Chem. Senses 35: 239–245, 2010
doi:10.1093/chemse/bjq007
Advance Access publication January 25, 2010
Tmem16b is Specifically Expressed in the Cilia of Olfactory Sensory Neurons
Sebastian Rasche1, Bastian Toetter1, Jenny Adler2, Astrid Tschapek2, Julia F. Doerner1,
Stefan Kurtenbach1, Hanns Hatt1, Helmut Meyer2, Bettina Warscheid2 and Eva M. Neuhaus3
1
Department of Cell Physiology, Ruhr-University Bochum, Universitaetsstrasse 150, 44780
Bochum, Germany, 2Medical Proteome Center, Ruhr-University Bochum, Universitaetsstrasse
150, 44780 Bochum, Germany and 3NeuroScience Research Center, Charité, Charitéplatz 1,
10117 Berlin, Germany
Correspondence to be sent to: Eva M. Neuhaus, NeuroScience Research Center, Charité, Universitätsmedizin Berlin, 10117 Berlin, Germany.
e-mail: [email protected]
Accepted January 7, 2010
Abstract
Calcium-activated chloride channels (CaCCs) are involved in many physiological processes, including sensory signal
transduction, but only little is known to date about their structure and function. We performed a proteome analysis of the
olfactory epithelium (OE) membrane proteome and identified so far uncharacterized membrane proteins as candidate
channels. One of the most abundant membrane proteins in olfactory sensory neurons (OSNs) was Tmem16b, a member of
a recently identified family of CaCCs. In addition to former studies performed on Tmem16b, we show here that Tmem16b
expression is highly specific for the OE, in contrast to the closely related Tmem16a, which shows a broad expression pattern in
secretory epithelial cells. Native Tmem16b is localized in the cilia of the OSNs, which is in agreement with previous
electrophysiological recordings.
Key words: chloride channel, proteomics, signal transduction, Tmem16b
Introduction
The responses of olfactory sensory neurons (OSNs) to odorant stimuli consist of 2 main currents, a small Ca2+ influx
mediated by cyclic nucleotide gated (CNG) channels and
a strong Cl– efflux, that is mediated by a calcium-activated
chloride channel (CaCC). This CaCC belongs to the family
of chloride channels that are regulated by the cytosolic Ca2+
concentration. The membrane conductance induced by this
CaCC is large enough to profoundly affect electrical excitability of the neurons (Frings et al. 2000; Reisert et al.
2005), and the channel was shown to be expressed in the cilia
of OSNs by electrophysiological methods. The molecular
identity of this channel was unknown for long time.
Bestrophin-2 has been described as a candidate (Pifferi et al.
2006), but bestrophin-2 knockout mice showed neither deficits in a behavioral assay of olfactory function (Bakall et al.
2008) nor significantly different responses to odorant stimuli
compared with wild type mice (Pifferi et al. 2009).
Recently, a new protein family of CaCCs, the anoctamin/
Tmem16 family, has been described (Caputo et al. 2008;
Schroeder et al. 2008; Yang et al. 2008). Expression of these
genes was previously found to be implicated in gnathodiaphy-
seal dysplasia (Tsutsumi et al. 2005) and in some forms of cancer (Huang et al. 2006), but their function was unknown. The
Tmem16 family members have 8 predicted transmembrane
segments and a conserved C-terminal domain of unknown
function named DUF590. Tmem16a, the first characterized
family member, has been shown to be activated by receptors
that elevate intracellular Ca2+ (Schroeder et al. 2008; Yang
et al. 2008) and by intracellular Ca2+ release mediated by photolysis of caged Inositol-1,4,5-trisphosphat (Schroeder et al.
2008; Yang et al. 2008). Tmem16a is expressed in many of
the tissues that are known to express CaCCs, such as
bronchiolar epithelial cells, pancreatic acinar cells, proximal
kidney tubule epithelium, retina, dorsal root ganglion sensory
neurons, and submandibular gland (Caputo et al. 2008;
Schroeder et al. 2008; Yang et al. 2008).
