Provided for non-commercial research and education use.
Not for reproduction, distribution or commercial use.
The Canadian Journal of Veterinary Research is published by
Canadian Veterinary Medical Association. The attached copy is
furnished to readers for personal, non-commercial research and
education use. Other uses, including reproduction and distribution,
or selling or licensing copies, or posting to personal, institutional
or third party Web sites are prohibited. Those who require further
information regarding reprints or archiving and manuscript policies
are encouraged to contact [email protected].
Veterinary Research
Recherche Vétérinaire
Canadian Journal of
Revue Canadienne de
Articles
Snatch-farrowed, porcine-colostrumdeprived (SF-pCD) pigs as a model
for swine infectious disease research
Yanyun Huang, Deborah M. Haines,
John C.S. Harding . . . . . . . . . . . . . . . . . . . . . . . 81
Prediction of serum IgG concentration by
indirect techniques with adjustment for
age and clinical and laboratory covariates
in critically ill newborn calves
Gilles Fecteau, Julie Arsenault, Julie Paré,
David C. Van Metre, Charles A. Holmberg,
Bradford P. Smith . . . . . . . . . . . . . . . . . . . . . . . 89
A method to quantify infectious airborne
pathogens at concentrations below the
threshold of quantification by culture
Timothy D. Cutler, Chong Wang,
Steven J. Hoff, Jeffrey J. Zimmerman . . . . . . . . 95
Influence of temperature and organic load
on chemical disinfection of Geobacillus
steareothermophilus spores, a surrogate
for Bacillus anthracis
Jiewen Guan, Maria Chan, Brian W. Brooks,
Liz Rohonczy . . . . . . . . . . . . . . . . . . . . . . . . . . 100
Effect of a straw-derived
xylooligosaccharide on broiler growth
performance, endocrine metabolism,
and immune response
Sun Zhenping, Lv Wenting, Yu Ruikui, Li Jia,
Liu Honghong, Sun Wei, Wang Zhongmie,
Li Jingpan, Shan Zhe, Qin Yuling . . . . . . . . . . 105
The rabbit as an infection model for
equine proliferative enteropathy
Francesca Sampieri, Andrew L. Allen,
Nicola Pusterla, Fabio A. Vannucci,
Aphroditi J. Antonopoulos, Katherine R. Ball,
Julie Thompson, Patricia M. Dowling,
Don L. Hamilton, Connie J. Gebhart . . . . . . . 110
Effects of vitamin E supplementation
on cellular a-tocopherol concentrations
of neutrophils in Holstein calves
Hidetoshi Higuchi, Erina Ito, Hidetoma Iwano,
Shin Oikawa, Hajime Nagahata . . . . . . . . . . . 120
Preliminary study on the factors
influencing rabbit doe reproductive
efficiency: Effect of parity, day of mating,
and suckling on ovarian status and
estrogen levels at day 6 of pregnancy
Maria Laura Marongiu, Corrado Dimauro . . . 126
A p r i l / Av r i l 2 0 1 3 , V o l . 7 7 N o . 2
table of contents continued on back cover/
la table des matières se poursuit sur la
couverture arrière
Established in 1937
FOR PERSONAL USE ONLY
ISSN 0830-9000
Canadian Journal of
Ve t e r i n a r y R e s e a r c h
Revue canadienne de
recherche vétérinaire
Formerly CANADIAN JOURNAL OF COMPARATIVE MEDICINE
Remplace la REVUE CANADIENNE DE MÉDECINE COMPARÉE
The journal publishes the results of original research in veterinary
and comparative medicine. Manuscripts must be as concise as possible, and the research described must represent a significant contribution to knowledge in veterinary medicine. Full-length papers,
short communications, and review papers are welcome. All manuscripts will be reviewed for scientific content and editorial accuracy.
Manuscripts must conform to the Instructions for Authors found
on the CVMA Web site. Consultation of a recent issue of the journal
to ensure that the manuscript conforms to current style is also recommended. Please use the Web site (www.canadianveterinarians.net)
to submit articles. A publication charge of $90 per published page,
plus a cost of $10 per table, $15 per illustration, and $150 per color
illustration is payable by contributors. Instructions for ordering
reprints are sent with the galley proofs. Color illustrations will only
be published if the author(s) agree to pay the extra cost.
La revue publie les résultats de recherches originales en médecine
vétérinaire et comparative. Les manuscrits doivent être aussi brefs que
possible et la recherche décrite doit apporter une contribution importante à la médecine vétérinaire. Les exposés complets, les communi­
cations brèves et les comptes rendus sont bienvenus. Nous véri­fierons
le fonds ­scientifique et la forme de tous les manuscrits.
Les manuscrits doivent être conformes aux directives aux auteurs
qui se trouvent sur le site Web de l’ACMV. La consultation d’un
récent numéro de la revue est aussi profitable, afin de s’assurer qu’un
manuscrit se conforme au style courant. Veuillez utiliser le site Web
(www.veterinairesaucanada.net) pour soumettre les articles. Les
auteurs doivent acquitter des frais de 90 $ par page publiée, 10 $
pour chaque tableau, 15 $ pour chaque illustration, et 150 $ pour
chaque illustration en couleur. Un formulaire de commande de
tirés à part accompagne l’en­voi des épreuves d’un manuscrit. Les
illustrations en couleurs ne seront publiées que si les auteurs en
assument les frais supplémentaires.
Canadian Journal of Veterinary Research
Revue canadienne de recherche vétérinaire
Editor — Rédacteur
Éva Nagy, Guelph, Ontario
Associate Editor — Rédacteur adjoint
Deborah M. Haines, Saskatoon, Saskatchewan
Assistant Editors — Assistants à la rédaction
Serge Messier, Saint-Hyacinthe (Québec)
Jeffrey J. Wichtel, Charlottetown, Prince Edward Island
Managing Editor — Directrice de la rédaction
Heather Broughton, Ottawa, Ontario
Assistant Managing Editor — Directrice adjointe à la ­rédaction
Stella Wheatley, Ottawa, Ontario
Advertising Manager — Gérante de la publicité
Laima Laffitte, Wendover, Ontario
Editorial Coordinator/Coordonnatrice de la rédaction
Beverley Kelly, Ottawa, Ontario
Abstracted and/or indexed in:/Résumé et/ou catalogué dans :
Biological Abstracts
Index Veterinarius
Chemical Abstracts
Nutrition Abstracts
Current Contents (Agric. Section)
Science Citation Index
EMBASE/Excerpta Medica
Veterinary Bulletin
Index Medicus
Derwent Veterinary
Drug File
Address all correspondence to/Adresser toute correspondance à :
Canadian Journal of Veterinary Research
Revue canadienne de recherche vétérinaire
339, rue Booth Street, Ottawa, Ontario K1R 7K1
Tel./Tél. : (613) 236-1162 — Fax/Télécopieur : (613) 236-9681
e-mail/Courriel : [email protected]
© Canadian Veterinary Medical Association 2013.
L’Association canadienne des médecins vétérinaires 2013
Subscriptions/Abonnements —
Canada
Foreign/Étranger
2013
$150 $ ( applicable GST/HST;
TPS/TVH en vigueur)
$165 $ US/É.-U.
Typesetting/Typographie
AN Design Communications
www.an-design.ca
Published quarterly by the Canadian Veterinary Medical Association
Publication trimestrielle de l’Association canadienne des
médecins vétérinaires
Return undeliverable Canadian addresses to: 339 rue Booth Street, Ottawa, Ontario K1R 7K1, e-mail: [email protected]
FOR PERSONAL USE ONLY
Article
Snatch-farrowed, porcine-colostrum-deprived (SF-pCD) pigs as a model
for swine infectious disease research
Yanyun Huang, Deborah M. Haines, John C.S. Harding
Abstract
The current study tested the benefit of commercially available spray-dried bovine colostrum (The Saskatoon Colostrum
Company, Saskatoon, Saskatchewan) in raising snatch-farrowed, porcine-colostrum-deprived (SF-pCD) pigs. In experiment 1,
12 SF-pCD pigs received a liquid diet composed mainly of bovine colostrum from birth to day 10; 6 remained on the same liquid
diet (COL), and the other 6 were fed a diet composed mainly of milk replacer (RPL) until weaning. In experiment 2, 12 SF-pCD
pigs were fed mainly bovine colostrum before weaning; after weaning, 6 were fed a starter diet containing 20% (w/w) bovine
colostrum powder (STARTER-COL), and the other 6 were fed a starter diet without any bovine colostrum (STARTER-CTRL)
until termination (day 42 or day 49). In experiment 1 the COL pigs had significantly fewer fever-days than did the RPL pigs.
In experiment 2 diarrhea, typhlocolitis, and pancreatic degeneration developed in 4 of the STARTER-COL pigs after weaning.
In both experiments all the pigs fed mainly bovine colostrum before weaning survived until termination. All pigs tested free
of swine influenza virus H1N1 and H3N2, Porcine reproductive and respiratory syndrome virus, and Porcine parvovirus. In
experiment 2 all the pigs tested free of Porcine circovirus type 2 (PCV2), but some in both groups tested positive for Torque
teno virus genogroups 1 and 2. In conclusion, with the use of snatch-farrowing and bovine colostrum, pigs can be raised in the
absence of porcine maternal antibodies with 100% survival and freedom from most porcine pathogens of biologic relevance.
This model is potentially suitable for animal disease research.
Résumé
La présente étude visait à tester l’avantage du colostrum bovin déshydraté disponible commercialement pour élever des porcs captés à la misebas et privés de colostrum porcin (SF-pCD). Dans l’expérience 1, 12 porcs SF-pCD ont reçu une diète liquide composée principalement de
colostrum bovin de la naissance au jour 10; 6 sont demeurés sur la même diète liquide (COL), et les 6 autres étaient nourris avec une diète
composée principalement de substitut de lait (RPL) jusqu’au sevrage. Dans l’expérience 2, 12 porcs SF-pCD étaient nourris principalement
avec du colostrum bovin avant le sevrage; après le sevrage, 6 étaient nourris avec une diète de début contenant 20 % (poids/poids) de poudre
de colostrum bovin (STARTER-COL), et les 6 autres étaient nourris avec une diète de début mais sans le colostrum bovin (STARTER-CTRL)
jusqu’à la fin de l’expérience (jour 42 ou jour 49). Dans l’expérience 1, les porcs COL avaient significativement moins de jours avec fièvre
que les porcs RPL. Dans l’expérience 2, de la diarrhée, une typhlocolite et une dégénération du pancréas s’est développée chez 4 des porcs
STARTER-COL après le sevrage. Dans les 2 expériences tous les porcs nourris principalement avec du colostrum bovin avant le sevrage
ont survécu jusqu’à la fin de l’expérimentation. Tous les porcs se sont avérés négatifs pour les virus H1N1 et H3N2 de l’influenza porcin, le
virus du syndrome reproducteur et respiratoire porcin, et le parvovirus porcin. Dans l’expérience 2, tous les porcs ont testé négatif pour le
circovirus porcin de type 2 (PCV2), mais quelques-uns dans les 2 groupes ont testé positif pour le virus Torque teno des génogroupes 1 et 2.
En conclusion, avec l’utilisation de la mise-bas avec captation et de colostrum bovin, les porcs peuvent être élevés en absence d’anticorps
maternels porcins avec un taux de survie de 100 % et l’absence des principaux agents pathogènes porcins d’importance biologique. Ce modèle
est potentiellement approprié pour la recherche sur les maladies animales.
(Traduit par Docteur Serge Messier)
Introduction
In porcine research, especially that investigating infectious diseases, obtaining pigs that are free of porcine pathogens is essential.
Currently, 3 main methods are used to obtain such pigs: testing of
conventional pigs for antigen and antibodies of certain pathogens,
the pigs testing negative being labeled specific pathogen free (SPF);
the cesarean-derived colostrum-deprived (CDCD) method; and
the gnotobiotic or germ-free technique. The advantage of the SPF
method is its convenience, low technical requirement, and cost efficiency. However, when the research requires freedom of infection
with pathogens that are highly prevalent in pig populations, such as
Department of Large Animal Clinical Sciences, Western College of Veterinary Medicine, University of Saskatchewan, 52 Campus Drive,
Saskatoon, Saskatchewan S7N 5B4 (Huang and Harding); Department of Veterinary Microbiology, Western College of Veterinary Medicine,
University of Saskatchewan, 52 Campus Drive, Saskatoon, Saskatchewan S7N 5B4, and The Saskatoon Colostrum Company, 30 Molaro Place,
Saskatoon, Saskatchewan S7K 6A2 (Haines).
Address all correspondence to Dr. Yanyun Huang; telephone: 306-966-6480; e-mail: [email protected]
Received December 22, 2011. Accepted March 22, 2012.
2013;77:81–88
The Canadian Journal of Veterinary Research
81
FOR PERSONAL USE ONLY
Table I. Ingredients in the liquid diets fed until weaning to snatch-farrowed, porcine-colostrum-deprived pigs in experiments 1
and 2
Experiment 1
Days 1 to 3
Days 4 to 10
Days 11 to 15
Days 16 to 23
Experiment 2
Ingredienta
RPL
COL
RPL
COL
RPL
COL
RPL
COL
Days 1 to 3
Days 4 to 21
Colostrum A20200 0 0
0 0 0 20
0
(%, w/v)
Colostrum B
(%, w/v)
0
0
15
15
Reduce to 5
15
5
15
0
15
Milk replacer
000 0Increase to 13
01300
(%, w/v)
0
Iron (mg/kg 250250250 250250
milk solids)
250250 250250
250
IgY K88
(g/pig/d)
22 22
2
222 22
Warm water
0.3–0.53
0.67–1.67
1.84–2.5
2.67–3.33
0.3–0.53
0.67–3.33
(L/pig/d)
aColostrum A — HeadSTART, The Saskatoon Colostrum Company, Saskatoon, Saskatchewan; Colostrum B — Calf’s Choice Total HiCal, The
Saskatoon Colostrum Company; milk replacer — WetNurse, Prairie Micro-Tech, Regina, Saskatchewan; iron — Enfamil Fer-In-Sol syrup (30 mg of
elemental iron per 5 mL), Mead Johnson & Company, Ottawa, Ontario; IgY K88 — Hyper-Egg K88; J.H. Hare & Associates, Winnipeg, Manitoba.
RPL — Replacement: dietary colostrum was gradually replaced with milk replacer from day 11 until 5% colostrum remained in the diet;
COL — Colostrum: the diet consisted mainly of bovine colostrum until day 20.
Porcine circovirus type 2 (PCV2), this method may be inadequate, as
most pigs have antibodies against these pathogens, either maternal
or acquired, or are actively infected with the pathogen of interest.
As a result, researchers may have to screen a large number of farms
and pigs to obtain a reliable pig source and then select pigs after the
level of maternally derived antibodies has waned.
The CDCD and gnotobiotic methods use cesarean section to obtain
term piglets from pregnant sows. The CDCD pigs are raised in
sterile compartments for several days and then in a clean room (1).
Gnotobiotic pigs are raised entirely in sterile compartments.
Although the CDCD and gnotobiotic methods are reliable for obtaining pathogen-free pigs, they have several disadvantages compared
with the SPF method, including the need for surgery, specialized
facilities, and sterile compartments, and the greater cost. In addition,
gnotobiotic experiments are limited to only a few weeks, after which
the pigs outgrow the sterile compartments. There is also a risk that
cesarean-derived pigs, especially if delivered before term, do not
fully experience the prenatal serum cortisol surge that occurs in vaginally delivered pigs (2). This surge plays an important role in tissue
maturation, immunoglobulin absorption, surfactant production, and
deposition of glycogen in muscle and liver (3). This helps to explain
why morbidity and mortality rates are higher in cesarean-derived
piglets than in naturally born cohorts. Further, there is debate as to
whether gnotobiotic pigs have the same immunologic responses
as naturally born pigs because they are not exposed to microbial
programming, as are piglets reared in natural environments (4).
Recent attempts to raise snatch-farrowed, porcine-colostrumdeprived (SF-pCD) pigs with bovine colostrum have provided an
alternative method for obtaining susceptible pigs for infectious disease experiments (5,6). In this method, pigs are fed bovine colostrum
82
The Canadian Journal of Veterinary Research
for 3 d and a porridge of milk replacer and dry feed from day 4 to
14 and then are weaned onto a dry diet on day 15. The advantages
of this method are that the pigs experience natural vaginal delivery
and bacterial colonization of their intestines and thus are more
representative of conventional pigs than are CDCD or gnotobiotic
pigs. However, the survival rates in these studies were at most 80%,
mostly because of deaths from septicemia due to Escherichia coli or
staphylococci (5,6). A further disadvantage was that the pigs were
weaned much earlier than in the commercial industry and at an
age when there may not be enough digestive enzymes to efficiently
cope with solid feed.
In the present study a method of raising SF-pCD pigs is
described that used commercially available bovine colostrum products (HeadSTART and Calf’s Choice Total HiCal; The Saskatoon
Colostrum Company, Saskatoon, Saskatchewan). With this method
the pigs were weaned at 21 or 24 d of age, all survived, and they
were free of major porcine pathogens and maternal antibodies,
such that they were fully susceptible to challenge with pathogens
and receptive to vaccination at an early age. This method is thus
an alternative to cesarean-derived methods of producing porcinecolostrum-deprived pigs for infectious disease research.
Materials and methods
Snatch-farrowing, animal care, and experimental
design
This work was approved by the University of Saskatchewan’s
Animal Research Ethics Board and adhered to the Canadian Council
on Animal Care guidelines for humane animal use (7).
2000;64:0–00
FOR PERSONAL USE ONLY
Table II. Ingredients and nutrient levels in the dry starter diet fed to the pigs after
weaning
Experiment 2
Experiment 1
STARTER-COL
STARTER-CTRL
Ingredients
(%)(%) (%)
Wheat
30.9044.80 30.90
Colostrum B
0
20.00
0
White fish meal
8.61
0
8.61
Oat groat
15.00
15.00
15.00
Whey permeate
20.00
11.40
20.00
Soybean meal
15.00
3.60
15.00
NuProa
5.000
5.00
Canola oil
3.00
2.00
3.00
Limestone
0.430.90 0.43
Salt
0.440.63 0.44
Monocalcium phosphate
0
0.63
0
Zinc oxide
0.40
0.40
0.40
Lysine
0.470.36 0.47
0.20
0.20
0.20
Starter microbial phytase
Choline chloride
0.08
0.08
0.08
Methionine
0.250.03 0.25
Threonine
0.200
0.20
L-tryptophan
0.030
0.03
Nutrientsb
Crude protein
21.7
21.5
21.7
Crude fat
1.5
8.4
1.5
5.6
1.6
5.6
Crude fibre
Digestible energy (Mcal/kg)
3.69
3.76
3.69
Net energy (Mcal/kg)
2.62
2.76
2.62
Calcium
0.90.9 0.9
Available phosphorus
0.8
0.7
0.8
0.470.45 0.47
Sodium
Total lysine
1.58
1.64
1.58
Total threonine:lysine
0.64
0.77
0.64
Total methionine 1 cystine:lysine
0.58
0.61
0.58
Total tryptophan:lysine
0.17
0.20
0.17
aAlltech Canada, Guelph, Ontario.
bAs-fed basis; estimated 90% dry matter.
STARTER-COL — Diet devoid of all animal by-products except 20% (w/v) colostrum B;
STARTER-CTRL — Same starter diet as used in e­ xperiment 1.
Pregnant sows at the Prairie Swine Center, Saskatoon,
Saskatchewan, were used as the source of SF-pCD pigs. Parturition
was induced by intramuscular injection of a commercial prostaglandin analogue (Planate; Merck Animal Health Canada, Kirkland,
Quebec) on day 115 of pregnancy. The perivulvar area of the sows
and the pens in which the sows were housed were washed with
warm water twice on the day before expected parturition and
sprayed with an iodine disinfectant (Prepodyne; West Penetone,
Ville d’Anjou, Quebec). Before parturition a clean drape was placed
behind the sow to reduce the risk of environmental contamination
of the piglets. During parturition, the piglets were snatched before
contacting the floor, farrowing equipment, or barn facilities. The
umbilical cords were clamped and disinfected with Prepodyne.
