J. Basic. Appl. Sci. Res., 3(5)453-457, 2013
© 2013, TextRoad Publication
ISSN 2090-4304
Journal of Basic and Applied
Scientific Research
www.textroad.com
Identification of Fungi Based on ITS from Humus Soil at UNILA,
Indonesia.
Husniati* and Eva Oktarina
Balai Riset dan Standardisasi Industri (Baristand), Bandar Lampung, Indonesia
ABSTRACT
Fungal isolate HEU1 isolated from humus soil at UNILA, Indonesia was identified based on Internal
Transcribed Spacer (ITS). Fungal isolate HEU1 has brown blackish spore and white mycelia. DNA was isolated
from mycelia and the ITS region was amplified by Polymerase Chain Reaction (PCR) with ITS4 and ITS5
primers. The PCR product was purified using PCR Purification Kit, and nitrogen base sequence analyzed with
automated DNA sequencer. The homology of sequences analyzed with Basic Local Alignment Search Tool
nucleotide (BLASTn). The BLASTn result showed that the fungal isolate HEU1 has 100% homology with
Aspergillus aculeatus strain M9. ClustalW was used for sequence-alignment. Phylogenetic analysis was
constructed using Neighbour joining methode with Kimura distance. The phylogenetic tree obtained showed that
fungal isolate HEU1 is Aspergillus aculeatus.
KEYWORDS: Aspergillus, Internal transcribed spacer, phylogenetic tree, DNA (Deoxyribo Nucleic
Acid) sequence.
INTRODUCTION
Identification of fungi has an aim to discover nature diversity of fungi species. Identification proceeds with
comparing the unknown isolate with existing taxa to establish the identity [1]. Fungi identification can be done
in two ways, conventional and molecular. Conventional identification of fungi can be done based on
morphology, physiology, and biochemical characteristic. Morphology and physiology character from two
species closely related fungi, often identical, which can lead miss-identification. Therefore, the fungi
identification is required molecular way. Molecular identification method is using Deoxyribo Nucleic Acid
(DNA). Regions of genes encoding ribosomal RNA (rRNA) or ribosomal DNA (rDNA), is a common target
used for the identification of fungi. rRNA coding genes shared by all organisms and are present in multiple
copies (100-200 copies in the genome). One unit rRNA gene regions in eukaryotic organisms consist of coding
and non-coding regions. Gene coding region consists of small sub-unit (SSU), 5.8 S; large sub-unit (LSU) and
5S. Non-coding regions consist of Internal Transcribed Spacer (ITS) and Intergenic Spacer (IGS) [2,3].
ITS regions are non-coding regions that have higher mutation rates than coding regions, thus generally
have a higher sequence variation than coding regions [4]. One potential advantage of this method is that ITS
primers designed according to the highly conserved rRNA gene sequences, could be highly applicable in a broad
range of organisms including plants, fungi and animals [5].According to Sugita et al., the same species have
regional ITS sequence homology 99-100%, while the homology lower than 99% showed a distinct species [6].
Previous research by Husniati et al.,showed that isolate HEU1 can produce galactomannan, but in those
research isolate still known as A. niger [7]. In this research, we clarify and underline our statement about the
identification of the isolate. Samson et al., stated that species which belong to Aspergillus section Nigri were A.
aculeatus, A. brasiliensisined, A. carbonarius, A. costaricaensis, A. ellipticus, A. japonicas, A. foetidus, A.
heteromorphus, A. homomorphus, A. lacticoffeatus, A. niger, A. piperis, A. sclerotioniger, A. tubingensis, and A.
vadensis [8]. A. niger section Nigri have been extensively used for various biotechnological purpose, including
production of enzyme and metabolites to be used in food industry. A. niger products hold the GRAS (Generally
Recognized As Safe). Due to their biotechnological importance, the identification of such strain needs to be
unambiguous. This research aimed to identify fungal isolate HEU1, isolated from Unila humus soil, based on
Internal Transcribed Spacer (ITS).
