Development 117, 89-95 (1993)
Printed in Great Britain © The Company of Biologists Limited 1993
89
Functional and molecular characterization of the transcriptional regulatory
region of Tcp-10bt, a testes-expressed gene from the t complex responder
locus
U. Kevin Ewulonu1, T. J. Buratynski2 and John C. Schimenti1,*
1The Jackson Laboratory, Bar Harbor, Maine 04609, USA
2Case Western Reserve Univ. School of Medicine, Cleveland,
OH 44106, USA
*Author for correspondence
SUMMARY
Mouse t haplotypes contain several mutant alleles that
disrupt spermatogenesis. Their phenotypes include
sterility, reduced fertility and transmission ratio distortion (TRD). The substantial genetic analyses of these
mutant alleles, coupled with intensive physical characterization of the t complex, provides a fertile ground for
identifying and understanding genes essential to male
gametogenesis. The t complex responder (Tcr) locus plays
a central role in this process, interacting with other t
haplotype-encoded genes to mediate TRD. A candidate
responder gene, Tcp-10bt, has been cloned and subjected
to molecular characterization. Here, we define the transcriptional regulatory regions of this gene in transgenic
mice. A 1.6 kb (but not 0.6 kb) DNA fragment upstream
of the transcription start site contains all the regulatory
signals for appropriate temporal and germ cell-specific
expression of this gene. Two smaller fragments within
this region bound specifically to nuclear factor(s) from
germ cell protein extracts in gel shift assays. This work
is a step towards understanding the mechanism of Tcp10bt regulated expression and may ultimately help
reveal a common regulatory pathway shared by other
similarly expressed spermatogenic genes.
INTRODUCTION
Thomas et al., 1991; Schimenti et al., 1988). Tcp-10bt is a
member of a gene family (the Tcp-10 genes), containing
three or four copies in t haplotypes and two to four in wildtype chromosomes (Bullard and Schimenti, 1991). Tcp-10bt
transcripts are found only in male germ cells, from the
spermatocyte stage onward (Schimenti et al., 1988).
Genes that are expressed in testis can be categorized into
three groups based on their patterns of transcription (Wolgemuth and Watrin, 1991). (1) Those expressed exclusively
during spermatogenesis. (2) Those expressed in several
tissues, but which exhibit quantitative or qualitative differences in expression during male germ cell development. (3)
Those that represent a testis-specific isotype of a more generally expressed gene.
In spite of the identical (or nearly identical) expression
patterns of some genes within certain classes, cis-acting elements or transcription factors responsible for the appropriate regulation have yet to be identified. The lack of spermatogenic cell lines poses a major problem for the study
of germ cell transcriptional regulation. Although in vitro
testis transcription systems are being developed (Bunick et
al., 1990; Van der Hoorn and Tarnasky, 1992), investigations into gene regulation depend upon transgenic mouse
technology (Peschon et al., 1987; Robinson et al., 1989).
t haplotypes are variant forms of the t complex, a 15cM
stretch of DNA on mouse chromosome 17 (Silver, 1985).
Most t haplotypes contain a recessive developmental lethal
mutation and males heterozygous for two complementing t
haplotypes are sterile. Despite these properties, t haplotypes
are prevalent in wild mouse populations because of male
transmission ratio distortion (TRD). This process causes
male mice heterozygous for a t haplotype and a wild-type
form of the t complex (+/t) to transmit the t chromosome
to nearly all their offspring.
TRD occurs through the action of several trans-acting t
complex distorter (Tcd) loci upon a t complex responder
(Tcr) locus (Lyon, 1984, 1986). Tcr is the only gene in
mammals that mediates the production of functionally
inequivalent sperm. It has been mapped to a 40-155 kb
region in the center of t haplotypes by molecular and
genetic analyses of recombinant chromosomes called partial t haplotypes (Bullard et al., 1992; Fox et al., 1985;
Rosen et al., 1990). Chromosome walking from a linked
marker led to the identification of a candidate responder
gene, Tcp-10bt, which has been sequenced and molecularly
characterized (Bullard and Schimenti, 1990, 1991; Cebra-
Key words: t complex, spermatogenesis, transgenic mice, DNAbinding proteins
90
U. K. Ewulonu, T. J. Buratynski and J. C. Schimenti
The present study was undertaken to define sequence elements in the 5′ flanking region of Tcp-10bt that are required
for appropriate transcriptional activity. The results show
that these elements are located within 1.6 kb upstream of
the transcription start site and essential sequences have been
localized to 1.0 kb. Transcripts of a chimeric Tcp-10/LacZ
transgene were detected from the spermatocyte through
elongated spermatid stage. The RNA was translated immediately as determined by histochemical staining for LacZ.