Tmem16b, a second member of the anoctamin/Tmem16
family, has also been shown to act as a CaCC (Schroeder
et al. 2008; Pifferi et al. 2009; Stephan et al. 2009; Stohr
et al. 2009). Interestingly, heterologously expressed
Tmem16b exhibits channel properties similar to the native
olfactory CaCC (Stephan et al. 2009), indicating a possible
ª The Author 2010. Published by Oxford University Press. All rights reserved.
For permissions, please e-mail: [email protected]
240 S. Rasche et al.
involvement of Tmem16b in the olfactory signal transduction
cascade. Although trafficking of an overexpressed Tmem16b::enhanced green fluorescent protein (EGFP) fusion protein
to olfactory cilia has been shown (Stephan et al. 2009), the
localization of endogenous Tmem16b in the olfactory epithelium (OE) and in other tissues is still unknown.
We performed quantitative proteomics analysis of the
membrane proteome of cilia preparation from OE and identified several so far unknown membrane proteins, among
them Tmem16b. We report here that endogenous Tmem16b
is specifically expressed in the cilia of OSNs and could detect
exactly the stoichiometry of CNG channel subunits and
Tmem16b to explain earlier electrophysiological results.
Materials and methods
Antibodies and chemicals
Acetonitrile (ACN) (high-performance liquid chromatography [HPLC]-S gradient grade) was purchased from Biosolve,
formic acid (FA) from J.T. Baker B.V., trifluoroacetic acid
from Merck, sequencing grade modified trypsin from
Promega, dextran T500 from Carl Roth, and polyethylenglycol (PEG) 3350 from Fluka. Anti-acetylated tubulin
antibody was from Sigma, anti-CNGA2 from Santa Cruz,
fluorescent secondary antibodies were from Invitrogen,
and horseradish peroxidase coupled secondary antibodies
were from Biorad. Tmem16b antibody was generated against
an epitope of the intracellular C-terminus with the following
unique sequence motif: VKLADEPTQRSQG, Rabbits were
immunized with peptides by Eurogentec.
Immunohistochemistry
Immunostaining was done on 10-lM coronal cryosections of
paraformaldehyde-fixed tissue on superfrost slides (Menzel),
HEK293 cells were grown on coverslips (80–100 lm; Menzel
Gläser) and fixed in paraformaldehyde. Sections and cells
were incubated with antibodies in phosphate-buffered saline/
gelatin/Triton X-100 and mounted in ProLong Antifade
(Molecular Probes). Fluorescence images were obtained with
a confocal microscope (Leica) and further processed with
Photoshop (Adobe Systems Inc.).
Preparation of plasma membranes and olfactory cilia from
mice
For cilia enrichment, the cilia were dislodged from the OE
using the calcium shock method, and 10 lg total protein
was subjected to 1-D polyacrylamide gel electrophoresis
(PAGE). In independently performed plasma membrane
preparations, mouse OE was homogenized using pestle
and mortar in an aqueous 2-phase system consisting of
6.3% (w/w) PEG, 6.3% (w/w) dextran, 15 mM Tris–H2SO4
pH 7.8, and 5 mM boric acid. Membrane proteins were incubated with 100 mM Na2CO3 (pH 11.5/4 C) for 15 min and
centrifuged. Ciliary and plasma membranes were solubilized in Laemmli buffer and applied to a 4–12% or 12%
Bis–Tris gels with a 3-(N-Morpholino)-Propansulfonsäure
buffer system (NUPAGE-Novex, Invitrogen).
SDS-PAGE and in-gel digestion
For proteomics analysis of ciliary membranes and plasma
membranes of the OE, sodium dodecyl sulfate (SDS)-gels
were stained by colloidal coomassie brilliant blue G-250.
The gel was equally cut in 2 mm slices. Gel bands were destained by alternately incubating them with 20 lL of 10 mM
ammonium hydrogencarbonate (NH4HCO3) and 20 lL of
5 mM NH4HCO3/50% ACN (v/v) for 10 min each. Gel pieces
were dried in vacuo, and proteins were digested in gel applying 2-lL trypsin solution (0.03 lg/lL trypsin in 10 mM
NH4HCO3, pH 7.8) overnight at 37 C. The resulting tryptic
peptides were extracted twice with 10 lL of 2.5% FA/50%
ACN (v/v); extracts were combined, dried in vacuo, and
eventually reconstituted in 15 lL of 5% FA/5% ACN (v/v).