Within 1 min of birth the piglets were placed in sealed plastic
2000;64:0–00
containers fitted with a high-efficiency particulate air filter, which
provided filtered fresh air during transportation to a Biosafety
Level 2 animal care room with positive pressure ventilation at the
University of Saskatchewan. The animal room was disinfected twice
at 24-h intervals before pig entry: first with 7% hydrogen peroxide
solution (Peroxigard; Bayer, Toronto, Ontario) and then with 1%
Virkon solution (Antec International, Lavaltrie, Quebec). The piglets
were raised in groups of 2 (for experiment 2) or 3 (for experiment 1)
per pen on an elevated plastic floor. The concrete floor beneath the
plastic flooring was washed 2 to 3 times each week in experiment 1
and daily in experiment 2. The room temperature was set at 30°C
from day 1 to day 21 and was decreased by 1°C weekly thereafter.
Before weaning, a heat lamp was provided for each pen and the
height of the lamps adjusted according to the pigs’ comfort level
The Canadian Journal of Veterinary Research
83
FOR PERSONAL USE ONLY
(pigs sleep comfortably on their sides under the heat lamp with
their abdomens exposed).
After entry to the animal care room the piglets were fed a liquid
diet (Table I) hourly for the first 6 h, every 2 h from 6 to 24 h of
age, and 4 times per day (8 am, 12 am, 4 pm, and 10 pm) thereafter
until weaning. The pigs were initially bottled-fed, and the liquid
diet was also provided in a liquid feeder (product BPW4; Miller
Manufacturing Company, Eagan, Minnesota, USA) in the pen to
encourage drinking from the feeder. Once a pig was observed to be
drinking from the feeder, bottle-feeding was discontinued for that
pig. All pigs began to drink from the feeder within 48 h of age. The
liquid diets contained combinations of the following ingredients:
spray-dried bovine colostrum powder containing at least 25%
bovine immunoglobulin G (bIgG) (HeadSTART), spray-dried bovine
colostrum powder containing at least 14% bIgG (Calf’s Choice Total
HiCal), commercial pig milk replacer (WetNurse; Prairie Micro-Tech,
Regina, Saskatchewan), spray-dried whole egg powder containing
polyclonal antibodies to E. coli K88 (Hyper-Egg K88; J.H. Hare &
Associates, Winnipeg, Manitoba), and an oral iron supplement
(Enfamil Fer-In-Sol syrup; Mead Johnson & Company, Ottawa,
Ontario; 30 mg of elemental iron per 5 mL). The targeted dry matter
fed to each pig in the liquid diet gradually increased from 66 g/d on
day 1 to 500 g/d on day 20, and the feeding volume increased from
150 to 3300 mL/d over the same period. The exact feeding amount
and volume varied somewhat according to appetite. The pigs were
weaned on day 24 (in experiment 1) or day 21 (in experiment 2) to a
custom starter diet without porcine by-products (Table II); the treatment group in experiment 2 was weaned to a diet that contained
bovine colostrum powder.
No prophylactic parenteral antibiotic treatment was used before
the pigs entered the animal care room or before weaning, and
no antibiotics were added to the starter feeds. In experiment 1,
when a pig’s temperature was greater than 40°C, oxytetracycline
(Bio-Mycin 200; Boehringer Ingelheim, Burlington, Ontario) was
administered intramuscularly (20 mg/mL) to relieve the symptoms
of septicemia.
Experiment 1 aimed to compare the effects of 2 different liquid
diet formulations on the health of SF-pCD pigs. The 12 SF-pCD pigs
used in this experiment were conveniently placed, in the order they
arrived at the facility, into 4 3 6 ft (1.23 3 1.85 m) pens (3 pigs per
pen) equipped with a liquid feeder. Unlimited access to water was
provided by a nipple drinker. All the pigs were housed in the same
room throughout the experiment. The 6 pigs in 2 systematically
selected pens (pens 1 and 2) were fed a liquid diet composed mainly
of bovine colostrum for the first 10 d, and then the colostrum was
gradually replaced with milk replacer (RPL) until 5% (w/v) colostrum was left in the diet; they were designated the RPL group. The
6 pigs in the remaining 2 pens (pens 3 and 4) were fed a liquid diet
composed mainly of bovine colostrum (COL) throughout days 1
to 20 and were designated the COL group. The starter diet was
introduced to all the pigs on day 20, and the pigs were fully weaned
on day 24. Blood samples were drawn from the cranial vena cava of
half of the pigs in each group into tubes containing ethylene diamine
tetraacetic acid (EDTA) 24 h after the initial colostrum feeding and
weekly thereafter. The rectal temperature was measured daily from
entry to the animal care room until day 33. The experiment was ter-
84
The Canadian Journal of Veterinary Research
minated on day 35, when all the surviving animals were euthanized
with intravenous barbiturate and underwent necropsy.
Experiment 2 aimed to evaluate the potential benefits of adding
bovine colostrum powder to the dry starter diet fed after weaning.
The 12 SF-pCD pigs used in this experiment were housed 2 per pen,
conveniently selected. All were kept in the same room throughout
the experiment. Before weaning on day 21, all the pigs were fed
a liquid diet composed mainly of bovine colostrum. At weaning,
the pigs were systematically allocated into 2 groups. The pigs in
3 pens (pens 2, 4, and 6) were fed a dry starter diet devoid of animal
by-products except for 20% (w/w) colostrum (Calf’s Choice Total
HiCal) and designated the STARTER-COL group. The pigs in the
remaining 3 pens (pens 1, 3, and 5) served as the control group and
were fed the same starter diet as was used in experiment 1 without
additional colostrum; they were designated the STARTER-CTRL
group. Blood samples were drawn from the cranial vena cava into
EDTA tubes 24 h after the initial colostrum feeding and weekly
thereafter. The rectal temperature was measured daily until day 30
and twice weekly thereafter. Half of the pigs in each group were
euthanized by intravenous barbiturate on day 42 and the remainder
on day 49. Necropsy was done immediately after euthanasia.
Packed cell volume (PCV) and plasma total
protein concentration
In both experiments the PCV was determined in the whole blood
samples by the capillary tube method, and the plasma total protein
concentration was determined by refractometry.
Histopathological examination of tissues
Internal organs were collected at necropsy, preserved in 10%
formalin, and processed for histopathological examination. Tissues
examined included brain, nasal turbinate, salivary gland, tonsil,
thymus, lung, heart, bronchial lymph node, stomach (fundus and
pylorus), duodenum, jejunum, ileum, spiral colon, cecum, mesenteric lymph node, adrenal gland, kidney, and superficial inguinal
lymph node.
Adjunct tests for porcine pathogens
In both experiments the plasma from blood collected immediately
before necropsy was examined for the presence of pathogen-specific
antibodies by enzyme-linked immunosorbent assay with commercial
kits used according to the manufacturer’s instructions by Prairie
Diagnostic Services (PDS), Saskatoon, Saskatchewan. The samples
were tested for antibodies to swine influenza virus (SIV) with Swine
Influenza Virus Antibody Test Kit H1N1 (part 99-06731) and Swine
Influenza Virus Antibody Test Kit H3N2 (part 99-09332) from IDEXX
Laboratories, Westbrook, Maine, USA, and for Porcine reproductive
and respiratory syndrome virus (PRRSV) with PPRS X3 HerdChek,
Porcine Reproductive and Respiratory Virus Antibody Test Kit
(part 99-18070), from IDEXX Laboratories. An in-house hemagglutination (HA) inhibition assay adapted from a previously described
protocol (8) was used by PDS to test for Porcine parvovirus (PPV)
antibody. Briefly, PPV propagated in the laboratory from a diagnostic
isolate was used as the HA antigen and was incubated at a concentration of 6 HA units with 2-fold dilutions of serum starting at 1:20.
Hemagglutinating activity was assessed with the use of chicken
2000;64:0–00
FOR PERSONAL USE ONLY
Days
Days
Figure 1. Body temperatures of snatch-farrowed, porcine-colostrum-deprived (SF-pCD) pigs in experiment 1. Between days 11 and 20 of life the pigs
fed bovine colostrum as the main component of their diet (left panel) had significantly fewer days of fever (P = 0.009) than the pigs for which the
colostrum was gradually replaced with milk replacer from day 11 (right panel) before weaning to a dry feed.
erythrocytes. An antibody test for PCV2 was done with a previously
described in-house immunoperoxidase monolayer assay (9). In both
experiments polymerase chain reaction (PCR) was used to test for
the presence of PCV2 DNA in plasma collected at all time points and
in spleen, superficial inguinal lymph node, and tonsil collected at
necropsy (10). Additionally, in experiment 2 PCR was used to test
for the presence of DNA of Torque teno virus (TTV) genogroups 1
and 2 in bone marrow (11). For pigs that died or were euthanized
for humane reasons before the end of the experiment, lung, spleen,
and joint or abdominal fluid was cultured for bacteria under both
aerobic and anaerobic conditions.
Statistical analysis
Differences between the groups in frequencies of lesions were
compared by Fisher’s exact test. The group difference in plasma bIgG
concentration on day 1 was compared by the Mann–Whitney U test.
The numbers of fever-days, defined as the total number of days that
individual pigs had a body temperature of 39.5°C or greater, were
compared between groups by generalized linear models with the
use of a Poisson regression and SPSS Predictive Analytics SoftWare
Statistics 18 (SPSS, Chicago, Illinois, USA). Probabilities of less than
0.05 were considered statistically significant.
Plasma IgG concentrations
The concentration of bIgG in plasma was determined by radial
immunodiffusion (RID) as previously described (12). The plasma
half-life of bIgG was calculated with the following formula:
ConB
T = (T*log2)/log
1/2
ConE
where: T1/2 is the half-life, T the total time period, ConB the beginning bIgG concentration, and ConE the ending bIgG concentration.
All plasma collected in experiment 2 was also tested for porcine (p)
IgG by RID as previous described (13). The plasma pIgG concentrations were not compared by statistical methods because half of
the pigs in each group were euthanized on day 42 and the remainder on day 49, which substantially reduced the statistical power
(n = 3).
2000;64:0–00
Results
Experiment 1
All the pigs learned to drink from the liquid feeder within 48 h
of entry to the animal care room. Four of the six RPL pigs and all
the COL pigs survived until the termination of the experiment (on
day 35). One RPL pig was observed to have atresia ani on day 2,
defecating by way of a rectovaginal fistula. Lethargy, anorexia, and
temperature elevation (to 40.4°C) developed on day 16, and the animal was euthanized by intravenous administration of barbiturate.
Acute fibrinous polyserositis and renal petechiae were noted grossly.
Histopathological changes were consistent with acute septicemia,
and E. coli was cultured from lung, spleen, and joint fluid. Lethargy,
anorexia, and temperature elevation (to 41.4°C) developed in another
The Canadian Journal of Veterinary Research
85
FOR PERSONAL USE ONLY
Figure 2. Plasma concentrations of bovine and porcine immunoglobulin G
(bIgG and pIgG) in the SF-pCD pigs in experiments 1 and 2. Squares indicate mean values for experiment 1. Triangles indicate mean values for
bIgG and diamonds mean values for pIgG in experiment 2. The vertical
lines represent standard deviations.
RPL pig, on day 22. Gross and histological lesions indicated acute
septicemia, and E. coli was cultured from lung, spleen, and abdominal fluid. Both E. coli isolates were not further characterized.
The RPL pigs had significantly more fever-days than the COL pigs
from day 11 to day 20 (16 fever-days in 50 total pig-days for the RPL
pigs versus 5 fever-days in 54 pig-days for the COL pigs; P = 0.009)
but not from day 1 to day 10 or from day 21 to day 33 (P . 0.05)
(Figure 1). Two of the 4 RPL pigs and 4 of the 6 COL pigs had mild
neutrophilic infiltration in the mesenteric lymph nodes, but the difference was not statistically significant (P . 0.05). No other pathological changes were observed in the pigs that survived until day 35.
The RPL pigs had marginally but significantly higher plasma
concentrations of bIgG at days 1 and 7 (P = 0.0495) than the COL
pigs even though the groups had the same diet during this time.
The levels were highest 24 h after initial colostrum intake and
then decreased rapidly in the first 2 wk of life to negligible levels
(Figure 2). The half-life of bIgG in experiment 1 was 9.2 d. The PCV
and plasma total protein concentration remained within normal
limits throughout the experiment (data not shown).
At termination, all the pigs were negative for antibodies to SIV
(H1N1 and H3N2), PRRSV, and PPV. However, 1 COL pig was positive for PCV2 antibody, and PCV2 DNA was detected by PCR in the
plasma from day 21 to day 35, as well as in spleen and superficial
inguinal lymph node collected at necropsy. Another COL pig, reared
in the same pen, remained negative for PCV2 antibody but had PCV2
DNA detected by PCR in spleen and superficial inguinal lymph node
collected at necropsy.
Experiment 2
All the pigs learned to drink from the liquid feeder by 48 h. All
pigs in both groups survived until the end of the experiment. The
feces of all the STARTER-CTRL pigs were of normal consistency
throughout the experiment. Four of the six STARTER-COL pigs had
semiliquid diarrhea from day 27 (6 d after weaning) until the end
86
The Canadian Journal of Veterinary Research
of the experiment, but they remained alert and otherwise healthy.
Necropsy of these pigs revealed a dilated colon and cecum that
contained unformed feces. The large intestinal mucosa was reddened, and mesocolonic blood vessels were congested. Histologic
examination showed typhlocolitis with combinations of the following changes: bacterial attachment on the mucosa, degeneration and
necrosis of the epithelial cells, and congestion, edema, and mixed
inflammatory cell infiltration of the lamina propria. No adjunct
tests were carried out to determine the cause of the typhlocolitis.
In addition, the pancreas was firm and had a nodular appearance
on gross examination in all the STARTER-COL pigs; microscopic
examination showed pancreatic glandular epithelial degeneration
and necrosis with regeneration and fibrosis. In the STARTER-CTRL
pigs the pancreas was normal macroscopically and microscopically
except in 1 pig, which had mild microscopic pancreatic degeneration.
Both groups had only 2 fever-days in total.
As in experiment 1, the plasma concentrations of bIgG were
highest 1 d after initial colostrum intake, then decreased rapidly
in the first 2 wk to negligible levels (Figure 2). The half-life of bIgG
in experiment 2 was 5.5 d. Porcine IgG was not detectable in the
plasma until day 21 and then gradually increased to 5 g/L by day 49
(Figure 2). The PCV and plasma total protein concentration remained
within normal limits through the experiment (data not shown).
All the pigs were negative at the end of experiment 2 for antibodies to SIV (H1N1 and H3N2), PRRSV, PPV, and PCV2. The absence
of PCV2 infection was confirmed by PCR in plasma and tonsil;
however, PCR detected TTV1 DNA in 1 STARTER-COL pig and
4 STARTER-CTRL pigs, as well as TTV2 DNA in 1 of the latter 4 pigs.
Discussion
In the current study, neonatal SF-pCD pigs were successfully
raised on a bovine-colostrum-based liquid diet, all remaining
serologically negative for SIV, PRRSV, and PPV. Moreover, all but
1 pig remained serologically negative for PCV2, and only 2 pigs
(in experiment 1) had detectable PCV2 DNA in serum or tissues. In
both experiments, all the pigs fed mainly bovine colostrum before
weaning survived until termination of the experiment.
The bovine colostrum was likely the main factor contributing to
the high survival rate. It is well-known that the epitheliochorial placentation in pigs and other farm mammals prevents macromolecule
transportation from dam to fetus. Thus, pigs are born hypogammaglobulinemic, with only trace amounts of immunoglobulin in
the blood. As a result, neonatal pigs have a low survival rate when
neither sow colostrum nor immunologic supplements derived from
other sources are fed, in spite of intensive treatment with antibiotics (14). In other studies using bovine colostrum in neonatal pigs,
colostrum was fed for only a few days (5,6,14), and the survival rate
was at most 80% (6,14). In the present experiments, the use of commercially available spray-dried bovine colostrum powder allowed
more protracted use of the colostrum and enables the SF-pCD technique to be easily adopted by others. It is clear from our results that
providing bovine colostrum to pigs after gut closure provides health
benefits up to weaning at 3 wk of age. Although immunoglobulins
cannot be absorbed in a substantial quantity after gut closure, and
the plasma half-life of bIgG in these experiments was shorter than
2000;64:0–00
FOR PERSONAL USE ONLY
that of pIgG (at least 12 to 14 d) (15), they and the other antimicrobial
substances present in colostrum may provide local immunity in the
gastrointestinal tract.
It is noteworthy, however, that bovine colostrum fed after weaning
to the SF-pCD pigs, in experiment 2, was associated with persistent
diarrhea, typhlocolitis, and pancreatic degeneration. The mechanism
for this phenomenon was not determined. The level of fat in the diet
supplemented with colostrum was 8.4% compared with 1.5% in the
diet without the supplementation (Table II). The additional colostrum
powder in the diet after weaning, without consideration of the fat levels in the diet, may exceed the capacity of the pancreatic enzymes and
cause maldigestion and diarrhea (likely osmotic). Irrespective of the
reason, the finding of no benefit to supplementation with bovine colostrum after weaning substantially reduces the cost of raising these pigs.
The normal PCV of the SF-pCD pigs indicates that oral iron
supplementation was sufficient to prevent anemia. The industrystandard practice of administering iron dextran parenterally was
not used in this study since there was a concern that any injection
would increase the risk of septicemia. For the same reason, only half
of the pigs were bled in experiment 1. However, in experiment 2,
when all the pigs were bled weekly, no septicemia occurred in any
pig. Thus, injections and blood collection can be done in SF-pCD pigs
without health compromise, provided the procedures are conducted
hygienically. Indeed, in a subsequent SF-pCD experiment in the same
laboratory, iron dextran was administered intramuscularly in the
neck without ill effects (data not shown).
The roles of polyclonal antibodies to E. coli K88, which reportedly
prevented diarrhea due to K88 (F4) E. coli (16), were not characterized in this study. This component was included in the diet to help
avoid potential illness due to K88 E. coli because F4 colibacillosis is
a common disease of young pigs in the commercial swine industry,
and vaccination of dams before farrowing is routine.
Pyrexia was rare in experiment 2, in contrast to experiment 1. This
may be due to the higher level of sanitation during experiment 2,
as the concrete under the plastic floor was cleaned more frequently
(daily) than in experiment 1 (2 to 3 times weekly), discouraging
the accumulation of fecal microorganisms in the environment. The
benefit of high sanitation is further emphasized by the fact that when
SF-pCD pigs were raised on a concrete floor bedded with straw,
diarrhea and septicemia due to E. coli developed in 4 of 9 pigs (5).
Thus, good hygiene practices are strongly recommended for the
health of SF-pCD pigs.
The results of this experiment demonstrate that it is possible to
raise SF-pCD pigs that remain free of porcine pathogens, including
SIV, PRRSV, PPV, and PCV2. The source farm was serologically free
of PRRSV but positive for SIV, PPV, and PCV2. Snatch-farrowing,
preventing contact with barn facilities, minimizing exposure to barn
air, and disinfecting the sows and piglets are likely all critical in preventing horizontal transmission of these pathogens to SF-pCD pigs.
Although the source of PCV2 infection in 2 pigs in experiment 1 was
not definitively identified, retrospective evaluation of the biosecurity
protocols guiding entry into the animal care room and the timing of
the infections implicated a bottle of antibiotic previously used on a
PCV2-positive farm. In experiment 1 all the pigs remained PCV2negative before day 21, which indicates that vertical transmission of
PCV2 was unlikely. After the biosecurity measures were improved,
2000;64:0–00
all the pigs in experiment 2 remained PCV2-negative. Thus, it is
possible, although not guaranteed, that PCV2-negative pigs can
be obtained from a PCV2-positive farm using the SF-pCD method,
provided the piglets are not infected prenatally. A recent study
showed that 39.9% of the piglets on 5 North American farms were
born PCV2-viremic (17). Although in that study most of the piglets
were born of gilts, which may be more likely to vertically infect their
progeny in utero, the putatively high rate of viremia at birth on some
farms highlights that PCV2-free status is not guaranteed. We recommend excluding PCV2-viremic sows to increase the probability of
obtaining PCV2-free piglets.