Two DNA fragments in the 1.6 kb flanking region were
found to bind testicular protein in an electrophoretic mobility shift assay (EMSA). This work is a step towards the
identification and characterization of transcription factors
critical for meiosis and/or spermiogenesis, and may help
elucidate the role of Tcp-10bt in these processes.
MATERIAL AND METHODS
DNA sequencing
Various DNA fragments upstream of the Tcp-10bt transcriptional
start site were subcloned into the plasmid Bluescript (Stratagene)
and sequencing of double-stranded templates was performed by
the dideoxy-chain termination procedure (Sanger and Coulson,
1977) using Sequenase (US Biochemicals, Cleveland, Ohio)
according to manufacturer’s instructions. Both strands were
sequenced, in some cases using internal synthetic oligonucleotides
rather than the polylinker primers to initiate chain extension. DNA
sequence analyses and homology searches were performed using
MacVector (IBI) software package.
Gene constructs
Two constructs were used for generating transgenic mice, differing only in the length of Tcp-10bt 5′ flanking DNA (Fig. 1).
p1.6Tcr-Lac-SV was constructed as follows: The 1.6 kb
NheI/EcoRI fragment shown in Fig. 1 was isolated from a genomic
subclone by cleaving with EcoRI, Klenow filling, cleaving with
NheI and gel purifying. It was then ligated to SmaI/XbaI digested
pLacC plasmid (a kind gift of Jacques Peschon) to generate the
intermediate plasmid p1.6Tcr-Lac. pLacC contains the bacterial
LacZ gene inserted into pUC18. The 0.85 kb SV40 fragment was
generated by digesting the plasmid pC4βgal (Thummel et al.,
1988) with XbaI and EcoRI. After Klenow filling, the fragment
was ligated into a T4 Polymerase-blunted PstI site 3′ to the LacZ
gene in p1.6Tcr-Lac. p0.6Tcr-Lac-SV was generated by digesting
the p1.6Tcr-Lac-SV with XmnI (see this site in Fig. 1) and HindIII,
which removed the entire insert except for the 5′-most 1 kb of the
Tcp-10bt gene. This excised fragment was ligated into pBluescript
cut with HindIII and HincII.
Transgenic mice
The inserts from each of the two plasmid constructs was excised
by HindIII/KpnI digestion, purified on low melting point agarose
gels, further purified with GeneClean (Bio101) and microinjected
into 1-cell C57BL/6 × SJL F2 embryos. The injected embryos
were transferred into pseudopregnant CF1 females while still at
the 1-cell stage. Transgenics from the litters born were identified
by Southern blot hybridization of tail DNA, using a [32P]-labeled
2.5 kb PvuII LacZ fragment as probe. For the 1.6Tcr-Lac-SV construct, six founder transgenics were identified from eighteen mice
born. Three independent lines were established from these and
subsequently analyzed. For the 0.6Tcr-Lac-SV construct, four
founder mice were identified from seventeen mice born, and three
independent lines were also established and analyzed.
Quantitation of transgene copy number
Genomic DNA from each line was digested with SacI, yielding
fragments corresponding to the tandem repeats, an internal fragment and two additional fragments corresponding to the junction
of the transgene array and the host genome. Southern blots of the
digested DNAs were probed to determine how many fold more
intense the tandem array or internal bands were compared to the
junction bands. The number of nucleotides detected in each fragment by the probe (a 1.95 kb PvuII-SacI lacZ fragment) was taken
into account in order to normalize molecule copy number against
band intensity. Quantitation was performed on a phosphorimager
device (Molecular Dynamics).
