This suggests that the composition of scaffolds allowed
attachment of cells and PDGF-BB did not affect the viability of these
cells. A previous study showed increased hydrophilicity with Col,
and enhanced cell attachment and proliferation with HA [24]. These
results confirm that bone marrow stromal cells can proliferate on
the composite scaffolds better compared with cells on the PLLA
scaffolds with either Col or HA with growth factor supplements.
Previous studies have shown that PLGA nano-fibers fabricated with
the HA particles induce bone mineralization better than PLGA
without HA [25]. Therefore, the incorporation of the HA particles
into the PLLA nano-fibers increases their physical and biological
performance. These results support our findings that PLLA/HA supplemented with growth factor increases the differentiation of cells.
Similarly, the combination of HA and Col accelerates osteogenesis,
which is in agreement with our findings that the combination of
PLLA with HA and Col with PDGF-BB enhances the expression of
the osteogenic markers in vitro. Compared with the use of the Col
scaffold alone, the combination of Col with HA using human fetal
osteoblast cells has been reported to enhance the proliferation and
mineralization of cells [5].
In the PLLA/Col/HA scaffold, Ca deposition increased gradually. Although some increase in Ca deposition was noted in the
PLLA/Col and PLLA/HA scaffolds, the increase was relatively lower
than that observed on the PLLA/Col/HA scaffold (Fig. 1b). In this
study, scanning electron microscopy showed the following: morphology of cells in the differentiation phase; mineralization seen as
Ca deposits (Fig. 2a) on the scaffold surface; and cell spreading on
the fibrous region with characteristics such as pseudopodia. Mineralization indicated that supplementation with PDGF-BB enhanced
the differentiation of human bone marrow stromal cells in 12 days
in PLLA/Col/HA compared with PLLA using Col alone. Greater cell
spreading was observed on the PLLA/Col/HA scaffold compared
with PLLA using Col alone, and different scaffolds showed the mineral deposition on the surface of the material. This data indicate
that the combined action of PDGF-BB and scaffold material induces
early differentiation of the stromal cells into osteogenic-like cells.
Recent cell-based bioengineering trials have reinforced the benefits of stromal cells for the treatment of large bone defects, and
H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78
71
Fig. 1. (a) Fluorescence microscopy of the cells attached to the scaffold on Day 12. The PLLA/Col/HA, PLLA/HA and PLLA/Col scaffold were washed with ice-cold PBS twice
and fixed with 4% formalin. The post-fixed samples were stained with Hoechst blue and viewed under the fluorescence microscope. The blue dots indicate the DNA of live
cells stained with Hoechst blue. (b) The conditioned medium was collected at different points in time, and calcium quantification was performed using the Quantichrom TM
calcium assay kit. A calibration curve was obtained by reading the 96-well plates at 612 nm. The data were represented as means ± Standard deviation (SD). The statistical
significant was set at level P < .05, post-hoc followed by the least significant deviation (LSD) which was performed using SPSS version 10. * Represents the PLLA/Col/HA
compared with the PLLA/Col at different time points. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this
article.)
steroid-induced osteonecrosis of the femoral head. Reports have
shown that the application of PDGF-BB enhances bone formation,
whereas one report has shown that it does not play a role in bone
formation [26–28]. The role of PDGF-BB in bone formation is still
unclear with conflicting reports in vitro and in vivo . The hMSCs
grown on different scaffolds showed mineral deposition on the surface after 12 days. More deposits were seen on the PLLA/Col/HA and
PLLA/HA scaffolds compared with the PLLA/Col scaffold. The current evidence suggests that the osteogenic potential of electrospun
PLLA/Col/HA nano-fibrous scaffolds is enhanced by the incorporation of PDGF-BB.
Mineralization is a cell-mediated extracellular deposition of Ca
and phosphorus salts, in which the anionic matrix molecules bind
with Ca2+ and PO4 3− ions, and thereafter serve as sites of nucleation
and growth [29]. Mineral nodules in the cultures of the scaffolds
were examined at different time points (4, 8, and 12 days) by
using the AR dye (Fig. 2b) . The images showed positive AR staining that suggests the differentiation of hMSCs into osteogenic cells
with mineral deposition. The scores of the intensity of AR staining
were higher in the PLLA/Col/HA and PLLA/HA scaffold compared
with PLLA/Col (p < 0.05). The fabricated scaffold also induced Ca
deposition, which indicates osteogenic differentiation of the bone
marrow stromal cells. This suggests that rapid mineralization can
be induced with PDGF-BB supplementation.
