Research Article
4087
Dynamic association–dissociation and harboring of
endogenous mRNAs in stress granules
Junwei Zhang1, Kohki Okabe1, Tokio Tani2 and Takashi Funatsu1,*
1
Laboratory of Bio-Analytical Chemistry, Graduate School of Pharmaceutical Sciences, The University of Tokyo, Bunkyo-ku, Tokyo 113-0033, Japan
Department of Biological Science, Graduate School of Science and Technology, Kumamoto University, Kumamoto City, Kumamoto 860-8555,
Japan
2
*Author for correspondence ([email protected])
Journal of Cell Science
Accepted 11 July 2011
Journal of Cell Science 124, 4087–4095
ß 2011. Published by The Company of Biologists Ltd
doi: 10.1242/jcs.090951
Summary
In response to environmental stress, cytoplasmic mRNAs aggregate to form stress granules (SGs). SGs have mainly been studied
indirectly using protein markers, but the real-time behavior of endogenous mRNAs in SGs remains uncertain. Here, we visualized
endogenous cytoplasmic poly(A)+ mRNAs in living mammalian cells using a linear antisense 29-O-methyl RNA probe. In arsenitestressed cells, endogenous mRNAs aggregated in granules that colocalized with SGs marked by TIA-1–GFP. Moreover, analysis of
mRNA dynamics using fluorescence recovery after photobleaching showed that approximately one-third of the endogenous mRNAs in
SGs was immobile, another one-third was diffusive, and the remaining one-third was in equilibrium between binding to and dissociating
from SGs, with a time constant of approximately 300 seconds. These dynamic characteristics of mRNAs were independent of the
duration of stress and microtubule integrity. Similar characteristics were also observed from fos mRNA labeled with an antisense 29-Omethyl RNA probe. Our results revealed the behavior of endogenous mRNAs, and indicated that SGs act as dynamic harbors of
untranslated poly(A)+ mRNAs.
Key words: Stress response, mRNA storage, mRNA imaging, Linear antisense probe, Fluorescence recovery after photobleaching (FRAP)
Introduction
In eukaryotic cells, regulation of translation plays an important
role in protein synthesis. When cells are exposed to various types
of environmental stress, such as oxidative stress, heat shock or
UV exposure, translation is reprogrammed and untranslated
mRNAs are recruited to cytoplasmic foci called stress granules
(SGs) (Anderson and Kedersha, 2008; Buchan and Parker, 2009).
SGs do not have membranes, and their typical dimensions are 1–
2 mm. Electron microscopy shows that SGs have a fibrillogranule structure with a low level of compaction (Souquere et al.,
2009). SGs typically contain stalled mRNAs, 40S ribosomal
subunits, a number of translational initiation factors (such as
eIF2a and eIF3) and RNA binding proteins (e.g. TIA-1 and
PABP) (Souquere et al., 2009; Kimball et al., 2003; Mazroui
et al., 2006; Kedersha et al., 2005; Kedersha et al., 1999). The
assembly of SGs, which starts with the detachment of ribosomes
from mRNA transcripts (Kedersha et al., 2005; Kedersha et al.,
1999; Wek et al., 2006), requires the self-aggregation and RNA
binding ability of TIA-1 and TIAR (Gilks et al., 2004; Kedersha
et al., 1999). Microtubules also contribute to the formation of
SGs (Fujimura et al., 2009; Nadezhdina et al., 2010). These
findings indicate the involvement of SGs in the regulation of
translation.
Although the SG is generally regarded as the site where
mRNAs are remodeled for reinitiation, degradation or storage
(Anderson and Kedersha, 2002; Anderson and Kedersha, 2009;
Buchan and Parker, 2009), its functions have not been clarified.
The dynamics of SG components have been examined to
determine the physiological significance of SGs. Previous
studies using fluorescence recovery after photobleaching
(FRAP) suggest that some protein components of SGs rapidly
shuttle in and out. For instance, TIA-1–GFP in SGs is completely
mobile and is quite rapidly replaced within several seconds
(Kedersha et al., 2000), whereas PAPB-I–GFP (Kedersha et al.,
2000) and CPEB1–GFP (Mollet et al., 2008) are not completely
mobile in SGs, although they also have high exchange rates.
These GFP-fused proteins have revealed kinetic information of
SG components in living cells that suggest SGs are highly
dynamic sites. However, the real-time behavior of mRNAs, the
main components of SGs, in stressed cells is still unclear, which
limits a deeper comprehension of SG functionality.
Mollet et al. investigated the kinetics of MS2–GFP-tagged bgal mRNA in SGs and found that it is also mostly mobile and that
residence time in SGs is even shorter than that in the cytoplasm
(Mollet et al., 2008). These kinetic data of a tagged mRNA do not
support the hypothesized role of SGs as storage or refuge sites for
mRNA. If mRNAs could not remain there, it would be difficult to
explain the necessity of recruiting mRNAs to SGs. However,
these results might not truly reflect the dynamics of endogenous
mRNAs during stress, because MS2–GFP-tagged mRNAs have a
different structure from native mRNA. Therefore, it is very
important to target endogenous mRNAs and to elucidate their
real-time behavior under stress to further understand the role of
SGs.
In this study, SG function was explored by examining
endogenous mRNAs in living cells. To visualize endogenous
mRNAs, we used a linear antisense 29-O-methyl RNA probe
labeled with a fluorescent dye that can bind to native mRNA in a
4088
Journal of Cell Science 124 (23)
sequence-specific way (Molenaar et al., 2001; Molenaar et al.,
2004; Ishihama et al., 2008; Okabe et al., 2011). A linear
antisense probe was advantageous because of its ability to target
native mRNA and its excellent hybridization kinetics in living
cells (Okabe et al., 2011; Molenaar et al., 2001). Using this kind
of probe, we directly visualized endogenous mRNAs in living
cells and monitored the localization of mRNAs during the stress
response in real time. Furthermore, we performed FRAP
and inverse FRAP (iFRAP) to investigate the dynamics of
endogenous mRNAs in SGs and to reveal the existence of
mRNAs that remained in, and associated with, SGs. These
observations are quite different from previous findings and
support the hypothesis that SGs actively harbor mRNAs.