RNA isolation and northern blot analyses
Total RNA was isolated from various tissues of male transgenic
mice as described (Chomczynski and Sacchi, 1987). RNA electrophoresis, transfer onto Nytran membranes (Schleicher &
Schuell) and hybridization was carried out by standard procedures
(Maniatis et al., 1989). The probe used for transgene detection
was the same as that used for the Southern blot hybridization,
whereas that used for detecting endogenous Tcp-10 RNA was a
cDNA fragment called Tcr16R/H.2 (Bullard and Schimenti, 1990).
Staining for -galactosidase
Testes from six mature transgenic mice were dissected and used
for to prepare a cell suspension from seminiferous epithelium by
a modification (Murti and Schimenti, 1991) of the
collagenase/trypsin method of Romrell (Romrell et al., 1976). The
cells were resuspended in 50 ml sperm medium plus 0.2% bovine
serum albumin and loaded onto a 1000 ml 2-4% BSA gradient
prepared in a CELSEP chamber (Dupont) with a 10% BSA cushion at the bottom. 50 ml fractions were collected. Each was numbered starting from the bottom (high density BSA). The cells were
pelleted, fixed, stained for LacZ activity and photographed as previously described (Murti and Schimenti, 1991).
1.6 kb
0.6 kb
R
B
H
X Bm
H
GGGTTTTTA
N
Start
Binds nuclear protein
100 bp
Fig. 1. Map of the Tcp-10bt 5′ flanking region and
fragments used to generate transgenic mice. Selected
restriction sites are shown: B, BglII; Bm, BamHI; H,
HincII; N, NheI; R, EcoRI; and X, XmnI. There are
other HincII sites besides the one indicated. The
transcriptional start site is indicated by the arrow (L.
Snyder, L. Silver and J. Schimenti, unpublished
observations). The DNA fragments used as promoter
fragments in the transgenic constructs are shown as
stippled lines above the map. The fragments that bind
nuclear factor(s) are indicated, as is the position of a
nanonucleotide resembling others present in the Pgk-2
and Zfp-35 genes.
Transcriptional regulation of Tcp-10bt
Gel shift assay
Nuclear extracts were prepared essentially as described (Dignam
et al., 1983) from liver, spleen and testicular cells enriched for
spermatogonia, spermatocytes and spermatids of male mice. After
ammonium sulfate precipitation for 30 minutes at 4°C and ultracentrifugation at 123,342 g for 25 minutes at 4°C, the pellet was
resuspended in 1 ml of buffer D (20 mM Hepes-KOH, pH 7.9,
20% (v/v) glycerol, 100 mM KCl, 200 mM EDTA, 0.5 mM DTT,
0.5 mM PMSF) and dialyzed twice against buffer D over a 24
hour period. Samples were centrifuged for 10 minutes at 4°C to
remove precipitated protein. 15 µg of each protein extract was
incubated at 30°C for 30 minutes with 1 µg nonspecific DNA
(lambda/BstEII) in a 15 µl volume containing 12% glycerol, 12
mM Hepes (pH 7.9), 60 mM KCl, 1 mM EDTA, 1 mM DTT and
1-5 fmoles of a 5′ end labelled Tcp-10bt fragment. The mixtures
were loaded on a 4% non-denaturing polyacrylamide gel (30:1
acrylamide:bis) and electrophoresed at 125 volts for 2.5 hours.
The gel was then dried and autoradiographed.
RESULTS
Nucleotide sequence of the Tcp-10bt 5 flanking
region
The nucleotide sequence of 1.6 kb of the Tcp-10bt gene 5 ′
flanking region is shown in Fig. 2. Similar to other testisexpressed genes, Tcp-10bt does not possess canonical
91
TATA or CCAAT boxes in the typical locations upstream
of the transcriptional start site (Boer, 1987; Cunliffe et al.,
1990; Galliot, 1989). Curiously, there are three closely
spaced TATA sequences in the region between −104 and
−86. Since they are further upstream than the typical 35
bases or so, their functional significance is questionable.