Osteonectin (ON) plays a significant role in modulating mineralization of marrow stem cells to osteogenic-like cells [30]. As
measured in the supernatant, the ON levels increased (p < 0.05)
approximately 1.5–2-fold in the cells grown on the PLLA/Col/HA
and PLLA/HA compared with those grown on the PLLA/Col scaffold on days 4, 8, and 12 (Fig. 2c). However, the expression of ON
was slower in these cells than for cells grown on the PLLA/Col scaffold. These findings indicate that the differentiation of cells in the
scaffold environment occurs more rapidly with PDGF-BB supplementation compared with PLLA scaffold using Col alone.
3.1. In vitro cell differentiation
Fibronectin mediates ECM interactions and accelerates the differentiation of stromal cells into other cell lineages. The increased
intensity of fluorescence in this study indicates ECM formation
during the differentiation of bone marrow stromal cells into
osteogenic-like cells [31]. Although this was observed in all the
three scaffolds, the percentage of fluorescein isothiocyanate (FITC)
positive cells in PLLA/Col/HA and PLLA/HA was higher compared
with that of PLLA/Col (Figs. 3 a and 7). FN is a major component of ECM that is essential for the assembly and integrity of the
matrix. The physiology of bone marrow stromal cells and FN is complex. Most evidence suggests that FN-coated materials promote cell
attachment and proliferation, but do not affect osteogenic differentiation. Conversely, some studies suggest that FN is an important
factor for osteogenic differentiation of osteoblast-like cells [32].
Although FN was observed in all scaffolds, it was localized extracellularly and associated with the cell outlines in the cultures
grown on the PLLA/Col/HA scaffold. Increased expression of FN was
observed in the PLLA/Col scaffold, but the increase was not as high
as that observed in the PLLA/HA scaffold. This confirms that the
combination of Col and HA with PLLA, and the supplementation of
the growth factor could be promoted due to the protein-phosphate
composite layers. In light of this evidence, it is clear that PDGF-BB
induces early osteogenic differentiation, but the scaffold surfaces
72
H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78
Fig. 2. (a) SEM of the PLLA/Col/HA, PLLA/HA and PLLA/Col scaffold. Mesenchymal stromal cells were cultured on these scaffolds and subjected to the CPD procedure. Following
the CPD procedure, the samples were viewed under SEM (Phenom G2 Pro equipped with Fiber metric-Pro-Suite application). Arrows indicate the interaction of the hMSCs
with the fibrous substrate and calcium-like apatite. (b) Post-fixed scaffold samples from days were fixed with 95% ethanol for 10 min, and subsequently washed with sterile
water and incubated with 0.1% AR stain and Tris–HCl solution at 37 ◦ C for 30 min. The data were represented as means ± Standard deviation (SD). The statistical significant
was set at level P < .05, post-hoc followed by the least significant deviation (LSD) which was performed using the SPSS version 10. * Represents the PLLA/Col/HA and PLLA/HA
compared with the PLLA/Col. (c) The OC and Ca levels in the PLLA/Col/HA (a), PLLA/HA (b), and PLLA/Col (c) on days 0, 4, 8, and 12. The OC released at different points in
time was quantified using the commercially available ELISA kit. The data were represented as the means ± Standard deviation (SD). The statistical significant was set at level
P < .05, post-hoc followed by the least significant deviation (LSD) which was performed using SPSS version 10. * Represents the PLLA/Col/HA, PLLA/HA compared with the
PLLA/Col at day variable points in time.
Fig. 3. (a), (b) The post-fixed scaffold samples were immunostained with primary and secondary antibodies and the fluorescence signals were observed under a fluorescence
microscope (Nikon C-HGFI, Japan). The image analysis was performed using the NIS-elemental imaging software. Arrows indicate nuclear staining (blue 20×) and FN, Col 1
(green) of the ECM-like architecture after 12 days of culture. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of
this article.)
H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78
behave differently based on their composition. The addition of
growth factors to cell cultures offers some advantages in inducing
differentiation for future clinical applications. The use of scaffolds
similar to the ECM would be more advantageous than the conventional procedures in terms of cell attachment, proliferation, and
differentiation.