Mass spectrometry
Tryptic digests were analyzed by nano HPLC/elektrosprayionisation (ESI)-mass spectrometry (MS)/MS using the UltiMate 3000 HPLC system (Dionex LC Packings) online
coupled to an linear trap quadrupole (LTQ) Orbitrap XL instrument (Thermo Fisher Scientific). Reversed-phase (RP)
capillary HPLC separations were performed as described previously (Schaefer et al. 2004) with slight modifications. In
brief, peptide mixtures were loaded onto 1 of 2 C18 l-precolumns (0.3 mm inner diameter [i.d.] · 5 mm; PepMap, Dionex
LC Packings) equilibrated in 0.1% (v/v) trifluoroacetic acid,
washed, and preconcentrated for 5 min with the same solvent
at a flow rate of 30 lL/min using the loading pump. The precolumn was then switched in line with a C18 RP nano LC
column (75 lm i.d. · 150 mm; PepMap, Dionex LC Packings).
For peptide separation, a binary solvent system consisting of
0.1% (v/v) FA (solvent A) and 0.1% (v/v) FA/84% (v/v) ACN
(solvent B) was applied. The gradient was as follows: 5–50%
solvent B in 40 min and 50–95% solvent B in 2 min; the nano
LC column was then washed for 3 min with 95% solvent B and
subsequently equilibrated for the next run with 5% solvent B
(20 min). The flow rate was 150 nL/min.
The LTQ Orbitrap XL instrument was equipped with
a nanoelectrospray ion source (Thermo Fisher Scientific)
and distal coated SilicaTips (FS360-20-10-D; New Objective). The instrument was externally calibrated using standard components, and lock masses were used for internal
calibration. Mass spectrometric parameters were as follows:
spray voltage, 1.7–2.0 kV; capillary voltage, 45 V; capillary
temperature, 200 C; and tube lens voltage, 100 V. For datadependent MS/MS analyses, the software XCalibur 2.0
SR 2 (Thermo Fisher Scientific) was used. MS spectra ranging from m/z 300 to 1500 were acquired in the Orbitrap at
a resolution of 30 000 (at m/z 400). Automatic gain control
Tmem16b Expression in Cilia of Olfactory Neurons 241
(AGC) was set to 5 · 105 ions and a maximum fill time of
750 ms. After a brief survey scan, the 4 most intense multiply
charged ions were selected for low energy collision-induced
dissociation in the linear ion trap concomitant with the completion of the MS scan in the Orbitrap. The AGC of the LTQ
was set to 10 000 ions and a maximum fill time of 100 ms.
Fragmentation was carried out at a normalized collision energy of 35% with an activation q = 0.25 and an activation
time of 30 ms. The fragmentation of previously selected precursor ions was dynamically excluded for the following 45 s.
Data analysis
Peaklists of MS/MS spectra were generated using the software tools Bioworks 3.1 SR 1 applying default parameters.
For peptide and protein identification, peaklists were
correlated with the mouse International Protein Index
(Mouse IPI v3.30.; Mouse IPI v3.54) (http://www.ebi.ac.uk)
MASCOT (release version 2.2.0) (Perkins et al. 1999). All
searches were performed with tryptic specificity allowing
2 missed cleavages, and oxidation of methionine and carbamidomethylation were set as variable modifications. Mass
spectra were searched with a mass tolerance of 3 ppm for
precursor ions and 0.6 Da for fragment ions. Cut-off scores
applied in this work provided highest number of protein
identifications on the basis of one peptide and a false discovery rate below 5% calculated as described (Stephan
et al. 2006; Wiese et al. 2007). Proteins were assembled
on the basis of peptide identifications using the ProteinExtractor Tool (version 1.0) in ProteinScape (version 1.3,
Bruker Daltonics) and sorted according to their identification scores. Subcellular localizations of proteins were determined via SwissProt (http://ca.expasy.org/) annotation.
Western blotting
For western blotting, 10 lg of protein was resolved by 8%
SDS-PAGE and transferred to nitrocellulose membrane
(Protran; Schleicher & Schuell). The nitrocellulose membranes were blocked and incubated with the antibodies diluted in 4% dry milk in tris-buffered saline with tween.
