GLUCOCORTICOIDS-CRH-ACTH-ADRENAL
Fetal Glucocorticoid Synthesis Is Required for
Development of Fetal Adrenal Medulla and
Hypothalamus Feedback Suppression
Chen-Che Jeff Huang, Meng-Chun Monica Shih, Nai-Chi Hsu, Yu Chien, and
Bon-chu Chung
Institute of Molecular Biology (C.-C.J.H., M.-C.M.S., N.-C.H., Y.C., B.-c.C.), Academia Sinica, Taipei 115,
Taiwan; and Institute of Biochemistry and Molecular Biology (Y.C.), National Yang-Ming University,
Taipei 112, Taiwan
During pregnancy, fetal glucocorticoid is derived from both maternal supply and fetal secretion.
We have created mice with a disruption of the Cyp11a1 gene resulting in loss of fetal steroid
secretion but preserving the maternal supply. Cyp11a1null embryos have appreciable although
lower amounts of circulating corticosterone, the major mouse glucocorticoid, suggesting that
transplacental corticosterone is a major source of corticosterone in fetal circulation. These embryos
thus provide a means to examine the effect of fetal glucocorticoids. The adrenal in Cyp11a1 null
embryos was disorganized with abnormal mitochondria and oil accumulation. The adrenal medullary cells did not express phenylethanolamine N-methyltransferase and synthesized no epinephrine. Cyp11a1 null embryos had decreased diencephalon Hsd11b1, increased diencephalon Crh,
and increased pituitary Pomc expression, leading to higher adrenocorticotropin level in the plasma.
These data indicate blunted feedback suppression despite reasonable amounts of circulating corticosterone. Thus, the corticosterone synthesized in situ by the fetus is required for negative
feedback suppression of the hypothalamus-pituitary-adrenal axis and for catecholamine synthesis
in adrenal medulla. (Endocrinology 153: 4749 – 4756, 2012)
he majority of circulating steroids are secreted from
the adrenal cortex, which contains enzymes that function in steroid synthesis, such as CYP11A1, CYP11B1,
and HSD3B. The levels of glucocorticoids in the body are
tightly controlled in the hypothalamus-pituitary-adrenal
(HPA) axis, which is activated by CRH in the hypothalamus and ACTH in the pituitary, and attenuated by
glucocorticoids in a negative feedback loop (1). The
major glucocorticoid in most mammalian species is cortisol, but rodents use corticosterone as their major
glucocorticoid.
Glucocorticoids play important roles in glucose homeostasis, lung maturation, antiinflammation, and the development of adrenal medulla. The adrenal medulla contains enzymes for catecholamine secretion such as tyrosine
hydroxylase (TH) and phenylethanolamine N-methyltransferase (PNMT). PNMT expression is induced by glucocorticoids (2–5).
T
Glucocorticoids are present in a large quantity during
pregnancy to support the growth and development of the
fetus. Prenatal exposure to glucocorticoids affects HPA
development and permanently changes the HPA activity in
the adulthood (1). Prenatal glucocorticoids come from
both fetal secretion and maternal supply transferred
through the placenta (6). Maternal glucocorticoids are
necessary for the development of adrenal medulla, pancreatic ␤-cells, cerebral cortex, and lung maturation (7–
10). The functions of glucocorticoids secreted from the
fetus, however, is still unclear.
The gap in our understanding about the functions of
fetal steroids comes from the lack of an animal model that
differentiates the roles of maternal steroids and de novo
synthesized steroids. Here, we have used the Cyp11a1 null
fetus that is devoid of fetal synthesis but retains maternal
steroid supply. Using this mouse model, here we show that
ISSN Print 0013-7227 ISSN Online 1945-7170
Printed in U.S.A.
Copyright © 2012 by The Endocrine Society
doi: 10.1210/en.2012-1258 Received March 5, 2012. Accepted July 31, 2012.
First Published Online September 7, 2012
Abbreviations: E, Embryonic d; GR, glucocorticoid receptor; H&E, hematoxylin/eosin; HPA,
hypothalamus-pituitary-adrenal; PCNA, proliferating cell nuclear antigen; PNMT, phenylethanolamine N-methyltransferase; TH, tyrosine hydroxylase.
Endocrinology, October 2012, 153(10):4749 – 4756
endo.endojournals.org
4749
4750
Huang et al.
Fetal Glucocorticoid Synthesis and Development
de novo synthesized steroids affect circulating corticosterone levels, medulla function, and the negative feedback of
the HPA axis during the fetal stage. In this study, we demonstrate that steroids from the fetus itself are necessary for
normal fetal development.
Materials and Methods
The generation of Cyp11a1 mutant mice
The original Cyp11a1 null mice contained a neo marker in its
exon 1 (11). This neo gene was removed from the genome after
mating with EIIa-CRE transgenic mice, which express the CRE
recombinase gene at the one-cell stage (12). The resulting mouse
strain contains a loxP site in the first exon, which creates a frameshift mutation and thus still results in a null phenotype. This
mouse has been backcrossed with inbred strain (C57BL/6) female mice for 7–10 generations. Mice were housed in specific
pathogen-free environment under a 14-h light, 10-h dark cycle.
The use of mice complied with the guidelines set forth by the
Institutional Animal Care and Utilization Committee. All experiments were performed on at least three animals for each
genotype.
Histological analysis
The specimens were fixed with Bouin’s solution overnight,
embedded in paraffin after standard sectioning, and stained in
hematoxylin/eosin (H&E). For Oil Red O staining, frozen tissue
sections were stained with Oil Red O (Sigma, St. Louis, MO) as
previously described (11).