Although complete mineralization cannot be achieved, it may
be possible with the scaffold-like PLLA/Col/HA after PDGF-BB supplementation. The chemical composition and physical properties
of the natural ECM has significant effects on the cell morphology,
motility, and migration [33]. Similarly, tissue engineering scaffolds can influence cell proliferation and differentiation, and the
biomaterial and microarchitecture can influence chemo-attraction,
adhesion, and migration. This will, in turn, affect the matrix deposition and mineralization. Several factors contribute to the strength
of the Integrin ligand-mediated cell adhesion. These include concentrations of the adhesive ligands or substrates, number of
receptors, and the receptor-ligand affinity. A shift in any of these
factors can have a dramatic effect on cell migration [35]. By changing the ligand density, the strength of the cell-substrate interactions
via differential Integrin binding to adhesion ligands is affected. In
recent years, these effects have been translated using 3D scaffold
design. Changing the composition of biomaterials used in scaffold
fabrication can change ligand availability and subsequent Integrin
binding. Changes in the concentration of collagen have a significant
influence on the osteoblast activity, indicating the effect of differing ligand availability [34,36]. The ECM composition and properties
vary with respect to tissues both in vitro and in vivo . Soft tissues
have collagen I and III, and basement membranes have laminins
and type IV collagen. The rigidity of bones is due to the presence
of calcium phosphate within a fibrillar collagen matrix. Stem cells
interact with the ECM, irrespective of whether the ECM can influence stem cell differentiation. It is apparent that factors such as
attachment to ECM, ECM stiffness, topography, and components
play a significant role.
Collagen is a major organic component of the bone ECM and
produced by the osteoblasts. Col was not present in higher amounts
in the PLLA-based scaffolds compared with PLLA/HA and PLLA/Col
(Figs. 3b and 7). However, the percentage of cells positive for
FITC in PLLA/Col/HA was significantly higher than in PLLA/HA
and PLLA/Col. In general, collagen type I production involves a
series of closely coordinated physiological processes. Following
the transcription and translation, the proteins undergo extensive posttranslational modifications before being released into the
extracellular space [36]. Several factors are known to trigger Col 1,
namely, hormones, cytokines, and trace metals [37]. The increase in
Col 1 after supplementation with PDGF-BB stimulates regeneration
of damaged tissues and indicates that the ECM provides a suitable
environment for the differentiation of the bone marrow stromal
cells [38]. However, the precise mechanism by which PDGF-BB
promotes Col 1 synthesis is unclear.
In addition to the Col 1 and FN expression, a few adhesion
molecules like ICAM-1 play important roles in the differentiation of
the bone marrow stem cells into osteogenic cells. The overexpression of ICAM-1 in the MSCs also inhibits osteogenesis [39]. Although
ICAM-1 enhances proliferation, it also causes loss of stem cell markers. The overexpression of ICAM-1 activates the signaling proteins
to suppress the osteogenic differentiation. The AKT pathway partially rescues the osteogenic differentiation [40]. In our study, we
observed that the expression of ICAM-1 appears to be high in the
case of PLLA/Col compared with the other two scaffolds supplemented with PDGF-BB. This indicates that even though osteogenic
differentiation is supported in these cells, but these cells are not
likely to get differentiated into other lineages (Figs. 4 & 7).
N-cadherin, a Ca-dependent protein, is expressed in neural tissues and other cell types, such as myoblasts and mesenchymal
73
stem cells [41]. In this study, N-cadherin was expressed less in the
PLLA/Col/HA and PLLA/HA scaffolds supplemented with the PDGF
on day 12 compared with the PLLA/Col scaffold (Figs. 4 and 7). These
results concur with those of a previous study in which the overexpression of N-cadherin in the bone morrow stromal cells inhibited
osteogenesis, and osteogenesis was promoted in vitro when Ncadherin was inhibited [42,48]. Although N-cadherin increases
the migration potential of bone marrow stromal cells, it inhibits
osteogenic differentiation. The process of osteogenic cell–cell and
cell-to-matrix interactions is important during osteoblast adhesion, signaling, and gene expression. The role of N-cadherin in
osteoblast differentiation has conflicting results. It may promote
osteogenesis in the MC3T3E1 pre-osteoblasts or inhibit osteogenic
differentiation by signaling pathways such as Wnt/beta catenin
[43].
Runx2 is expressed throughout the osteogenic differentiation
phase [44]. In this study, Runx2 was expressed in undifferentiated
cells, and showed a considerable increase with the kick-start of
a late differentiation phase (Figs. 5 and 7). Osterix is responsible
for the osteogenic differentiation (Figs 5 and 7). The percentage of
positive cells was considerably increased in (p < 0.05) PLLA/Col/HA
and PLLA/HA compared with PLLA/Col. This indicates that PDGF-BB
supplementation alone did not enhance the differentiation pattern
and the synergistic action of the ECM is essential for differentiation.