Results
Journal of Cell Science
Endogenous mRNAs visualized using a linear
antisense probe
To investigate the real time behavior of endogenous mRNAs in
living cells during stress, we mainly targeted cytoplasmic
poly(A)+ mRNAs, which are considered to be components of
SGs (Kedersha et al., 2000; Kedersha et al., 1999; Souquere et al.,
2009; Fujimura et al., 2009; Unsworth et al., 2010). A Cy3labeled poly(U)22 29-O-methyl RNA probe was used to detect
poly(A)+ mRNAs in the cytoplasm (Fig. 1A). We chose 29-Omethyl RNA as the backbone of the probe, because this artificial
nucleic acid is resistant to nucleases in living cells and it has a
high affinity for nucleic acids (Molenaar et al., 2001; Okabe et al.,
2011). The poly(U)22 29-O-methyl RNA probe has previously
been used to detect nuclear poly(A)+ RNA (Molenaar et al., 2004;
Ishihama et al., 2008). We further developed the probe for
use with cytoplasmic mRNAs by combining the probe with
streptavidin, which helps to prevent entry to the nucleus (Okabe
et al., 2011). In our previous study, endogenous fos mRNA
in SGs was selectively detected by observing fluorescence
resonance energy transfer (FRET) from two linear antisense
probes, which demonstrates that the poly(U)22 probe can be used
to investigate endogenous poly(A)+ mRNAs in SGs (Okabe et al.,
2011).
The poly(U)22 29-O-methyl RNA probe was microinjected into
the cytoplasm of living COS7 cells. As shown in Fig. 1B,
fluorescence was mostly observed in the cytoplasm. To confirm
the hybridization of probes and mRNAs in living cells,
fluorescence correlation spectroscopy (FCS) was performed.
FCS analysis can estimate the size of a molecule by
quantitatively measuring its diffusion in living cells (Magde
et al., 1972; Yoshida et al., 2001; Breusegem et al., 2006). When
probes bind to mRNAs, diffusion time increases compared with
that of unbound probes. The poly(A)18 probe, which has a
different sequence but similar structure to the poly(U)22 probe,
was used as a control. As can be seen in Fig. 1C, the poly(U)22
probe diffused more slowly than the poly(A)18 probe, which
indicated its binding with poly(A)+ mRNAs. Fluorescence
autocorrelation functions obtained from FCS measurements in
living cells showed that 85% of the injected poly(U)22 probe
bound to mRNAs. In arsenite-treated cells, the binding ratio in
the cytoplasm outside SGs was 91% and that inside SGs was
88%. The injected poly(A)18 probe did not bind to mRNA. These
FCS results demonstrated the hybridization between the probe
and mRNAs, which confirmed that the fluorescence of the
poly(U)22 probe represented endogenous poly(A)+ mRNAs.
A linear antisense probe is also advantageous as it has a fast
hybridization reaction with target mRNAs and is, therefore,
applicable to real-time monitoring of endogenous mRNAs in
living cells. In vitro evaluation of the poly(U)22 probe and mRNA
binding in solution using fluorescence spectroscopy indicated
that the poly(U)22 probe could bind to mRNAs within 10 seconds
(at the concentration of 10 nM; supplementary material Fig. S1).
Our previous study showed that fos antisense probe, a probe that
Fig. 1. Visualization of endogenous poly(A)+
mRNAs using linear antisense probes. (A) Schematic
drawing of the poly(U)22 probe bound to poly(A)+
mRNA. (B) Phase-contrast and fluorescence images of
the cells microinjected with the poly(U)22 probe, which
were imaged 10 minutes after microinjection. (C) FCS
measurements of the hybridization of the poly(U)22
probe (open circles) and the poly(A)18 probe (open
triangles) with poly(A)+ mRNAs. Nine cells
microinjected with the poly(U)22 probe and 13 cells
microinjected with the poly(A)18 probe were measured.
A typical fluorescence autocorrelation function from
each probe was normalized and is shown in the same
graph with its fit line. Scale bar: 10 mm.
Dynamics of mRNA in stress granules
could specifically bind to a single species of mRNA, hybridized
with its target mRNA within 1 minute in living cells (Okabe et al.,
2011). Because the poly(U)22 probe could hybridize nearly 25
times faster than the fos antisense probe (10 nM) in solution, the
binding process of the poly(U)22 probe in living cells was
estimated to be less than 1 minute. Thus, the poly(U)22 probe can
be applied to monitor the rapid localization of endogenous
poly(A)+ mRNAs in living cells during stress.
Real-time imaging of endogenous mRNAs during stress
whereas the average number of the granules in each cell initially
increased, but then began to decrease 30 minutes after the stress
was induced (Fig. 2C, filled circles). These results indicated that
there are two steps involved in mRNA accumulation in SGs: a
number of small granules first form and then these gradually merge
to become bigger SGs. Interestingly, SG formation in two steps has
also been observed when microtubules were destroyed (Fujimura
et al., 2009). In control experiments in the absence of stress, neither
the size nor the number of granules changed over 60 minutes
(Fig. 2B,C, open triangles). By contrast, cells injected with the
poly(A)18 probe did not show changes despite being subjected to
stress (Fig. 2D,E; supplementary material Fig. S2A).
Next, we expressed GFP-tagged TIA-1, which is a well-known
protein component of SGs, to confirm that the granules in which
mRNAs aggregated were SGs, and to compare the aggregation
processes of the protein components and the endogenous
mRNAs. After arsenite stress was induced, the accumulation
of TIA-1–GFP and mRNAs was monitored simultaneously
(Fig. 3A). The two kinds of fluorescence closely overlapped
throughout the granule formation process. Also, the average size
and number of SGs, indicated by TIA-1–GFP, showed similar
Journal of Cell Science
Using the poly(U)22 probe, we monitored the aggregation of
endogenous poly(A)+ mRNAs to SGs in living cells during stress.