Immunohistochemistry
For immunohistochemical analysis, samples were fixed in 4%
paraformaldehyde/PBS in 4 C overnight and embedded in paraffin. Paraffin-embedded sections were dewaxed and rehydrated
in a series of alcohol to PBS. The endogenous peroxidase activity
was blocked by 3% H2O2 (in methanol) for 8 min and rinsed
with PBS three times for 5 min each. Slides were pretreated in the
microwave in 0.1 mM citrate acid for 1 min. After preincubating
with 1.5% normal goat serum in PBS for 30 min, sections were
incubated with the anti-PNMT or anti-TH antibody (diluted
1:1000 in phosphate-buffered saline with 0.1% Tween-20 containing 1.5% normal goat serum; Chemicon International, Inc.,
Temicula, CA) at 4 C overnight. For proliferating cell nuclear
antigen (PCNA), slides were stained with Zymed’s PCNA staining kit (Zymed Laboratories, Inc., CA.) according to the manufacturer’s instructions. After rinsing with PBST, sections were
incubated with biotinylated antibody for 30 min and avidinbiotin-peroxidase complex for 10 min (ABC kit; Vector Laboratory, Inc., Burlingame, CA). Visualization of the immune complex was achieved by incubating the sections in 3,3⬘diaminobenzidine for 2 min. Slides were dehydrated and
mounted in Permount.
Hormone assays
Plasma was collected from embryonic mice that were killed by
decapitation at 0900 or 1800 h. Plasma was collected in ice-cold
EDTA-rinsed tubes. Hormonal analyses were performed with
RIA kits for corticosterone (ICN Biomedicals, Inc., Palo Alto,
Endocrinology, October 2012, 153(10):4749 – 4756
CA) and ACTH (Nichols Institute Diagnostics, San Juan Capistrano, CA) according to the manufacturer’s instructions. Two
microliters of plasma were used for corticosterone test, and 50 ␮l
of plasma were used for ACTH test.
Real-time PCR
Total RNA was isolated from each adrenal, diencephalon, or
pituitary using the RNAeasy kit from QIAGEN (Valencia, CA).
The RNA pellet was dissolved in 20 ␮l of water, and 10 ␮l of the
RNA solution were used for RT. RT was performed by Oligo(dT)
primer and reverse transcriptase (SuperSript II; Invitrogen,
Carlsbad, CA). First-strand cDNA was used as the template together with 250 nM each primer in a LightCycler quantitative
PCR (Roche Diagnostics, Grenzacherstrasse, Switzerland) with
QuantiTect SYBR Green PCR Master Mixture (QIAGEN) to
follow the progress of DNA synthesis. RNA amounts were calculated with relative standard curves for glyceraldehyde-3-phosphate dehydrogenase and each gene. Primers used were:
TGCGGGCTCACCTACCA (forward) and AAGGCAGGCAGGACGACA (reverse) for Crh, GTGTTTCCTGGCAACGGAGATG (forward) and CATGA AGCCACCGTA
ACGCTTG (reverse) for Pomc, TCATGGCGTG AGTACCTC
(forward) and GGGCTTGAATATCCATTAGAA (reverse) for
GR, GGTGTGCCTTTCCCCATCATT (forward) and CAACATGTAGGTGATGCCCAG (reverse) for Crhr, ACCCCGACATCATATTTAAGGA (forward) and TTAACTTGTCTTTGCACCTCTGA (reverse) for Shh, TCAGCCCATATCCACAAT
(forward) and CAGGGAACCAGAAAGCAG for Ucn3, and
GCTGTAGCC AAATTCGTTGTC and GATGACATCAAGAAGGTGGTG for Gapdh. For Hsd11b1 and Avp, real-time
quantitative PCR was performed using TaqMan Assay-on-Demand (Applied Biosystems, Foster City, CA) and using the 7000
Sequence Detector (Applied Biosystems).
Epinephrine and norepinephrine measurement
Each adrenal was homogenized in 500 ␮l of ice-cold 0.4 M
perchloric acid containing 0.5 mM EDTA. Homogenates were
centrifuged at 1000 ⫻ g at 4 C for 20 min, and the supernatants
were store at ⫺80 C until assay. Each sample was adjusted to 4
ml with 10 N HCl for standard epinephrine and norephinephrine
HPLC assays.
Chromaffin reaction
Adrenal was stained with chromium salt by soaking in
Muller’s fluid (2.5 g of K2Cr2O7, 1 g of Na2SO4 䡠 10H2O in 100
ml H2O) for 48 h and washed in running water overnight. Tissues were fixed in 10% neutral formaldehyde overnight, embedded in wax, and sliced into 15-␮m sections. Adrenal sections
were dewaxed and mounted in Permount followed by visualization under a microscope.
Ultrastructural studies
Tissues were fixed in 2.5% glutaraldehyde in 0.1 M phosphate
buffer (pH 7.2) overnight followed by washing in 0.1 M phosphate buffer (15 min, three times). After refixation in 1% osmium tetraoxide for 2 h at room temperature, they were washed
in phosphate buffer, dehydrated in graded series of acetone/
phosphate buffer for 15 min each (30, 50, 70, 80, 90, 95, and
100%), equilibrated, and embedded in ERL 4206 epoxy resin.
For transmission electron microscopic studies, ultrathin 80-nm
Endocrinology, October 2012, 153(10):4749 – 4756
endo.endojournals.org
sections were mounted on coated 50-mesh copper grids, contrasted with aqueous solutions of uranyl acetate and lead citrate,
and viewed and photographed using the FEI Tecnai TM G2
Transmission Electron Microscope.