Transcriptional regulatory sequences defined in
transgenic mice
To define the extent of 5′ flanking sequence required for
tissue-specific transcription, we established transgenic mice
carrying the LacZ coding sequence flanked 5′ by either 1.6
kb or 0.6 kb of Tcp-10bt upstream sequence. Northern blot
hybridization of total RNA isolated from various male
transgenic tissues is shown in Fig. 3. A transcript of about
3.9 kb, exclusive to testis, was observed in all three transgenic lines carrying the 1.6 kb fragment. No hybridization
was observed in the other tissues, in wild-type mice or in
any of the three transgenics carrying the 0.6 kb upstream
fragment. Two of the three 1.6Tcr-Lac-SV lines contained
2 copies of the transgene and the other had 3 copies. Two
of the three 0.6Tcr-Lac-SV lines contained 3 copies of the
transgene and the other had 4 copies. The results demonstrate that the 1.6 kb fragment contains the sequence information necessary for tissue-specific transcription of the
transgene. The inability of the 0.6 kb fragment to direct
EcoR I
GAATTCAGGAGGATTGGCTGTCTCAGCACCACAGAGGAGGAGACTGGGGAACAGACAAATACGTTTATCT
-1552
TTGTGTATTTACCATCACACCGTGTTGCTTATTAAAAATGTTTGGACCTCTGGGTCTGGGTCTTACTTGG
-1482
GGGCTTCGGTTCTCTCTTAGCCATGGATTTCAGTTTTTGCTTTAACTTCTCTACAATGGACTGTCATTGC
-1412
CCATGGTTATCTGCGCTACAGAGGAGTTGGAGTGTCAGAGACTGTACCTTAGCATAGATCTCACAAACAC
BglI I
ACAGTTAAGGATTCACACCTTAGCATAGATCTCACAAACACACAGTTAAGGATTCACACTCATACATAAG
-1342
-1272
GCAAGGGGCTTGACTACAGGAGGGAAAATCCCAAATCACCTTGCCAGTCTCTGGGGATCACATGTAGAAA
HincII
CCTTTCTGTCTTTAGGACCTTCTTAGAAAGTCCACTGCCTTGTTAACAGTCAGCGCGGAGTCGATTTCTG
-1132
CTCTCAGAAGGTGAACGTGTGGTGTGCTGTCACCTCCCCTATGGACGTAAGAGCGTGAACAGCCAAGTCT
-1062
-1202
GGAGTGCAGCGAAGGCATTCACTGTGTCCTTCACTCAACACATCATTGTTTTCTGCTGACCCCATGCCTG
-992
CAGACCTACCAACACCAATGTCCCAAGCAGGTTCAAGCTGACTGACACTGGCACAGGTTCCCATAGATGT
-922
TTGCCCATCACAAAATGGAGAGGAAGCAATGAAGTTCAGCTCTTCCTATATCCCTGCTTCTGGACACTCT
-852
CCACCCAGCCTCTTTGGGCTTCAGAAATTCCACTCTATCCAGCTCTCCCCGCAATCACATGGAGCCTTAC
-782
TAGGGATCCCTTTCCAGGAAGGAGCATCTCTGACCACAGCCAGGTGGTGGATGTCTTATCGTCCAATGGA
-712
TACAATCAAAGCCCTGGGCACCTGGCCTCTCCGAGCAAACAAGGACTGGTCCAAGTCCTTGGGGAAAAAA
XmnI
AAAGAATGAGAAGCAATTCAAGGCCTCCCAGAAGTAGCACTGTCAATTCCAACACAGCTAGAACCCTCTA
BamH I
TGTCCCCAGGATCCCCAGGTAGGGAATGACACACTCTTATGAAAAATGTCCCCTCTGTTTGCCTTTAAAT
-642
ATTTAACCACTCTAAATACTTTGCTGGGGGTAAGAAGTGATGGCCGGGGCTTTCAGCTTTACACTGACTC
-432
-572
-502
TCTGTTTCTCATCCTTGCCCATGATCACAAAAACCAGATGGACAAGTTATTGGGAGGAACATTTTTGTGG
-362
AATCACAAAATCTTGCCTCATATCTCCTGTTTAAGCCCGTAGAGATTATATTCTCCTTGTGAACATCTAT
-292
Fig. 2. Nucleotide sequence of the Tcp-10bt 5′
flanking region. Restriction enzyme sites
GGTTTTTATCCTATTGCAACTTACTCTGTTGTCAATTGAGCAGAGAGTCCGGCTCTCTCCAGTCCTCTAT
-152 relevant to making constructs are indicated. The
HincII
multiple TATA sequences are underlined and
ATGGGTTGACATGAGCTTACTCTAGCTGAATCATGAGTATGTTGGTAATTATAAAATCTTATAACTGTAT
-82
the transcriptional start site is numbered +1.