Similarly, the presence of TTV1 and TTV2 in some of the SF-pCD
pigs in the present study was not unexpected since vertical transmission of TTV had been reported (18,19). Even gnotobiotic derivation
cannot guarantee freedom from infection with TTV or other vertically transmitted pathogens.
The SF-pCD method has advantages over the conventional SPF
method in obtaining pathogen-free pigs and is less technically
demanding than CDCD and gnotobiotic models. Since conventional
SPF pigs have suckled their dams and remain on the farm before
their inclusion in an experiment, there is a high risk of exposure and
possibly infection with organisms circulating on the farm. Moreover,
the presence of maternally derived antibodies against endemic
pathogens means that SPF piglets cannot be used for experiments
until passive immunity has decayed. Unlike the CDCD and gnotobiotic methods, SF-pCD derivation requires neither surgery nor sterile
compartments. Thus, the technical requirements are low and easily
adapted to any laboratory. The natural birth of SF-pCD pigs allows
them to be exposed to the vaginal flora and the potential for infection
by the vaginal microbiota and any pathogens present. The technique
also avoids the need to sacrifice the donor sow after surgery.
In conclusion, this study established a method to raise SF-pCD
pigs with high health and survival that balances convenience,
freedom from major pathogens, animal welfare, cost, and pathogen
susceptibility. The SF-pCD model is a good alternative to current
methods of producing pigs for infectious disease research. The main
disadvantages are the intensive labor associated with bottle-feeding
for the first 48 h, the risk of contamination by vaginal microbiota,
and the risk of septicemia if the environment is not hygienic.
Acknowledgments
This research was made possible with a contribution from
Saskatchewan Agriculture and Food through the Agriculture
Development Fund. The bovine colostrum powder and the bIgG
assay kits were generously donated by The Saskatoon Colostrum
Company, Saskatoon, Saskatchewan. The Hyper-Egg K88 was
donated by J.H. Hare & Associates, Winnipeg, Manitoba. The authors
appreciated the help of diagnosticians at Prairie Diagnostic Services,
Saskatoon, and Dr. Malachy Young, of Gowan’s Feed Consulting,
Wainwright, Alberta, for formulating the starter diets. Daniel Petri’s
expertise in raising colostrum-deprived pigs and the assistance of
Crissie Auckland, Shrijana Dhakal, Rayna Gundvalsen, Blake Balog,
Atul Desai, and the staff at the Animal Care Unit of Western College
of Veterinary Medicine, University of Saskatchewan, Saskatoon, was
critical to the success of this research.
The Canadian Journal of Veterinary Research
87
FOR PERSONAL USE ONLY
References
1. Struve R. A source of CDCD swine for research. Proc Am Assoc
Swine Vet Conf 1999:117.
2. Sangild PT, Holtug K, Diernaes L, Schmidt M, Skadhauge E.
Birth and prematurity influence intestinal function in the newborn pig. Comp Biochem Physiol A Physiol 1997;118:359–361.
3. Fowden AL, Li J, Forhead AJ. Glucocorticoids and the preparation for life after birth: Are there long-term consequences of the
life insurance? Proc Nutr Soc 1998;57:113–122.
4. Butler JE, Weber P, Sinkora M, et al. Antibody repertoire development in fetal and neonatal piglets. VIII. Colonization is required
for newborn piglets to make serum antibodies to T-dependent and
type 2 T-independent antigens. J Immunol 2002;169:6822–6830.
5. Oliveira S, Galina L, Blanco I, Canals A, Pijoan C. Naturallyfarrowed, artificially-reared pigs as an alternative model for
experimental infection by Haemophilus parasuis. Can J Vet Res
2003;67:146–150.
6. Blanco I, Galina-Pantoja L, Oliveira S, Pijoan C, Sanchez C,
Canals A. Comparison between Haemophilus parasuis infection
in colostrum-deprived and sow-reared piglets. Vet Microbiol
2004;103:21–27.
7. Olfert ED, Cross BM, McWilliam AA, eds. Guide to the Care
and Use of Experimental Animals. 2nd ed. Volume 1. Ottawa,
Ontario: Canadian Council on Animal Care, 1993. Available at
www.ccac.ca/Documents/Standards/Guidelines/Experimental_
Animals_Vol1.pdf
8. Carmichael LE, Joubert JC, Pollock RV. Hemagglutination by
canine parvovirus: Serologic studies and diagnostic applications.
Am J Vet Res 1980;41:784–791.
9. McNair I, Marshall M, McNeilly F, et al. Interlaboratory testing
of porcine sera for antibodies to porcine circovirus type 2. J Vet
Diagn Invest 2004;16:164–166.
10. McIntosh KA, Tumber A, Harding JCS, Krakowka S, Ellis JA,
Hill JE. Development and validation of a SYBR green real-time
88
The Canadian Journal of Veterinary Research
PCR for the quantification of porcine circovirus type 2 in serum,
buffy coat, feces, and multiple tissues. Vet Microbiol 2009;
133:23–33.
11. Kekarainen T, Sibila M, Segalés J. Prevalence of swine Torque
teno virus in post-weaning multisystemic wasting syndrome
(PMWS)-affected and non-PMWS-affected pigs in Spain. J Gen
Virol 2006;87:833–837.
12. Chelack BJ, Morley PS, Haines DM. Evaluation of methods for
dehydration of bovine colostrum for total replacement of normal
colostrum in calves. Can Vet J 1993;34:407–412.
13. Olson GL, Robine L, Rosengren LB, et al. Parturition induction
2 days prior to term decreases birth weight, lactational growth
but not piglet maturity, health or post-weaning growth. Can J
Anim Sci 2009;89:219–228.
14. Gomez GG, Phillips O, Goforth RA. Effect of immunoglobulin
source on survival, growth, and hematological and immunological variables in pigs. J Anim Sci 1998;76:1–7.
15. Rooke JA, Carranca C, Bland IM, et al. Relationships between
passive absorption of immunoglobulin G by the piglet and
plasma concentrations of immunoglobulin G at weaning. Livest
Prod Sci 2003;81:223–234.
16. Marquardt RR, Jin LZ, Kim JW, Fang L, Frohlich AA, Baidoo SK.
Passive protective effect of egg yolk antibodies against enterotoxigenic Escherichia coli K881 infection in neonatal and early
weaned piglets. FEMS Immunol Med Microbiol 1999;23:283–288.
17. Shen H, Wang C, Madson DM, Opriessnig T. High prevalence of
porcine circovirus viremia in newborn piglets in five clinically
normal swine breeding herds in North America. Prev Vet Med
2010;97:228–236.
18. Martinez-Guino L, Kekarainen T, Segalés J. Evidence of Torque
teno virus (TTV) vertical transmission in swine. Theriogenology
2009;71:1390–1395.
19. Pozzuto T, Mueller B, Meehan B, et al. In utero transmission of
porcine torque teno viruses. Vet Microbiol 2009;137:375–379.
2000;64:0–00
FOR PERSONAL USE ONLY
Article
Prediction of serum IgG concentration by indirect techniques with
adjustment for age and clinical and laboratory covariates in critically
ill newborn calves
Gilles Fecteau, Julie Arsenault, Julie Paré, David C. Van Metre, Charles A. Holmberg, Bradford P. Smith
Abstract
The objective of this study was to develop prediction models for the serum IgG concentration in critically ill calves based on
indirect assays and to assess if the predictive ability of the models could be improved by inclusion of age, clinical covariates,
and/or laboratory covariates. Seventy-eight critically ill calves between 1 and 13 days old were selected from 1 farm. Statistical
models to predict IgG concentration from the results of the radial immunodiffusion test, the gold standard, were built as a
function of indirect assays of serum and plasma protein concentrations, zinc sulfate (ZnSO 4) turbidity and transmittance, and
serum g-glutamyl transferase (GGT) activity. For each assay 4 models were built: without covariates, with age, with age and
clinical covariates (infection and dehydration status), and with age and laboratory covariates (fibrinogen concentration and
packed cell volume). For the protein models, dehydration status (clinical model) and fibrinogen concentration (laboratory model)
were selected for inclusion owing to their statistical significance. These variables increased the coefficient of determination (R2)
of the models by $ 7% but did not significantly improve the sensitivity or specificity of the models to predict passive transfer
with a cutoff IgG concentration of 1000 mg/dL. For the GGT assay, including age as a covariate increased the R 2 of the model
by 3%. For the ZnSO4 turbidity test, none of the covariates were statistically significant. Overall, the R2 of the models ranged
from 34% to 62%. This study has provided insight into the importance of adjusting for covariates when using indirect assays
to predict IgG concentration in critically ill calves. Results also indicate that ZnSO4 transmittance and turbidity assays could be
used advantageously in a field setting.
Résumé
L’objectif de cette étude était de développer un modèle de prédiction de la concentration sérique des IgG chez des veaux malades à partir
de techniques indirectes, et d’évaluer si la capacité de prédiction du modèle peut être améliorée par l’inclusion de l’âge et de certains
paramètres clinique et de laboratoire. Soixante-dix-huit veaux gravement malades âgés entre 1 et 13 jours et élevés sur une même ferme ont
été sélectionnés. Des modèles statistiques pour prédire la concentration sérique des IgG mesurée par immunodiffusion radiale (épreuve de
référence) ont été construits à partir de mesures indirectes (concentration des protéines sériques, concentration des protéines plasmatiques,
turbidité au sulfate de zinc, transmittance au sulfate de zinc, concentration sérique de la GGT (g-glutamyl transférase). Pour chacune des
techniques indirectes, 4 modèles ont été construits : sans covariable, avec l’âge seulement, avec l’âge et des paramètres cliniques (présence d’un
foyer d’infection et état d’hydratation), et avec l’âge et les paramètres de laboratoires (concentration plasmatique en fibrinogène, hématocrite).
Pour les modèles incluant les protéines sériques et plasmatiques, l’état d’hydratation et la concentration plasmatique en fibrinogène ont été
retenus (statistiquement significatif). L’inclusion de ces variables augmentait la valeur du R2 des deux modèles de $ 7 %, mais n’avait pas
d’impact significatif sur la sensibilité ou spécificité des modèles pour prédire le transfert de l’immunité passive (utilisant une valeur seuil de
1000 mg/dL). Pour le modèle GGT, l’âge a été retenu comme covariable et son inclusion augmentait le R2 de 3 %. Pour les modèles de sulfate
de zinc, aucune covariable n’était statistiquement significative. La valeur du R 2 des différents modèles construits variait de 34 % à 62 %.
Les résultats de cette étude soutiennent l’importance d’inclure certains autres paramètres pour prédire le succès du transfert de l’immunité
passive à partir de techniques indirectes dans une population de veaux gravement malades. Ils indiquent également que les techniques de
turbidité et de transmittance au sulfate de zinc sont appropriées pour une utilisation à la ferme.
(Traduit par les auteurs)
Faculté de médecine vétérinaire, Université de Montréal, CP 5000, Saint-Hyacinthe, Québec J2S 7C6 (Fecteau, Arsenault); Epidemiology and
Surveillance Section, Canadian Food Inspection Agency, CP 5000, Saint-Hyacinthe, Québec J2S 7C6 (Paré); College of Veterinary Medicine and
Biomedical Sciences, Colorado State University, Fort Collins, Colorado 80523-1678, USA (Van Metre); School of Veterinary Medicine, University
of California, Davis, California 95616, USA (Holmberg, Smith).
Address all correspondence to Dr. Gilles Fecteau; telephone: 450-773-8521, ext. 8337; fax: 450-778-8158; e-mail: [email protected]
Received November 11, 2011. Accepted February 16, 2012.
2013;77:89–94
The Canadian Journal of Veterinary Research
89
FOR PERSONAL USE ONLY
Introduction
Partial or complete failure of passive transfer (FPT) of immunoglobulins to suckling calves is a significant problem, increasing the
risk of both illness and death (1–3). It is assessed by measuring the
serum IgG concentration, ideally within 24 to 48 h after birth. Radial
immunodiffusion (RID) is the only test that directly measures this
concentration, and it is considered the gold standard.
In practice, evaluation of the serum IgG concentration is often
done in older calves with neonatal disease. The level is rarely measured directly. Instead, less expensive and more rapid tests measuring the concentrations of total globulins or other proteins known to
be correlated with the IgG concentration (3,4) are generally used.
Available tests include measurements of the serum concentration of
total solids by refractometry, sodium sulfate turbidity, zinc sulfate
(ZnSO4) turbidity, serum g-glutamyl transferase (GGT) activity, and
whole blood glutaraldehyde gelation.
In previous studies the interpretation and validation of the results
of various indirect assays for the serum IgG concentration were
generally based on defining a cutoff value for predicting the failure
or adequacy of passive transfer (5,6). However, in a clinical setting
such an approach does not allow for critical appraisal of the level of
IgG passive transfer, which may directly influence decision-making
in regard to treatment and prognosis. Moreover, the impact of different clinical parameters, such as dehydration and sepsis, on the
association between a particular indirect assay and the gold standard
was not taken into account in previous studies and warrants further
investigation.
This study proposed prediction models based on various indirect
assays for estimating the serum IgG concentration in ill calves and
compared the predictive ability of the models with and without the
inclusion of age, clinical covariates, and laboratory covariates. The
null hypothesis was that these covariates do not have an impact
on the association between various indirect assays and the serum
IgG concentration.
Materials and methods
The data used in this study originated from an observational study
based on a convenience sample. From a large calf-rearing farm in
the San Joaquin Valley of California, we selected 78 critically ill male
Holstein calves between 1 and 13 d of age with a total clinical score
of 5.5 or higher. This score is based on evaluation of feces, hydration
status, calf behavior, umbilicus, and scleral vessel characteristics (7).
There was no information available on colostrum feeding since the
animals arrived on the premises at approximately 1 d of age. At
the time of selection the calves were clinically evaluated, age was
noted, and blood samples were collected by a previously described
technique (8).
Clinical evaluation
The presence of infection and hydration status were recorded
according to a previously described protocol (7). Infection was considered present if at least 1 of the following was noted: a positive
blood culture, visual detection of an infection site (e.g., septic joint,
hypopyon, mucopurulent discharge, or abscess), or an umbilical
90
The Canadian Journal of Veterinary Research
Table I. Descriptive statistics for the variables used in models
to predict the serum IgG concentration in 78 critically ill
calves
Continuous variables
Assay
Serum protein concentration
Plasma protein concentration
ZnSO4 transmittance
Serum GGT activity
Demographic covariate
Age
Laboratory covariate
Packed cell volume
Fibrinogen concentration
Categorical covariates
Assay
ZnSO4 turbidity
Unit
Range
Median
g/L
g/L
%
IU/L
36–81
43–90
0–64
8–586
46
56
32
19
Days
1–13 5
%
21–54
35
g/L
3–16 7
Category
n
Total failure
Partial failure
Adequate protection
Clinical covariate
Infection
Yes
No
Dehydration
Yes
No
ZnSO4 — zinc sulfate; GGT — g-glutamyl transferase.
39
26
13
16
62
19
59
score $ 2. Calves presenting obvious signs of dehydration (such as
sunken eyes) were considered dehydrated.
Laboratory evaluation
Within 8 h of collection, blood samples were centrifuged and
analyzed. Packed cell volume (PCV) was estimated in microcapillary tubes, fibrinogen concentration was evaluated by the heat
precipitation method, and serum and plasma protein concentrations
were determined with a refractometer. For all other analyses, serum
was frozen at 220°C for a maximum of 6 mo. The concentration
of IgG was evaluated with an RID kit (Immunoglobulins Bovine
IgG Kit; ICN Biomedicals, Costa Mesa, California, USA) according
to manufacturer specifications. The RID plates were read with an
electronic plate reader (Binding Site, San Diego, California, USA).
Serum GGT activity was determined with the Synchron CX5 device
(Beckman Coulter, Brea, California, USA). Zinc sulfate turbidity and
transmittance were evaluated with a ZnSO4 heptahydrate solution
prepared by adding 250 mg of ZnSO4.7H2O to 1 L of distilled water.
Approximately 4 mL of the solution was put in glass vacuum tubes
16 mm in diameter, with caution taken to maintain negative pressure,
and 0.1 mL of serum was added. After gentle mixing, the tubes were
incubated for 1 h at room temperature. Zinc sulfate turbidity was
then evaluated semiquantitatively (for total failure, partial failure, or
adequate protection) by placing newspaper behind the tubes: a tube
through which letters could be easily distinguished was categorized
as showing total failure, a tube through which letters were illegible
but detectable as shadows was designated as showing partial failure,
and a totally opaque tube was categorized as showing adequate
2000;64:0–00
FOR PERSONAL USE ONLY
Table II. Estimated coefficient of regression (b) with standard error (SE) and P-value for
various linear regression models to predict the log-transformed serum IgG concentration
in the calvesa
Model and variable
Serum protein
No covariate (R2 = 41%)
Intercept
Serum protein level
Age and clinical covariates (R2 = 49%)
Intercept
Serum protein level
Dehydration
Age and laboratory covariates (R2 = 48%)
Intercept
Serum protein level
Fibrinogen concentration
Plasma protein
No covariate (R2 = 34%)
Intercept
Plasma protein level
Age and clinical covariates (R2 = 42%)
Intercept
Plasma protein level
Dehydration
Age and laboratory covariates (R2 = 50%)
Intercept
Plasma protein level
Fibrinogen concentration
GGT
No covariate (R2 = 47%)
Intercept
GGT activity (log-transformed)
Age (R2 = 50%)
Intercept
GGT activity (log-transformed)
Age
bSE
P-value
20.4500.365 0.22
0.054
0.007
, 0.001
20.6790.350 0.06
0.061
0.007
, 0.001
20.4480.133, 0.01
20.1380.360 0.70
0.057
0.007
, 0.001
20.0620.020, 0.01
20.5020.428 0.24
0.046
0.007
, 0.001
20.8030.416 0.06
0.053
0.007
, 0.001
20.4510.143, 0.01
20.4310.376 0.26
0.058
0.007
, 0.001
20.1000.020, 0.001
0.578
1.103
0.202
0.135
, 0.01
, 0.001
0.313
1.175
0.031
0.233
0.136
0.014
0.18
, 0.001
0.04
ZnSO4 transmittance
No covariate (R2 = 62%)
Intercept
3.210
0.104
, 0.001
Transmittance
20.0330.003, 0.001
ZnSO4 turbidity
No covariate (R2 = 60%)
Intercept
1.746
0.068
, 0.001
Adequate protection
1.433
0.136
, 0.001
Partial failure
0.557
0.108
, 0.001
aThe log (IgG) can be predicted using the following equations:
log (IgG) = bIntercept 1 Sb3
Where 3 = the value of the variable for the individual and b is the estimated regression coefficient
for this variable.
2000;64:0–00
The Canadian Journal of Veterinary Research
91
FOR PERSONAL USE ONLY
Predicted log(IgG) = bIntercept 1 [bPlasma proteins 3 Plasma proteins (g/L)] 1 [bFibrinogen 3 Fibrinogen (g/L)]
Predicted log(IgG) = 20.431 1 [0.058 3 60] 1 [20.100 3 7]
Predicted log(IgG) = 2.349
Figure 1. Equation used to predict the log serum IgG concentration from the plasma protein model developed in this study with age and laboratory
covariates. This model included the intercept and the plasma protein and fibrinogen concentrations as variables according to the model selection
building procedure.
protection. Zinc sulfate transmittance was obtained by reading the
optical density of each tube with a spectrophotometer (Coleman
Spec 20; PerkinElmer, Downers Grove, Illinois, USA) at 485 nm. All
ZnSO4 assays were performed the same day by the same investigator
on the same ZnSO4.7H2O preparation.