MATERIALS AND METHODS
Materials
The material used in this study were humus soil at University of Lampung (UNILA) as a sample source
culture, Potato Dextrose Agar (Difco), peptone Water (Pronadisa), distilled water, lactophenol (Merck).
Methods
Isolation
Five grams of humus soil samples taken from the UNILA student village’s (Kampung Baru) dissolved in
45 mL of distilled water and measured the pH. Samples were then diluted to 10-12 dilution factors. After that,
*Corresponding Author: Husniati, Balai Riset dan Standardisasi Industri (Baristand), Bandar Lampung, Indonesia.
Email: [email protected]
453
Husniati and Oktarina, 2013
pipetted and poured in PDA media, this work was performed in duplicates. Samples were then incubated for 3-7
days at 25˚ C.
Morphology Identification
Observations were done from day-1 until day-7. Parameters analyzed included: changes arising on colony
color, colony surface conditions (flat, mounting, powders, granules, grain, velvet or cotton), presence or absence
of radial lines, the availability of lines or concentric circles, presence or absence of exudates drops, the bottom
of the colony and the presence or absence of odor.
Microscopic observation was using lactophenol. Observations performed with 10 x 1000 zoom. Parameters
analyzed included: the availability conidiophores, conidia and vesicles.
Molecular Identification
Molecular identification of fungi carried out based on genetic analysis as partially on ribosomal DNA sub
unit of fungi that includes internal transcribed spacer (ITS4 and ITS5). PCR amplification using Primer ITS4 at
5 '- TCC TCC GCT TAT TGA TAT GC - 3' and Primer ITS 5 at 5 '- GGA AGT AAA AGT CGT AAC AAGG3' [5].
PCR product purification was done by PCR Purification Kit and followed by cycle sequencing. Results
returned purified cycle sequencing with Ethanol purification method. Analysis of the reading order of nitrogen
bases using automated DNA sequencer (ABI PRISM 3130 Genetic Analyzer) (Applied Biosystems).
Sequence data then trimming and assembling, with the BioEdit program, and further conversed in a
FASTA format. The results then run for BLAST for looking homology, in data base center of the DNA at the
site http://www.ncbi.nlm.nih.gov [9].
Phylogenetic Tree
Establishment of a phylogenetic tree based on Hall [10]. Analysis of the others sequences accessed from
GenBank, which are Aspergillus aculeatus strain M9 (GenBank JQ670921.1), A. japonicus strain CBS 61 178
(GenBank: AY585562.1), A. carbonarius strain SRRC (GenBank: AY373844.1), A. niger strain ASRA2
(GenBank: JQ675290.1), A. ochraceus isolates 41 (GenBank: HQ905486.1), and Penicillium chrysogenum M30
strain (GenBank: JQ422624.1) as outgroup.
Sequencing results in a FASTA format, aligned and processed on the website http://npsa-pbil.ibcp.fr/cgibin/npsa_automat.pl?page=/NPSA/npsa_clustalwan.html [11] to convert FASTA become ClustalW [12]. Data
from ClustalW edited on SEAVIEW 4, and phylogenetic trees constructed on PHYLO_WIN [13].
RESULTS AND DISCUSSION
Morphology Identification
Macroscopic observations of fungal isolates HEU1 on the 7 th day incubation at temperature 25° C on PDA
showed same characteristic with genus Aspergillus [14], the spore colors were brown to black, with colonies
mounting surface were white colored cotton and colonies diameter were 80 mm (Picture 1).
Picture 1. Macroscopic view of fungi isolate HEU1 (days 7) on PDA.
Microscopic observations showed that Aspergillus isolates had small conidia colored dark brown,
uniseriate, spherical vesicle shapes and forms fialid like tubes (Picture 2). Aspergillus species that uniseriate
were A. aculeatus, A. aculeatinus, A. japonicus and A. uvarum [14,15].