After stress was induced by 0.5 mM arsenite, the localization
of cytoplasmic mRNAs was monitored for 60 minutes using
epifluorescence microscopy (Fig. 2A). We observed that
endogenous mRNAs rapidly aggregated (within 20 minutes) to
form foci in response to stress (Fig. 2A, Ars 20 minutes). By
60 minutes after arsenite addition, ,10% of poly(A)+ mRNAs had
accumulated in SGs. A quantitative analysis of mRNA aggregation
in SGs was performed (Fig. 2B,C). The average size of the
granules increased chronologically (Fig. 2B, filled circles),
4089
Fig. 2. Real-time imaging of endogenous poly(A)+
mRNAs aggregating to SGs. Sodium arsenite (Ars;
0.5 mM) was added to induce SG formation. (A) COS7
cells were microinjected with the poly(U)22 probe.
Fluorescence images were taken every 10 minutes (times
after addition of sodium arsenite are indicated in each
panel). (B,C) Average size (B) and number (C) of
granules with (filled circles; means ± s.d., 20 cells) or
without (open triangles; means ± s.d., 10 cells) arsenite
stress, using the poly(U)22 probe. (D,E) Average size
(D) or number (E) of granules with (filled circles; means
± s.d., 20 cells) or without (open triangles; means ± s.d.,
six cells) arsenite stress, using the poly(A)18 probe. Scale
bar: 10 mm.
4090
Journal of Cell Science 124 (23)
Journal of Cell Science
Fig. 3. Simultaneous imaging of TIA-1–GFP
and endogenous poly(A)+ mRNAs
aggregating in SGs. COS7 cells were
transfected with TIA-1–GFP and cultured for
18 hours before microinjection of the poly(U)22
probe. SGs were then induced with sodium
arsenite (Ars, 0.5 mM). (A) Fluorescence
images of TIA-1–GFP (green, top row) and
poly(A)+ mRNA accumulation (magenta,
middle row) in SGs. Merged images are shown
in the bottom row. Images were taken every
10 minutes (times after addition of sodium
arsenite are indicated above each column).
(B,C) Average size (B) and number of granules
(C) in cells under arsenite stress, as observed
using TIA-1–GFP (green circles; means ± s.d.,
four cells). (D,E) Average size (D) and number
of granules (E) in cells under arsenite stress, as
observed using the poly(U)22 probe (magenta
circles; means ± s.d., four cells). Scale bar:
10 mm.
changes to that observed for poly(A)+ mRNAs (Fig. 3B–E).
These results showed that aggregation of mRNAs in SGs
occurred simultaneously with that of TIA-1, indicating that
before these two components were recruited to the visible SGs,
they could have already started to interact in the cytoplasm. In
control experiments, cells expressing GFP alone were induced
with arsenite stress but accumulation of mRNA was not observed
(supplementary material Fig. S2B).
By removing the arsenite stress we also observed the release
of mRNAs from SGs that had formed in response to stress. In
most cells (21 out of 22 cells), SGs were disassembled within
90 minutes after the removal of stress (supplementary material
Fig. S3). During this process, small SGs appeared to dissolve
earlier than large ones. Furthermore, it has been reported that
mRNAs must be released from polysomes before being recruited
to SGs (Kedersha et al., 2000; Mollet et al., 2008; Buchan et al.,
2008). We treated cells with emetine before or after arsenite
treatment. Emetine inhibits mRNA translation by binding to the
40S subunit of the ribosome (Jimenez et al., 1977). Our results
showed that emetine treatment inhibited endogenous mRNAs
aggregating to arsenite-induced SGs (supplementary material
Fig. S4A). In addition, mRNAs that had accumulated in SGs
under stress were gradually released as a result of emetine
treatment (supplementary material Fig. S4B).
The dynamics of endogenous poly(A)+ mRNAs in SGs
investigated by FRAP analysis
Previous studies have suggested that both GFP-tagged protein
and GFP-tagged RNA are mostly mobile and exchange rapidly
between SGs and the cytoplasm (Kedersha et al., 2000; Mollet
et al., 2008). Our FRAP experiment also showed that TIA-1–GFP
was mostly mobile (98%) in SGs (supplementary material Fig.
S5). However, endogenous mRNAs might not behave in the same
way as GFP-tagged protein and GFP-tagged RNA. To determine
the dynamics of endogenous mRNAs in SGs, we performed a
FRAP analysis (Fig. 4). Endogenous mRNAs bound with the
poly(U)22 probe in a single SG were photobleached and the
fluorescence recovery was recorded (Fig. 4A).
First, the diffusion of poly(A)+ mRNAs in the cytoplasm
without stress was investigated and produced a fluorescence
Dynamics of mRNA in stress granules
4091
Journal of Cell Science
Fig. 4. FRAP analysis of endogenous mRNAs in living
cells. (A) Fluorescence images of a single SG that was
photobleached in a living cell. COS7 cells were
microinjected with the poly(U)22 probe and then treated
with sodium arsenite (Ars, 0.5 mM) for 60 minutes. A
single SG was then photobleached and fluorescence
intensity of the bleached area was monitored for
15 minutes. The bleached SG is indicated by a white
arrow, and the white open circle shows the spot
immediately after photobleaching. The time after
photobleaching is given in each panel. (B,C) Cytoplasm
containing no SGs without (B; means ± s.d., five cells) or
with (C; means ± s.d., five cells) arsenite treatment was
photobleached. (D) After 60 minutes of arsenite treatment,
poly(A)+ mRNAs in a single SG were photobleached
(means ± s.d., nine cells). The calculated fluorescence
recovery ratio and the fitted lines of fluorescence recovery
are also indicated on the graphs. Dashed lines indicate the
final fluorescence recovery ratio extrapolated from the
curves. Scale bar: 10 mm.
recovery of 90% (Fig. 4B). The time course of fluorescence
recovery was fitted to a single exponential curve with a time
constant of 38 seconds. We also performed the experiment in the
cytoplasm of cells under stress; ,94% of poly(A)+ mRNAs in the
cytoplasm were mobile and the time constant was 36 seconds
(Fig. 4C). We noticed that fluorescence recovery was not 100%
and we presumed that this might represent mRNAs that were
bound to the cell cytoskeleton or to other cellular structures, such
as processing bodies.