Statistical analysis
For each of the 5 assays, 4 linear regression models were built
with the logarithmic transformation (base 10) of the serum IgG
concentration measured by RID as the dependent variable (9). The
assay results were put in the models in their original scales, apart
from the GGT results, which were log-transformed (base 10). The
log transformations were used to improve the normality and linearity of the residuals. Full main-effect models were built first. Of the
4 models, the 1st included only the assay, the 2nd also included age,
and the 3rd and 4th models also included age and either clinical
covariates (dehydration and infection) or laboratory covariates (PCV
and fibrinogen concentration), respectively. A backward-elimination
procedure based on the F-test with P . 0.05 as the criterion of elimination was then used. Variables were removed only if removal did
not change the estimated coefficient of the assay by more than 20%.
First-order interactions between assay and covariates were tested 1
at a time with the resulting models and were selected for inclusion
in the final model if their P-value was less than 0.05 (F-test). For
each final model the coefficient of determination (R2) was computed.
Normal distribution of the residuals was visually assessed on a
normal-probability plot. Outliers were detected visually as well as
by using studentized residuals and the difference in fitted values
(DFFITs) after deletion of a case. Studentized residuals were plotted against the predicted value to evaluate homoscedasticity and
against each continuous predictor variable to evaluate the linearity
of the regression function. When an outlier was identified, the model
was refitted to exclude the outlier, and changes in the coefficient or
P-value were studied. All statistical analyses were performed with
the PROC GLM procedure in SAS 9.1 (SAS Institute, Cary, North
Carolina, USA).
The ability of each final model to predict passive transfer status
was computed. The RID test result was used as the gold standard:
calves were classified as having FPT if the serum IgG concentration
was less than 1000 mg/dL and otherwise were considered to have
adequate passive transfer (APT). The sensitivity of the various
models was estimated as the percentage of calves with predicted
FPT (gauged by model predictions transformed from a logarithmic
scale to the original scale) among the calves with FPT. Specificity
was estimated as the percentage of calves with predicted APT among
the calves with APT. Confidence intervals (95%) for the sensitivity
92
The Canadian Journal of Veterinary Research
and specificity estimates were calculated with the PROC FREQ procedure in SAS 9.1 with the use of exact computations for binomial
distributions. For each assay, McNemar tests with exact computations were performed to determine if the sensitivity and specificity
differed significantly (a = 0.05) between each 2 3 2 combination
of the 4 models. The positive predictive value for each model was
estimated as the probability (%) of FPT among the calves with predicted FPT. Similarly, the negative predictive value for each model
was estimated as the probability (%) of APT among the calves with
predicted APT. These predictive values were calculated with the
assumption of the same proportion of FPT in the population as
observed in the study sample.
Results
In the 78 calves included in the study, the serum IgG concentration
ranged from 5 to 6980 (median 135) mg/dL. With a cut-off value of
1000 mg/dL the proportion of calves with FPT was 86%. Descriptive
statistics for the assay results and covariates are presented in Table I.
The final linear regression models are presented in Table II. Only
models with covariates selected for inclusion are presented. For the
serum protein, plasma protein, and GGT assays, at least 1 covariate was kept in the final model owing to its statistical significance
(P , 0.05). For the 2 assays based on ZnSO4, none of the tested
covariates was significantly associated with the log-transformed
serum concentration of IgG.
During the model building, no evidence of confounding was
detected, and no interactions were statistically significant (all
P $ 0.10). Visual analysis of the residuals did not reveal any important departure from normality, homoscedasticity, or linearity of the
regression function. No outlier was detected visually or according
to studentized residuals (all # 2.8) or DFFITs (all # 0.64) except for a
relatively high studentized residual value (3.15) in a single model in
1 calf. Because exclusion of this value did not influence model selection and had only a minor impact on coefficient estimates (, 15%),
it was kept for analysis.
The estimated coefficients of regression were used to predict the
log IgG serum concentration for each calf with each model. As an
example, the equation presented in Figure 1 was used to predict the
log IgG concentration from the plasma protein model with age and
laboratory covariates in a calf with a plasma protein concentration
of 60 g/L and a fibrinogen concentration of 7 g/L. The predicted
log IgG value was then back-transformed on its original scale
(i.e., 102.349 = 223 mg/dL) (Figure 1).
The sensitivity, specificity, and predictive values of the various
models are presented in Table III. No statistically significant differ-
2000;64:0–00
FOR PERSONAL USE ONLY
Table III. Sensitivity, specificity, positive and negative predictive values of the various
models in predicting failure of passive transfer (FPT) of immunoglobulins to the calves,
with a cut-off for the IgG concentration of , 1000 mg/dL and radial immunodiffusion
(RID) as the gold standard
Model and covariates included
Serum protein
None
Dehydration
Fibrinogen level
Sensitivity Specificity PositiveNegative
(95% confidence
(95% confidence
predictive
predictive
interval)ainterval)bvaluecvalued
100 (95, 100)
100 (95, 100)
100 (95, 100)
18 (2, 52)
27 (6, 61)
45 (17, 77)
88 (67/76)
89 (67/75)
92 (67/73)
100 (2/2)
100 (3/3)
100 (5/5)
Plasma protein
None
Dehydration
Fibrinogen level
100 (95, 100)
100 (95, 100)
100 (95, 100)
27 (6, 61)
27 (6, 61)
36 (11, 69)
89 (67/75)
89 (67/75)
91 (67/74)
100 (3/3)
100 (3/3)
100 (4/4)
GGT
None 97 (90, 100)
Age 99 (92, 100)
27 (6, 61)
27 (6, 61)
89 (65/73)
89 (66/74)
60 (3/5)
75 (3/4)
ZnSO4 transmittance
None 99 (92, 100)
73 (39, 94)
96 (66/69)
89 (8/9)
ZnSO4 turbidity
None
94 (85, 98)
82 (48, 98)
97 (63/65)
69 (9/13)
a Percentage of calves with FPT as predicted by the model among the 67 calves with FPT according
to RID.
b Percentage of calves with adequate passive transfer (APT) as predicted by the model among the
11 calves with APT according to RID.
c Numbers in parenthesis represent the number of calves with FPT as predicted by the model over
the number of calves with FPT according to RID, based on an 86% prevalence of FPT in the sample.
d Numbers in parenthesis represent the number of calves with APT as predicted by the model over
the number of calves with APT according to RID, based on an 86% prevalence of FPT in the sample.
ence in sensitivity or specificity was detected between the 4 models
of each assay (all P . 0.25 by the McNemar exact test).
Discussion
In this study, FPT was common, affecting 86% of the study
population. Although this proportion is not representative of that
in the normal population of dairy calves, it may reflect the occurrence in sick calves presented to veterinarians. All the animals were
male Holstein calves fed and housed in an identical manner and
sampled over a short period (within 5 d), and all the blood samples
were stored and analyzed in an identical manner. This protocol
likely minimized the number of potential confounding covariates.
The solution used for the evaluation of ZnSO4 turbidity and transmittance was prepared with a 250-mg/L solution rather than the
typical 208-mg/L solution (4). In our clinical experience, adding a
3rd category (for partial failure) instead of relying on the traditional
2 categories makes readings easier; it is also likely to provide more
information about the serum IgG concentration.
Among the clinical covariates, hydration status had a significant
effect of similar magnitude in the serum and plasma protein models.
Clinical dehydration was associated with a decrease in serum IgG
2000;64:0–00
concentration, perhaps because of poor suckling as a common factor.
However, this association was unexpected since PCV, considered an
indicator of dehydration, was not selected for inclusion in the laboratory models. Further exploration of the data showed that hydration
status is a poor predictor of PCV in a simple linear regression model
(R2 = 3%, P = 0.12). Thus, other unidentified covariates might play
an important role in the observed relationship.
Among the laboratory covariates, fibrinogen concentration was
a significant predictor of IgG concentration in the models based on
serum and plasma protein concentrations estimated by refractometry.
Inclusion of the fibrinogen concentration most likely provided an
adjustment for the presence of nonimmunoglobulin proteins, such as
acute-phase proteins, in the presence of infection. When fibrinogen
concentration was included as a covariate the R2 increased 7% with
the serum model and 16% with the plasma model. This observation
supports the importance of such adjustment for IgG prediction. Age
had a significant effect in the GGT model. An increase in serum IgG
concentration was observed as age increased, as previously reported
(10). However, the inclusion of age had a minor impact on the R 2
of the model.
The coefficient of determination for the 10 models ranged from
34% to 62%. Although this indicates that about half of the changes
The Canadian Journal of Veterinary Research
93
FOR PERSONAL USE ONLY
in IgG concentration could be explained by a particular assay and by
the covariates included in the model, it also reminds us that almost
half of the variations remain unexplained. Interestingly, the highest
R2 was observed in the model that included ZnSO4 transmittance
with no covariate.
The use of mathematical equations to predict IgG concentration
on the basis of indirect assays can be useful in a clinical setting,
allowing adjustment for covariates and facilitating comparison of the
results obtained from various assays. The equations give an estimate
on a continuous scale, which is highly informative. The prediction
could be done directly by a practitioner using a simple calculator or
a program in computerized medical records for a direct result based
on input values for various tests. The predicted IgG could then be
directly interpreted or classified as adequate or not adequate. Based
on a cut-off of 1000 mg/dL, the models developed in this study were
very sensitive at predicting FPT, 94% to 100% of the calves with an
IgG concentration , 1000 mg/dL being correctly classified. However,
the specificity of the models to predict APT was highly variable,
ranging from 18% to 45% for the serum protein, plasma protein,
and GGT models; it was more satisfactory for ZnSO4 transmittance
(73%) and turbidity (82%). Adjustment with covariates did not allow
a significant increase in the ability of the models to correctly classify
passive transfer. However, the evaluation of the models’ ability to
predict APT was based on a very limited population of calves and
thus should be interpreted as preliminary. The high sensitivity of
the models combined with the high prevalence of FPT (86%) led to
very good predictive values, although the negative predictive values
were based on a very small sample. In a clinical setting, predictive
values are of great interest because they can be interpreted as the
probability that a calf with a predicted condition truly has the condition according to the gold standard. These values are influenced by
the prevalence of FPT in the population and should be extrapolated
only to similar populations or be recomputed for populations with
different expected prevalence rates. However, in a clinical setting
the proportion of ill calves with FPT is likely to be high, as was
observed in this study.
These results suggest that for some assays the inclusion of clinical
or laboratory covariates improves the accuracy of IgG-concentration
predictions, particularly when the results are interpreted on a con-
94
The Canadian Journal of Veterinary Research
tinuous scale. In general, the ZnSO4 transmittance and turbidity
assays performed well in predicting the IgG concentration and could
be used advantageously in a field setting.
References
1. Beam AL, Lombard JE, Kopral CA, et al. Prevalence of failure
of passive transfer of immunity in newborn heifer calves and
associated management practices on US dairy operations. J Dairy
Sci 2009;92:3973–3980.
2. Dewell RD, Hungerford LL, Keen JE, et al. Association of neonatal serum immunoglobulin G1 concentration with health
and performance in beef calves. J Am Vet Med Assoc 2006;228:
914–921.
3. Roy JHB. The Calf. 5th ed. Toronto, Ontario: Butterworths,
1990:39–42.
4. Weaver DM, Tyler JW, Van Metre DC, Hostetler DE, Barrington
GM. Passive transfer of colostral immunoglobulins in calves.
J Vet Intern Med 2000;14:569–577.
5. Tyler JW, Parish SM, Besser TE, Van Metre DC, Barrington GM,
Middleton JR. Detection of low serum immunoglobulin concentrations in clinically ill calves. J Vet Intern Med 1999;13:40–43.
6. Lee SH, Jaekal J, Bae CS, et al. Enzyme-linked immunosorbent
assay, single radial immunodiffusion, and indirect methods for
the detection of failure of transfer of passive immunity in dairy
calves. J Vet Intern Med 2008;22:212–218.
7. Fecteau G, Paré J, Van Metre DC, et al. Use of a clinical sepsis
score for predicting bacteremia in neonatal dairy calves on a calf
rearing farm. Can Vet J 1997;38:101–104.
8. Fecteau G, Van Metre DC, Paré J, et al. Bacteriological culture
of blood from critically ill neonatal calves. Can Vet J 1997;38:
95–100.
9.Dohoo I, Martin W, Stryhn H. Veterinary Epidemiologic
Research. 2nd ed. Charlottetown, Prince Edward Island: AVC,
2009:323–360.
10. Wilson LK, Tyler JW, Besser TE, Parish SM, Gant R. Prediction
of serum IgG1 concentration in beef calves based on age and
serum gamma-glutamyl-transferase activity. J Vet Intern Med
1999;13:123–125.
2000;64:0–00
FOR PERSONAL USE ONLY
Article
A method to quantify infectious airborne pathogens at concentrations
below the threshold of quantification by culture
Timothy D. Cutler, Chong Wang, Steven J. Hoff, Jeffrey J. Zimmerman
Abstract
In aerobiology, dose-response studies are used to estimate the risk of infection to a susceptible host presented by exposure to a
specific dose of an airborne pathogen. In the research setting, host- and pathogen-specific factors that affect the dose-response
continuum can be accounted for by experimental design, but the requirement to precisely determine the dose of infectious
pathogen to which the host was exposed is often challenging. By definition, quantification of viable airborne pathogens is
based on the culture of micro-organisms, but some airborne pathogens are transmissible at concentrations below the threshold
of quantification by culture. In this paper we present an approach to the calculation of exposure dose at microbiologically
unquantifiable levels using an application of the “continuous-stirred tank reactor (CSTR) model” and the validation of this
approach using rhodamine B dye as a surrogate for aerosolized microbial pathogens in a dynamic aerosol toroid (DAT).
Résumé
En aérobiologie, les études dose-réponse sont utilisées pour estimer le risque d’infection que représente pour un hôte susceptible l’exposition à
une dose spécifique d’un agent pathogène en suspension dans l’air. Dans un environnement de recherche, les facteurs spécifiques à l’hôte et à
l’agent qui affectent le continuum dose-réponse peuvent être tenus pour compte dans le design expérimental, mais l’obligation de déterminer
précisément la dose d’agent pathogène à laquelle l’hôte a été exposée représente souvent un défi. Par définition, la quantification des agents
pathogènes viables en suspension dans l’air est basée sur la culture des microorganismes, mais certains agents pathogènes aériens sont
transmissibles à des concentrations inférieures au seuil de quantification par culture. Dans cet article nous présentons une approche pour
le calcul de la dose d’exposition à des niveaux non-quantifiables microbiologiquement en utilisant une application du modèle de réaction
en réservoir avec agitation continue (CSTR) et la validation de cette approche en utilisant le colorant rhodamine B comme substitut à des
agents pathogènes microbiens mis en aérosol dans un tore dynamique (DAT).
(Traduit par Docteur Serge Messier)
Introduction
Airborne transmission poses a major challenge to the control
of human and animal pathogens. For humans, airborne transport
has been linked to the transmission of Coccidioides immitis (1);
Mycobacterium tuberculosis (2); Legionella spp. (3); smallpox virus (4);
and a variety of other pathogenic fungi, bacteria, and viruses (5–8).
For animals, some of the most economically significant pathogens
are transmitted in bioaerosols, such as foot-and-mouth disease
virus (9), classical swine fever virus (10), and porcine respiratory
and reproductive syndrome virus (11). Of importance to both human
and animal health are major zoonotic pathogens transmitted via
aerosols, including influenza virus (12,13), severe acute respiratory syndrome (SARS) coronavirus (14), Yersinia pestis (6), Bacillus
anthracis (15), and others.
In aerobiology, dose-response curves are useful for describing
the probability (y-axis) that a specific dose (x-axis) of an airborne
pathogen will produce infection in a susceptible host (5,16). Under
experimental conditions, dose-response curves can be derived by
individually exposing susceptible animal hosts to a known quantity
of pathogen and then monitoring each animal for evidence of infection under conditions that preclude the possibility of infection from
all other sources (17,18). The proportion of individuals that become
infected at each dose provides the raw data upon which the doseresponse curve is based.
A variety of statistical techniques can be used to analyze the
dose-response relationship, with ID50, the dose required to infect
50% of the population, being the most useful summary statistic of
the dose-response for any defined pathogen-host system (19,20).
A standard dose-response curve is defined by 4 parameters: the
baseline (bottom), the maximum response (top), the slope of the
curve, and the mid-point of the curve. But the exact parameters of
a dose-response curve depend on the pathogen (21), the strain or
isolate of the pathogen (19), the host species (22), and specific host
factors, such as age and immune status (23).
In a research setting, host- and pathogen-specific factors that affect
the dose-response curve can be accounted for by careful experimental design. A larger challenge is the requirement to determine
Department of Veterinary Diagnostic and Production Animal Medicine, College of Veterinary Medicine, Iowa State University 50011-1250, USA
(Cutler, Wang, Zimmerman); Department of Agricultural and Biosystems Engineering, College of Agriculture and Life Sciences, Iowa State
University, Ames, Iowa 50011-1250, USA (Hoff); Department of Statistics, College of Liberal Arts and Sciences, Iowa State University, Ames,
Iowa 50011-1210, USA (Wang).
Address all correspondence to Dr. Zimmerman; telephone: (515) 294-1073; fax: (515) 294-3564; e-mail: [email protected]
Received January 21, 2012. Accepted May 16, 2012.
2013;77:95–99
The Canadian Journal of Veterinary Research
95
FOR PERSONAL USE ONLY
Table I. Target concentration as a function of the number of
complete exchanges of a continuous-stirred tank reactor
(CSTR)
Target retained
Exchange (x)a
Ct /Cinb
in the CSTR (%)
11 2 e2137.0
21 2 e2214.0
31 2 e23 5.0
41 2 e24 1.8
51 2 e25 0.7
a
x = one complete exchange of the volume of the CSTR.
b
Mass balance of target concentration.
Ct — target concentration at time = t; Cin — target input concentration
time at time = 0.
the dose of infectious pathogen to which the host was exposed.
Estimation of the exposure dose requires measurements of the total
volume of air respired by the host and the concentration of viable
airborne pathogen, for example, liters of air respired by the susceptible host 3 pathogen concentration per liter of air = exposure
dose. In domestic animals, total respired air can be measured using
spirometric instrumentation (18).
Estimates of the concentrations of infectious airborne pathogens
are often more difficult to achieve. By definition, quantification
of viable airborne pathogens is based on techniques that require
the micro-organism to replicate in culture. Culture-based methods are less analytically sensitive than contemporary molecular
techniques, e.g., polymerase chain reaction (PCR), but molecular
assays are not a good substitute because they do not differentiate
between infectious and non-infectious micro-organisms (5,19). If the
pathogen is not highly transmissible, i.e., if transmission requires a
large exposure dose, the dose-response curve may be determined
despite the requirement to quantify infectious micro-organisms in
culture. Commonly, airborne pathogens are transmissible at concentrations below the threshold of quantification by culture. Under
these circumstances, the exposure dose, and hence the probability
of transmission, is incalculable (16,24). In this paper, we present an
engineering approach to calculate the exposure dose at microbiologically unquantifiable levels.
The continuous-stirred tank reactor (CSTR) is a vessel characterized by steady-state and uniform internal conditions due to mixing.
The reactions and processes occurring within the CSTR may be
defined for the conditions of the vessel. For example, as shown in
Table I, the concentration of a target within a CSTR can be predicted
at any time (t) using the equation:
Ct = Cin (1 2 e2t(Q/V)) = C = Cin (1 2 e2x)
where:
Ct =target concentration at time = t
Cin=target input concentration at time = 0
t =time
Q =flow rate (incoming rate = outgoing rate)
V =volume of the CSTR
e =the base of natural logarithm (Euler’s number)
x =one complete exchange of the volume of the CSTR
96
The Canadian Journal of Veterinary Research
Continuous-stirred tank reactors are widely used in a variety of
industrial, chemical, and biological applications, including bioreactors, fermentation vessels, and wastewater treatment. Goldberg et al
(25) introduced the use of a continuously rotating drum (dynamic
aerosol toroid) to experimental aerobiology as a method to maintain
and study infectious particles suspended in aerosols over time. A
rotating dynamic aerosol toroid (DAT) housed in an environment
that preserves the pathogen’s infectivity, e.g., held at temperatures
below freezing, is a CSTR. As such, the concentrations of the airborne components within the DAT can be predicted at time (t) if the
exchange volumes are known. This paper provides experimental
evidence to support this concept and discusses the application of this
approach to the problem of estimating the concentration of airborne
pathogens at microbiologically unquantifiable levels.