Detection was performed with ECL plus (Amersham) on
Hyperfilm ECL (Amersham).
Reverse transcriptase-polymerase chain reaction
RNA of different mouse tissues was isolated with Trizol
reagent (Invitrogen), digested with DNAseI (Fermentas),
and purified again with Trizol before isolation of polyA+
messenger RNA (mRNA) with oligo-dT-coated paramagnetic particles (Dynal). cDNA was synthesized by using
moloney murine leukemia virus reverse transcriptase (Invitrogen) and oligo (dT12-18) primer. Polymerase chain reaction (PCR) was performed with 2-ng template cDNA and
specific primer pairs for Tmem16 family members. The primers and expected sizes are given in Supplementary Table 3.
Cloning of full-length Tmem16b
Mouse Tmem16b was amplified from cDNA from OE by
PCR using the primer pair Tmem16b-Fwd (CATGCACTTTCACGACAACCAGAGGAAAGTC) and Tmem16b-Rev
(TCATACATTGGTGTGCTGGGACCCTG),whichamplify
the whole open reading frame (NM_153589). The generated
plasmid was verified by sequencing.
Cell culture and transfection
Reagents for cell culture use were purchased from Invitrogen.
HEK293 cells were maintained under standard conditions in
Minimum Essential Medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin and streptomycin, and
2 mM L-glutamine. HEK293 cell transfections with the
Tmem16b-containing plasmid were performed using a standard calcium phosphate precipitation technique.
Results
Mass spectrometry of OE membranes
We employed a highly sensitive (MS)-based proteomics
approach to get to quantitative information on the composition of the olfactory membrane proteome in mouse. In
total, 1453 and 818 proteins were reliably identified in
plasma membranes and ciliary membranes of mouse OE, respectively (Supplementary Tables S1 and S2). About half of
the proteins identified in both preparations are annotated as
integral membrane proteins comprising numerous proteins
with known functions in the olfactory signal transduction
cascade, such as adenylate cyclase III and CNGA2, CNGA4,
and cyclic nucleotide gated channel B1b (CNGB1b). Because
we readily identified membrane components that play key
roles in olfaction, we deemed our olfactory membrane proteomics survey to be a valuable tool for the identification
of new candidates of CaCCs. We consistently identified
3 proteins belonging to the Tmem16 family (Tmem16a,
Tmem16b, and Tmem16f) in both plasma and ciliary membranes of the mouse OE. In addition, we identified
membrane proteins for which no functional annotations
have been described yet (Tmem30a, 33, 111, 205, 109, and
Tmem43). Tmem16a and Tmem16b, also referred to as
Anoctamin1 and 2, were reported as bona fide CaCC
(Caputo et al. 2008; Schroeder et al. 2008; Yang et al.
2008; Pifferi et al. 2009; Stohr et al. 2009), and Tmem16b
(Anoctamin2) has recently been proposed as the CaCC in
OSNs (Stephan et al. 2009). Furthermore, we identified 2
additional proteins of the Tmem16 family, Tmem16f and
Tmem16k, in olfactory membranes. In addition to former
mass spectrometric analysis of the cilia of olfactory neurons
in rats (Mayer et al. 2008) and mice (Stephan et al. 2009),
we semiquantitatively evaluated the relative abundance of
Tmem16 proteins in olfactory membranes on the basis of
spectral counts, which reflects the fact that higher abundance
242 S. Rasche et al.
proteins are sampled more frequently (Liu et al. 2004).
Tmem16b is significantly more abundant than Tmem16a
and about 2-fold more abundant than CNGA2
(Figure 1A). Spectral counts for CNGA2 (39,42), CNGB1b
(10,9), and CNGA4 (13,27) were in relative agreement with
the 2:1:1 ratio expected for the 3 channel subunits, showing
the validity of the quantitative analysis. Abundance of
Tmem16f in olfactory membranes appeared to be comparable with the abundance of Tmem16a, whereas Tmem16k was
detected in ciliary membranes only. To additionally verify expression of Tmem16b in the mature sensory neurons of the
epithelium, we performed reverse transcriptase-PCR
(RT-PCR) with fluorescence-activated cell sorting (FACS)
sorted OSNs from olfactory marker protein (OMP) green
fluorescent protein (GFP) mice (Potter et al. 2001) (Supplementary Figure 1A) and in situ hybridization with OE cryosections (Supplementary Figure 1B), which were in direct
agreement with former studies (Stephan et al. 2009).