Next, FRAP of poly(A)+ mRNAs in a single SG was analyzed
(Fig. 4A). As shown in Fig. 4D, only 66% of the fluorescence
intensity recovered in SGs induced by a 60 minute treatment
of arsenite stress. This result suggested that ,34% of the
endogenous poly(A)+ mRNAs in SGs was immobile
(unrecoverable part). Interestingly, two protein components of
SGs, PAPB-I–GFP and CPEB1–GFP, are not completely mobile
in SGs (Kedersha et al., 2000; Mollet et al., 2008). These results
suggest that there is machinery in SGs that retains components
during stress. Moreover, the time course of fluorescence recovery
was biphasic, with a fast phase of 40 seconds (t1) and a slow
phase of 275 seconds (t2). The proportion of t1 was ,38% for all
mRNAs in SGs, and that of t2 was ,28%. The fast phase had a
similar time constant to that of cytoplasmic poly(A)+ mRNAs.
This could include mRNAs outside SGs, because epifluorescence
microscopy also captures the cellular region above or below the
plane of focus. In addition, examination of the ultrastructure of
SGs by electron microscopy indicated that there is some
interspace in their granular structure (Souquere et al., 2009).
Therefore, the fast phase of recovery might also include
cytoplasmic mRNAs passing through the SGs. The slow phase
was not observed in the cytoplasm, but only appeared in SGs.
This phase could represent either a fraction of poly(A)+ mRNAs
that are slowly diffusing or a fraction that is binding to and
dissociating from the SG machinery.
The dynamics of endogenous mRNAs in SGs is
independent of the duration of stress treatment,
microtubule integrity and the species of mRNA
Real-time imaging indicated that there were two steps in the
assembly of SGs (Fig. 2), which raised the possibility that the
Journal of Cell Science
4092
Journal of Cell Science 124 (23)
status of mRNAs in SGs might be different depending on the
stage of SG formation. Therefore, to test the mobility of mRNAs
in early stage SGs, we investigated the dynamics of poly(A)+
mRNAs after 30 minutes of arsenite treatment (Fig. 5A). The
results were similar to those following 60 minutes of arsenite
treatment: 65% of overall fluorescence recovered, with biphasic
time constants (t1 and t2 were 38 seconds and 299 seconds,
respectively) and the remaining 35% was unrecovered. These
data indicated that the dynamics of endogenous mRNAs in SGs
does not depend on the duration of stress treatment.
Recently, it has been reported that microtubule integrity is
required for the spatial movement of SGs, but is unnecessary
for the formation of initial SG foci (Fujimura et al., 2009;
Nadezhdina et al., 2010). We examined the influence of
microtubule integrity on the mobility of mRNAs in SGs. Cells
were treated with nocodazole to depolymerize microtubules
(Fujimura et al., 2009) and then arsenite stress was induced
(0.5 mM, 60 minutes). Unlike the untreated cells (Fig. 2),
nocodazole-treated cells formed smaller SGs that rarely merged
(supplementary material Fig. S6). Analysis of single
photobleached SGs revealed that even though the microtubules
were destroyed, 33% of the poly(A)+ mRNAs in the SGs
remained immobile (Fig. 5B). The time constants were 37
seconds (t1) and 278 seconds (t2), and the proportion of t2 was
,28%. Overall, the dynamics of endogenous mRNAs in SGs was
independent of microtubule integrity.
To investigate whether a single species of mRNA also
undergoes similar dynamics in SGs, we performed a FRAP
experiment on a single species of mRNA (Fig. 5C). We
visualized endogenous fos mRNA using a linear antisense 29O-methyl RNA probe that had been developed previously (Okabe
et al., 2011) and its dynamics were analyzed in SGs. Thirty
percent of the fos mRNA in SGs was immobile and the time
course of fluorescence recovery was biphasic with t1531
seconds and t25345 seconds. The proportion of t1 was ,29%,
and that of t2 was ,41%. These results indicated that
endogenous fos mRNA behaves in a similar way to that of
endogenous poly(A)+ mRNAs. Taken together, the dynamics
of endogenous mRNAs in SGs is independent of the duration of
stress treatment and the integrity of microtubules. Furthermore,
similar dynamic behavior was also observed for a single species
of mRNA (Fig. 5D).
A fraction of endogenous mRNAs in SGs undergoes
binding to and dissociation from the SG machinery
The fast phase of fluorescence recovery could represent the free
diffusion of mRNAs, whereas the slow phase could represent
either the slow diffusion of mRNAs or mRNAs binding to and
dissociating from the SG machinery. To determine the underlying
processes of these two phases, we varied the size of the
photobleached area when performing FRAP experiments. By
changing the diameter of the photobleached spot, the time
constant for freely diffusing mRNA should differ according to the
spot size. By contrast, mRNA bound to the SG machinery should
not be under such an influence. With the enlargement of the
spot diameter (from 3 mm to 4.5 mm and 6 mm), t1 increased
accordingly, but t2 remained almost unchanged (Fig. 6). These
results indicated that t1 represents free diffusion, whereas t2,
which was independent of the photobleached area, represents
mRNAs binding to and dissociating from the SG machinery.
To further verify the significance of t2, we performed iFRAP
experiments on SGs (Fig. 7). The fraction of endogenous
mRNAs in SGs during t2 is in equilibrium between binding to
and dissociating from the SG machinery; therefore, the slow
Fig. 5. FRAP analysis of endogenous
mRNAs in SGs under various
conditions. (A) FRAP experiment on
endogenous poly(A)+ mRNAs in a single
SG after 30 minutes of 0.5 mM arsenite
stress treatment (means ± s.d., five cells).