Results
Cyp11a1 null mice suffer from mild defects of
steroid secretion during the embryonic stage
We have previously generated Cyp11a1E1-neo mice
with the insertion of a neo gene into the first exon of
Cyp11a1 resulting in complete loss of gene function and
neonatal death (11). To eliminate the interference of the
neo cassette, we have since removed the neo gene in the
first exon using the Cre recombinase, which was introduced into the Cyp11a1E1-neo mice since fertilization via
mating with the EIIa-cre transgenic mice. The resulting
Cyp11a1E1-loxP mice had a LoxP sequence inserted into
the first exon of Cyp11a1 causing a frame shift mutation
(Fig. 1A). These mice expressed no CYP11A1 in their ad-
A
B +/+ +/- -/-
Cyp11a1
Exon2
Exon1
WT
CYP11A1
+
E1-Neo
β-Actin
neo
100 28
E1-loxP -
0
6
3
*
0
Plasma
CORT. (ng/ml)
E
200
150
100
50
0
E18.5
D
Adrenal
CORT.
(ng/mouse)
9
10
8
6
4
2
0
*
*
#
E18.5
E19
*
WT
WT KO
*
E18.5
WT
KO
KO
F
WT
KO
Adrenal
C
Plasma
P5 (ng/ml)
loxP
FIG. 1. Defective hormone secretion of CYP11A1 null embryos. A,
Diagrams of the Cyp11a1 alleles showing the insertion of the neo gene
or of the loxP site in the first exon in E1-Neo and E1-loxP, respectively.
B, Western blot analysis of E18.5 adrenal CYP11A1 from the wild-type
(WT) (⫹/⫹), heterozygous (⫹/⫺), or homozygous (⫺/⫺) Cyp11a1
mutant mice. C, Plasma levels of pregnenolone (P5) at E18.5 measured
by RIA are shown as mean ⫾ SEM [*, P ⫽ 0.002 vs. control littermates;
WT, n ⫽ 5; knockout (KO), n ⫽ 4]. D, Tissue levels of corticosterone
(CORT.) in E18.5 adrenal measure by RIA are shown as mean ⫾ SEM (*,
P ⫽ 0.03 vs. control littermates; WT, n ⫽ 4; KO, n ⫽ 5). E, Plasma
levels of corticosterone at E18.5 (WT, n ⫽ 15; KO, n ⫽ 10) and E19
(WT, n ⫽ 11; KO, n ⫽ 10) measured by RIA are shown as mean ⫾ SEM
(*, P ⫽ 0.001; #, P ⫽ 0.02). F, Transmission electron micrographs of
mitochondria in adrenocortical cells at E17.5.
4751
renals at embryonic d 18.5 (E18.5) (Fig. 1B). Their plasma
pregnenolone (Fig. 1C) and adrenal corticosterone (Fig.
1D) levels were greatly reduced, indicative of the defect in
de novo steroid synthesis at the embryonic stage. The resulting mice survived throughout gestation but died after
birth.
The survival of these knockout mice during gestation
indicates that some steroids are present to sustain their life.
Indeed, we detected appreciable although lower amounts
of corticosterone, the major mouse glucocorticoid, in the
plasma of knockout mice at both E18.5 (morning) and
E19 (evening) (Fig. 1E). Because the knockout adrenal
synthesized no corticosterone (Fig. 1D), the corticosterone
detected in their plasma should all come from the maternal
supply. Thus, the transplacental corticosterone appeared
to be the major source of corticosterone in fetal circulation. The decrease of plasma corticosterone also indicates
that these knockout mice suffer from mild steroid deficiency even at the embryonic stage.
Disorganized embryonic Cyp11a1 null adrenals
The mitochondria from the zona fasciculata of E17.5
adrenal were examined by electron microscopy. Wild-type
mitochondria appeared tubulo-vesicular, indicating these
mitochondria were functional with steroidogenic activity
(Fig. 1F). The null mitochondria, on the contrary, contained only a few stalks and lacked discernable cisternae
(Fig. 1F). This indicates that mitochondrial abnormality
existed even in the fetal stage.
We examined histology of the fetal adrenal at different
developmental stages. At E14.5, both wild-type and null
adrenals were composed of cells with no distinct features,
and no recognizable difference was observed (Fig. 2, A and
B). In E16.5 wild-type adrenal, the medulla was easily
recognized inside the cortex, and a preliminary zonation
of adrenal cortex was observed (Fig. 2C). However, in null
mice, the adrenals appeared disorganized, and separation
of the cortex and the medulla was not recognized (Fig.
2D). At E18.5, vacuolated cytoplasm was present in the
adrenocortical cells of Cyp11a1 null mice (Fig. 2, E and F).
We examined the growth of the fetal adrenal by histological staining of PCNA, a cell proliferation marker. In
the wild-type adrenal, PCNA staining was located in the
cortex at E16.5 and was further restricted to the outer
periphery of the adrenal at E18.5 (Fig. 2, G and I). In the
null adrenal, PCNA positive signals were evident but were
randomly distributed at E16.5 (Fig. 2H) and E18.5 (Fig.
2J). This indicates that the defect in the Cyp11a1 null mice
affects the distribution, but not the proliferation, of the
cortical cells.
Huang et al.
Fetal Glucocorticoid Synthesis and Development
WT
WT
KO
E14.5
E16.5
KO
Endocrinology, October 2012, 153(10):4749 – 4756
G
H
I
J
PCNA
4752
B
H&E
E16.5
E18.5
A
In the null adrenal, oil droplets appeared normal at E16.5 (Fig. 2L) but
were much larger and randomly distributed in the adrenal at E18.5 (Fig.