We also examined the expression of other osteogenic factors, such
as osteopontin, osteocalcin, and BMP2 in the scaffolds at the day
12 using confocal microscopy. The percentage of FITC positive cells
showed that OPN and BMP2 expressions were significantly greater
in PLLA/Col/HA compared with the other two scaffolds (Figs. 6c
and Fig. 7). In contrast, OC was significantly more expressed in the
PLLA/Col/HA and PLLA/HA compared with the PLLA/Col.
3.2. In vitro gene expression
PLLA/Col/HA showed an approximately four-fold increase in
Runx2 compared with (p < 0.05) PLLA/Col. The increase in the
PLLA/HA scaffold was around 0.5-fold compared with the PLLA/Col
(Fig. 8a). These data correlated with the confocal data for the Runx2
expression. The nano-fibrous environment provides the surface for
cell attachment and enhances the proliferation of cells by using
mitogens such as PDGF-BB for rapid differentiation of the stromal
cells. The fibrous surface also enhances the cell matrix interactions and cell–cell communications, which are important for the
oxygen and nutrient exchange between cells [45]. Runx2 is a zinc
finger transcription factor, which is essential for osteoblast differentiation, acting on the downstream Runx2, and modulating
the expression of important osteoblast proteins such as OPN, ON,
bone sialoprotein, and collagen type I. OPN is a phosphoprotein
containing several Ca binding domains expressed in the differentiating osteoblasts. It regulates cell adhesion, proliferation, and
ECM mineralization during bone development [45]. In this study,
an approximately 6-fold increase was noted (p < 0.05) in Col in
PLLA/Col/HA and a four-fold increase (p < 0.05) in PLLA/HA compared with the PLLA/Col scaffold (Fig. 8a). Col is necessary for
osteogenesis stimulates the pre-osteoblast cell surface integrins
leading to the activation of other core binding factors, and increases
the level of surface integrin [46]. The integrin levels also increase
significantly in PLLA/Col/HA and PLLA/HA scaffold compared with
PLLA/Col (Fig. 8a).
Osteonectin is a non-collagenous component of the ECM and
is considered bone-specific because of its biochemical properties,
such as a marker related to osteoblastic functional differentiation [47]. When PLLA/Col/HA was supplemented with PDGF-BB,
it showed increased osteonectin levels (p < 0.05). However, there
was no increase in the osteonectin levels with the other scaffolds (Fig. 8a). Previous reports have shown that osteonectin is
74
H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78
Fig. 4. (a), (b) Confocal analysis and ICAM and Cadherin immunostaining (10×) represented by photographs of the PLLA/Col/HA, PLLA/Col and PLLA/HA after 12 days of culture.
The post-fixed samples were treated with primary and FITC-labeled secondary antibody and nuclear stain using Hoechst blue and viewed using the confocal microscope.
The arrows indicate the green cytoplasm and blue nuclear staining of the differentiated cells. (For interpretation of the references to colour in this figure legend, the reader
is referred to the web version of this article.)
Fig. 5. (a) & (b). Confocal analysis of the Runx2 and Osterix immunostaining represented by photographs of the PLLA/Col/HA, PLLA/HA and PLLA/Col after 12 days of culture.
The post-fixed samples were treated with the primary and FITC-labeled secondary antibody and nuclear stain using Hoechst blue and viewed using the confocal microscope
(10×). The arrows indicate the green cytoplasm and blue nuclear staining of the differentiated cells. (For interpretation of the references to colour in this figure legend, the
reader is referred to the web version of this article.)
observed in the petri dish during osteogenic differentiation with
or without ECM. When the stromal cells were cultivated in the
petri dish without the ECM, the osteonectin level was relatively
less during the early stages of differentiation, but increased after
the addition of the osteogenic medium after one week [48]. The
increase in the osteonectin on day 12 in the PLLA/Col/HA scaffolds indicates the beginning of differentiation. Supplementation
with PDGF-BB does not influence the increase in the osteogenic
differentiation in the presence of HA and Col alone in the PLLA, but
a combination of HA and Col with PLLA improves the osteogenic
differentiation of the stromal cells. Bone gamma-carboxyglutamic
acid-containing protein (BGALP) is a post-proliferative osteoblast
producer, enhancing the differentiation progress of the hMSCs on
the electrospun scaffolds (Fig. 8b) [49]. The OC gene expression
is usually related to the early differentiation of the hMSCs scaffold culture. We demonstrated that an increase of many-fold in the
expression of OC correlated approximately with a 1.5-fold increase
in both the PLLA/Col/HA and PLLA/HA (p < 0.05) compared with
PLLA/Col. These results demonstrate that mineralization is a slow
process and adequate time is required for complete mineralization.