ATAAAACCCTAAGACTGCATGAGATGGCATGGCCCTTTAAGACAGAGAGTCGGTTTAGAATGGACAGGTT
-12The nanonucleotide resembling those present in
+ 1
NheI
the Pgk-2 and Zfp-35 genes is double
TCCTGGCGTTCTTAAGCTAGC
underlined.
GAGTAGTTTGATTTCATCTTAAAGAAATTTTACAGTTTTTTTTTTTCAAGAATGCGTGCTGAGAAAATTG
-222
92
U. K. Ewulonu, T. J. Buratynski and J. C. Schimenti
Fig. 3. Northern blot of total RNA from various tissues of male
transgenic mice. B, brain; H, heart; K, kidney; S, spleen; T, testis.
The probe is a [32P]-labelled 2.5 kb PvuII fragment within the
LacZ gene.
expression in three independent lines indicates that essential transcriptional regulatory sequences of the Tcp-10bt
gene reside in the 1.0 kb region between the EcoRI and
XmnI sites (Fig. 1).
To determine the stage of spermatogenesis at which the
LacZ transcripts first appear, RNA was prepared from testes
of transgenic mice ranging in age from 12.5 days old to
adulthood (>60 days). As shown in Fig. 4 (top panel), LacZ
transcripts first appear at day 14.5. This correlates with the
appearance of pachytene spermatocytes (Bellve, 1979),
which is in accordance with previously reported onset of
Tcp-10 transcription (Schimenti et al., 1988). To confirm
this correlation and compare transgene transcription to that
of the endogenous Tcp-10 genes in these particular animals,
the northern blot was stripped and rehybridized to a Tcp10 cDNA probe (Fig. 4, bottom panel). The developmental expression patterns were identical.
Assay for LacZ activity in testicular cells
To identify the spermatogenic cell type(s) in which translation of the transgene mRNA occurs, LacZ activity in
1.6Tcr-Lac-SV mice was monitored as a function of neonatal development via X-gal staining. LacZ staining was
observed in testicular cells from day 14.5 and older transgenics, but not in day 12.5 or younger animals. No staining was seen in adult 0.6Tcr-Lac-SV mice (Fig. 5D). To
determine the cell types containing LacZ activity in the
1.6Tcr-Lac-SV mice, staining was performed on testicular
cell samples fractionated by unit-gravity sedimentation. As
shown in Fig. 5, staining was seen in spermatocytes (Fig.
5A), round spermatids (Fig. 5B) and elongating spermatids
(Fig. 5C). We were unable to detect staining of mature spermatids. These results suggest that translation of the transgene mRNA occurs in all the cell types where it is transcribed. Alternatively, it is possible that lacZ activity
produced in spermatocytes persists throughout spermiogenesis in cells that no longer translate the transgene RNA.
The appearance of LacZ activity in spermatocytes coincides with the onset of transcription in day 14.5 transgenic
Fig. 4. Northern blot of total testicular RNA from male mice of
various ages. The age in days is shown above each lane (day of
birth=day 0.5). Each lane contains 15 µg of total RNA. TOP:
Hybridization with a LacZ probe (hence is specific for the
transgene). BOTTOM: The same blot stripped and rehybridized to
a cDNA probe specific for the Tcp-10 genes. These genes always
display the double-band pattern (Schimenti et al., 1988).
mice (see Fig. 4), demonstrating that this particular hybrid
messenger RNA is not subject to post-transcriptional regulation. The temporal translation pattern of endogenous Tcp10 has not been reported.
Sequences in the Tcp-10bt promoter that bind
nuclear factor(s)
A search for potential regulatory elements that bind specific
nuclear factors was conducted using the electrophoretic
mobility shift assay (EMSA). Various 5′ fragments corresponding to the Tcp-10bt DNA present in the 1.6Tcr-LacSV construct were assayed. The results are shown in Fig.