(B) Cells initially treated for 2 hours with
2 mg/ml nocodazole to depolymerize
microtubules, followed by 60 minutes
arsenite treatment with continuous
exposure to nocodazole (means ± s.d.,
seven cells). (C) FRAP experiment on
endogenous fos mRNA in a single SG after
60 minutes of 0.5 mM arsenite stress
treatment (means ± s.d., five cells).
Dashed lines indicate the overall recovery
ratio extrapolated from the curves.
(D) Proportion of immobile phase (black
bars), slow phase (white bar) and fast
phase (gray bar) mRNAs in SGs under
various conditions.
Dynamics of mRNA in stress granules
4093
Journal of Cell Science
Fig. 6. FRAP analysis of endogenous mRNAs in SGs with photobleached
areas of different sizes. COS7 cells were treated with 0.5 mM sodium
arsenite for 60 minutes. The diameter of the photobleached area was enlarged
from 3 mm to 4.5 mm (four cells) and 6 mm (six cells). Time courses of
fluorescence recovery were fitted using a double exponential function,
yielding the two time constants. Open circles represent t2 (mRNA binding to
and dissociating from the SG machinery), and filled triangles represent t1
(diffusion of mRNAs).
phase identified by the FRAP experiment represented the binding
process, and the iFRAP experiment should show the dissociation
process. An entire cell injected with poly(U)22 probe was
photobleached except for a single SG, and then the relative
fluorescence intensity of the SG was recorded (Fig. 7A). As
shown in Fig. 7B, 29% of the endogenous poly(A)+ mRNAs
remained in the SG, which was in agreement with the FRAP
experiment (34% immobile). Furthermore, the time course of
relative fluorescence intensity was fitted to a single exponential
curve with a time constant of 263 seconds. This time constant
was almost the same as the slow phase in the FRAP experiment,
which confirmed that a fraction of endogenous mRNAs in SGs
are in equilibrium between binding to and dissociating from the
SG machinery. The fast phase observed in the FRAP experiment
was not present here because of a long photobleaching time (40
seconds).
Discussion
In eukaryotic cells, aggregation of untranslated mRNAs and
associated proteins to SGs is a key process in the modulation of
translation during stress. This study is the first to directly
investigate SGs by monitoring endogenous poly(A)+ mRNAs in
living cells using a linear antisense 29-O-methyl RNA probe. Our
previous study showed that a linear antisense probe could
selectively bind to a specific endogenous mRNA in the
cytoplasm (Okabe et al., 2011). In this study, we monitored the
localization of endogenous cytoplasmic mRNAs during SG
formation and captured their real-time behavior in the SGs to
explore their physiological role in response to stress. Our FCS
experiments showed that most of the poly(U)22 probe (,90%)
bound to endogenous poly(A)+ mRNAs.
The dynamics of endogenous mRNAs revealed by FRAP
analysis indicated that one-third of poly(A)+ mRNAs in SGs were
immobile. This suggests that there should be machinery that
retains mRNAs in SGs during stress. Furthermore, a fraction of
poly(A)+ mRNAs, which was considered to be transiently
associated with the SG machinery, was detected by both FRAP
and iFRAP analysis. Approximately 30% of poly(A)+ mRNAs in
Fig. 7. iFRAP analysis of endogenous mRNAs in SGs. (A) Fluorescence
images of a COS7 cell before and after photobleaching. COS7 cells were
microinjected with the poly(U)22 probe and were then treated with 0.5 mM
sodium arsenite for 60 minutes. A whole cell, except for a single SG (white
arrow), was then photobleached for 40 seconds. The fluorescence intensity of
the SG was monitored for 10 minutes. The black filled circle shows the spot
without photobleaching, and the broken lines indicate the entire cell area.
Times after photobleaching are given in each panel. (B) iFRAP time course of
endogenous poly(A)+ mRNAs in a single SG after arsenite stress treatment
(means ± s.d., six cells). The dashed line indicates the final relative
fluorescence intensity extrapolated from the curve. Scale bar: 10 mm.
SGs were in equilibrium between binding to and dissociating
from SGs with a time constant of ,300 seconds. Furthermore,
mRNAs that had accumulated in SGs under stress were gradually
released after emetine treatment, which blocks rebinding of
cytoplasmic mRNAs to SGs. We also investigated the
mechanism by which endogenous mRNAs bind to the SG
machinery. First, we revealed that the association of endogenous
mRNAs with the SG machinery is independent of the maturity of
SGs, and, interestingly, it can also be observed for a single
species of mRNA. These results indicate that the harboring
mRNAs in SGs is crucial for SG function. Second, the kinetics of
endogenous poly(A)+ mRNAs we measured were found to be
different from those of MS2–GFP-tagged mRNAs (Mollet et al.,
2008). Although MS2–GFP-tagged mRNAs were recruited to
SGs, they did not remain there and showed no re-association with
the SG machinery. This implies that both endogenous and GFPtagged mRNAs can be recruited, but possibly they can be
distinguished by the machinery in SGs, and hence the MS2–GFPtagged mRNAs failed to remain in SGs.
Previous studies on SG protein components suggested that they
undergo a highly dynamic shuttling in and out (Kedersha et al.,
2000; Mollet et al., 2008). Our results for TIA-1–GFP in SGs
were consistent with this view. Taken together with our data
Journal of Cell Science
4094
Journal of Cell Science 124 (23)
showing that mRNA movement in SGs was considerably
restricted, the highly dynamic kinetics of these protein
components might indicate many mRNAs from the cytoplasm
being recruited to SGs. This phenomenon – that RNA binding
proteins showed different kinetics from endogenous mRNAs –
has also been observed in the nucleus: PAPB–GFP moves in and
out of speckles faster than poly(A)+ RNA (Molenaar et al., 2004).
The persistence of endogenous mRNAs in SGs supports the
hypothesis that SGs might function as a triage or a storage site of
mRNAs during stress (Anderson and Kedersha, 2002; Anderson
and Kedersha, 2008; Buchan and Parker, 2009). Moreover, the
endogenous mRNA binding to and dissociating from the SG
machinery might also indicate a role of SGs as a remodeling site,
where mRNAs are processed, followed by exchange with
unprocessed mRNAs.