Materials and methods
The objective of this experiment was to determine whether the
CSTR-derived calculations could accurately predict the concentration of an airborne target in a DAT given known exchange volumes.
As a surrogate for an airborne micro-organism, a fluorescent dye
(rhodamine B) was aerosolized into a 400 L DAT held at 24°C.
In 10 replicates, 12 air samples (200 L each) were collected and
the fluorescence measured. These data were tested for: (i) a linear
relationship between the concentration of rhodamine B removed
(log10 Mc,out(t)) and volume of aerosol removed (Vextracted), and (ii) a
significant difference between the theoretical and the observed
rhodamine B regression lines.
A stainless steel 400 liter DAT was constructed based on the
description provided by Goldberg et al (25). For temperature control,
the DAT was housed in a custom-built refrigeration unit (Carroll
Coolers Inc., Carroll, Iowa, USA) maintained at 24°C. During operation, the DAT rotated at 4 RPM (Brother International Gearmotors,
Bridgewater, New Jersey, USA). Three HEPA-filters (Fisher Scientific,
Hampton, New Hampshire, USA) were fixed to ports on the periphery of the DAT to allow for pressure equilibration during nebulization and impingement. The entire system was disassembled and
cleaned between each of the 10 replicates.
In each replicate, approximately 50 mL of a 13 phosphate buffered
saline (PBS; Thermo Scientific, Rockford, Illinois, USA) solution
containing 0.08% v/v; rhodamine B (Sigma Chemical Company,
St. Louis, Missouri, USA) and 0.1% v/v Antifoam A Emulsion (Sigma
Chemical Company) was nebulized into the DAT using a 24-jet
Collison nebulizer (BGI, Waltham, Massachusetts, USA) operating
at 40 PSI. According to the manufacturer’s specifications, these
parameters aerosolized the solution at a rate of 1.1 mL per min and
produced particles 1.9 mm in diameter. After nebulization and prior
to sampling, the cloud was allowed to equilibrate within the DAT
for 60 min. This allowed for complete mixing, sedimentation, and
thermal equilibration of aerosolized rhodamine B.
Air samples were collected using sterile AGI-30 glass impingers (Ace Glass, Vineland, New Jersey, USA) containing 20 mL of
sterile 13 PBS (Thermo Scientific) as collection fluid. Impingers
were operated at a constant flow rate of 12.5 L per min using oilless pumps (Fisher Scientific, Hampton, New Hampshire, USA).
Pump performance was monitored using a vacuum pressure gauge
2000;64:0–00
FOR PERSONAL USE ONLY
(Cato Western, Tucson, Arizona, USA). Twelve 200-L air samples
were taken in succession, i.e., 6 complete evacuations of the DAT
over a period of approximately 3.5 h. All samples were maintained
on ice until sampling was completed. Thereafter, a 1.5 mL aliquot
of each sample was dispensed into a disposable ultraviolet transmissible cuvet (Fisher Scientific, Pittsburgh, Pennsylvania, USA),
allowed to warm to 20°C. The amount of rhodamine B dye in each
sample was measured using a fluorometer (Turner BioSystems,
Sunnyvale, California, USA) equipped with a green optical kit
(Turner BioSystems). Results were expressed as raw fluorescence
units. Prior to each replicate, the fluorometer was evaluated using
a rhodamine B solid standard (Turner BioSystems).
To predict the concentration of an airborne target (e.g., rhodamine B) within a CSTR as samples are drawn from the drum and
replaced with filtered inlet air, a mass balance equation of the target’s
concentration in the drum can be written as:
d(Mc,drumma)
= ma{Mc,in 2 Mc,out} [Equation 1]
dt
where:
Mc,drum=mass fraction of the target inside drum, kgtarget/kga
ma = mass of air inside drum, kga
t
= time, s
ma = mass flow rate of air through drum, kga/s
Mc,in = mass fraction of target entering drum, kgtarget/kga
Mc,out = mass fraction of target leaving drum, kgtarget/kga
Based on the work of Goldberg et al (25), a DAT is a well-mixed vessel. Therefore, the mass fraction of target leaving the drum is representative of the mass fraction inside the drum and can be stated as:
Mc,drum = Mc,out [Equation 2]
and Equation 1 can be re-written as:
d(Mc,outMa)
= ma{Mc,in 2 Mc,out} [Equation 3]
dt
Integrating Equation 3 results in the common form of a perfectly
mixed, but dynamically changing, mass fraction starting from a
known initial mass fraction as:
Mc,out(t) = Mc,out(t = 0)e2(t ma/ma) [Equation 4]
Equation 4 states that the mass fraction of target in a perfectly mixed
drum at any time (t) (Mc,out(t)) is a function of the initial concentration
inside the (Mc,out(t = 0)) drum and the exponential decay characterized by the mass of air inside the drum (ma) and the mass flow rate of
air through the drum (ma). Assuming constant air density, equation
(4) can be further described by:
Mc,out(t) = Mc,out(t = 0)e2(Vextracted/Vdrum) [Equation 5]
The starting point for determining the concentration of the target
at time (t) is the initial mass fraction within the drum (Mc,out(t = 0)).
Determination of target concentration requires sampling the air and
subsequent sample analysis. This extraction process results in an
interruption of the initial mass fraction of the target.
Equation 5 can be used to back-calculate the initial target mass
fraction (t = 0) within the drum from the initial extracted sample
2000;64:0–00
(t = 1). Thus, after the first sample extraction, some known amount
of drum air has been extracted (Vextracted) resulting in a mass fraction
of (Mc,out(t1)) providing an estimation of the initial mass fraction
determined as:
Mc,out(t = 0) =
Mc,out(t1)
[Equation 6]
e2(Vextracted,t1/Vdrum)
Equation 6 represents the initial mass fraction inside the drum. Since
the drum behaves as a well-mixed vessel, all subsequent sample
extractions and the resulting mass fractions will obey the mixing
model as given in equation (5) using the estimate for the initial
mass fraction given in equation (6). The final relationship becomes:
Mc,out(t) =
Mc,out(t1) e2(Vextracted/Vdrum) [Equation 7]
e2(Vextracted,t1/Vdrum)
where:
Mc,out(t1) =mass fraction from the first sampled extraction,
kgtarget/kga
Vextracted,t1=volume of drum air extracted for the first sample, liters
Vdrum =fixed volume of the drum, liters
Converting Equation 5 to log10 format, the mass fraction of the DAT
can be mathematically represented as:
log10 Mc,out(t) = log10 Mc,out(t=0) 2 (log10 e/Vdrum)*Vextracted
where:
Mc,out(t=0)=concentration of rhodamine B at (t = 0)
Mc,out(t) =rhodamine B concentration at current time
Vextracted =the running total of the volume removed
Vdrum =the total volume in container
e
=the base of natural logarithm (Euler’s number).
This mathematical representation contained 2 assumptions:
1.There is a linear relationship between (log10 Mc,out(t)) and Vextracted;
2.The slope of the rhodamine B regression line was equal to
2(log10 e/Vdrum).
If both of these assumptions are true, then, log10 Mc,out(t) is a linear function of Vextracted with intercept log 10 M c,out(t=0) and slope
2(log10 e/Vdrum). Thus, the linear relationship between log10 Mc,out(t)
and Vextracted may be used to estimate the concentration of rhodamine
B at any time along the regression line. To validate assumption (1),
the concentration of rhodamine B (log10) in sequential air samples
collected in each of 9 replicates was analyzed using a simple linear
regression model using the REG procedure (SAS, version 9.2; SAS
Institute Inc, Cary, North Carolina, USA) and the coefficient of
determination (R2) was calculated. To validate assumption (2), the
hypothesis that the average slope was equal to the theoretical slope
(log10 e/Vdrum) was tested using the Student’s t-test.
Results
A total of 10 replicates were attempted. One replicate (number 4)
failed because of technical problems that occurred during the
procedure. For the remaining 9 runs, least square estimates of the
intercept and slope, as well as the coefficient of determination (R2),
The Canadian Journal of Veterinary Research
97
FOR PERSONAL USE ONLY
were calculated for each regression line (Table II). R 2 described the
proportion of response variation explained for by the linear model
and ranges from 0 to 1, with a large R2 value indicative of a good
fit of the linear model. The mean R2 for the 9 replicates was 0.93
with a standard deviation of 0.07. Overall, the linear regression line
explained 93% of the variation in log10 transformed rhodamine B
data. The average slope of the 9 runs was not significantly different
(P = 0.1593) from the theoretical slope (20.0011). Thus, these data
show that the linear relationship between log10 Mc,out(t) and Vextracted
may be used to estimate the concentration of an airborne target in a
DAT given known exchange volumes.
Discussion
Successful airborne transmission occurs in 3 basic steps: (i) aerosolization of the infectious agent; (ii) environmentally dependent
movement, dilution, and inactivation of airborne infectious particles;
and (iii) contact, entry, and replication within a susceptible host (26).
From the perspective of prevention and control, the goal is to understand and model the transmission of airborne pathogens in order
to design effective counter-measures. Both macro- and micro-level
approaches are useful in meeting this objective. That is, field data
collected over the course of an outbreak may be useful for modeling
the airborne spread of a pathogen within a population (27). Likewise,
the basic steps and their components may be evaluated independently under controlled conditions to understand the contribution of
each to the process of transmission (18). That is: (i) quantify the rate
at which the pathogen is excreted into the environment; (ii) measure
the rate of inactivation of the airborne infectious pathogen under
specific environmental conditions; and (iii) estimate the likelihood
that exposure to a specific dose of the airborne infectious pathogen
will produce a response (infection) in an individual host.
This study addressed the third step in this process and, in particular, the specific problem of deriving dose-response curves
under experimental conditions in which transmission occurs at
concentrations below the threshold of quantification for culturebased methods. In this experiment, a tracer was used to model the
behavior of an aerosolized pathogen in a rotating DAT. Tracers (e.g.,
uranine, rhodamine B, and Bacillus subtilis spores) have been used
extensively in experimental aerobiology (28). Songer (29) aerosolized rhodamine B dye simultaneously with virus (Newcastle disease
virus, infectious bovine rhinotracheitis virus, vesicular stomatitis
virus, T3 bacteriophage) to track the physical loss of airborne virus
within a DAT. In an experiment of similar design, Hermann et al (30)
found no significant difference between the slopes of rhodamine B
dye and porcine reproductive and respiratory syndrome virus RNA
detected by quantitative PCR, i.e., the concentrations of rhodamine B
and viral RNA declined in the DAT at the same rate. Under the conditions of this experiment, the fact that the theoretical line and the
experimental line were not significantly different provided evidence
that physical loss did affect the outcome of the tracer values. Thus,
rhodamine B concentration has been shown to reflect target pathogen concentrations under conditions similar to those reported here.
The physical parameters and experimental conditions of this
study merit discussion. This experiment was conducted in a 400 L
DAT rotated at 4 RPM. However, a variety of DAT sizes and rotation
98
The Canadian Journal of Veterinary Research
Table II. Parameters describing the linear relationship
between the concentration of airborne rhodamine B and the
volume of air extracted from a dynamic aerosol toroid
Replicate
R2Slope Intercept
1
0.96
20.00133.47
2
0.83
20.00213.40
3
0.96
20.00303.16
5
0.94
20.00073.20
6
0.95
20.00114.07
7
0.80
20.00072.56
8
0.97
20.00124.08
9
0.99
20.00134.72
100.98
20.00164.70
speeds are reported in the literature, for example, 140 L (29), 1000 L
(31), and 2500 L (32). A review of the literature found no evaluation
of the effect of DAT dimensions, volume, and rate of rotation on the
behavior of suspended particles. Therefore, it would be of value to
confirm the results reported here using the described methodology.
In this experiment, the environmental conditions were designed
to preserve target pathogen infectivity. In particular, the 24°C
temperature at which the DAT was maintained would be expected
to preserve the infectivity of a target pathogen indefinitely. At temperatures above freezing, the slope of the airborne pathogen would
diverge from the slope of the rhodamine B. Therefore, the inactivation of the target pathogen over time would need to be accounted
for in the estimation of the airborne pathogen concentration. This
is not an insignificant consideration because the rate of airborne
pathogen concentration inactivation is affected by isolate (26,27),
the suspension medium (32,33), temperature (29,34), and relative
humidity (30,35). Therefore, it is preferable to avoid this complication
by maintaining the DAT at temperatures below 0°C.
In dose-response studies, the CSTR model solves the problem of
estimating the exposure dose when the concentrations of airborne
pathogens are at microbiologically unquantifiable levels.
Specifically, the linear relationship between log10 Mc,out(t) and
Vextracted may be used to estimate the concentration of a target at any
point along the regression line. Thus, log10 Mc,out(t) is a linear function
of Vextracted with intercept log10 Mc,out(t=0) and slope 2(log10 e/Vdrum).
Therefore, under conditions similar to those reported here, the CSTR
model solves the problem of estimating the exposure dose when
the concentrations of airborne pathogens are at microbiologically
unquantifiable levels.
Acknowledgments
The study was supported in part by Pork Checkoff funds distributed through the National Pork Board, Des Moines, Iowa, USA and
the PRRS CAP USDA NIFA Award 2008-55620-19132.
References
1. CDC (Centers for Disease Control and Prevention), 2009. Increase
in coccidioidomycosis — California, 2000–2007. MMWR Morb
Mortal Wkly Rep 2009;58:105–109.
2000;64:0–00
FOR PERSONAL USE ONLY
2. de la Rua-Domenech R. Human Mycobacterium bovis infection
in the United Kingdom: Incidence, risks, control measures
and review of the zoonotic aspects of bovine tuberculosis.
Tuberculosis (Edinb) 2006;86:77–109.
3. Diedern BMW. Legionella spp. and Legionnaries’ disease. J Infect
2007;56:1–12.
4. Feigel J, Clarke RC, Edwards DA. Airborne infectious disease
and the suppression of pulmonary bioaerosols. Drug Discov
Today 2006;11:51–57.
5. Douwes J, Thorne Pl, Pearce N, Heederik L. Bioaerosol health
effects and exposure assessment: Progress and prospects. Br
Occup Hyg Soc 2003;47:187–200.
6. Nicas M, Nazaroff WW, Hubbard A. Toward understanding
the risk of secondary airborne infection: Emission of respirable
pathogens. J Occup Environ Hyg 2005;2:134–154.
7. Farnsworth JE, Goyal SM, Kim SW, et al. Development of a
method for bacteria and virus recovery from heating, ventilation, and air conditioning (HVAC) filters. J Environ Monit 2006;
8:1006–1013.
8. Tang JW, Eames I, Chan PK, Ridgway GL. Factors involved in
the aerosol transmission of infection and control of ventilation
in healthcare premises. J Hosp Infect 2006;64:100–114.
9. Alexandersen S, Brotherhood I, Donaldson AI. Natural aerosol
transmission of foot-and-mouth disease virus to pigs: Minimal
infectious dose for strain 01 Lausanne. Epidemiol Infect 2002;128:
301–312.
10. Weesendorp E, Landman WJM, Stegeman A, Loeffen WLA.
Detection and quantification of classical swine fever virus in
air samples originating from infected pigs and experimentally
produce aerosols. Vet Microbiol 2008;127:50–62.
11. Dee SA, Deen J, Cano JP, Batista L, Pijoan C. Further evaluation
of alternative air-filtration systems for reducing the transmission of porcine reproductive and respiratory syndrome virus
by aerosol. Can J Vet Res 2006;70:168–175.
12. Loosli C, Lemon H, Robertson O, Appel E. Experimental airborne
influenza infection. 1. Influence of humidity on survival of virus
in air. Proc Soc Exp Biol Med 1943;53:205–206.
13. Wong S, Yuen K. Avian influenza virus infections in humans.
Chest 2006;129:156–168.
14. Booth TF, Kournikakis B, Bastien N, et al. Detection of airborne
severe acute respiratory syndrome (SARS) coronavirus and
environmental contamination in SARS outbreak units. J Infect
Dis 2005;191:1472–1477.
15. Inglesby TV, Henderson DA, Bartlett JG, et al. Anthrax as a biological weapon: Medical and public health management. J Am
Med Assoc 1999;281:1735–1745.
16. Pillai SD, Ricke SC. Bioaerosols from municipal and animal
wastes: Background and contemporary issues. Can J Microbiol
2002;48:681–696.
17. French NP, Kelly L, Jones R, Clancy D. Dose-response relationships for foot and mouth disease in cattle and sheep. Epidemiol
Infect 2002;128:325–332.
2000;64:0–00
18. Hermann JR, Muñoz-Zanzi CA, Zimmerman JJ. A method to
provide improved dose-response estimates for airborne pathogens in animals: An example using porcine reproductive and
respiratory syndrome virus. Vet Microbiol 2009;133:297–302.
19. Ward RL, Akin EL. Minimum infective dose of animal viruses.
Crit Rev Environ Control 1984;14:297–310.
20. Spouge JL. Statistical analysis of sparse infection data and its
implications for retroviral treatment trials in primates. Proc Natl
Acad Sci U S A 1992;89:7581–7585.
21. Liao CM, Chang CF, Liang HM. A probabilistic transmission
dynamic model to assess indoor airborne infection risks. Risk
Anal 2005;25:1097–1107.
22. Thurston-Enriquez JA, Haas CN, Jacangelo J, Riley K, Gerba CP.
Inactivation of feline calicivirus and adenovirus type 40 by
UV radiation. Appl Environ Microbiol 2003;69:577–582.
23. Jani JV, Holm-Hansen C, Mussa T, et al. Assessment of measles
immunity among infants in Maputo City, Mozambique. BMC.
Public Health 2008;8:386–396.
24. Gillespie RR, Hill MA, Kanitz CL. Infection of pigs by aerosols
of Aujeszky’s disease virus and their shedding of the virus. Res
Vet Sci 1996;60:228–233.
25. Goldberg LJ, Watkins HMS, Boerke EE, Chatigny MA. The use of
a rotating drum for the study of aerosols over extended periods
of time. Am J Hyg 1958;68:86–93.
26. Stärk KDC. The role of infectious aerosols in disease transmission
in pigs. Vet J 1999;158:164–181.
27. Keeling MJ, Woolhouse ME, Shaw DJ, et al. Dynamics of the
2001 UK foot and mouth epidemic: Stochastic dispersal in a
heterogeneous landscape. Science 2001;294:813–817.
28. Verreault D, Moineau S, Duchaine C. Methods for sampling of
airborne viruses. Microbiol Mol Biol Rev 2008;72:413–444.
29. Songer JR. Influence of relative humidity on the survival of some
airborne viruses. Appl Microbiol 1967;15:35–42.
30. Hermann JR, Hoff S, Muñoz-Zanzi C, et al. Effect of temperature and relative humidity on the stability of infectious porcine
reproductive and respiratory syndrome virus in aerosols. Vet
Res 2007;38:81–83.
31. Adams DJ, Spendlove JC, Spendlove RS, Barnett BB. Aerosol stability of infectious and potentially infectious reovirus particles.
Appl Environ Microbiol 1982;44:903–908.
32. Ehrlich R, Miller S, Idoine LS. Effects of environmental factors on the survival of airborne T-3 coliphage. Appl Microbiol
1964;12:479–482.
33. Benbough JS. Some factors affecting the survival of airborne
viruses. J Gen Virol 1971;10:209–220.