2N). This severe oil accumulation parallels the appearance of foamy adrenal
observed in H&E staining. Thus, the
defect of lipid accumulation already occurred during the embryonic stage.
E16.5
E18.5
E16.5
E18.5
Oil Red O
Cyp11a1 null adrenal lacks
adrenergic chromaffin cells
D
C
The medulla of Cyp11a1 null adrenal was examined by immunohistoK
L
chemical staining of medullary markers
TH and PNMT. Both E16.5 and E18.5
null adrenals stained normally for TH
(Fig. 3, A–D). Because TH is the first
E
F
N
M
enzyme in the synthesis of catecholFIG. 2. Cyp11a1 null adrenal cells are disorganized and accumulate oil. A–F, H&E staining
amine in the medulla, this result sugwas performed on adrenal sections. G–J, Immunohistochemistry for PCNA was performed on
gests that TH-positive neural crest cells
adrenal sections. K–N, Oil Red O staining was performed on adrenal sections. Scale bars, 50
␮m. WT, Wild type; KO, knockout.
migrate into Cyp11a1 null adrenal
normally.
Contrary to TH expression, null adLipid accumulation in null adrenal
Cyp11a1-deficient adrenals accumulate foamy vacu- renals expressed no PNMT at E16.5 and E18.5, whereas
oles and lipid droplets at postnatal d 3 (11). We would like wild-type adrenal contained plenty of it (Fig. 3, E–H).
to follow the time course of oil accumulation in fetal ad- PNMT is a marker for adrenergic chromaffin cells; the
renals. Upon staining lipid with Oil Red O, mild oil drop- lack of PNMT expression indicates that the Cyp11a1 null
lets started to appear in the cortex of wild-type adrenal at adrenal contains no adrenergic chromaffin cells and thereE16.5 (Fig. 2K) and were more evident at E18.5 (Fig. 2M). fore cannot synthesize epinephrine. Indeed, epinephrine
was undetected in the Cyp11a1 null adrenal (n ⫽ 5) (Fig.
3I).
The level of norepinephrine was also reduced. MoreTH
PNMT
over,
Cyp11a1 null adrenal also reacted poorly in chroKO
WT
KO
WT
maffin reaction (Fig. 3, J and K), indicating that the null
medulla contains little catecholamine.
B
E
F
C
D
G
H
45
30
15
0
WT
KO
*
N.D.
Epi. Norepi.
Chromaffin
E18.5
I
ng/adrenal
E18.5
A
J
K
FIG. 3. Cyp11a1 null embryos fail to express medullary PNMT and
synthesize epinephrine. Immunohistochemistry for (A–D) TH (brown
staining) and (E–H) PNMT (brown staining) on adrenal sections. I,
Amount of epinephrine (Epi.) and norepinephrine (Norepi.) in E18.5
adrenal measured by HPLC are shown as mean ⫾ SD [wild type (WT),
n ⫽ 5; knockout (KO), n ⫽ 6]. J and K, Chromaffin reaction was
performed on E18.5 adrenals. N.D., Undetected. Scale bars, 50 ␮m.
Activated HPA axis in Cyp11a1 null fetus
In addition to the adrenal, we checked ACTH secretion
in the negative feedback suppression of glucocorticoid. In
the null fetus at E18.5, the plasma ACTH level was about
10-fold higher than that in the wild-type fetus (Fig. 4A).
This unsuppressed ACTH indicates that the negative feedback in null fetus is absent, even when an appreciable
amount of transplacental corticosterone was in the
circulation.
Besides plasma ACTH, the expression levels of pituitary Pomc, diencephalon Crh, and diencephalon Pomc,
as measured by real-time RT-PCR, were higher than those
of the wild-type control (Fig. 4B), indicating the HPA axis
in the null fetus is consistently activated. The expression
levels of other genes in the diencephalon, including MR,
GR, Ucn3, Crhr, and Avp, however, were not altered in
B
Plasma
ACTH (pg/ml)
A
300
**
200
100
0
WT KO
*
*
WT
KO
*
Pomc
Crh Pomc
Pituitary Diencephalon
WT
KO
1
0
MR
Diencephalon
1
*
0
Crhr GR
Pituitary
GR Ucn3 Crhr Avp
Diencephalon
Hsd11b1
WT
KO
E
CORT. (pg/tissue)
D
5
4
3
2
1
0
endo.endojournals.org
2
Relative RNA level
Relative RNA level
C
Relative RNA level
Endocrinology, October 2012, 153(10):4749 – 4756
Diencephalon
600
400
200
0
*
WT KO
FIG. 4. Unsuppressed HPA axis in Cyp11a1 null embryos. A, Plasma
levels of ACTH at E18.5 measured by RIA are shown as mean ⫾ SEM. B,
Relative RNA levels of Pomc and Crh at E18.5 measured by real-time
RT-PCR are shown as mean ⫾ SEM [pituitary Pomc: *, P ⬍ 0.01 vs.
control littermates; wild type (WT), n ⫽ 4; knockout (KO), n ⫽ 4;
diencephalon Crh: *, P ⫽ 0.04 vs. control littermates; WT, n ⫽ 6; KO,
n ⫽ 7; and diencephalon Pomc: **, P ⬍ 0.01 vs. control littermates;
WT, n ⫽ 6; KO, n ⫽ 7]. C, RNA levels of genes related to HPA axis
activity at E18.5 measured by real-time RT-PCR are shown as mean ⫾
SEM (diencephalon: WT, n ⫽ 6; KO, n ⫽ 6; pituitary: WT, n ⫽ 4; KO,
n ⫽ 4). D, Relative RNA levels of Hsd11b1 in E18.5 diencephalon
measured by real-time RT-PCR are shown as mean ⫾ SEM (*, P ⬍ 0.001
vs. control littermates; WT, n ⫽ 5; KO, n ⫽ 8). E, Tissue levels of
corticosterone (CORT.) in E18.5 diencephalon measured by RIA are
shown as mean ⫾ SEM (*, P ⫽ 0.01 vs. control littermates; WT, n ⫽ 4;
KO, n ⫽ 5).