6. Specific binding with testicular nuclear extracts from
spermatocyte- and spermatid-enriched fractions were
observed with a 158 bp BglII-HincII and a 264 bp BamHIHincII fragment (Figs 1, 6). The BglII-HincII fragment
yielded three retarded bands (a, b, c), which could be eliminated by a 100-fold excess of the unlabeled fragment as
competitor. The BamHI-HincII fragment yielded one
retarded band, ‘a’, which could be removed by self-competition and another, ‘b’, which could not. An upstream,
unlabeled DNA fragment could not eliminate the specific
bands generated by either fragment (Fig. 6, lane 3a,b). At
present, it is unknown whether the multiple retarded bands
formed by the BglII-HincII fragment represent the binding
of different proteins or the same factor(s) as monomeric
and multimeric units. No binding was observed with the
extracts prepared from either liver, spleen (Fig. 6, lanes 4a,
5a, 5b, 6b), or the spermatogonium-enriched fraction (data
not shown), suggesting that the factor(s) binding to the
above two fragments have a considerable level of tissue
specificity.
Transcriptional regulation of Tcp-10bt
93
Fig. 5. LacZ activity staining of
fractionated transgenic testicular
cells. Cel-Sep fractions of 1.6TcrLac-SV mice enriched for (A)
spermatocytes, (B) round
spermatids and (C) elongating
spermatids. (D) lacZ activity
staining of unfractionated 0.6TcrLac-SV cells. Arrowheads in C
show an individual elongating
spermatid. All animals were
homozygous for the transgene
insertions. Microphotographs were
taken at 250× magnification.
DISCUSSION
Transcriptional control of spermatogenesis genes
Our understanding of gene regulation during spermatogenesis is relatively poor. This is due to the inability to maintain or differentiate spermatogenic cells in culture. Descriptive characterization of transcriptional patterns represents
the bulk of existing data in this area. The compiled data
reveal groups of similarly regulated genes (Wolgemuth and
Watrin, 1991). These are activated at different times during
spermatogenesis: some in spermatogonia, others in spermatocytes and others in the haploid stages. In addition,
some genes are active both in testes and somatic cells,
whereas others are exclusive to testis. The Tcp-10bt gene
is transcribed predominantly or exclusively in testicular
germ cells and is first transcribed in spermatocytes. This
pattern is shared by other genes, including tcte-1 (Sarvetnick et al., 1989), 177c3 (Rappold et al., 1987) and Pgk-2
(Gold et al., 1983).
More detailed investigations into spermatogenic gene
regulation have utilized transgenic mice to characterize the
promoter regions of testis-expressed genes. Appropriate
temporal and spatial expression of the mouse protamine1(mP1), mouse protamine-2 (mP2) and human phosphoglycerate kinase-2 (PGK2) genes can be directed with
a maximum of 425 bp (Peschon et al., 1989), 859 bp
(Stewart et al., 1988) and 323 bp (Robinson et al., 1989),
respectively, upstream of the transcriptional initiation site.
Fig. 6. Electrophoretic mobility shift assay.
Nuclear protein was incubated with [left
panel] a 158 bp BglII-HincII fragment (Fig.
1), or [right panel] a 264 bp BamHI-HincII
fragment (Fig. 1). ‘+’ indicates the presence
of extract or self/non-self competing DNA
(all contain 1 µg of lambda DNA - see
Materials and methods), while ‘−’ indicates
the absence of same. Lanes 1-3 contain
testicular nuclear extracts while lanes 4-5
(A) and 5-6 (B) were contain extracts from
liver and spleen, respectively. Lane 3 in
both panels contains 100 ng of a 255 bp
EcoRI/RsaI fragment as control competitor.
This fragment corresponds to the first 255
bases in Fig. 2. Lane 2 in both panels
contains 100 ng of unlabelled probe
fragment (specific competitor).
94
U. K. Ewulonu, T. J. Buratynski and J. C. Schimenti
Genes sharing similar expression patterns may be activated by a common regulatory or signalling mechanism,
possibly involving identical transcription factors. If this is
the case, each of these genes would be expected to share
common DNA-binding sites for such factors. The promoter
studies in transgenic mice, coupled with sequence comparisons of promoter regions, has led to identification of potential regulatory sequences. Cunliffe et al. (1990) noted that
the Zfp-35 and Pgk-2 genes, which have parallel transcription patterns in the testis (transcription of both begins in
pachytene spermatocytes, although Zfp-35 is also expressed
in somatic cells), have similar sequence elements in their
5′ flanking regions. Zfp-35 has the sequence
GGGTTTTGACAT located at −226 to −215, which is identical at 10 of 12 positions to the sequence AGGTTTTTACAT located at −512 to −501 upstream of Pgk-2. The
nanonucleotide GGGTTTTTA resides upstream of Tcp-10bt
at positions −207 to −216, which differs by one nucleotide
compared to either Zfp-35 or Pgk-2. It will be interesting
to see whether other similarly expressed genes also contain
this motif. Functional evaluation via in vitro mutagenesis
will provide direct tests of such sequences.