34. Elazhary MA, Derbyshire JB. Effect of temperature, relative
humidity and medium on the aerosol stability of infectious
bovine rhinotracheitis virus. Can J Comp Med 1979;41:158–167.
35. Sattar SA, Ijaz MK, Johnson-Lussenburg CM, Springthorpe VS.
Effect of relative humidity on the airborne survival of rotavirus
SA11. Appl Environ Microbiol 1984;47:879–881.
The Canadian Journal of Veterinary Research
99
FOR PERSONAL USE ONLY
Article
Influence of temperature and organic load on chemical disinfection
of Geobacillus steareothermophilus spores, a surrogate
for Bacillus anthracis
Jiewen Guan, Maria Chan, Brian W. Brooks, Liz Rohonczy
Abstract
This study evaluated the influence of temperature and organic load on the effectiveness of domestic bleach (DB), Surface
Decontamination Foam (SDF), and Virkon in inactivating Geobacillus stearothermophilus spores, which are a surrogate for Bacillus
anthracis spores. The spores were suspended in light or heavy organic preparations and the suspension was applied to stainless
steel carrier disks. The dried spore inoculum was covered with the disinfectants and the disks were then incubated at various
temperatures. At 220°C, the 3 disinfectants caused less than a 2.0 log10 reduction of spores in both organic preparations during
a 24-h test period. At 4°C, the DB caused a 4.4 log10 reduction of spores in light organic preparations within 2 h, which was about
3 log10 higher than what was achieved with SDF or Virkon. In heavy organic preparations, after 24 h at 4°C the SDF had reduced
the spore count by 4.5 log10, which was about 2 log10 higher than for DB or Virkon. In general, the disinfectants were most effective
at 23°C but a 24-h contact time was required for SDF and Virkon to reduce spore counts in both organic preparations by at least
5.5 log10. Comparable disinfecting activity with DB only occurred with the light organic load. In summary, at temperatures as
low as 4°C, DB was the most effective disinfectant, inactivating spores within 2 h on surfaces with a light organic load, whereas
SDF produced the greatest reduction of spores within 24 h on surfaces with a heavy organic load.
Résumé
Cette étude a permis d’évaluer l’influence de la température et de la charge organique sur l’efficacité de javellisant domestique (DB), de mousse
de décontamination de surface (SDF) et de Virkon pour inactiver les spores de Geobacillus stearothermophilus, un substitut pour les spores
de Bacillus anthracis. Les spores ont été suspendues dans des préparations organiques légères ou denses et la suspension étaient appliquées sur
des disques d’acier inoxydable. L’inoculum séché de spores était recouvert avec les désinfectants et les disques étaient ensuite incubés à différentes
températures. À 220 °C les trois désinfectants ont entrainé une réduction de moins de 2 log10 du nombre de spores dans les deux préparations
organiques durant une période d’essai de 24 h. À 4 °C, le DB a causé, en dedans de 2 h, une réduction de 4,4 log10 de la quantité de spores
dans les préparations organiques légères, à peu près 3 log10 plus élevé que ce qui a été atteint par la SDF ou le Virkon. Dans les préparations
organiques denses, après 24 h à 4 °C la SDF avait réduit le dénombrement de spores par 4,5 log10, ce qui était à peu près 2 log10 plus élevé que
ce qui a été obtenu avec le DB ou le Virkon. En général, les désinfectants étaient les plus efficaces à 23 °C mais un temps de contact de 24 h était
requis pour la SDF et le Virkon pour réduire le nombre de spores dans les deux préparations organiques par au moins 5,5 log 10. Une activité
désinfectante comparable avec le DB n’a été observée qu’avec une charge organique légère. En résumé, à des températures aussi basse que 4 °C,
le DB était le désinfectant le plus efficace inactivant les spores en moins de 2 heures sur des surfaces avec des charges organiques légères, alors
que la SDF a causé la plus grande réduction de spores en-dedans de 24 h sur des surfaces avec une charge organique élevée.
(Traduit par Docteur Serge Messier)
Introduction
Anthrax is a highly lethal infectious disease caused by the
endospore-­forming bacterium Bacillus anthracis, which is a Grampositive soil organism commonly found in nature. Although anthrax
can affect all mammals including humans, it is primarily a disease
of herbivores, such as cattle, sheep, horses, pigs, goats, and camels,
with hyperacute or acute symptoms and usually with a fatal outcome. Anthrax is not transmitted from sick to healthy animals, but
is generally acquired by the ingestion of spores dispersed into the
environment (1). Flooding, drought, and other natural or man-made
disturbances can bring the spores up to the soil surface where graz-
ing animals are at risk of exposure to the organism. The disease is
characterized by outbreaks, usually involving a small number of
animals, but may at times turn into an epidemic with serious consequences. According to reports by the Canadian Food Inspection
Agency, anthrax outbreaks occur sporadically in the Canadian prairie
provinces, often during the summer and sometimes in the colder
months, and can affect hundreds of animals (2).
It is expected that exposure to B. anthracis could be reduced by
proper disposal of infected animal carcasses and wastes and by
cleaning and disinfecting contaminated surfaces. Fumigation with
formaldehyde or hydrogen peroxide has been used for emergency
decontamination of indoor surfaces in buildings at temperatures
Ottawa Laboratory (Fallowfield), Canadian Food Inspection Agency, Ottawa, Ontario K2H 8P9.
Address all correspondence to Jiewen Guan; telephone: (613) 228-6698; fax: (613) 228-6670; e-mail: [email protected]
Received May 18, 2012. Accepted June 26, 2012.
100
The Canadian Journal of Veterinary Research
2013;77:100–104
FOR PERSONAL USE ONLY
around 20°C (3,4). At similar temperatures, sodium hypochlorite,
hydrogen peroxide, peracetic acid, and chlorine dioxide were found
to be effective for routine surface decontamination in a hospital or
a laboratory setting (5,6). In addition, most of these chemicals are
also recommended for surface decontamination of fomites such as
farm equipment, surgical instruments, and vehicles in an agricultural
setting at temperatures above 10°C (7). However, as temperatures in
Canada and many other countries are frequently below 10°C, more
information is needed on the effectiveness of chemical disinfectants
at colder temperatures.
Since the 2001 anthrax bioterrorist attacks in the United States,
Geobacillus stearothermophilus spores have been used as a surrogate
for B. anthracis spores to assess the effectiveness of disinfectants and
decontamination processes (3,4,8). Since G. stearothermophilus spores
are heat-resistant, they are also used as biological indicators of the
effectiveness of heat sterilization processes (9).
The objective of this study was to evaluate the effectiveness of
3 chemical disinfectants in killing G. stearothermophilus spores at
temperatures of 220°C, 4°C, 10°C, and 23°C. Domestic bleach has
been recommended for inactivation of B. anthracis spores by the
US Environmental Protection Agency and the US Centers for Disease
Control (5). Virkon has been widely used in an effort to kill infectious
agents in various environments (10–12). Surface Decontamination
Foam (SDF) was recently developed for inactivating chemical and
biological agents in a wide range of field environments (13,14).
St. Isidore, Quebec). The garden soil was pre-sterilized at 121°C for
90 min to prevent the introduction of other live microorganisms
into the tests.
Materials and methods
A neutralizer was used to immediately stop the activity of the disinfectants at the end of a test period in order to provide an accurate
contact time. The neutralizer solution contained 1.56 g of sodium
thiosulfate (Na 2S 2O 2  · 5H 2O; Thermo Fisher Scientific, Ottawa,
Ontario), 0.07 g of lecithin (Thermo Fisher Scientific), and 0.1 mL
of Tween 80 (Thermo Fischer Scientific) in 100 mL of PBS and was
sterilized at 121°C for 15 min before use.
Carrier disks
The second tier quantitative carrier test (15) was used for evaluating the sporicidal activity of the 3 disinfectants. Disks (1 cm in
diameter; 0.75 mm thick) of brushed stainless steel (AISI No. 430;
Muzeen & Blythe, Winnipeg, Manitoba) were used as carriers. They
were washed 3 times with distilled water and dried at 60°C for 1 h.
The dried disks were sterilized at 121°C for 25 min before use.
Spore inoculum
A suspension of G. stearothermophilus American Type Culture
Collection (ATCC) strain 7953 spores (Spordex) was obtained from
a commercial source (Steris, Mentor, Ohio, USA). The suspension
was heated at 100°C for 35 min to inactivate vegetative cells and
sonicated for 5 min to break up clumps. The treated suspension
was mixed with an organic preparation and the mixture containing
4.6 3 106 colony-forming units (CFUs) of spores was loaded onto a
carrier disk as inoculum. There were 2 types of organic preparations:
one was used to simulate a light organic challenge (equivalent to
5% to 10% serum (15) on relatively clean surfaces and the other to
simulate a heavy organic challenge (light organic preparation plus
5% garden soil) on relatively dirty surfaces. The light organic preparation was a peptide and protein mixture (16) that contained 0.35%
weight/volume (w/v) tryptone (Sigma, Oakville, Ontario), 0.25%
w/v bovine serum albumin (Sigma), and 0.04% w/v mucin (Sigma)
in 0.01 M phosphate-buffered saline (PBS, pH 7.2). The heavy organic
preparation was a mixture of the light organic preparation and
5% w/v garden soil (Premium Nature Mix; Modugno-Hortibec,
2000;64:0–00
Disinfectants
Standard hard water was used to prepare disinfectant solutions
to avoid variations in results that may derive from differences in tap
water quality. The water was prepared in accordance with AOAC
960.09 (17) to a standard hardness of 400 ppm as calcium carbonate.
Solutions of the 3 disinfectants were prepared as follows. Domestic
bleach (Clorox; Oakland, California, USA) containing about 5.25%
sodium hypochlorite (52 500 ppm available chlorine) was diluted
to obtain a chlorine concentration of 5 250 ppm for testing. Surface
Decontamination Foam (SDF) (Allen Vanguard, Ottawa, Ontario)
includes 3 separate reagents: GPA-2100 decontaminant (A); GPB2100 buffer (B); and GCE-2000 surfactant (C). The SDF solution was
prepared according to the manufacturer’s instructions: i) 1.8 g B and
4.5 g C were dissolved in 150 mL of water; ii) 7.8 g A was dissolved
in 50 mL of water; and iii) the 2 solutions were mixed immediately
before use. The 2% Virkon solution (Antec, Suffolk, United Kingdom)
was prepared by dissolving 4 tablets in 1.0 L of water. For tests at
220°C, propylene glycol [1,2-propanediol, Sigma, 40% volume/
volume (v/v) final concentration] was added to the disinfectant
solutions as an antifreeze agent.
Neutralizer
Test procedure
Contact time course experiments were carried out to evaluate the
disinfectants. Six time points were included for each experiment:
5 min, 15 min, 30 min, 1 h, 2 h, and 24 h. Duplicate sample disks
and duplicate control disks were prepared for each time point. Ten
microliters of the spore inoculum was applied to the surface of
each disk and the discs were air dried in a biosafety cabinet for 1 h.
Each disk, with the inoculum side up, was then placed in a 30-mL
Nalgene polypropylene straight-side vial (Thermo Fisher Scientific).
Disinfectant solution (50 μL) was added to each test disk to cover the
dried inoculumn and 50 μL of PBS was added to each control disk.
Vials containing the disks were incubated at 220°C, 4°C, 10°C, or
23°C for specific periods up to 24 h to assess the activity of bleach
and SDF and at 220°C, 4°C, and 23°C for periods up to 24 h for
Virkon. At the end of each contact time, 9.95 mL of neutralizer solution was immediately added to 2 vials with test disks and 2 vials
with control disks to stop the activity of the disinfectants and the
vials and contents were vortexed for 1 min. A 10-fold serial dilution
was made of the suspension in each vial. Each of the serial dilutions
was passed through a 0.2-µm membrane filter (Supor 200 membrane
filter; Pall, Ann Arbor, Michigan, USA) in a magnetic filter holder
(Pall). The filter unit was subsequently rinsed 3 times with 10 mL of
The Canadian Journal of Veterinary Research
101
FOR PERSONAL USE ONLY
Figure 1. Effects of disinfectants on reduction of the spores of Geobacillus stearothermophilus at temperatures of
220°C ( and ), 4°C ( and ), 10°C ( and ), and 23°C ( and ). The spores in the light (equivalent to 5 ~ 10%
serum, open symbols) and the heavy (equivalent to 5 ~ 10% serum plus 5% garden soil, solid symbols) organic preparations were treated with domestic bleach (A and B), SDF (C and D), and Virkon (E and F) at contact times of 5 min,
15 min, 30 min, 1 h, 2 h, and 24 h. The data were the mean difference of the spore counts recovered from duplicate
sets of the control and the sample disks in duplicate experiments and the standard deviations were less than 1.2 log10
colony-forming units (CFUs). The recovery of spores from untreated control disks ranged from 5.5 to 5.7 log 10.
PBS to maximize spore recovery. The membrane filter was removed
from the unit and placed on the surface of a tryptic soy agar (TSA;
Voigt Global Distribution, Lawrence, Kansas, USA) plate and incubated at 56°C in a relative humidity of approximately 60%. After
incubation for 2 d and 5 d, colonies were counted.
Statistical analysis
Duplicate contact time course experiments were conducted to
evaluate each disinfectant and duplicate sets of test and control
disks were used for each time point. The difference in recovery of
102
The Canadian Journal of Veterinary Research
live spores from control and test disks was recorded as spore reduction (log10) at each time point to indicate the sporicidal efficiency
of disinfectants for a specific contact time. The data presented
were the means of spore reduction from duplicate sets of control
and test disks in duplicate experiments. Student’s t-test was used
to determine statistical significance (P , 0.05) in difference in
spore reduction among various temperatures with 1 disinfectant
solution or among various disinfectant solutions at 1 temperature. The comparison was done with either light or heavy organic
preparation.
2000;64:0–00
FOR PERSONAL USE ONLY
Results
The recovery of G. stearothermophilus spores from control disks
ranged from 5.5 to 5.7 log10 (data not shown) and was not influenced
by time, temperature, or exposure to organic matter. The neutralizer solution had no effect on the survival of the spores (data not
shown), but the effectiveness of all disinfectants was influenced by
the treatment variables.
The propylene glycol that was added to the disinfectant solutions
prevented freezing during the 24-h test period at 220°C, but under
these conditions, the disinfectants produced less than a 2.0 log10
reduction of spores. With the light organic load, after a contact
period of 2 h at 4°C or 10°C, the DB had reduced spore counts by
4.4 and 4.7 log10, respectively. These reductions were about 3 log10
higher than those produced by SDF or Virkon (4°C only) and the
differences were significant (P , 0.05). After 24 h at 4°C or 10°C,
both DB and SDF had reduced spore counts by more than 5.0 log10.
Virkon was not tested at 10°C but spore reduction after 24 h at 4°C
was about 2 log10 lower than for the other disinfectants (Figures 1, A,
C, and E).
With the heavy organic load, the disinfectants reduced spore
counts by only less than 2 log10 within 2 h at either 4°C or 10°C.
After 24 h at these temperatures, however, the SDF had reduced
spore counts by at least 4.5 log10. These reductions were significantly
higher (P , 0.05) than those produced by DB or Virkon (Figures 1,
B, D, and F).
With both the light and heavy organic load, the disinfectants
were usually most effective at 23°C but contact for at least 24 h was
required for SDF and Virkon to kill at least 5.5 log10 of spores. The
DB was comparable in its effectiveness with the light organic load,
but not with the heavy load. It was concluded that at temperatures
as low as 4°C, DB was the most effective disinfectant for inactivating
spores within 2 h on surfaces with a light organic load. In comparison, SDF produced the greatest reduction of spores within 24 h on
surfaces with a heavy organic load.
Discussion
The spores of G. stearothermophilus, Bacillus atrophaeus, Bacillus
cereus, and Bacillus subtilis have all been used as surrogates for
spores of B. anthracis in previous studies (3,4,8,18). Geobacillus
­stearothermophilus was selected for use in this study because its spores
have high heat resistance that aided in separating them from other
microorganisms. It is also possible that the G. stearothermophilus
spores are more resistant to oxidizing chemicals than are Bacillus
surrogates (3,8). This may account for the fact that the disinfectants
used in this study had to be in contact with the preparations of
spores for up to 24 h in order to inactivate approximately 6 log 10 of
G. stearothermophilus.
The laboratory study described here was designed to simulate the
disinfection that would be required to inactivate B. anthracis spores
on the surfaces of farm equipment under field conditions. For this
reason, both light and heavy organic challenges were included for
evaluating the disinfectants. The light organic preparation, which is
equivalent to 5% to 10% serum, has been widely used in evaluating
disinfectants in medical settings and other environments (16). Such
2000;64:0–00
organic loads may be found on pre-cleaned farm equipment and
veterinary tools. The heavy organic preparation, which is equivalent
to 5% to 10% serum plus 5% sterilized garden soil, was intended to
provide more stringent challenges to disinfection, such as may be
encountered on inadequately cleaned tractors, trucks, and other
equipment. As discussed in other studies, organic matter may reduce
the effectiveness of disinfectants by interacting with the active ingredients and by forming a physical barrier that could hinder contact
between disinfectants and microorganisms (19).
In the present study, DB was the most effective disinfectant against
spores in the light organic preparations, in which it killed at least
4 logs of spores within 2 h at 4°C, 10°C, or 23°C. These findings are
in agreement with a report by Best, Springthorpe, and Sattar (20).
However, DB was not effective against spores in the heavy organic
preparation at any of these temperatures. The effectiveness of SDF
in both light and heavy organic preparations may be attributed to
its surfactant ingredients. In agreement with earlier reports (10–12),
the sporicidal effect of Virkon was compromised by organic loads.
Environmental temperature varies widely in many countries and in
this study, the disinfectants applied to solid surfaces at 220°C reduced
G. stearothermophilus spore counts by only approximately 2 log10. These
results differed substantially from those of other studies (21,22), which
reported that disinfectants killed at least 6 log10 of B. subtilis spores in
suspension tests at temperatures from 0 to ~ 240°C. The disinfectants
used in those studies were solutions made of sodium hypochlorite,
peracetic acid, or ß-propiolactone. Although tests on solid surfaces or
suspensions have been officially accepted by international organizations for evaluating sporicidal disinfectants (23), a much longer contact
time was required to inactivate anthrax spores by alcoholic peracetic
acid on a solid surface than in a suspension (24). It is therefore evident
that test results could be influenced by many factors, including the
type of spores used as surrogates, the type of disinfectants, temperature, and the nature of the tests.
For this study, the tests were carried out on solid surfaces in
order to simulate conditions that would exist on farms. It is evident, however, that cleaning and disinfection could only reduce
the levels of B. anthracis spores in the environment since farm
equipment is often difficult to clean and spores washed from the
equipment could survive in the soil and be picked up by boots and
tires. Nevertheless, this study suggests that DB and SDF, applied at
temperatures ranging from 4°C to 23°C, could substantially reduce
the load of B. anthracis counts on prewashed farm equipment and
thereby reduce the chances for spread of the disease.
Acknowledgments
This study is a part of the CRTI 08-0122TD project entitled
“Verification of Decontamination Processes in the AgriFood
Context,” which is funded by the Canadian Chemical, Biological,
Radiological, and Nuclear (CBRNE) Research and Technology
Initiative (CRTI). The authors thank Dr. S.A. Sattar of the University
of Ottawa in Ottawa, Ontario for introducing the second tier quantitative carrier test method to assess the sporicidal activity of chemical
disinfectants and Dr. J.L. Spencer, emeritus research scientist at the
Canadian Food Inspection Agency in Ottawa, Ontario, for discussing
and reviewing the manuscript.
The Canadian Journal of Veterinary Research
103
FOR PERSONAL USE ONLY
References
1. Fasanella A, Galante D, Garofolo G, Jones MH. Anthrax undervalued zoonosis. Vet Microbiol 2010;140:318–331.
2. Epp T, Argue C, Waldner C, Berke O. Spatial analysis of an
anthrax outbreak in Saskatchewan, 2006. Can Vet J 2010;51:
743–748.