Cyp11a1 null mice. Pituitary Crhr and GR were also unchanged (Fig. 4C).
Lower Hsd11b1 expression in Cyp11a1 null mice
brain
Besides the circulating corticosterone, the source of active corticosterone in the brain includes that converted
from the inactive 11-dehydrocorticosterone by HSD11B1
(13). The brain HSD11b1 expression was measured by
real-time RT-PCR (Fig. 4D) and found to be lower in the
null fetus than the wild type. Consistent with lower levels
of Hsd11b1, the corticosterone level in the diencephalon
was also much lower than that in the wild type (Fig. 4E).
Discussion
A mouse model of Cyp11a1 deficiency
In this report, we have characterized prenatal phenotypes of mice devoid of Cyp11a1. We show here that fetal
4753
glucocorticoid is important for the development of adrenal medulla and the establishment of HPA feedback suppression. The adrenal deficiency in Cyp11a1 null mice is
similar to those reported for human and rabbit Cyp11a1
deficiency (14 –22). Because human and rabbit Cyp11a1
deficiencies have not been characterized in details, our
mouse model may provide a means for detailed analysis of
the fetal glucocorticoid functions in the suppression of the
HPA axis.
Functions of fetal steroids vs. maternal steroids
Steroids in the fetal circulation are derived from two
sources: the mother and the fetus; yet the functions of
maternal vs. fetal steroids were never discerned. In this
study, we have evidence indicating that the maternal supply constitutes a major source of circulating corticosterone
that sustains gestation. Fetal secretion, on the other hand,
is important for proper development of the HPA feedback
loop and the differentiation of adrenal medullary adrenergic chromaffin cells. Thus, we can now distinguish the
functions of maternal vs. fetal steroids during
embryogenesis.
Unsuppressed HPA axis in Cyp11a1 null fetus
In this report, we show that Cyp11a1 null mice produce
unsuppressed ACTH in utero. It indicates that transplacental corticosterone, even though constituting the majority of the corticosterone supply in the fetal circulation,
is insufficient to suppress ACTH expression. It also proves
that the steroids synthesized de novo are required to suppress the HPA axis activity even before birth. This is consistent with the presence of multidrug-resistance gene
1-type P-glycoproteins as a natural blood-brain barrier
that controls the access of circulating corticosterone into
the brain (23). It confirms that the negative feedback loop
is already present at the fetal stage (1, 24). Our results,
however, do not mean that maternal corticosterone is not
important. When the circulating corticosterone is high
enough to saturate the blood-brain barrier, some of it will
leak into the brain exerting an effect.
In addition to those in the circulation, other sources of
steroids are also involved in the regulation of the HPA
axis. In the brain, neurosteroids are synthesized in situ in
response to stress, and this stress-induced neurosteroid
can negatively feedback the HPA axis (25). Here, we
showed that the expression of Hsd11b1 was reduced in
Cyp11a1 null mouse brain perhaps due to insufficient corticosterone, because Hsd11b1 can be up-regulated by glucocorticoids (26). This reduction of Hsd11b1 may lead to
lower amounts of active glucocorticoids in the brain.
Thus, besides the lack of neurosteroid production, decreased expression of Hsd11b1 may be the other cause for
4754
Huang et al.
Fetal Glucocorticoid Synthesis and Development
the reduction of active corticosterone and, thus, the uninhibited HPA axis.
It is interesting that Crh mRNA in Cyp11a1 null mice
was mildly increased by only 1.5-fold, but Pomc mRNA
and ACTH levels were greatly increased by 3- and 10-fold,
respectively. This indicates that only a little CRH can induce high Pomc expression, similar to the earlier observation in stressed rats with mild increase in CRH but high
Pomc induction (27). GRdim/dim mice, whose glucocorticoid receptor (GR) cannot dimerize, also have unaffected
CRH but increased Pomc levels (28). This demonstrates
that the effect of ACTH in the pituitary may be amplified
by CRH in the hypothalamus.
The link of cortex and medulla during adrenal
development
Cyp11a1 null mice have degenerating adrenal cortex
and improper medulla differentiation. These defects were
also observed in mice with a homozygous disruption of the
StAR, Cyp21, Crhr1, and GR genes, heterozygous for Sf1,
and conditionally mutated for GR (29 –34). Cyp11a1 and
StAR null mice are most similar in their adrenal phenotypes; both are deficient in glucocorticoid secretion and
accumulate lipid droplets in their adrenals. The accumulated lipid is most likely cholesterol ester, because free
cholesterol stained by Filipin was not increased in
Cyp11a1 null adrenals (Supplemental Fig. 1, published on
The Endocrine Society’s Journals Online web site at
http://endo.endojournals.org).
We find that the level of norepinephrin is reduced in
Cyp11a1 null mice. This is similar to the case of GR null
mice (29), which also contain reduced levels of norepinephrine and no epinephrine. The lack of epinephrine is
due to the absence of adrenergic cells. Because these adrenergic cells also produce some norepinephrine, their absence leads to decreased norepinephrine levels in the GR
and Cyp11a1 knockout adrenals.