Another interesting feature of SGs is gathering together and
merging during assembly, the physiological significance of
which remains unclear. In our study, the kinetics of mRNAs in
SGs before and after merging did not differ. These data indicate
that SGs can function without merging with each other. Possibly,
the advantage of SG merging might be to condense their
components to enhance reaction efficiency.
In conclusion, we successfully monitored the dynamic
distribution of endogenous cytoplasmic poly(A)+ mRNAs in
living mammalian cells under stress using a linear antisense
probe. The FRAP and iFRAP data suggest that a portion of the
poly(A)+ mRNAs in SGs are immobile and that a portion are in
equilibrium between association with and dissociation from SGs.
We suggest that the retention of mRNAs in SGs might contribute
to translational regulation and that it might ensure enough time
for mRNAs to be remodeled for re-initiation of translation,
degradation or storage. Determining the details of the SG
machinery requires further investigation; however, our
observations of endogenous mRNAs provide a new angle for
future studies of SGs and of the regulation of translation during
stress. In addition to cytoplasmic mRNAs, small RNAs and
argonaute protein (the protein that associates with microRNAs)
are also enriched in SGs during stress. Moreover, localization of
argonaute protein to SGs depends on the presence of microRNAs
(Leung et al., 2006). Therefore, microRNA is implicated in
having an important role in the reprogramming of mRNA
translation in SGs (Leung and Sharp, 2007; Leung and Sharp,
2010; Leung et al., 2006). Our results indicate that endogenous
mRNAs harbored in SGs are regulated in a particular way.
Clarification of the dynamics of endogenous mRNAs in SGs will
provide a new approach to reveal the function of microRNAs in
response to stress.
Materials and Methods
Cell culture
COS7 cells were cultured in DMEM (Gibco, Carlsbad, CA, USA), supplemented
with 10% fetal calf serum (Gibco) at 37 ˚C in 5% CO2. Before use, cells were
transferred to 2 ml medium without Phenol Red (Gibco) in 35 mm glass culture
dishes (ASAHI Techno GLASS, Tokyo, Japan). During all experiments, cells were
maintained at 37 ˚C on the microscope stage, using a stage plate heater (TOKAI
HIT, Fujinomiya, Japan) and a microscope objective lens heater (TOKAI HIT).
before stress was induced and was maintained after stress induction (Fujimura
et al., 2009).
Preparation of 29-O-methyl RNA probe
A poly(U)22 29-O-methyl RNA probe was synthesized by Japan Bio Services
(Saitama, Japan) as a 22 mer with Cy3 at its 59 end and biotin at its 39 end. A Cy3labeled poly(A)18 probe was used as a control and was prepared in the same way. A
29-O-methyl linear antisense probe specifically detecting fos mRNA (59-Cy3UCUAGUUGGUCUGUCUCCGC–biotin-39) was designed as previously described
(Okabe et al., 2011) and was purchased from FASMAC (Kanagawa, Japan).
Streptavidin was allowed to react with the probes at room temperature for 20 minutes
to bind to the 39 biotin to prevent the probes from accumulating in the nucleus.
Microinjection
Probes were dissolved in microinjection buffer containing 80 mM KCl, 10 mM
K2PO4 and 4 mM NaCl pH 7.2 and were then filtered using an Ultrafree-MC filter
(Millipore, Billerica, MA). The poly(U)22 probe was used at a final concentration
of 3 mM, except for FCS under stress conditions, when the probe was used at 1 mM
because 3 mM resulted in too many fluorescent molecules in the SGs to
be accurately measured by FCS. The poly(A)18 probe was also prepared at
3 mM. The filtered probe solution was microinjected into the cytoplasm of cells.
Microinjection was performed using a FemtoJet injector (Eppendorf, Hamburg,
Germany) equipped with a micromanipulator (Eppendorf) and a glass capillary
microneedle (Femtotips II; Eppendorf). The injection pressure was ,20 hPa. After
microinjection, cells were observed with a phase contrast microscope (IX 70;
Olympus, Tokyo, Japan) and obviously damaged cells were excluded from further
analysis. All analyses were performed at least 10 minutes after microinjection to
ensure that the hybridization between the probes and the mRNAs had achieved
equilibrium.
Fluorescence microscopy
Microinjection, epifluorescence microscopy and FRAP were performed on an
inverted microscope (IX 70, Olympus) using a 606 oil immersion objective lens
(UplanApo, NA 1.40; Olympus). Images were taken using a cooled CCD camera
(ORCA-ER, Hamamatsu Photonics, Shizuoka, Japan), quantitatively analyzed
using AQUA-Lite ver. 10 (Hamamatsu Photonics) and further compiled using
Adobe Photoshop ver. 6.0. For epifluorescence microscopy, Cy3 was excited with
a green solid-state laser (532 nm, 100 mW Compass 315M-100; Coherent, Santa
Clara, CA) of 1.4 mW. A dichroic mirror (565LP; Chroma Technology,
Rockingham, VT) and an emission filter (610/75M; Chroma Technology) were
used. GFP was excited with a blue laser (488 nm, 30 mW, Sapphire 488-30;
Coherent) of 1.1 mW. A dichroic mirror (Q505LP; Chroma Technology) and an
emission filter (HQ535/50x; Chroma Technology) were used.