3. Rogers JV, Sabourin CLK, Choi YW, et al. Decontamination
assessment of Bacillus anthracis, Bacillus subtilis, and Geobacillus
stearothermophilus spores on indoor surfaces using a hydrogen
peroxide gas generator. J Appl Microbiol 2005;99:739–748.
4. Rogers JV, Choi YW, Richter WR, et al. Formaldehyde gas inactivation of Bacillus anthracis, Bacillus subtilis, and Geobacillus
stearothermophilus spores on indoor surface materials. J Appl
Microbiol 2007;103:1104–1112.
5. Heninger SJ, Anderson CA, Beltz G, Onderdonk AB. Decon­
tamination of Bacillus anthracis spores: Evaluation of various
disinfectants. Appl Biosaf 2009;14:7–10.
6. Chatuev BA, Peterson JW. Analysis of the sporicidal activity of
chlorine dioxide disinfectant against Bacillus anthracis (Sterne
strain). J Hosp Infect 2010;74:178–183.
7. Guidelines for the Surveillance and Control of Anthrax in
Humans and Animals. World Health Organization (WHO)
[homepage on the Internet]. 3rd edition 2003. Available from:
http://www.who.int/csr/resources/publications/anthrax/
whoemczdi986text.pdf Last accessed on December 5, 2012.
8. Sabbah S, Springthorpe S, Sattar SA. Use of a mixture of surrogates for infectious bioagents in a standard approach to assessing
disinfection of environmental surfaces. Appl Environ Microbiol
2010;76:6020–6022.
9. Watanabe T, Turukawa S, Hirata J, Koyama T, Ogihara H,
Yamasaki M. Inactivation of Geobacillus stearothermophilus spores
by high-pressure carbon dioxide treatment. Appl Environ
Microbiol 2003;69:7124–7129.
10. Herńndez A, Martró E, Matas L, Martin M, Ausina V. Assessment
of in-vitro efficacy of 1% Virkon against bacteria, fungi, viruses
and spores by means of AFNOR guidelines. J Hosp Infect
2000;46:203–209.
11. Angelillo IF, Bianco A, Nobile CGA, Pavia M. Evaluation of the
efficacy of glutaraldehyde and peroxygen for disinfection of
dental instruments. Lett Appl Microbiol 1998;27:292–296.
12. Coates D. Sporicidal activity of sodium dichloroisocyanurate,
peroxygen and glutaraldehyde disinfectants against Bacillus
subtilis. J Hosp Infect 1996;32:283–294.
104
The Canadian Journal of Veterinary Research
13. Love AH, Bailey CG, Hanna ML, et al. Efficacy of liquid and
foam decontamination technologies for chemical warfare agents
on indoor surfaces. J Hazard Mater 2011;196:115–122.
14. Technology Information Summary on Surface Decontamination
Foam. U.S. EPA [homepage on the Internet]. EPA, 2009. Available
from: http://www.epa.gov/nhsrc/pubs/TISSurfaceDecontami
nationFoam.pdf Last accessed on December 5, 2012.
15. Sattar SA, Springthorpe VS, Adegbunrin O, Zafer AA, Busa M.
A disc-based quantitative carrier test method to assess the virucidal activity of chemical germicides. J. Virol Methods 2003;112:
3–12.
16. ASTM International. Standard Quantitative Disk Carrier Test
Method for Determining the Bactericidal, Virucidal, Fungicidal,
Mycobactericidal and Sporicidal Activities of Liquid Chemical
Germicides, E2197-02, West Conshohocken: ASTM, 2002.
17. Official Methods of Analysis. AOAC (Association of Official
Analytical Chemists) International. Washington DC, AOAC
960.09. Available from: http://www.eoma.aoac.org Last accessed
December 5, 2012.
18. Tomasino SF, Pines RM, Cottrill MP. Determining the efficacy
of liquid sporicides against spores of Bacillus subtilis on a hard
nonporous surface using the quantitative three step method:
Collaborative study. J AOAC Int 2008;91:833–852.
19. Springthorpe VS, Sattar SA. Carrier tests to assess microbicidal
activities of chemical disinfectants for use on medical devices
and environmental surfaces. J AOAC Int 2005;88:182–201.
20. Best MV, Springthorpe S, Sattar SA. Feasibility of a combined
carrier test for disinfectants: Studies with a mixture of five types
of microorganisms. Am J Infect Control 1994;22:152–162.
21. Jones LA, Jr, Hoffman RK, Phillips CR. Sporicidal activity of
peracetic acid and ß–propiolactone at subzero temperatures.
Appl Microbiol 1967;15:357–362.
22. Jones LA, Jr, Hoffman RK, Phillips CR. Sporicidal activity of
sodium hypochlorite at subzero temperatures. Appl Microbiol
1968;16:787–791.
23. Humphreys PN. Testing standards for sporicides. J Hosp Infect
2011;77:193–198.
24. Nattermann H, Becker S, Jacob D, Klee SR, Schwebke I,
Appel B. Efficient killing of anthrax spores using aqueous and
alcoholic peracetic acid solutions. Bundesgesundheitsblatt
Gesundheitsforschung Gesundheitsschutz 2005;48:939–950.
2000;64:0–00
FOR PERSONAL USE ONLY
Article
Effect of a straw-derived xylooligosaccharide on broiler growth
performance, endocrine metabolism, and immune response
Sun Zhenping, Lv Wenting, Yu Ruikui, Li Jia, Liu Honghong, Sun Wei, Wang Zhongmie,
Li Jingpan, Shan Zhe, Qin Yuling
Abstract
The aim of this work was to evaluate the effect of 3 levels of supplemental xylooligosaccharides (XOS) from straw on the growth
performance, endocrine metabolism, and immune response of broiler chickens. Day-old, healthy Arbor Acres broilers (n = 192)
received a basal diet of maize–soybean meal and, depending on the group to which they were allocated, no additive (control
group) or the following experimental treatments for 59 d: treatment 1: 5 g XOS/kg; treatment 2: 10 g XOS/kg; and treatment 3:
20 g XOS/kg. By day 59 the body weight gain of the chickens receiving treatment 2 had increased by 9.44% (P , 0.01) over the
gain of the control group. The levels of serum triiodothyronine, thyroxine, and insulin on day 44 were significantly higher in
the treatment groups than in the control group. The titers of antibody to the avian influenza H5N1 virus on day 24 were also
significantly higher in the treatment groups than in the control group, and on day 59 the titer of the chickens receiving treatment
2 were still significantly increased (P , 0.05). Thus, the addition of XOS to feed can increase growth performance, enhance
endocrine metabolism, and improve immune function in broiler chickens.
Résumé
L’objectif de ce travail était d’évaluer les effets de trois niveaux d’un supplément de xylooligosaccharides (XOS) provenant de la paille sur les
performances de croissance, le métabolisme endocrinien, et la réponse immunitaire de poulets à griller. Des poussins à griller en santé âgés d’un
jour (n = 192) de race Arbor Acres ont reçu une alimentation de base maïs-soya et, selon le groupe auquel ils ont été assignés, aucun additif
(groupe témoin) ou pendant 59 j le traitement expérimental suivant : traitement 1 : 5 g XOS/kg; traitement 2 : 10 g XOS/kg; et traitement
3 : 20 g XOS/kg. Au jour 59, le gain de poids corporel des poulets recevant le traitement avait augmenté de 9,44 % de plus (P , 0,01) que
le gain du groupe témoin. Les niveaux sériques de triiodothyronine, de thyroxine et d’insuline au jour 44 étaient significativement plus
élevés dans les groupes de traitement que dans le groupe témoin. Les titres d’anticorps contre le virus de l’influenza aviaire H5N1 au jour 24
étaient également significativement plus élevés dans les groupes de traitement que dans le groupe témoin, et au jour 59 les titres des poulets
recevant le traitement 2 étaient encore significativement augmentés (P , 0,05). Ainsi, l’ajout de XOS à l’alimentation peut augmenter les
performances de croissance, augmenter le métabolisme endocrinien et améliorer la fonction immunitaire des poulets à griller.
(Traduit par Docteur Serge Messier)
Introduction
Antibiotics as growth promoters have been used for decades
in poultry production to improve farm performance and control
intestinal pathogens. With increasing interest in discontinuing
the use of antibiotics as feed additives the search for alternatives has intensified. Ideally these alternatives should improve
growth performance and maintain sound health for the chickens. Therefore, the search for new types of feed additives that
are pollution-free has become the focus of current research (1).
China is a large agricultural country, and substantial amounts of
agricultural by-products, such as corn cob, cotton seed hull, and
straw, that are rich in cellulose-type xylanase are produced every
year (2). Xylooligosaccharides (XOS) can be produced from many
edible fungi through the hydrolysis of semicellulose by xylanase
(3,4). Straw chaff, the substrate used for cultivating edible fungi,
is regarded as XOS after the biologic degradation of fungi through
2 to 3 batches of fungus production. To explore the biologic characteristics of XOS and their application in livestock and poultry
production, the authors studied the effects of XOS on growth
performance, endocrine metabolism, and immune response in
broiler chickens.
Materials and methods
The animal research protocols conformed to those approved by the
Yangzhou University Animal Care and Use Committee, Yangzhou,
China.
College of Veterinary Medicine, Yangzhou University, Yangzhou 225009, China (Sun, Lv, Yu, Li, Liu, Sun, Wang, Li, Zhe); Jianhu Agriculture
College, Jianhu 334700, China (Qin).
Address all correspondence to Professor Sun Zhenping; telephone: 186 514 87972245; fax: 186 514 87972218; e-mail: [email protected]
Received February 14, 2012. Accepted June 26, 2012.
2013;77:105–109
The Canadian Journal of Veterinary Research
105
FOR PERSONAL USE ONLY
Table I. Feed formula and nutritional levels of the broiler chickens’ basal diet
Composition
Age (d)
Age (d)
(% of feed)
1–21
22–42
43–59
Nutritional level
1–21
22–42
43–59
Corn
53.8062.00 69.72 MJ (mCal/kg)
2.9503.050 2.966
Soybean meal
38.16
29.97
24.62
Crude protein (%)
21.92
19.06
17.72
Fish meal
1.50
1.50
1.00
Linoleic acid (%)
1.52
1.73
1.73
Limestone
1.100.90 1.00Calcium (%)
1.000.85 0.81
Calcium phosphate
1.70
1.60
1.60
Phosphorus (%)
0.47
0.42
0.42
0.30
0.30
0.30
Sodium chloride (%)
0.35
0.35
0.35
Table salt
Lysine
0.020.02 0.08Lysine
1.140.96 0.96
Methionine
0.250.21 0.18Methionine (%)
0.540.47 0.47
Vegetable oil
2.17
2.50
0.50
Methionine 1 cystine
0.88
0.78
0.75
Premixa
1.001.00 1.00
a
Supplied per kilogram of 1% premix: vitamin A, 1500 IU; vitamin D3, 200 IU; vitamin E, 10 IU; vitamin K, 0.5 mg; thiamine, 1.8 mg; riboflavin,
3.6 mg; pyridoxine, 3.5 mg; vitamin B12, 0.01 mg; pantothenic acid, 10 mg; niacin, 35 mg; choline, 1300 mg; biotin, 0.15 mg; folic acid, 0.55 mg;
manganese, 60 mg; zinc, 40 mg; copper, 8 mg; iron, 80 mg.
Production of XOS
Edible fungi were used by the Animal Physiology Laboratory
of the College of Veterinary Medicine at Yangzhou University to
ferment and degrade straw chaff to make XOS. Briefly, the edible
fungus Pleurotus ostreatus, obtained from the Yangzhou Academy of
Agricultural Sciences, was cultivated in potato dextrose agar (200 g
of potato, 15 g of agar, 20 g of glucose, 3 g of KH2PO4, 10 mg of VB1,
and 1.5 g of MnSO4; Difco Laboratories, Detroit, Michigan, USA) at
30°C for 7 d, at which time mycelia completely covered the surface of
the Petri dishes. Liquid medium was inoculated with 1 disk of agar
plate mycelium 6 mm in diameter per 10 mL of medium. The liquid
medium contained (per liter) 1.4 g of (NH4)2SO4, 2.0 g of KH2PO4,
0.1 g of urea, 0.3 g of MgSO 4 · 7H2O, 0.3 g of CaCl2, 5.0 mg of
FeSO4 · 7H2O, 1.56 mg of MnSO4 · H2O, 2.0 mg of CoCl2, and 1.4 mg
of ZnSO4 · 7H2O. Solid fermentation was carried out in 500-mL plastic flasks containing 350 g of sterile solid medium (pH 5.5) plus 10%
of liquid mycelium. The solid medium contained, per 100 g, 96 g of
straw, 1 g of CaHPO4, 1.4 g of lime, 1.5 g of gypsum, and 0.6 mg of
carbendazole. The flasks were incubated at 30°C for 40 d in a warm
room without agitation. Paper chromatography and photoelectric
colorimetry were used to determine that the XOS content of the
degraded straw medium was 82.48 mg/g and that the other macronutrients consisted mainly of neutral detergent fiber (81.81 mg), acid
detergent fiber (56.15 mg), and crude protein (8.30 mg).
Animals and experimental treatments
Day-old Arbor Acres (AA) broiler chickens (n = 192) were provided by Nantong Haian Poultry Breeding Farm, Nantong, Jiangsu,
China. Males and females were identified and housed separately in
6 wire cages per group, 8 birds per cage (3 cages for males and 3 for
females). Each bird was numbered and weighed. The birds were randomly allocated to 1 of 4 experimental groups for 59 d. All received
a basal diet of maize–soybean meal with no additive (control group)
or XOS: 5 g/kg (treatment 1); 10 g/kg (treatment 2); or 20 g/kg
(treatment 3). The basal diet was prepared by the authors according to the recommendations of the US National Research Council
106
The Canadian Journal of Veterinary Research
(5). The details of the feed formula and nutritional levels are shown
in Table I. The feed was made into pellets for use in 3 periods: the
1st period was from day 1 to day 21, the 2nd from day 22 to day 42,
and the 3rd from day 43 to day 59.
Animal management
The chickens were kept in cages in a chicken house during the
entire period of the experiments. Infrared lights and heaters were
used to maintain warmth; natural ventilation and a sustained lighting system were also implemented. The temperature was kept at
23.4°C to 29.0°C, and the relative humidity ranged from 50% to 80%.
All the chickens had free access to feed and water.
Vaccination and sample collection
On day 14 all the chickens were given an inactivated vaccine
against the H5N1 subtype of avian influenza (AI) virus via a single
intramuscular injection. Starting on day 24 blood samples were
collected every 5 d from the plantar vein of 6 chickens (3 male and
3 female) selected randomly from each group.
Measurement of parameters
To assess growth performance the weight of the chickens was
measured on days 1 and 59. Body weight gain, feed intake, and feed
conversion ratio were determined.
The radioimmunoassay (RIA) technique was used to determine
the serum concentrations of triiodothyronine (T3), thyroxine (T4),
and insulin on day 44. The RIA assay kits were produced by Beijing
Kemei Dongya Biotechnology Company, Beijing, China.
Serum antibody titers against the AI H5N1 vaccine virus were
determined by hemagglutination inhibition (HI) (6) with use of
a preparation of 1% chicken erythrocytes made by conventional
technique. The antibody titers were expressed as the average of log2.
Statistical analysis
A Microsoft Excel database was established for all the experimental data. One-way analysis of variance was used in SPSS 11.5
statistical software (SPSS, Chicago, Illinois, USA) to determine the
2000;64:0–00
FOR PERSONAL USE ONLY
Table II. Effects of xylooligosaccharides (XOS) added to the feed on the growth performance of the
chickens in 59 d
Growth performance, mean 6 standard errora
Treatment group
Body weight gain (kg)
Feed intake (kg)
Feed conversion ratio
Control: basal diet
3.486 6 0.052
6.402 6 0.110
1.844 6 0.044
Treatment 1: 5 g XOS/kg
3.694 6 0.085
6.475 6 0.057
1.767 6 0.031
Treatment 2: 10 g XOS/kg
3.815 6 0.099**
6.479 6 0.063
1.716 6 0.045*
Treatment 3: 20 g XOS/kg
3.510 6 0.050
6.171 6 0.048*
1.765 6 0.028
a
Significant difference from the mean for the control group at P-values of * , 0.05 and ** , 0.01.
Table III. Effects of XOS on serum hormone concentrations after 44 d
Hormone concentration, mean 6 standard errora
TriiodothyronineThyroxine
Insulin
Treatment group
(ng/mL)(ng/mL)(ng/mL)
Control1.422 6 0.159
4.654 6 0.317
7.095 6 0.333
Treatment 1
2.327 6 0.189**
6.288 6 0.136**
7.984 6 0.357*
1.829 6 0.171
6.375 6 0.170**
7.762 6 0.190
Treatment 2
2.709 6 0.272**
5.689 6 0.148**
8.250 6 0.275**
Treatment 3
aSignificant difference from the mean for the control group at P-values of * , 0.05 and ** , 0.01.
Table IV. Changes over time in titer of hemagglutination inhibition antibody to the H5N1 subtype of avian influenza virus
Treatment Average log2 titer, mean 6 standard error;a age (d)
group24 2934 3944495459
Control4.1 6 0.2
5.8 6 0.3
4.6 6 0.2
5.4 6 0.3
5.0 6 0.3
6.5 6 0.4
4.8 6 0.5
5.1 6 0.5
Treatment 1
5.4 6 0.3**
5.3 6 0.3
4.7 6 0.4
4.8 6 0.3
5.3 6 0.3
5.0 6 0.3
5.2 6 0.3
5.9 6 0.6
Treatment 2
5.3 6 0.3**
5.5 6 0.5
4.8 6 0.3
5.1 6 0.5
5.6 6 0.5
5.6 6 0.2
5.7 6 0.2
6.8 6 0.4**
Treatment 3
4.9 6 0.3*
4.3 6 0.3
4.6 6 0.2
5.1 6 0.3
4.3 6 0.3
5.0 6 0.4
4.9 6 0.2
5.1 6 0.5
aSignificant difference from the mean for the control group at P-values of * , 0.05 and ** , 0.01.
differences between groups. Results for the multiple-range test variant of the least significant difference method are shown as mean 6
standard error. Differences between means were considered significant at P , 0.01 and P , 0.05.
titers in the control group, the titer in treatment group 2 was 33.78%
higher (P , 0.05) on day 59.
Results
In this study, broilers with XOS-supplemented diets had greater
body weight gain than those with a basal diet, along with decreased
feed conversion, in agreement with the Food and Agriculture
Organization of the United Nations (7), which suggested that XOS
could be considered emerging prebiotics and defined a prebiotic as
“a nonviable food component that confers a health benefit on the
host associated with modulation of the microbiota”. Made up of
xylose units, and approximately half as sweet as sucrose, XOS can be
produced by enzymatic hydrolysis from xylan, the main component
of plant hemicelluloses and therefore readily available in nature
(8). The fungal genera Trichoderma, Aspergillus, Fusarium, and Pichia
are considered great producers of xylanases (9–13). White-rot fungi
have also been shown to produce extracellular xylanases that act
on a wide range of hemicellulose materials and are also useful as
food sources (14) and metabolites of interest to the pharmaceutical,
cosmetic, and food industries (15,16). In this study, the edible fungus
P. ostreatus was used to ferment and degrade straw chaff to make
XOS. During the process, other nutritional agents were produced
(e.g., neutral and acid detergent fiber, crude protein, and minerals)
As shown in Table II, the chickens receiving treatment 2 had a
9.44% greater gain in body weight (P , 0.01) and a 4.18% lower
feed conversion ratio (P , 0.05) than the control group. In addition,
the chickens receiving treatment 3 had a 3.61% lower feed intake
(P , 0.05) than the control group.
As shown in Table III, on day 44 the serum level of T3 in treatment
groups 1 and 3 was greater than that in the control group by 63.64%
(P , 0.01) and 90.51% (P , 0.01), respectively, and the serum level
of T4 in treatment groups 1, 2, and 3 was greater than that in the
control group by 35.11% (P , 0.01), 36.98% (P , 0.01), and 22.24%
(P , 0.01), respectively. In addition, the serum insulin level in treatment groups 1 and 3 was greater than that in the control group by
12.53% (P , 0.05) and 16.28% (P , 0.01), respectively.