These data demonstrate that Tmem16b protein is present
in adequate amounts in the cilia of OSNs to fulfill the known
function in the olfactory signal transduction cascade.
Expression of Tmem16 family members in OE
To analyze and validate expression of all Tmem16 family
members, we performed RT-PCR with OE mRNA using intron-spanning primer pairs that specifically detect the different Tmem16 proteins (Figure 1B). As positive control, we
prepared mRNA from tissues where the respective Tmem16
family member is known to be expressed or where we could
detect expression by RT-PCR. Similar results were obtained
as in the proteomics approach, Tmem16b was robustly detected, and in addition, we detected Tmem16a, f, and k
mRNAs.
Tmem16b is expressed in the cilia of mature olfactory
neurons
The Tmem16b::EGFP fusion protein was shown to traffic to
olfactory cilia (Stephan et al. 2009), but the localization of
the endogenous channel in the OSNs still needs to be determined. To analyze the subcellular localization, we generated
an antibody against an intracellular epitope, which is unique
for Tmem16b (Supplementary Figure 2). The antibody
specifically stains recombinantly expressed Tmem16b in
HEK293 cells, without major background staining of the
untransfected cells, and detected recombinantly expressed
Tmem16b by western blotting (Supplementary Figure 2).
Moreover, no band was detected in tissues expressing Tmem16a, such as lung (Figure 3), indicating specificity of the
antibody for Tmem16b.
Using this antibody, we could show that the protein is
highly enriched in the cilia of OSNs because Tmem16b
showed nearly complete colocalization in cryosections of
OMP-GFP mice with marker proteins for olfactory cilia
such as acetylated tubulin and CNGA2 (Figure 2A).
Figure 1 Expression of Tmem16 family members in the OE. (A) Semiquantitative evaluation of the relative abundance of Tmem16 family members, as well
as CNGA2, CNGA4, CNGB1b, and ACIII in olfactory plasma membranes (black bars) and olfactory cilia preparations (gray bars) on the basis of spectral counts,
the data are contained in Supplementary Tables S1 and S2. (B) RT-PCR analysis of Tmem16 family member expression in the OE, different reference tissue
samples and negative control (water) using intron-spanning primer pairs.
Tmem16b Expression in Cilia of Olfactory Neurons 243
Figure 2 Tmem16b is expressed in the cilia of OSNs. (A) Colocalization of
Tmem16b (red) with acetylated tubulin and CNGA2 (blue) in cryosections of
OMP-GFP transgenic mice, mature neurons are green in the overlay.
(B) Tmem16b (red) and CNGA2 (blue) expression is restricted to the sensory
part of the OE, in which mature neurons appear in green. (C) Detection of
Tmem16b in membrane preparations of OE and cilia enriched fractions (cilia)
by western blotting. Equal amounts of total protein were loaded in both
lanes. Scale Bar = 10 lm.
Loading of equal protein amounts resulted in strong bands
in the cilia fraction compared with whole OE (Figure 2C).
Increased detection time also allowed the detection of the
Tmem16b in lysates from complete OE (Figure 3). From
western blotting we could furthermore deduce that
Tmem16b seems to be highly glycosylated in the ciliary
compartment (Figure 2C), which is in accordance to recent
work in the retina (Stohr et al. 2009) where Tmem16b also
showed diffuse banding pattern. Moreover, Tmem16b was
only expressed in the sensory part of the nasal epithelium
because staining was restricted to the part of the epithelium
where OMP and CNGA2 positive neurons were present
(Figure 2B).
Figure 3 Tmem16b shows highest expression level in the main OE. (A)
Localization of Tmem16b in membrane preparations of different tissues by
western blotting, equal amounts of total protein was loaded for the different
tissues. Each experiment was performed at least 3 times. Asterisks denote
weak bands detected in the vomeronasal organ. (B) Tmem16b (red) expression
in the sensory microvilli of vomeronasal neurons. Scale Bar = 20 lm.