Identification of male germ cell transcription
factors
Analysis of transgenic mice carrying various lengths of the
Tcp-10bt gene 5′ flanking region has enabled us to define a
1.0 kb segment containing essential transcriptional control
element(s) for spermatocytes and more developed spermatogenic cells. Two promoter fragments bound to nuclear
factor(s) in protein extracts from testis. Additional experiments will be required to determine whether binding of
these proteins is required for effective transgene expression.
The fact that the construct that was missing one of the DNA
elements (0.6Tcr-Lac-SV) was incapable of transcription is
consistent with this possibility.
Research into spermatogenic transcription factors is still
in early stages. To date, no testis-specific transcription factors have been isolated. However, specific interactions of
germ cell nuclear proteins with the RT7 and Pgk-2 promoters have also been identified (Gebara and McCarrey,
1992; Van der Hoorn and Tarnasky, 1992). As progress on
the regulation of these and other testis-expressed genes
advances, the potential existence of shared regulatory pathways may be identified. With regards to Tcp-10bt, elucidation of its regulatory mechanisms will be important for
understanding its potential involvement in TRD of t haplotypes.
We thank Peter Harte for providing the pC4βgal plasmid. This
work was supported by grants from the Searle Scholars Program/The Chicago Community Trust to J. S., the Lucille Markey
Charitable Trust to Case Western Reserve University and NIH
grant R01 HD24374-02 to J. S. This work was performed in the
Department of Genetics at Case Western Reserve University.
REFERENCES
Bellve, A. R. (1979). The molecular biology of mammalian
spermatogenesis. In Oxford Reviews of Reproductive Biology (ed C.A.
Finn), pp. 159-261. Oxford Univ. Press.
Boer, P. H., Andra, C. N., Lau, Y. and McBurney, M. W. (1987). The
testis-specific phosphoglycerate kinase gene pgk-2 is a recruited
retroposon. Mol. Cell. Biol. 7, 3107-3112.
Bullard, D. and Schimenti, J. (1990). Molecular cloning and genetic
mapping of the t complex responder candidate gene family. Genetics 124,
957-966.
Bullard, D., Ticknor, C. and Schimenti, J. (1992). Functional analysis of a
t complex responder locus transgene in mice. Mammalian Genome in
press.
Bullard, D. C. and Schimenti, J. (1991). Molecular structure of Tcp-10
genes from the t complex responder locus. Mammalian Genome 1, 228234.
Bunick, D., Johnson, P. A., Johnson, T. R. and Hecht, N. B. (1990).
Transcription of the testis-specific mouse protamine 2 gene in a
homologous in vitro transcription system. Proc. Natl. Acad. Sci. USA 87,
891-895.
Cebra-Thomas, J., Decker, C., Snyder, L., Pilder, S. and Silver, L.
(1991). An allele- and haploid specific product generated by alternative
splicing from a mouse t complex responder locus candidate. Nature 349,
239-241.
Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem. 162, 156-159.
Cunliffe, V., Williams, S. and Trowsdale, J. (1990). Genomic analysis of
a mouse zinc finger gene, Zfp-35, that is up-regulated during
spermatogenesis. Genomics 8, 331-339.
Dignam, J. D., Lebovitz, R. M. and Roeder., R. G. (1983). Accurate
transcription initiation by RNA polymerase II in a soluble extract from
isolated mammalian nuclei. Nuc. Acid Res. 11, 1475-1489.
Fox, H., Martin, G., Lyon, M. F., Herrman, B., Frischauf, A.-M.,
Lehrach, H. and Silver, L. M. (1985). Molecular probes define different
regions of the mouse t complex. Cell 40, 63-69.