Previous studies on the effect of PDGF-BB on the OPN levels show
mixed results. One study showed that OPN levels did not increase
H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78
75
Fig. 6. (a), (b) & (c). Confocal analysis OPN, OC and BMP2 immunostaining represented by photographs of the PLLA/Col/HA, PLLA/HA and PLLA/Col after 12 days of culture.
The post-fixed samples were treated with the primary and FITC-labeled secondary antibody and nuclear stain using Hoechst blue and viewed using the confocal microscope
(10x). The arrows indicate the green cytoplasm and blue nuclear staining of the differentiated cells. (For interpretation of the references to colour in this figure legend, the
reader is referred to the web version of this article.)
Fig. 7. Confocal expression of Fibronectin, collagen 1, ICAM, Cadherin, Runx2, OPN, OC, BMP2, and Osterix. The scoring percentage was based on the FITC positive cells in
each type of scaffold. The data were represented as the means ± Standard deviation (SD). The statistical significant was set at level P < .05, post-hoc followed by the least
significant deviation (LSD) which was performed using the SPSS version 10. * Represents the PLLA/Col/HA, PLLA/HA compared with the PLLA/Col on day 12.
with the addition of PDGF-BB, but increased when supplemented
with TGF-␤ and PDGF-BB [50]. However, the current study, a onefold increase was noted in the PLLA/Col/HA scaffold supplemented
with PDGF-BB (Fig. 8b). OPN expression has been shown to increase
at the beginning of osteodifferentiation and decline during the few
weeks of differentiation [51]. Another study showed a decline in
the OPN gene expression in the hMSCs after one week of differentiation. The gene expression in the hMSCs seeded on to the Col
nano-fibers was noted to decrease after three weeks. In contrast,
the current study did not show an increase in the scaffolds containing the Col and HA material fabricated with the PLLA even after 12
days. These findings indicate that rapid initiation and termination
of the differentiation process of the hMSCs cultured on the fibrous
material depends on the composition of the scaffold. The course of
OPN during the differentiation phase with or without extracellular
molecules also correlated with the osteonectin expression [52].
In our previous research, we have shown that fibrous scaffolds
can induce osteogenic differentiation [10]. In this study, we hypothesized that the introduction of a single mitogen like PDGF-BB would
speed up osteogenic differentiation using stromal cells. Previous
studies have shown that stem cell transplantation with a scaffold like HA/Tri calcium phosphate would be more effective than
the cell-free scaffold in animal models [53]. Similarly, a combined
therapy of BMP2 with bone graft materials promotes bone regeneration. The production of increased BMP2 considerably enhances
osteogenic differentiation [54]. In the present study, an increase in
76
H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78
Fig. 8. (a) Quantitative gene expression of the PLLA/Col/HA, PLLA/HA and PLLA/Col during the differentiation process. The gene expression of Runx2, Col1 and Integrin. The
total RNA was extracted from hMSCs cultured on the substrates (n = 8) at day 12 using the RNeasy Mini Kit (Qiagen, Chatsworth, CA, USA). Following the cDNA synthesis and
qPCR, the relative gene expression was normalized to the GAPDH and baseline expression. The data were represented as the means ± Standard deviation (SD). The statistical
significant was set at level P < .05, post-hoc followed by the least significant deviation (LSD) which was performed using the SPSS version 10. * Represents the PLLA/Col/HA
compared with the PLLA/Col on day 12. (b) Quantitative gene expression of the PLLA/Col/HA, PLLA/HA and PLLA/Col during the differentiation process. (a) Gene expression
of the Osteonectin (ON), BGALP (osteocalcin), Osteopontin (OPN) and bone morphogenetic protein 2 (BMP 2). The total RNA was extracted from the hMSCs cultured on
the substrates (n = 8) on the 12th day using the RNeasy Mini Kit (Qiagen, Chatsworth, CA, USA). Following the cDNA synthesis and qPCR, the relative gene expression was
normalized to the GAPDH and baseline expression. The data were represented as the means ± Standard deviation (SD). The statistical significant was set at level P < .05,
post-hoc followed by the least significant deviation (LSD) which was performed using the SPSS version 10. * Represents the PLLA/Col/HA and PLLA/HA compared with the
PLLA/Col on day 12.
the BMP2 was seen in all the three scaffolds (p < 0.05), which suggests that the scaffolds can induce stromal cell differentiation into
osteogenic-like cells (Fig. 8b). These data correlated well with our
confocal data with reference to BMP2 expression.