Tmem16b is specifically expressed in the OE
Tmem16a was found in a multitude of tissues where secretory epithelial cells are present, in sensory cells and in the
retina (Schroeder et al. 2008; Yang et al. 2008). We therefore
determined whether Tmem16b also shows a ubiquitous expression pattern or whether expression is specific for certain
tissues. Significant expression could only be detected in OE,
olfactory bulb, eye, and brain. In membrane preparations of
different tissues, such as kidney, liver, testis, trachea, lung,
tongue, spleen, heart, intestine, and skeletal muscle we did
244 S. Rasche et al.
not detect Tmem16b in similar amounts as in the OE
(Figure 3). The major band in the retina membrane preparations had only a size of approximately 50 kD, whereas the
major isoform in the OE had the expected size of 110 kD.
Whether the lower molecular weight isoform detected in retina
presents a functional ion channel is unclear; a higher molecular
weight band as reported (Stohr et al. 2009) can also be detected. Other sensory tissues do not seem to express Tmem16b
because it was not detectable from trigeminal or dorsal root
ganglia (Figure 3). Tmem16b can be detected in the vomeronasal organ from male and female mice, but at much lower
expression levels than in the main OE (Figure 3 and Supplementary Figure 3). Immunostainings of cryosections from the
vomeronasal organ showed Tmem16b expression in the sensory microvilli of the sensory neurons (Figure 3B).
Discussion
Using semiquantitative proteomics and immunodetection
we show here that Tmem16b, recently proposed as candidate
CaCC in the olfactory system (Stephan et al. 2009), is present
in the right amount and at the right location to fulfill its wellknown function in the olfactory signal transduction cascade.
Using a highly sensitive proteomics approach allowed us to
semiquantitatively analyze the membrane proteome of cilia
from OSNs. Among the identified proteins were members of
a novel family of CaCCs (Tmem16a, Tmem16b, Tmem16f,
and Tmem16k). Although Tmem16b was detected in proteomic analysis of olfactory cilia membranes previously (Mayer
et al. 2008; Stephan et al. 2009), it was unclear whether it is
expressed in proper amounts to serve as CaCC in olfactory
signal transduction. Performing a semiquantitative analysis
of the relative abundance of membrane proteins in olfactory
membranes on the basis of spectral counts (Liu et al. 2004),
we found Tmem16b to be one of the most abundant membrane proteins in the OE. It is expressed in notably higher
expression levels than the other Tmem16 family members.
Tmem16b was found to be nearly twice as abundant as
the CNGA2 subunit, and approximately 3-fold higher expressed than CNGA4 and ;8-fold higher than CNGB1b.
This is consistent with the fact that the maximum Cl– current
is greater than the maximum CNG current by a factor of 33
(Reisert et al. 2003). Based on physiological experiments,
it was estimated that Cl– channels in rat are in excess by a
factor of 8 compared with CNG channels (Reisert et al.
2003), which is in the same order of magnitude as the
Tmem16b:CNGB1b ratio we found in our experiments.
Tmem16b is therefore present in a proper amount in olfactory membranes to be a likely candidate as olfactory CaCC.
Consistent with this estimate is our observation that the protein is readily present in the cilia of OSNs, similar as the
CNGA2 channel subunit.
Functional studies on recombinantly expressed Tmem16b
in HEK293 cells indicated that it encodes a CaCC (Supplementary Figure 4), consistent with previous reports showing
that mouse Tmem16b gives rise to CaCC in Axolotl oocytes
(Schroeder et al. 2008) and HEK293 cells (Pifferi et al. 2009;
Stephan et al. 2009). A detailed comparison of recombinantly expressed Tmem16b in HEK293 cells with the endogenous CaCCs in OSNs was published recently (Stephan et al.