Galliot, B., Dolle, P., Vigeron, M., Featherstone, M. S., Baron, A. and
Duboule, D. (1989). The mouse Hox-1.4 gene: primary structure,
evidence for promoter activity and expression during development.
Development 107, 343-359.
Gebara, M. M. and McCarrey, J. R. (1992). Protein-DNA interactions
associated with the onset of testis-specific expression of the mammalian
Pgk-2 gene. Mol. Cell. Biol. 12, 1422-1431.
Gold, B., Fugimoto, H., Kramer, J., Erickson, R. and Hecht, N. (1983).
Haploid accumulation and translational control of phosphoglycerate
kinase-2 messenger RNA during mouse spermatogenesis. Dev. Biol. 98,
392-399.
Lyon, M. F. (1984). Transmission ratio distortion in mouse t haplotypes is
due to multiple distorter genes acting on a responder locus. Cell 37, 621628.
Lyon, M. F. (1986). Male sterility of the mouse t-complex is due to
homozygosity of the distorter genes. Cell 44, 357-363.
Maniatis, T., Fritsch, E. F. and Sambrook, J. (1989). Molecular Cloning
- A Laboratory Manual. 2nd edition. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory Press.
Murti, J. R. and Schimenti, J. C. (1991). Microwave-accelerated fixation
and lacZ activity staining of testicular cells in transgenic mice. Analyt.
Biochem. 198, 92-96.
Peschon, J. J., Behringer, R. R., Brinster, R. L. and Palmiter, R. D.
(1987). Spermatid-specific expression of protamine 1 in transgenic mice.
Proc. Natl. Acad. Sci. USA 84, 5316-5319.
Peschon, J. J., Behringer, R. R., Palmiter, R. D. and Brinster, R. L.
(1989). Expression of mouse protamine 1 genes in transgenic mice. Ann.
NY Acad. Sci. 564, 186-197.
Rappold, G., Stubbs, L., Labeit, S., Crkvenjakov, R. and Lehrach, H.
(1987). Identification of a testis-specific gene form the mouse t complex
next to a CpG-rich island. EMBOJ. 6, 1975-1980.
Robinson, M., McCarrey, J. and Simon, M. (1989). Transcriptional
regulatory regions of testis-specific PGK2 defined in transgenic mice.
Proc. Natl. Acad. Sci. USA 86, 8437-8441.
Romrell, L. J., Bellve, A. R. and Fawcett, D. (1976). Separation of
mouse spermatogenic cells by sedimentation velocity. Dev. Biol. 49, 119131.
Rosen, L., Bullard, D. and Schimenti, J. (1990). Molecular cloning of the
t complex responder genetic locus. Genomics 8, 134-140.
Sanger, F. N. and Coulson, A. R. (1977). DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467.
Sarvetnick, N., Tsai, J. Y., Fox, H., Pilder, S. and Silver, L. (1989). A
Transcriptional regulation of Tcp-10bt
mouse chromosome 17 gene encodes a testes-specific transcript with
unusual properties. Immunogenetics 30, 34-41.
Schimenti, J. C., Cebra-Thomas, J., Decker, C. L., Islam, S. D., Pilder,
S. H. and Silver, L. M. (1988). A candidate gene family for the mouse t
complex responder (Tcr) locus responsible for haploid effects on sperm
function. Cell 55, 71-78.
Silver, L. M. (1985). Mouse t haplotypes. Ann. Rev. Genet. 19, 179-208.
Stewart, T., Hecht, N., Hollingshead, P., Johnson, P., Leong, J. and
Pitts, S. (1988). Haploid-specific transcription of protamine-myc and
protamine-T-antigen fusion genes in transgenic mice. Mol. Cell. Biol. 8,
1748-1755.
95
Thummel, C. S., Boulet, A. M. and Lipshitz, H. D. (1988). Vectors for
Drosophila P-element-mediated transformation and tissue culture
transfection. Gene 74, 445-456.
Van der Hoorn, F. and Tarnasky, H. (1992). Factors involved in
regulation of the RT7 promoter in a male germ cell-derived in vitro
transcription system. Proc. Natl. Acad. Sci. USA 89, 703-707.
Wolgemuth, D. and Watrin, F. (1991). List of cloned mouse genes with
unique expression patterns during spermatogenesis. Mammalian Genome
1, 283-288.
(Accepted 11 September 1992)