Although Cyp11a1 and GR null mice have similar adrenal medullary defects, there are differences between
them. Mutations of GR block both maternal and fetal
corticosteroid response, but Cyp11a1 null mice can still
respond to maternal corticosterone, because they have
normal GR. Thus, the phenotypes in Cyp11a1 null embryos
do not represent total corticosterone deficiency, but they
manifest the absence of fetal corticosterone. Cyp11a1 null
embryos enable the distinction between maternal and fetal
steroid supply, and it proves that de novo synthesized fetal
corticosterone is responsible for medulla development.
The regulation of the medulla by the glucocorticoid
secreted from the cortex is likely based on the relative
location of these two tissues. The adrenal is a vascular
organ. In rats, adrenals typically comprise around 0.02%
Endocrinology, October 2012, 153(10):4749 – 4756
of the total body weight but receive approximately 0.14%
of the cardiac output (35). The sinusoids are arranged as
a network in the cortex continuing to the medulla. The
blood supply by this sinusoid network runs from the cortex to the medulla. Thus, the medullary cells receive a
steroid-rich blood supply. In the hypophysectomized rat,
medullary Pnmt expression requires relatively high circulating glucocorticoid (4, 36). The Cyp11a1 null fetus further provides strong evidence that Pnmt expression during
development depends on vicinal glucocorticoid directly
supplied by the adrenal either through the sinusoid network or a paracrine mechanism (35, 38). Maternal glucocorticoids, on the other hand, are also required for the
differentiation of adrenal medulla, because mice born
from adrenalectomized mother lacking maternal corticosterone have reduced catecholamine (7).
Mitochondrial structure is indicative of the activity of
a steroidogenic cell (39). The number of cristae in the mitochondria is reduced in StAR null mice (37). We detected
mitochondria defect in Cyp11a1-deficient mice as early as
E9.5 in placenta (data not shown), in E18.5 adrenal, and
also in a mild Cyp11a1 promoter mutant as late as 18wk-old adrenal glands (40). Thus, mitochondria appear
defective as soon as cells encounter Cyp11a1 deficiency
when they differentiate into steroidogenic cells.
Adrenal growth and lipid accumulation
Lipoid congenital adrenal hyperplasia patients or mice
with mutated StAR or Cyp11a1 have larger adrenals that
accumulate lipid aberrantly (11, 34, 41, 42). We have analyzed pathogenesis in Cyp11a1 null fetal adrenals and
showed that lipid accumulation started at E16.5 and became progressively worse. About one-half of the adrenal
was already smaller at E18.5 (data not shown). Thus, lipid
starts to accumulate in the adrenocortical cells, leading to
their degeneration soon after these cells are differentiated.
Besides lipid, ACTH may also affect adrenal growth.
Disruption of the ACTH receptor gene, Mc2r, results in
the atrophy of adrenal zona fasciculata and thickening of
the capsule, the adrenal stem/progenitor, in the adulthood
(43). The adrenal cortex secretes Sonic Hedgehog, which
stimulates the growth of the capsule starting from the embryonic stages (44, 45). It is unclear whether ACTH can
control the growth of adrenal capsule by modulating Sonic
Hedgehog secretion from the cortex. Our preliminary data
showed that Cyp11a1 null adrenals expressed less Shh
than the wild type (Supplemental Fig. 2). Because
Cyp11a1 null embryos have hypoplastic adrenal but excess prenatal ACTH, it will be a good tool to the study of
adrenal stem/progenitor cells.
Endocrinology, October 2012, 153(10):4749 – 4756
endo.endojournals.org
Acknowledgments
We thank Dr. Yu-Yao Huang in Chang-Gung Memorial Hospital for the epinephrine and norepinephrine HPLC assays, ShuJan Chou for excellent technical assistant, and Shu-Ping Lee for
assistance in the use of electron microscope.
Address all correspondence and requests for reprints to: Dr.
Bon-chu Chung, Institute of Molecular Biology, Academia Sinica, Taipei 115, Taiwan. E-mail: [email protected].
Present address for C.-C.J.H.: National Institute of Diabetes
and Digestive and Kidney Diseases, National Institutes of
Health, Bethesda, Maryland 20892.
Present address for M.-C.M.S.: Cancer and Stem Cell Biology
Program, Duke-National University of Singapore Graduate
Medical School, Singapore 169857, Singapore.
This work was supported by the Academia Sinica Grants
AS92IMB4PP and NHRI-EX101-9710SI and the National Science Council Grant NSC100-2321-B-001-006).
Disclosure Summary: The authors have nothing to disclose.
References
1. Matthews SG 2002 Early programming of the hypothalamo-pituitary-adrenal axis. Trends Endocrinol Metab 13:373–380
2. Kvetnanský R, Pacák K, Fukuhara K, Viskupic E, Hiremagalur B,
Nankova B, Goldstein DS, Sabban EL, Kopin IJ 1995 Sympathoadrenal system in stress. Interaction with the hypothalamic-pituitaryadrenocortical system. Ann NY Acad Sci 771:131–158
3. Evinger MJ, Towle AC, Park DH, Lee P, Joh TH 1992 Glucocorticoids stimulate transcription of the rat phenylethanolamine Nmethyltransferase (PNMT) gene in vivo and in vitro. Cell Mol Neurobiol 12:193–215
4. Wong DL, Lesage A, Siddall B, Funder JW 1992 Glucocorticoid
regulation of phenylethanolamine N-methyltransferase in vivo.