FRAP experiments
In FRAP experiments, COS7 cells were microinjected with a poly(U)22 probe,
followed by 60 minutes of arsenite treatment (0.5 mM) to induce the assembly of
SGs. After that, a single SG was photobleached in a circle of 3 mm diameter at
maximum power of the green laser (28.5 mW) for 10 seconds. Fluorescence
recovery was followed for 10 minutes. The cytoplasm outside SGs was also
bleached using the same conditions, with or without stress. For the FRAP
experiment on TIA-1–GFP SGs, COS7 cells were transfected with the plasmid and
cultured for 18 hours before treatment with arsenite for 60 minutes. After that, a
single SG was photobleached in a circle of 3 mm in diameter at maximum power
of the blue laser (11.1 mW) for 20 seconds, and the fluorescence recovery
was followed for 1 minute. Fluorescence recoveries were recorded using
epifluorescence microscopy. Pre-bleach, bleach and post-bleach steps were
unlinked so that FRAP and epifluorescence microscopy had to be switched
manually. Therefore, some recovery had already occurred when recording was
started. Background was determined from the average fluorescence intensities
outside the fluorescently labeled cells, and was subtracted. The ratio of the
fluorescence intensity of the photobleached spot to that of the whole cell was
calculated for each time point [F(t)spot/F(t)whole cell], and the fluorescence recovery
ratio was determined as the ratio of each time point to the initial time point before
photobleaching [F(0)spot/F(0)whole cell] (Eqn 1). The time course of fluorescence
recovery was fitted by Eqn 2 as previously reported (Darzacq et al., 2007). Fitting
was performed using KaleidaGraph 3.6 (Synergy Software, Reading, PA, USA).
F(t)spot=F(t)whole cell
F(0)spot=F(0)whole cell
ð1Þ
F(t)~A3 {A1 e{t=t1 {A2 e{t=t2
ð2Þ
F(t)~
Plasmid and reagent treatments
The TIA-1–GFP plasmid was provided by Paul Anderson (Harvard Medical
School, USA). COS7 cells were transfected with the plasmid using FuGENE 6
(Roche Diagnostics, Indianapolis, IN) and cultured for 18 hours before use.
To induce arsenite stress, cells were incubated with 0.5 mM sodium arsenite
(NaAsO2; Sigma-Aldrich, Steinheim, Germany) for 60 minutes. For microtubule
depolymerization, nocodazole (Sigma-Aldrich) was used at 2 mg/ml for 2 hours
where F is fluorescence, t is time (seconds) after photobleaching, t1 and t2 are time
constants, A1 and A2 are fluorescence recovery ratios of each fraction, A3 is
overall recovery.
Dynamics of mRNA in stress granules
iFRAP experiments
iFRAP experiments were performed in the same way as FRAP experiments except
for the use of a different objective lens. To photobleach the entire cell, a 406 oil
immersion objective lens (UAPO, NA 1.35; Olympus) was used. In iFRAP
experiments, an entire cell, except for a round spot 3 mm in diameter, was
photobleached using the maximum power of the green laser (28.5 mW) for 40
seconds. The relative fluorescence intensity was determined as the ratio of the
fluorescence intensity of the SG at each time point [F(t)SG] to that before
photobleaching [F(0)SG]:
F(t)~
F(t)SG
F(0)SG
ð3Þ
FCS measurement
Journal of Cell Science
The fluorescence correlation spectroscopy (FCS) system consisted of an inverted
microscope (IX70, Olympus) equipped with a water immersion objective
lens (UplanApo, 606, NA 1.20; Olympus), a green laser (532 nm, COMPASS
415M, Cohrent), an avalanche photodiode (SPCM-AQA-14PC, PerkinElmer
Optoelectronics, Fremont, CA) and a digital autocorrelator (ALV-6010/160,
ALV-GmbH, Langen, Germany). A pinhole 30 mm in diameter was set in front of
the photodiode.
Cells were injected with Cy3-labeled probes and the spots to be measured were
in cytoplasmic space outside or inside SGs. The focal point was fixed where
maximum fluorescence intensity along the z-axis was observed. Samples were
excited by the green laser (1.56 mW), and the fluorescence from the detection
spot was separated by an emission filter (Q560LP, Chroma Technology). The
fluorescence autocorrelation function [G(t)] was measured for 10 seconds,
repeated three times, and was fitted by Eqn 4 using Origin software (Origin
Lab, Northampton, MA).
G(t)~1z
m
1X
Fi
sffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
2 ffi
N i~1 t
1 t
1z
1z
ti
s ti
ð4Þ
where s is a structural parameter defined as the ratio of vertical and axial radius of
the focus and depends on the optical alignment; N is the average number of
molecules in the focal volume; Fi and ti are the fraction and diffusion time of
component i, respectively (Yoshida et al., 2001). The fluorescence autocorrelation
function of the poly(U)22 probe was fitted with two components: t1 for F1 was
,1.3 mseconds and t2 for F2 was ,73 mseconds. The component with a fast
diffusion time was defined as the free probe and that with a slow diffusion time
was defined as the probe bound with mRNA.
Acknowledgements
We thank Paul Anderson (Brigham and Women’s Hospital, Boston,
MA) for kindly providing the GFP-TIA-1 plasmid. We also thank
Yanting Song for helping to operate the FRAP system.
Funding
This work was supported by a Grant-in-Aid for Young Scientists
from the Ministry of Education, Culture, Sports, Science and
Technology of Japan [21770162 to K.O.]; the Japan Society for
the Promotion of Science (JSPS) through its Funding Program for
World-Leading Innovation R&D in Science and Technology (FIRST
Program) [T.F.].
Supplementary material available online at
http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.090951/-/DC1
References
Anderson, P. and Kedersha, N. (2002). Stressful initiations. J. Cell Sci. 115, 32273234.
Anderson, P. and Kedersha, N. (2008). Stress granules: the tao of RNA triage. Trends
Biochem. Sci. 33, 141-150.
Anderson, P. and Kedersha, N. (2009). RNA granules: post-transcriptional and
epigenetic modulators of gene expression. Nat. Rev. Mol. Cell Biol. 10, 430-436.
4095
Breusegem, S. Y., Levi, M. and Barry, N. P. (2006). Fluorescence correlation
spectroscopy and fluorescence lifetime imaging microscopy. Nephron Exp. Nephrol.
103, 41-49.
Buchan, J. R. and Parker, R. (2009). Eukarytic stress granules: the ins and outs of
translation. Mol. Cell. 36, 932-941.