Biomaterials exhibit bone induction through the intramembranous ossification process, whereas growth factors induce bone
formation through endochondral ossification [54]. Although supplementation with PDGF-BB induced differentiation of the stromal
cells in PLLA/Col/HA and PLLA/HA, this effect was not seen in
PLLA/Col. This could be due to the differences in composition, the
technique used to design the biomimetic nano- or micro-composite
scaffolds, or the choice of cell type. In this study, the ratio of HA or
Col, and cell type in the scaffold is different from that of previous
studies. Therefore, we hypothesize that the scaffold material also
plays an important role in cell differentiation.
In our previous research, a moderate increase was seen in the
osteogenic differentiation potential of the PLLA/Col scaffold [10].
However, there was no further increase after PDGF-BB supplementation. The reasons underlying these results are unclear, and further
studies are warranted to clarify them. One previous report has
stated that the differentiation behavior of the bone marrow stromal cells in the PLLA/Col was different from that of the thermal
cross-linked fibers [55]. The osteogenic potential of the Col was
observed in the late stages of the cultivation. The reason for this
is still unclear; however, the researchers anticipated that the composition of the scaffold could be the reason. This is supported by
our results in which the cell attachment and differentiation pattern were not observed during the early points in time despite the
addition of the PDGF-BB; however, in our previous research, it was
moderately enhanced after three weeks in the culture [10].
H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78
Studies have shown that the interaction with the cues are reciprocal, implying that the stem cells are able to remodel the cues in
response to the signals received. Thus, as a key component of the
stem cell niche, the ECM is not just an inert scaffold, but instead
can profoundly influence the cell fate choices [56]. The influence of
stiffness on stem cell differentiation has been demonstrated on a
range of model substrates, including collagen and hyaluronic acid
gels, polymer networks, and electrospun nanofibers. The electrospun fibers with identical microstructures and surface properties
but different degrees of stiffness have varying effects on MSC differentiation, with the softer fibers promoting chondrogenesis and
stiffer fibers promoting osteogenesis. Studies on MSC responses to
rigid substrates overlaid with soft hydrogels of differing thickness
indicate that the cells can sense the ‘hidden’ substrate at a depth
of approximately 5 ␮m and can deform a substrate to a depth of
15 ␮m [57]. Although there is ample evidence that substrate stiffness influences stem cell fate, the specific environmental cues that
the cells sense can vary in different contexts. Recent data indicate
that the human epidermal and mesenchymal stem cells cultured
on the ECM-coated hydrogels sense ECM tethering, as hydrogels
exhibit increasing porosity with decreasing stiffness. The stiffness
of the substrate can affect how cells respond to a specific concentration of ECM protein attached to the substrate, independent of
tethering. A recent study has measured the force that cells apply to
single Integrin ligand bonds during the initial adhesion to the ECM,
which opens up the possibility of determining whether substrate
stiffness influences the ECM interactions at this level of resolution
[58]. For example, osteogenic differentiation was enhanced on the
topographies that restricted the spread but promoted elongated
cell morphologies. It would be interesting to explore the effects
of these substrates on other stem cell populations and determine
how different cells ‘read’ the same topographical cues: whether
the degree of Integrin clustering and cytoskeletal rearrangement
provoked by specific topographies is equivalent to specific concentrations and combinations of the ECM components.
4. Conclusions
PDGF-BB enhances the osteogenic potential of PLLA/Col/HA
and PLLA/HA, but there was no effect on the osteogenic potential
of PLLA/Col. Supplementation of PDGF-BB into the nano-fibrous
scaffolds increases the osteogenic differentiation potential. This
increase probably results from the synergistic actions of the
PDGF-BB and the scaffold materials. Therefore, composite fibers
incorporating mitogen-like PDGF-BB may be useful as rapid stem
cell differentiation tissue for engineering applications.
Conflict of interest
The authors declare no competing interests exists.
Acknowledgments
This study was supported by a major grant support (Reference number -UM.C/625/1/HIR/MOHE/CHAN/03, account number
- A000003-50001), University of Malaya. A part of the research was
supported by BK-035 from the University of Malaya. Special thanks
to the University of Malaya Bright Sparks for their sponsorship and
the Institute of Post Graduate dual Ph.D. funding for supporting G.
Krishnamurithy’s research.
77
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.colsurfb.2015.11.
053.
References
[1] R. Langer, Acc. Chem. Res. (2000) 94.
[2] E.L. Chaikof, H. Matthew, J. Kohn, A.G. Mikos, G.D. Prestwich, C.M. Yip, Ann.