FASEB J 6:3310 –3315
5. Huber K 2006 The sympathoadrenal cell lineage: specification, diversification, and new perspectives. Dev Biol 298:335–343
6. Mulay S, Solomon S 1992 Adrenal cortical function during pregnancy. In: James VT, ed. The adrenal gland. 2nd ed. New York:
Raven Press; 105–116
7. Leret ML, Peinado V, González JC, Suárez LM, Rúa C 2004 Maternal adrenalectomy affects development of adrenal medulla. Life
Sci 74:1861–1867
8. Komatsu S, Yamamoto M, Arishima K, Eguchi Y 1998 Maternal
adrenocortical hormones maintain the early development of pancreatic B cells in the fetal rat. J Anat 193(Pt 4):551–557
9. Arahuetes RM, Carretero V, Diebold Y, Rua C 1991 Effects of
maternal bilateral adrenalectomy and betamethasone administration on fetal rat encephalic development. Biol Neonate 59:303–313
10. Venihaki M, Carrigan A, Dikkes P, Majzoub JA 2000 Circadian rise
in maternal glucocorticoid prevents pulmonary dysplasia in fetal
mice with adrenal insufficiency. Proc Natl Acad Sci USA 97:7336 –
7341
11. Hu MC, Hsu NC, El Hadj NB, Pai CI, Chu HP, Wang CK, Chung
BC 2002 Steroid deficiency syndromes in mice with targeted disruption of Cyp11a1. Mol Endocrinol 16:1943–1950
12. Lakso M, Pichel JG, Gorman JR, Sauer B, Okamoto Y, Lee E, Alt
FW, Westphal H 1996 Efficient in vivo manipulation of mouse
genomic sequences at the zygote stage. Proc Natl Acad Sci USA
93:5860 –5865
13. Harris HJ, Kotelevtsev Y, Mullins JJ, Seckl JR, Holmes MC 2001
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
4755
Intracellular regeneration of glucocorticoids by 11␤-hydroxysteroid
dehydrogenase (11␤-HSD)-1 plays a key role in regulation of the
hypothalamic-pituitary-adrenal axis: analysis of 11␤-HSD-1-deficient mice. Endocrinology 142:114 –120
Kim CJ, Lin L, Huang N, Quigley CA, AvRuskin TW, Achermann
JC, Miller WL 2008 Severe combined adrenal and gonadal deficiency caused by novel mutations in the cholesterol side chain cleavage enzyme, P450scc. J Clin Endocrinol Metab 93:696 –702
Hiort O, Holterhus PM, Werner R, Marschke C, Hoppe U, Partsch
CJ, Riepe FG, Achermann JC, Struve D 2005 Homozygous disruption of P450 side-chain cleavage (CYP11A1) is associated with prematurity, complete 46,XY sex reversal, and severe adrenal failure.
J Clin Endocrinol Metab 90:538 –541
Tajima T, Fujieda K, Kouda N, Nakae J, Miller WL 2001 Heterozygous mutation in the cholesterol side chain cleavage enzyme
(p450scc) gene in a patient with 46,XY sex reversal and adrenal
insufficiency. J Clin Endocrinol Metab 86:3820 –3825
Katsumata N, Ohtake M, Hojo T, Ogawa E, Hara T, Sato N,
Tanaka T 2002 Compound heterozygous mutations in the cholesterol side-chain cleavage enzyme gene (CYP11A) cause congenital
adrenal insufficiency in humans. J Clin Endocrinol Metab 87:3808 –
3813
al Kandari H, Katsumata N, Alexander S, Rasoul MA 2006 Homozygous mutation of P450 side-chain cleavage enzyme gene
(CYP11A1) in 46, XY patient with adrenal insufficiency, complete
sex reversal, and agenesis of corpus callosum. J Clin Endocrinol
Metab 91:2821–2826
Rubtsov P, Karmanov M, Sverdlova P, Spirin P, Tiulpakov A 2009
A novel homozygous mutation in CYP11A1 gene is associated with
late-onset adrenal insufficiency and hypospadias in a 46,XY patient.
J Clin Endocrinol Metab 94:936 –939
Parajes S, Kamrath C, Rose IT, Taylor AE, Mooij CF, Dhir V, Grötzinger J, Arlt W, Krone N 2011 A novel entity of clinically isolated
adrenal insufficiency caused by a partially inactivating mutation of
the gene encoding for P450 side chain cleavage enzyme (CYP11A1).
J Clin Endocrinol Metab 96:E1798 –E1806
Yang X, Iwamoto K, Wang M, Artwohl J, Mason JI, Pang S 1993
Inherited congenital adrenal hyperplasia in the rabbit is caused by a
deletion in the gene encoding cytochrome P450 cholesterol sidechain cleavage enzyme. Endocrinology 132:1977–1982
Pang S, Yang X, Wang M, Tissot R, Nino M, Manaligod J, Bullock
LP, Mason JI 1992 Inherited congenital adrenal hyperplasia in the
rabbit: absent cholesterol side-chain cleavage cytochrome P450 gene
expression. Endocrinology 131:181–186
Uhr M, Holsboer F, Müller MB 2002 Penetration of endogenous
steroid hormones corticosterone, cortisol, aldosterone and progesterone into the brain is enhanced in mice deficient for both mdr1a
and mdr1b P-glycoproteins. J Neuroendocrinol 14:753–759
Henry C, Kabbaj M, Simon H, Le Moal M, Maccari S 1994 Prenatal
stress increases the hypothalamo-pituitary-adrenal axis response in
young and adult rats. J Neuroendocrinol 6:341–345
Purdy RH, Morrow AL, Moore Jr PH, Paul SM 1991 Stress-induced
elevations of ␥-aminobutyric acid type A receptor-active steroids in
the rat brain. Proc Natl Acad Sci USA 88:4553– 4557
Low SC, Moisan MP, Noble JM, Edwards CR, Seckl JR 1994 Glucocorticoids regulate hippocampal 11 ␤-hydroxysteroid dehydrogenase activity and gene expression in vivo in the rat. J Neuroendocrinol 6:285–290
Makino S, Smith MA, Gold PW 1995 Increased expression of corticotropin-releasing hormone and vasopressin messenger ribonucleic acid (mRNA) in the hypothalamic paraventricular nucleus during repeated stress: association with reduction in glucocorticoid
receptor mRNA levels. Endocrinology 136:3299 –3309
Reichardt HM, Kaestner KH, Tuckermann J, Kretz O, Wessely O,
Bock R, Gass P, Schmid W, Herrlich P, Angel P, Schütz G 1998 DNA
binding of the glucocorticoid receptor is not essential for survival.