454
J. Basic. Appl. Sci. Res., 3(5)453-457, 2013
Conidiophore
Vesicle
Conidiospores
Picture 2. Microscopic picture of isolate HEU1 in PDA (7 days incubation).
Molecular Identification
Sequences result from automated DNA sequencer (ABI PRISM 3130 Genetic Analyzer) :
>Aspergillus aculeatus, 458 bp
TCCTTCGGGGCCCAACCTCCCACCCGTGCTTACCGTACCCTGTTGCTTCGGCGGGCCCGCCTTCGGG
CGGCCCGGGGCCTGCCCCCGGGACCGCGCCCGCCGGAGACCCCAATGGAACACTGTCTGAAAGCG
TGCAGTCTGAGTCGATTGATACCAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCAT
CGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTC
TTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTCCCCTC
CAGCCCCGCTGGTTGTTGGGCCGCGCCCCCCCGGGGGCGGGCCTCGAGAGAAACGGCGGCACCGT
CCGGTCCTCGAGCGTATGGGGCTCTGTCACCCGCTCTATGGGCCCGGCCGGGGCTTGCCTCGA
Identification was done by homology search on the ITS region sequence, using BLASTn program on DNA
database GenBank [9].
The BLASTn showed that the sequence of fungus isolates HEU1 have 100% homology with A. aculeatus
strain M9 (Appendix 1). According to Sugita et al., isolates with ITS region sequences ≥ 99% with the closest
species was the same species [6]. Therefore, it can be concluded that the fungal isolates HEU1 was identified as
Aspergiilus aculeatus, grouped in Aspergillus section Nigri [8].
Phylogenetic Analysis Of Fungal Isolate HEU1
FASTA data from the base sequence was converted into Mase with ClustalW and Seaview4 program, then
Phylogenetic Tree-Neighbour joining (NJ) of isolate HEU1 constructed with phylo_win program, using Kimura
distance. Schematic phylogeny with bootstrap was done 1000 times (Picture 3).
Picture 3.Phylogenetik tree dari A. aculeatus (isolate HEU1)
455
Husniati and Oktarina, 2013
Phylogenetic tree showed that A. aculeatus (isolate HEU1) have closely related with A. aculeatus strains
M9 and the A. japonicas strain CBS, and Penicillium chrysogenum strain M30 as an outgroup. Al-Musallam
(1980) stated that A. aculeatus Iizuka as varieties of A. japonicus, but Raper and Fennell (1965) stated that A.
aculeatus and A. japonicas were two different taxa [in 15]. Those statement also suported by Pařenicová et al.,
that examined 9 Aspergillus japonicus isolates and 10 Aspergillus aculeatus isolates by using molecular and
biochemical markers, including DNA sequences of the ITS1-5.8S rRNA gene-ITS2 region, restriction fragment
length polymorphisms (RFLP), and secondary-metabolite profiles. The DNA sequence of the internal
transcribed spacers (ITS1 and ITS2) and the 5.8S rRNA gene could not be used to distinguish between A.
japonicus and A. aculeatus but did show that these two taxa are more closely related to each other than to other
species of black aspergilli [17].
From the phylogenetic tree above can be seen that A. aculeatus was different taxa to A. japonicus, showed
from its bootstrap number is 100.
Conclusion
The observation of macroscopic, microscopic, and molecular identification confirmed that fungal isolate
HEU1 isolated from UNILA humus soil is Aspergillus aculeatus.
REFERENCES
1.
Barnett, J.A., R.W. Payne & D. Yarrow. 2000. Yeast: Characteristic and identification. 3rd ed. Cambridge
University Press, Cambridge: ix + 1139 hlm.
2.
Katsu, M., A. Kidd, A. Ando, M.L. Moretti-Branchini, Y. Mikami, K. Nishimura & W. Meyer. 2003. The
internal transcribed spacer and 5,8S rRNA gene show extensive diversity among isolates of the
Cryptococcus neoformans species complex. FEMS Yeast Research 1608: 1-12.