2009), demonstrating that the biophysical properties of the
channels are very similar. Nevertheless, the remaining differences between the endogenous olfactory CaCC and heterologously expressed Tmem16b raise the possibility that
Tmem16b forms complexes with other proteins in olfactory
cilia. In that respect it is interesting to note that we could
identify 3 other Tmem16 family members (Tmem16a, f,
and k) on the protein level in our samples, which are possible
interaction partners. Tmem16f and k were found to be present in similar amounts as CNG1B.
Western blotting revealed that Tmem16b expression is
highly specific for the OE, the protein was not detectable
in similar amounts in nearly all other tissues tested, except
brain. This is in contrast to Tmem16a, which was found
to be relatively ubiquitously expressed, mostly in secretory
epithelial cells (Caputo et al. 2008; Schroeder et al. 2008;
Yang et al. 2008). Tmem16b was recently identified in the
photoreceptor synaptic terminals in mouse retina (Stohr
et al. 2009), which is consistent with our detection showing
expression in eye membrane preparations, but the expression
level was found to be significantly lower than in the OE. Low
expression levels of Tmem16b were also detected in the vomeronasal organ but not in other sensory tissues such as trigeminal and dorsal root ganglia and tongue. Tmem16b
seems to be glycosylated in the cilia of the OSNs, similar
as the type III adenylyl cyclase (Bakalyar and Reed 1990)
and the CNGA2 subunit of the CNG channel (Bonigk
et al. 1999). The functions of these glycosylations are not
known to date but might be implicated in surface or ciliary
trafficking of the respective proteins. Detection of the endogenous channel in OE cryosections allowed to unambiguously
confirm ciliary localization in the sensory part of the nasal
epithelium, where Tmem16b readily colocalized with
CNGA2. Tmem16b was moreover localized in the microvilli
of sensory neurons in the vomeronasal organ, which could
indicate a role in signal transduction also in this tissue.
Taken together we show here that Tmem16b, the second
characterized member of a new family of CaCC, is highly
specific for the olfactory system and shows prominent ciliary
localization in OSNs. Moreover, Tmem16b is present in adequate amounts to be the well-known CaCC in the olfactory
system. Further characterization of the other members of the
family that are present in OSNs will help to further refine the
significance of this ion channel family in olfactory signal
transduction.
Supplementary material
Supplementary material can be found at http://www.chemse
.oxfordjournals.org/.
Tmem16b Expression in Cilia of Olfactory Neurons 245
Funding
This work was supported by grants from the Deutsche Forschungsgemeinschaft [SFB642 to E.M.N and H.H.]; the
Max-Planck-Research School for Chemical Biology; the
Ruhr-University Research School; and the Heinrich und
Alma Vogelsang Stiftung.
Pifferi S, Dibattista M, Menini A. 2009. TMEM16B induces chloride currents
activated by calcium in mammalian cells. Pflugers Arch. 458:
1023–1038.
Pifferi S, Pascarella G, Boccaccio A, Mazzatenta A, Gustincich S, Menini A,
Zucchelli S. 2006. Bestrophin-2 is a candidate calcium-activated chloride
channel involved in olfactory transduction. Proc Natl Acad Sci U S A.
103:12929–12934.
Potter SM, Zheng C, Koos DS, Feinstein P, Fraser SE, Mombaerts P. 2001.
Structure and emergence of specific olfactory glomeruli in the mouse.
J Neuroscience. 21:9713–9723.
Acknowledgements
We thank H. Bartel and J. Gerkrath for excellent technical assistance, K. Überla and M. Tenbusch (Ruhr-Universität Bochum)
for help with FACS sorting, and M. Spehr (RWTH Aachen) for
valuable discussions.
References
Bakall B, McLaughlin P, Stanton JB, Zhang Y, Hartzell HC, Marmorstein LY,
Marmorstein AD. 2008. Bestrophin-2 is involved in the generation of
intraocular pressure. Invest Ophthalmol Vis Sci. 49:1563–1570.
Bakalyar HA, Reed RR. 1990. Identification of a specialized adenylyl cyclase
that may mediate odorant detection. Science. 250:1403–1406.
Bonigk W, Bradley J, Muller F, Sesti F, Boekhoff I, Ronnett GV, Kaupp UB,
Frings S. 1999. The native rat olfactory cyclic nucleotide-gated channel is
composed of three distinct subunits. J Neurosci. 19:5332–5347.