Cell 93:531–541
4756
Huang et al.
Fetal Glucocorticoid Synthesis and Development
29. Cole TJ, Blendy JA, Monaghan AP, Krieglstein K, Schmid W, Aguzzi
A, Fantuzzi G, Hummler E, Unsicker K, Schütz G 1995 Targeted
disruption of the glucocorticoid receptor gene blocks adrenergic
chromaffin cell development and severely retards lung maturation.
Genes Dev 9:1608 –1621
30. Bornstein SR, Tajima T, Eisenhofer G, Haidan A, Aguilera G 1999
Adrenomedullary function is severely impaired in 21-hydroxylasedeficient mice. FASEB J 13:1185–1194
31. Bland ML, Jamieson CA, Akana SF, Bornstein SR, Eisenhofer G,
Dallman MF, Ingraham HA 2000 Haploinsufficiency of steroidogenic factor-1 in mice disrupts adrenal development leading to an
impaired stress response. Proc Natl Acad Sci USA 97:14488 –14493
32. Yoshida-Hiroi M, Bradbury MJ, Eisenhofer G, Hiroi N, Vale WW,
Novotny GE, Hartwig HG, Scherbaum WA, Bornstein SR 2002
Chromaffin cell function and structure is impaired in corticotropinreleasing hormone receptor type 1-null mice. Mol Psychiatry 7:967–
974
33. Parlato R, Otto C, Tuckermann J, Stotz S, Kaden S, Gröne HJ,
Unsicker K, Schütz G 2009 Conditional inactivation of glucocorticoid receptor gene in dopamine-␤-hydroxylase cells impairs chromaffin cell survival. Endocrinology 150:1775–1781
34. Caron KM, Soo SC, Wetsel WC, Stocco DM, Clark BJ, Parker KL
1997 Targeted disruption of the mouse gene encoding steroidogenic
acute regulatory protein provides insights into congenital lipoid adrenal hyperplasia. Proc Natl Acad Sci USA 94:11540 –11545
35. Vinson GP, Hinson JP 1992 Blood flow and hormone secretion in
the adrenal gland. In: James VT, ed. The adrenal gland. 2nd ed. New
York: Raven Press; 71– 86
36. Wurtman RJ 1966 Control of epinephrine synthesis in the adrenal
medulla by the adrenal cortex: hormonal specificity and dose-response characteristics. Endocrinology 79:608 – 614
Endocrinology, October 2012, 153(10):4749 – 4756
37. Ishii T, Hasegawa T, Pai CI, Yvgi-Ohana N, Timberg R, Zhao L,
Majdic G, Chung BC, Orly J, Parker KL 2002 The roles of circulating high-density lipoproteins and trophic hormones in the phenotype of knockout mice lacking the steroidogenic acute regulatory
protein. Mol Endocrinol 16:2297–2309
38. Huang CC, Liu C, Yao HH 2012 Investigating the role of adrenal
cortex in organization and differentiation of the adrenal medulla in
mice. Mol Cell Endocrinol 361:165–171
39. Webb PD 1980 Development of the adrenal cortex in the fetal sheep:
an ultrastructural study. J Dev Physiol 2:161–181
40. Shih MC, Hsu NC, Huang CC, Wu TS, Lai PY, Chung BC 2008
Mutation of mouse Cyp11a1 promoter caused tissue-specific reduction of gene expression and blunted stress response without affecting
reproduction. Mol Endocrinol 22:915–923
41. Fujieda K, Okuhara K, Abe S, Tajima T, Mukai T, Nakae J 2003
Molecular pathogenesis of lipoid adrenal hyperplasia and adrenal
hypoplasia congenita. J Steroid Biochem Mol Biol 85:483– 489
42. Hasegawa T, Zhao L, Caron KM, Majdic G, Suzuki T, Shizawa S,
Sasano H, Parker KL 2000 Developmental roles of the steroidogenic
acute regulatory protein (StAR) as revealed by StAR knockout mice.
Mol Endocrinol 14:1462–1471
43. Chida D, Nakagawa S, Nagai S, Sagara H, Katsumata H, Imaki T,
Suzuki H, Mitani F, Ogishima T, Shimizu C, Kotaki H, Kakuta S,
Sudo K, Koike T, Kubo M, Iwakura Y 2007 Melanocortin 2 receptor
is required for adrenal gland development, steroidogenesis, and neonatal gluconeogenesis. Proc Natl Acad Sci USA 104:18205–18210
44. Huang CC, Miyagawa S, Matsumaru D, Parker KL, Yao HH 2010
Progenitor cell expansion and organ size of mouse adrenal is regulated by sonic hedgehog. Endocrinology 151:1119 –1128
45. King P, Paul A, Laufer E 2009 Shh signaling regulates adrenocortical
development and identifies progenitors of steroidogenic lineages.
Proc Natl Acad Sci USA 106:21185–21190