N.Y. Acad. Sci. (2002) 96.
[3] S. Kress, A. Neumann, B. Weyan, C. Kasper, Adv. Biochem. Eng. Biotechnol.
(2012) 263.
[4] J.M.W. Ambikaipalan Wong, S. Khan, Curr. Stem Cell Res. Ther. (2013) 210.
[5] M.S. Kang, J.H. Kim, R.K. Singh, J.H. Jang, H.W. Kim, Acta Biomater. (2015) 103.
[6] Z. Liu, Y., Tang, T., Kang, M., Rao, K., Li, Q., Wang, C., Quan, C., Zhang, Q., Jiang,
H. Shen, 2015, 39.
[7] X. Ma, X. Zhang, Y. Jia, S. Zu, S. Han, D. Xiao, H. Sun, Y. Wang, Int. Orthop.
(2013) 1399.
[8] P. Yilgor, K. Tuzlakoglu, R.L. Reis, N. Hasirci, V. Hasirci, Biomaterials (2009)
3551.
[9] M. Mizuno, Y. Kuboki, J. Biochem. (2001) 133.
[10] H.R. Balaji Raghavendran, S. Puvaneswary, S. Talebian, M. Raman Murali, S.
Vasudevaraj Naveen, G. Krishnamurithy, R. McKean, T.A. Kamarul, PLoS One
(2014) e104389.
[11] G. Krishnamurithy, M.R. Murali, M. Hamdib, A.A. Abbas, H.B. Raghavendran, T.
Kamarul, Cer. Int. (2013) 771.
[12] J.L. Venugopal, S. Low, A.T. Choon, A.B. Kumar, S. Ramakrishna, J. Biomed.
Mater. Res. A (2008) 408.
[13] D. Cao, Y.P. Wu, Z.F. Fu, Y. Tian, C.J. Li, C.Y. Gao, Z.L. Chen, X.Z. Feng, Colloids
Surf. B Biointerfaces (2011) 26–34.
[14] X. Niu, Q. Feng, M. Wang, X. Guo, Q. Zheng, J. Control Rel. (2009) 111.
[15] R. Chung, B.K. Foster, A.C.W. Zannettino, C.J. Xian, Bone (2009) 878.
[16] X. Yu, S.C. Hsieh, W. Bao, D.T. Graves, Am. J. Physiol. (1997) 1709.
[17] S.J. Kono, Y. Oshima, K. Hoshi, L.F. Bonewald, H. Oda, K. Nakamura, H.
Kawaguchi, S. Tanaka, Bone (2007) 68.
[18] S. O’Sullivan, D. Naot, K. Callon, F. Porteous, A. Horne, D. Wattie, M. Watson, J.
Cornish, P. Browett, A. Grey, J. Bone Miner. Res. (2007) 1679.
[19] E.B. Stephan, R. Renjen, S.E. Lynch, R. Dziak, J. Periodontol. (2000) 1887.
[20] G. Wei, Q. Jin, W.V. Giannobile, P.X. Ma, J. Control Release (2006) 103.
[21] S.S. Kim, S.J. Gwak, B.S. Kim, J. Biomed Mat. Res A. (2008) 245.
[22] U.A. Gurkan, O. Akkus, Ann. Biomed. Eng. (2008) 1978.
[23] T. Tokunaga, Y. Oya, H. Ishii, C. Motomura, S. Nakamura, T. Ishizawa, Y.
Fujimori, A. Nabeshima, M. Umezawa, T. Kanamori, M. Kimura Sasahara, J.
Bone Miner. Res. (2008) 1519.
[24] M. Ngiam, S. Liao, A.J. Patil, Z. Cheng, C.K. Chan, Bone (2009) 4.
[25] C. Gardin, L. Ferroni, L. Favero, E. Stellini, D. Stomaci, S. Sivolella, E. Bressan, B.
Zavan, Int. J. Mol. Sci. (2012) 6452.
[26] R. Quarto, M. Mastrogiacomo, R. Cancedda, S.M. Kutepov, V. Mukhachev, A.
Lavroukov, E. Kon, M. Marcacci, N. Engl, J. Med. (2001) 385.
[27] B.H. Mitlak, R.D. Finkelman, E.L. Hill, J. Li, B. Martin, T. Smith, M. D’Andrea,
H.N. Antoniades, S.E. Lynch, J. Bone Miner. Res. (1996) 238.
[28] T.J. Nash, C.R. Howlett, C. Martin, J. Steele, K.A. Johnson, D.J. Hicklin, Bone
(1994) 203.