Caputo A, Caci E, Ferrera L, Pedemonte N, Barsanti C, Sondo E, Pfeffer U,
Ravazzolo R, Zegarra-Moran O, Galietta LJ. 2008. TMEM16A, a membrane protein associated with calcium-dependent chloride channel
activity. Science. 322:590–594.
+
–
Frings S, Reuter D, Kleene SJ. 2000. Neuronal Ca2 -activated Cl channels–
homing in on an elusive channel species. Prog Neurobiol. 60:247–289.
Huang X, Godfrey TE, Gooding WE, McCarty KS Jr, Gollin SM. 2006.
Comprehensive genome and transcriptome analysis of the 11q13
amplicon in human oral cancer and synteny to the 7F5 amplicon in
murine oral carcinoma. Genes Chromosomes Cancer. 45:1058–1069.
Liu H, Sadygov RG, Yates JRIII. 2004. A model for random sampling and
estimation of relative protein abundance in shotgun proteomics. Anal
Chem. 76:4193–4201.
Reisert J, Bauer PJ, Yau KW, Frings S. 2003. The Ca-activated Cl channel
and its control in rat olfactory receptor neurons. J Gen Physiol. 122:
349–363.
Reisert J, Lai J, Yau KW, Bradley J. 2005. Mechanism of the excitatory Cl–
response in mouse olfactory receptor neurons. Neuron. 45:553–561.
Schaefer H, Chervet JP, Bunse C, Joppich C, Meyer HE, Marcus K. 2004. A
peptide preconcentration approach for nano-high-performance liquid
chromatography to diminish memory effects. Proteomics. 4:2541–2544.
Schroeder BC, Cheng T, Jan YN, Jan LY. 2008. Expression cloning of
TMEM16A as a calcium-activated chloride channel subunit. Cell. 134:
1019–1029.
Stephan AB, Shum EY, Hirsh S, Cygnar KD, Reisert J, Zhao H. 2009. ANO2 is
the cilial calcium-activated chloride channel that may mediate olfactory
amplification. Proc Natl Acad Sci U S A. 106:11776–11781.
Stephan C, Reidegeld KA, Hamacher M, van HA, Marcus K, Taylor C, Jones P,
Muller M, Apweiler R, Martens L, et al. 2006. Automated reprocessing
pipeline for searching heterogeneous mass spectrometric data of the
HUPO Brain Proteome Project pilot phase. Proteomics. 6:5015–5029.
Stohr H, Heisig JB, Benz PM, Schoberl S, Milenkovic VM, Strauss O,
Aartsen WM, Wijnholds J, Weber BH, Schulz HL. 2009. TMEM16B,
a novel protein with calcium-dependent chloride channel activity,
associates with a presynaptic protein complex in photoreceptor
terminals. J Neurosci. 29:6809–6818.
Tsutsumi S, Inoue H, Sakamoto Y, Mizuta K, Kamata N, Itakura M. 2005.
Molecular cloning and characterization of the murine gnathodiaphyseal dysplasia gene GDD1. Biochem Biophys Res Commun. 331:
1099–1106.
Mayer U, Ungerer N, Klimmeck D, Warnken U, Schnolzer M, Frings S,
Mohrlen F. 2008. Proteomic analysis of a membrane preparation from rat
olfactory sensory cilia. Chem Senses. 33:145–162.
Wiese S, Gronemeyer T, Ofman R, Kunze M, Grou CP, Almeida JA,
Eisenacher M, Stephan C, Hayen H, Schollenberger L, et al. 2007.
Proteomics characterization of mouse kidney peroxisomes by tandem
mass spectrometry and protein correlation profiling. Mol Cell Proteomics.
6:2045–2057.
Perkins DN, Pappin DJ, Creasy DM, Cottrell JS. 1999. Probability-based
protein identification by searching sequence databases using mass
spectrometry data. Electrophoresis. 20:3551–3567.
Yang YD, Cho H, Koo JY, Tak MH, Cho Y, Shim WS, Park SP, Lee J, Lee B,
Kim BM, et al. 2008. TMEM16A confers receptor-activated calciumdependent chloride conductance. Nature. 455:1210–1215.