3.
Henry, T., P. C. Iwen, and S. H. Hinrichs. 2000. Identification Of Aspergillus Species Using Internal
Transcribed Spacer Regions 1 And 2. Journal Of Clinical Microbiology, 38 (4): 1510–1515.
4.
James, S.A. & M. Stratford. 2003. Spoilage yeast with emphasis on the genus Zygosaccharomyces.
InBoekhout, T. & V. Roberts (eds). 2003. Yeast in food: Beneficial and detrimental aspects. CRC press,
Boca Raton: 171-192.
5.
White T.J., Bruns T., Lee S., & Taylor J. 1990.Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols: a
guide to methods and applications. Academic press, New York pp. 315-322.
6.
Sugita, T., A. Nishikawa, R. Akeda& T. Shinoda. 1999. Identification of medically reevantTrichosporon
species based on sequences of Internal Transcribed Spacer regions and construction of database for
Trichosporon identification. Journal of Clynical Microbiology 37(6): 1985-1993.Abarca, M.L., F.
Accensi, J. Cano, & F. Javier Cabañes.2004. Taxonomy and significance of black aspergilla.Antonie van
Leeuwenhoek 86: 33-49.
7.
Husniati, Dian H, dan Eva O. 2010. Potensi Galaktomanan dari Aspergillus niger Isolat Tanah Humus.
Dalam Prosiding Seminar Nasional Sain MIPA, dan Aplikasinya Desember 2010, Universitas Lampung,
243-248. ISSN: 2086-2342.
8.
Samson, R.A., S.B. Hong, & J.C. Frisvad.2006. Old and new concepts of species differentiation in
Aspergillus.Medical Mycology 44: 5133-5148.
9.
BLAST, [online], Available: http://blast.ncbi.nlm.nih.gov/Blast.cgi, [20 Mei 2012].
10. Hall, B.G. 1942. Phylogenetic trees made easy: A how to manual.2nd ed. Sinauer Associates, Sunderland:
221 hlm.
11. Combet C., Blanchet C., Geourjon C. &Deléage G. 2000. NPS@: Network Protein Sequence
Analysis.TIBS 2000 March Vol. 25, No 3 [291]:147-150.
12. Thompson J.D., Higgins D.G., & Gibson T.J. 1994. CLUSTAL W: improving the sensitivity of
progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and
weight matrix choice.Nucleic Acids Res,22(22):4673-4680.
13. Galtier, N., Gouy, M., and C. Gautier.1996. SEAVIEW and PHYLO_WIN: two graphic tools for sequence
alignment and molecular phylogeny. CABIOS 12: 543-548.
14. Webster J. 1978. Introduction to fungi. Great Britain Inc., London.
15. Abarca, M.L., F. Accensi, J. Cano, & F. Javier Cabañes.2004. Taxonomy and significance of black
aspergilla.Antonie van Leeuwenhoek 86: 33-49.
456
J. Basic. Appl. Sci. Res., 3(5)453-457, 2013
16. Perrone, G., J. Varga, A. Susca, J. C. Frisvad, G. Stea, S. Kosube, B. toth, Z. Kozakiewicz, & R.A.
Samson. 2008. Aspergillusuvarum sp. nov., an uniseriate black Aspergillus species isolated from grapes in
Europe. IJSEM 58: 1032–1039.
17. Pařenicová, L., PernilleSkouboe, J.Frisvad, R. A. Samson, L.Rossen, M. T.Hoor-Suykerbuyk, andJ.Visser.
2001. Combined Molecular And Biochemical Approach Identifies AspergillusJaponicus And
AspergillusAculeatus As Two Species. Appl Environ Microbiol. 67(2): 521–527.
Appendix 1. Data alignment sequence isolate HEU1 with A. aculeatus strain M9 on BLASTn analysis.
457