[29] D. Vikjaer, S. Blom, E. Hjørting-Hansen, E.M. Pinholt, Eur. J. Oral Sci. (1997) 59.
[30] L. Boskey, J. Cell Biochem. (Suppl) (1998) 83.
[31] J.B. Lian, G.S. Stein, J.L. Stein, A.J. vanWijnen, Biochem Soc. Trans. (1998) 26.
[32] G. Kim, M.P. Hwang, P. Du, J. Ko, C.W. Ha, S.H. Do, K. Park, Biomaterials. (2015)
75.
[33] S.G. Kim, D.S. Lee, S. Lee, J. H. Jang. J, Biomed. Mater. Res. A. Biomater. (2015)
75.
[34] B.P. Kanungo, L.J. Gibson, Acta Biomater. (2010) 102, Tissue Eng A.
[35] D.A. Lauffenburger, A.F. Horwitz, Cell. (1996) 359.
[36] C.M. Tierney, M.G. Haugh, J. Liedl, F. Mulcahy, B. Hayes, F.J. O’Brien, J. Mech.
Behav. Biomed. Mater. (2009) 209.
[37] S.G. Kim, D.S. Lee, S. Lee, J.H. Jang, J. Biomed. Mater. Res. A. Biomater. (2015)
75.
[38] S. Shi, M. Kirk, A.J. Kahn, J. Bone Miner. Res. (1996) 1139.
[39] S. Emanuela, K. Vera, M. Gillian, G. Jelena, J. Cell Sci. (2000) 2055.
[40] F.F. Xu, H. Zhu, X.M. Li, F. Yang, J.D. Chen, B. Tang, H.G. Sun, Y.N. Chu, R.X.
Zheng, Y.L. Liu, L.S. Wang, Y. Zhang, Tissue Eng. Part A (2014) 2768.
[41] Y. Tanaka, I. Morimoto, Y. Nakano, Y. Okada, S. Hirota, S. Nomura, T.
Nakamura, S. Eto, J. Bone Miner. Res. (1995) 1462.
[42] P. Hulpiau, F. van Roy, Int. J. Biochem. Cell Biol. (2009) 349.
[43] R. Guntur, C.J. Rosen, M.C. Naski, Bone. (2011) 54.
[44] R.T. Franceschi, Crit. Rev. Oral Biol. Med. (1999) 40.
[45] Z.R. Zhao, M. Zhao, G.Z. Xiao, R.T. Franceschi, Mol. Ther. (2005) 247.
[46] M.D. Schaller, J.T. Parsons, Curr. Opin. Cell Biol. (1994) 705.
[47] C. Chai, K.W. Leong, Mol. Ther. (2007) 467.
[48] G. Karsenty, Matrix Biol. (2000) 85.
[49] S.J. Song, O. Jeon, H.S. Yang, D.K. Han, B.S. Kim, J. Microbiol. Biotechnol. (2007)
1113.
78
H.R.B. Raghavendran et al. / Colloids and Surfaces B: Biointerfaces 139 (2016) 68–78
[50] W. Liu, J. Lipner, J. Xie, C.N. Manning, S. Thomopoulos, Y. Xia, ACS Appl. Mater.
Interfaces (2014) 2842.
[51] W.T. Butler, Connect. Tissue Res. (1989) 12336.
[52] M. Bidder, J.S. Shao, N. Charlton-Kachigian, A.P. Loewy, C.F. Semenkovich, J.
Biol. Chem. (2002) 85.
[53] L. Jones, R.W. Bucholz, M.J. Bosse, S.K. Mirza, T.R. Lyon, L.X. Webb, A.N. Pollak,
J.D.A. GoldenValentin-Opran, J. Bone Joint Surg. Am. (2006) 1431.
[54] N.S. Hwang, S. Varghese, H.J. Lee, Z. Zhang, J. Elisseeff Tissue Eng. Part A.
(2013) 1723.
[55] M.D. Schofer, U. Boudriot, I. Leifeld, R.I. Sütterlin, M. Rudisile, J.H. Wendorff, A.
Greiner, J.R. Paletta, S. Fuchs-Winkelmann, Sci. World J. (2009) 118.
[56] P.A. Hall, F.M. WAtt, Development (1989) 619.
[57] C. Franck, S.A. Maskarinec, D.A. Tirrell, G. Ravichandran, PLoS One (2011)
e17833.
[58] P.Y. Wang, W.B. Tsai, N.H. Voelcker, Acta Biomater. (2012) 519.