Buchan, J. R., Muhlrad, D. and Parker, R. (2008). P bodies promote stress granule
assembly in Saccharomyces cerevisiae. J. Cell Biol. 183, 441-455.
Darzacq, X., Shav-Tal, Y., de Turris, V., Brody, Y., Shenoy, S. M., Phair, R. D. and
Singer, R. H. (2007). In vivo dynamics of RNA polymerase II transcription. Nat.
Struct. Mol. Biol. 14, 796-806.
Fujimura, K., Katahira, J., Kano, F., Yoneda, Y. and Murata, M. (2009).
Microscopic dissection of the process of stress granule assembly. Biochem.
Biophys. Acta. 1793, 1728-1737.
Gilks, N., Kedersha, N., Ayodele, M., Shen, L., Stoecklin, G., Dember, L. M. and
Anderson, P. (2004). Stress granule assembly is mediated by prion-like aggregation
of TIA-1. Mol. Biol. Cell. 15, 5383-5398.
Ishihama, Y., Tadakuma, H., Tani, T. and Funatsu, T. (2008). The dynamics of premRNAs and poly(A)+ RNA at speckles in living cells revealed by iFRAP studies.
Exp. Cell Res. 314, 748-762.
Jimenez, A., Carrasco, L. and Vazquez, D. (1977). Enzymic and nonenzymic
translocation by yeast polysomes. Site of action of a number of inhibitors.
Biochemistry. 16, 4727-4730.
Kedersha, N. L., Gupta, M., Wei, L., Miller, I. and Anderson, P. (1999). RNAbinding proteins TIA-1 and TIAR link the phosphorylation of eIF-2a to the assembly
of mammalian stress granules. J. Cell Biol. 147, 1431-1441.
Kedersha, N., Cho, M. R., Li, W., Yacono, P. W., Chen, S., Gilks, N., Golan, D. E.
and Anderson, P. (2000). Dynamic shuttling of TIA-1 accompanies the recruitment
of mRNA to mammalian stress granules. J. Cell Biol. 151, 1257-1268.
Kedersha, N., Stoecklin, G., Ayodele, M., Yacono, P., Lykke-Anderson, J., Fritzler,
M. J., Scheuner, D., Kaufman, R. J., Golan D. E. and Anderson, P. (2005). Stress
granules and processing bodies are dynamically linked sites of mRNP remodeling. J.
Cell Biol. 169, 871-884.
Kimball, S. R., Horetsky, R. L., Ron, D., Jefferson, L. S. and Harding, H. P. (2003).
Mammalian stress granules represent sites of accumulation of stalled translation
initiation complexes. Am. J. Physiol. Cell Physiol. 284, 273-284.
Leung, A. K. and Sharp, P. A. (2007). MicroRNAs: a safeguard against turmoil? Cell.
130, 581-585.
Leung, A. K. and Sharp, P. A. (2010). MicroRNA functions in stress responses. Mol.
Cell 40, 205-215.
Leung, A. K., Calabrese, J. M. and Sharp, P. A. (2006). Quantitative analysis of
Argonaute protein reveals microRNA-dependent localization to stress granules. Proc.
Natl. Acad. Sci. USA 103, 18125-18130.
Magde, D., Elson, E. and Webb, W. W. (1972). Thermodynamic fluctuations in a
reacting system – measurement by fluorescence correlation spectroscopy. Phys. Rev.
Lett. 29, 705-708.
Mazroui, R., Sukarieh, R., Bordeleau, M. E., Kaufamn, R. J., Northcote, P.,
Tanaka, J., Gallouzi, I. and Pelletier, J. (2006). Inhibition of ribosome recruitment
induces stress granule formation independently of eukaryotic initiation factor 2alpha
phosphorylation. Mol. Biol. Cell 17, 4212-4219.
Molenaar, C., Marras, S. A., Slats, J. C. M., Truffert, J.-C., Lemaitre, M., Raap,
A. K., Dirks R. W. and Tanke, H. J. (2001). Linear 29-O-methyl RNA probes for the
visualization of RNA in living cell. Nucleic Acids Res. 29, e89.
Molenaar, C., Abdulle, A., Gena, A., Tanke, H. J. and Driks, R. W. (2004). Poly(A)+
RNAs roam the cell nucleus and pass through speckle domains in transcriptionally
active and inactive cells. J. Cell Biol. 165, 191-202.
Mollet, S., Cougot, N., Wilczynska, A., Dautry, F., Kress, M., Bertrand, E. and Weil,
D. (2008). Translationally repressed mRNA transiently cycles through stress granules
during stress. Mol. Biol. Cell 19, 4469-4479.
Nadezhdina, E. S., Lomakin, A. J., Shpilman, A. A., Chudinova, E. M. and Ivanov,
P. A. (2010). Microtubules govern stress granule mobility and dynamics. Biochem.
Biophys. Acta 1803, 361-371.
Okabe, K., Harada, Y., Zhang, J., Tadakuma, H., Tani, T. and Funatsu, T. (2011).
Real time monitoring of endogenous cytoplasmic mRNA using linear antisense 29-Omethyl RNA probes in living cells. Nucleic Acids Res. 39, e20.
Souquere, S., Mollet, S., Kress, M., Dautry, F., Pierron, G. and Weil, D. (2009).
Unravelling the ultrastructure of stress granules and associated P-bodies in human
cells. J. Cell Sci. 122, 3619-3626.
Unsworth, H., Raguz, S., Edwards, H. J., Higgins, C. F. and Yague, E. (2010).
mRNA escape from stress granule sequestration is dictated by localization to the
endoplasmic reticulum. FASEB J. 24, 3370-3380.
Wek, R. C., Jiang, H. Y. and Anthony, T. G. (2006). Coping with stress: eIF2 kinases
and translational control. Biochem. Soc. Trans. 34, 7-11.
Yoshida, N., Kinjo, M. and Tamura, M. (2001). Microenvironment of endosomal
aqueous phase investigated by the mobility of microparticles using fluorescence
correlation spectroscopy. Biochem. Biophys. Res. Commun. 280, 312-318.