As shown in Table IV, on day 24 the serum HI antibody titer to
the AI H5N1 vaccine virus was greater in treatment groups 1, 2, and
3 than in the control group by 31.77% (P , 0.01), 27.71% (P , 0.01),
and 19.61% (P , 0.05), respectively. In addition, comparing with the
2000;64:0–00
Discussion
The Canadian Journal of Veterinary Research
107
FOR PERSONAL USE ONLY
that could help to modify feed intake (17,18). The fact that XOS are
relatively stable in acidic conditions may protect XOS from decomposition when passing through the stomach (19). Degradation in the
intestine has been studied in vitro with an artificial model of digestive enzymes (a-amylase, pancreatin, gastric juice, and intestinal
brush border enzymes), and no hydrolyzation of XOS (xylobiose)
was observed (20). This suggests that XOS may be nondigestible or
of low digestibility and would reach the colon intact. In addition,
XOS can decompose harmful substances, produce organic acids and
other beneficial substances, reduce fecal stench, and improve the
farming environment (21).
The effects of T3 and T4 on avian metabolism and growth rates
have been well-documented (22–24). The biologic activity of T 3 is
several times greater than that of T4, and T3 functions much faster
than T4. Therefore, T3 is believed generally to be the main thyroid
hormone with respect to physiological function (25). Kühn et al (26)
found that the level of T3 in poultry is related positively to growth.
Growth is slowed significantly in an animal with hypothyroidism.
The relation between thyroid secretion rate and growth demonstrated in chickens (27) suggests that the poorer growth performance
of the control birds in the present study could be partly attributed
to decreased T3 activity. Comparison of the serum concentrations
of T3 between the control and treatment groups indicated that XOS
increased the T3 activity, though not always significantly. The level
of T4 in the serum was significantly increased in the birds receiving
supplemental XOS compared with the control group. These results
indicate that XOS can improve thyroid function and that it helps the
thyroid hormones participate in the growth and metabolism of poultry. The main mechanism of action of T3 involves control of the gene
expression and synthesis of growth hormone. It also increases insulin and the RNA content of muscle, which further promote protein
synthesis (28). In the group receiving a supplement of 20 g XOS/kg,
although the serum levels of T3 and T4 increased significantly, there
was no notable difference in body weight gain compared with the
control group. This may be explained by excessive supplementation;
however, this question needs further exploration.
The main functions of insulin are to decrease the blood glucose
level, to regulate growth, and to participate in a wide range of
metabolic processes. One of the most important mechanisms of
action of insulin is to facilitate the transport of glucose and amino
acids into cells. This promotes protein synthesis and increases the
concentration of glucose in the cells, which facilitates glycolysis and,
further, improves the synthesis of fatty acids and the breakdown of
triglycerides. In the meantime, insulin inhibits the degradation of
glycogen, proteins, and triglycerides. An increased level of insulin
assists glucose transport into cells, decreases the concentration of
cyclic adenosine monophosphate, and enhances glycogen synthesis
(29). This study showed that the insulin level in the groups treated
with XOS was higher than that of the control group. The possible
reasons are that XOS is rich in amino acids, mainly lysine (1.2%)
and tryptophan (0.8%), and that XOS can facilitate intestinal and
bowel movement and further increase digestibility. Other studies
have shown that insulin can facilitate the transformation of T4 to T3
(30). Therefore, XOS supplementation can improve the metabolism
of broilers.
108
The Canadian Journal of Veterinary Research
Avian influenza is one of the most damaging diseases affecting the
poultry industry. In the present experiment the serum levels of antibody against the AI H5N1 vaccine virus were significantly greater
in the treatment groups than in the control group. This suggests that
XOS can strengthen humoral immunity in poultry. Because the level
of maternal antibody may have had an influence on the experimental
results, we will avoid the interference of maternal antibody and other
external factors in future experiments.
Acknowledgment
This work was supported by grant 08KJD180011 from the Jiangsu
Province Natural Science Foundation.
References
1. Fasina YO, Thanissery RR. Comparative efficacy of a yeast
product and bacitracin methylene disalicylate in enhancing early
growth and intestinal maturation in broiler chicks from breeder
hens of different ages. Poult Sci 2011;90:1067–1073.
2. Gong Y, Jiang M. Biodiesel production with microalgae as
feedstock: From strains to biodiesel. Biotechnol Lett 2011;33:
1269–1284.
3. Gobinath D, Madhu AN, Prashant G, Srinivasan K, Prapulla SG.
Beneficial effect of xylo-oligosaccharides and fructo-­
oligosaccharides in streptozotocin-induced diabetic rats. Br J
Nutr 2010;104:40–47.
4. Yoshida T, Tsubaki S, Teramoto Y, Azuma JI. Optimization of
microwave-assisted extraction of carbohydrates from industrial waste of corn starch production using response surface
methodology. Bioresour Technol 2010;101:7820–7826. Epub 2010
Jun 7.
5. NRC. Nutrient Requirements of Poultry. 9th ed. Washington,
DC, National Academy Press, 1994.
6. Ducatez MF, Cai Z, Peiris M, et al. Extent of antigenic crossreactivity among highly pathogenic H5N1 influenza viruses.
J Clin Microbiol 2011;49:3531–3536.
7. Food Quality and Standards Service, Food and Agriculture
Organization of the United Nations. FAO Technical Meeting on
Prebiotics. 2007 Sep 15–16. Rome, Italy. Available from www.
aat-taa.eu/index/en/company/download/1262610500.html
Last accessed January 17, 2013.
8. Teng C, Yan Q, Jiang Z, Fan G, Shi B. Production of xylooligosaccharides from the steam explosion liquor of corncobs coupled
with enzymatic hydrolysis using a thermostable xylanase.
Bioresour Technol 2010;101:7679–7682.
9. Wong KKY, Saddler JN. Trichoderma xylanases, their properties
and application. Crit Rev Biotechnol 1992;12:413–435.
10. Chistakopoulos P, Nerinckx W, Kekos D, Macris B, Claeyssens
M. Purification and characterization of two low molecular mass
alkaline xylanases from Fusarium oxysporum F3. J Biotechnol
1996;51:181–189.
11. De Vries RP, Kester HC, Poulsen CH, Benen JA, Visser J. Synergy
between enzymes from Aspergillus involved in the degradation
of plant cell wall polysaccharides. Carbohydr Res 2000;327:
401–410.
2000;64:0–00
FOR PERSONAL USE ONLY
12. Den Haan R, Van Zyl WH. Enhanced xylan degradation and
utilization by Pichia stipitis overproducing fungal xylanolytic
enzymes. Enzyme Microb Technol 2003;33:620–628.
13. Adsul MG, Ghule JE, Shaikh H, et al. Enzymatic hydrolysis of delignified bagasse polysaccharides. Carbohydr Polym
2005;62:6–10.
14. Buswell JA, Chang ST. Biomass and extracellular hydrolytic
enzyme production by six mushroom species grown on soybean
waste. Biotechnol Lett 1994;16:1317–1322.
15. Jong SC, Donovick R. Antitumoral and antiviral substances from
fungi. Adv Appl Microbiol 1989;34:183–262.
16. Cai QE, Yue XY, Niu TQ, Ji C, Ma QG. The screening of culture condition and properties of xylanase by white-rot fungus
Pleurotus ostreatus. Process Biochem 2004;39:1561–1566.
17. Centeno C, Arija I, Viveros A, Brenes A. Effects of citric acid and
microbial phytase on amino acid digestibility in broiler chickens.
Br Poult Sci 2007;48:469–479.
18. Fébel H, Mézes M, Pálfy T, et al. Effect of dietary fatty acid pattern on growth, body fat composition and antioxidant parameters in broilers. J Anim Physiol Anim Nutr 2008;92:369–376.
19. Imaizumi K, Nakatsu Y, Sato M, Sedarnawati Y, Sugano M.
Effects of xylooligosaccharides on blood glucose, serum and
liver lipids and cecum short-chain fatty acids in diabetic rats.
Agric Biol Chem 1991;55:199–205.
20. Koga K, Fujikawa S. Xylo-oligosaccharides. In: Nakakuki T,
ed. Oligosaccharides: Production, Properties and Applications.
Japanese Technology Reviews. Philadelphia, Pennsylvania:
Gordon and Breach Science Publishers, 1993:130–143.
21. Zhou J, Du WX, Yang TG. Effects of different xylooligosaccharide
combinations on productive performance of ducks and laying
hens. Anim Husb Vet 2006;9:21–24.
22. Scott T, van der Zijpp A, Glick B. Effect of thiouracil-induced
hypothyroidism on the humoral immunity of New Hampshire
chickens. Poult Sci 1985;64:2211–2217.
2000;64:0–00
23. Donkoh A. Ambient temperature: A factor affecting performance
and physiological response in broiler chickens. Int J Biometeorol
1989;33:259–265.
24. Haddad EE, Mashaly MM. Effect of thyroidectomy of immature
male chickens on circulating thyroid hormones and on responses
to thyroid-stimulating hormones and chronic cold exposure.
Poult Sci 1989;68:365–376.
25.Proszkowiec-Weglarz M, Richards MP, Humphrey BD,
Rosebrough RW, McMurtry JP. AMP-activated protein kinase
and carbohydrate response element binding protein: A study of
two potential regulatory factors in the hepatic lipogenic program
of broiler chickens. Comp Biochem Physiol B Biochem Mol Biol
2009;54:68–79.
26. Kühn ER, Decuypere E, Rudas P. Hormonal and environmental
interactions on thyroid function in the chick embryo and posthatching chicken. J Exp Zool 1984;232:653–658.
27. Leung FC, Taylor JE, van Iderstine A. Thyrotrophin-releasing
hormone stimulates body weight gain and increased thyroid hormones and growth hormone in plasma of cockerels.
Endocrinology 1984;115:736–740.
28. Fernández I, Martín del Río R, Orensanz LM. Surgical ablation
of oviductal extrinsic innervation changes GABA levels in the
rat fallopian tube. Life Sci 1985;36:1733–1737.
29. Larabee JL, Maldonado-Arocho FJ, Pacheco S, et al. Glycogen
synthase kinase 3 activation is important for anthrax edema
toxin-induced dendritic cell maturation and anthrax toxin
receptor 2 expression in macrophages. Infect Immun 2011;79:
3302–3308. Epub 2011 May 16.
30. Mitsuma T, Nogimori T, Chaya M. Beta-casomorphin inhibits
thyrotropin secretion in rats. Exp Clin Endocrinol 1984;84:
324–330.
The Canadian Journal of Veterinary Research
109
FOR PERSONAL USE ONLY
Article
The rabbit as an infection model for equine proliferative enteropathy
Francesca Sampieri, Andrew L. Allen, Nicola Pusterla, Fabio A. Vannucci, Aphroditi J. Antonopoulos,
Katherine R. Ball, Julie Thompson, Patricia M. Dowling, Don L. Hamilton, Connie J. Gebhart
Abstract
The objective of this study was to demonstrate the susceptibility of rabbits to Lawsonia intracellularis obtained from a case
of clinical equine proliferative enteropathy (EPE). This is a preliminary step toward developing a rabbit infection model
for studying pathogenesis and therapy of EPE in horses. Nine does were equally assigned to 3 groups. Animals in 2 groups
(Group 1 and Group 2) were orally inoculated with different doses of cell-cultured L. intracellularis. Controls (Group 3) were
sham-inoculated. Feces and blood were collected before the rabbits were infected and at 7, 14, and 21 days post-infection (DPI).
Serum immunoglobulin G (IgG) titers were measured using an immunoperoxidase monolayer assay (IPMA) and fecal samples
were analyzed with quantitative polymerase chain reaction (qPCR). A doe from each group was euthanized at 7, 14, and 21 DPI
for collection and evaluation of intestinal samples. Tissues were stained by routine hematoxylin and eosin (H&E) method and
immunohistochemistry (IHC) with L. intracellularis-specific mouse monoclonal antibody. At 14 DPI, serologic responses were
detected in both infected groups, which maintained high titers through to 21 DPI. Lawsonia intracellularis DNA was detected in
the feces of Group 2 on 7 DPI and in both infected groups on 14 DPI. Gross lesions were apparent in Group 1 and Group 2 on
14 DPI. Immunohistochemistry confirmed L. intracellularis antigen within cells of rabbits in Group 1 and Group 2 on 7, 14, and
21 DPI. No lesions, serologic response, shedding, or IHC labeling were found in Group 3 rabbits. This study describes an EPE
rabbit model that simulates natural infection, as typical lesions, immune response, and fecal shedding were present.
Résumé
Cette étude visait à démontrer la susceptibilité des lapins à Lawsonia intracellularis obtenu d’un cas clinique d’entéropathie proliférative
équine (EPE). Ceci est une étape préliminaire dans le développement d’un modèle d’infection chez le lapin pour étudier la pathogénie et
le traitement de l’EPE chez les chevaux. Neuf lapines ont été assignées également à 3 groupes. Les animaux dans deux groupes (Groupe 1
et Groupe 2) ont été inoculés oralement avec différentes doses de L. intracellularis cultivés sur cellules. Les témoins (Groupe 3) étaient
faussement inoculés. Des fèces et du sang ont été prélevés avant que les lapins soient infectés et aux jours 7, 14 et 21 post-infection (DPI). Les
titres sériques d’immunoglobulines G (IgG) ont été mesurés par une épreuve d’immunoperoxydase en monocouche (IPMA) et les échantillons
de fèces ont été analysés par réaction quantitative d’amplification en chaîne par la polymérase (qPCR). Une lapine de chaque groupe a été
euthanasiée 7, 14 et 21 DPI pour prélèvement et évaluation d’échantillons intestinaux. Les tissus étaient colorés à l’aide d’hématoxyline
et éosine (H&E) et en immunohistochime (IHC) avec un anticorps monoclonal de souris spécifique à L. intracellularis. Au jour 14 postinfection, une réponse sérologique a été détectée chez les animaux des deux groupes infectés, et des titres élevés ont été maintenus jusqu’à
21 DPI. De l’ADN de L. intracellularis fut détecté dans les fèces du Groupe 2 au jour 7 PI et dans les 2 groupes infectés au jour 14 PI.
Des lésions macroscopiques étaient apparentes dans le Groupe 1 et le Groupe 2 au jour 14 PI. L’immunohistochime a confirmé la présence
d’antigène de L. intracellularis à l’intérieur des cellules de lapins dans les Groupes 1 et 2 aux jours 7, 14 et 21 PI. Aucune lésion, réponse
sérologique, excrétion, ou marquage en IHC n’ont été trouvés chez les lapins du Groupe 3. La présente étude décrit un modèle lapin d’EPE
qui imite l’infection naturelle, étant donné la présence de lésions typiques, de réponse immunitaire et d’excrétion fécale.
(Traduit par Docteur Serge Messier)
Introduction
Lawsonia intracellularis is a Gram-negative, obligate intracellular
bacterium that affects a wide range of domestic, wild, avian, and
laboratory animal species (1–5). Principally, L. intracellularis is known
as the etiologic agent of porcine proliferative enteropathy (PPE) and
equine proliferative enteropathy (EPE), with approximately 98% 16S
recombinant DNA (DNAr) gene similarities reported between strains
(2,4,6). Associated with L. intracellularis’s intra-cytoplasmic replication is the patent proliferation induced in the host’s enterocytes of
Department of Veterinary Biomedical Sciences (Sampieri, Antonopoulos, Ball, Dowling, Hamilton), Department of Veterinary Pathology (Allen),
Western College of Veterinary Medicine, University of Saskatchewan, Saskatoon, Saskatchewan; Department of Veterinary Medicine and
Epidemiology, School of Veterinary Medicine, University of California, Davis, California, USA (Pusterla); Department of Veterinary and
Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, Saint Paul, Minnesota, USA (Vannucci, Gebhart); Canadian Light
Source, Saskatoon, Saskatchewan (Thompson).
Address all correspondence to Dr. Francesca Sampieri; telephone: 502-727-3460 fax: 270-767-7450; e-mail: [email protected] or
­[email protected]
Received February 10, 2012. Accepted June 6, 2012.
110
The Canadian Journal of Veterinary Research
2013;77:110–119
FOR PERSONAL USE ONLY
either the small or large intestine, which reduces nutrient absorption and results in malabsorption, diarrhea, depression, weight loss,
abdominal pain, and even death (7–8). Typically, EPE affects the
enterocytes of the distal portion of the jejunum and ileum of weanling foals. Several individual, isolated cases of EPE were reported
before 1999 (9–12). The first large outbreaks in foals occurred in 1999
in Quebec and Ontario, Canada and clinical EPE has since become
increasingly important worldwide (6,13–14).
Lawsonia intracellularis is a challenging organism to isolate and
maintain in vitro, as its growth requires an intracellular environment and a specific microaerophilic atmosphere (15). Many studies
about susceptibility to L. intracellularis in pigs targeted not only
bacterial culture in vitro, but also experimental reproduction of PPE
in animal models. Hamsters are the main laboratory species that
can be naturally affected by L. intracellularis and the disease in this
species is commonly and non-specifically referred to as “wet tail”
(2,8). Hamsters were the first model species in which information
about lesion progression was obtained experimentally, as disease
was induced through laborious filtration of scrapings of porcineinfected ileal tissue (16). Since the early 1990s, hamsters have been
considered a potentially advantageous model for PPE because they
cost less and provide larger statistical power of experiments than
mice (17–21). Reproduction of the disease in laboratory species using
intestinal mucosa homogenate or pure cell cultures has traditionally been limited to pigs or hamsters, either infected (from strains
collected from animals of the same species) or cross-infected (from
strains collected from different animal species) (17,22–23). Although
a few investigators have successfully produced typical lesions of
proliferative enteropathy (PE) in mice, hamsters continue to provide
a reliable infection model for investigating PPE using porcine ileal
scraping homogenates as inocula (8,18,24).
In foals, EPE has only been experimentally reproduced after oral
inoculation of an equine strain of L. intracellularis, which originated
from the intestine of an affected foal that succumbed to EPE (25).
There are no published reports about EPE reproduced in a different
species, however, which raises the question of whether other animals
are susceptible to the equine L. intracellularis strain. Two preliminary
infection trials in hamsters, which used a virulent pure cell culture
equine L. intracellularis strain, did not yield EPE lesions. However,
classical microscopic lesions were clearly observed in positive control
hamsters infected with a pure cell culture porcine L. intracellularis
strain (Sampieri F, Vannucci FA, Allen AL, et al. 2012, University of
Saskatchewan, Western College of Veterinary Medicine).
Interestingly, natural L. intracellularis infection is also recognized
in rabbits, although less frequently than in hamsters. Clinical signs
are similar to those noted in other species, although the intestinal
lesions are also often found in the cecum and large colon (18,26–28).
Furthermore, fecal shedding has been observed through quantitative
polymerase chain reaction (qPCR) of fecal material recovered from
wild rabbits living on the grounds of equine stud farms where EPE
was endemic (1).
The objective of this study was to reproduce EPE lesions in rabbits, due to the anatomical and physiological similarities of their
gastrointestinal systems to the horse (29). This is the first report
of experimental infection in rabbits with a pure cell culture of
L. intracellularis derived from a clinical case of EPE and it therefore
2000;64:0–00
represents a valuable preliminary step toward developing a rabbit
infection model for studying EPE in horses.
Materials and methods
Animals
Nine, 7- to 8-wk-old female New Zealand white rabbits (Charles
River Canada, Pointe Claire, Quebec) were used (Oryctolagus
­cuniculus, spp. strain -052). The rabbits originated from colonies
tested at regular intervals for absence [viral antibody free (VAF)]
of Reovirus, Rotavirus, L. intracellularis, Helicobacter spp., cilia-­
associated respiratory (CAR) bacillus, Salmonella spp., Pasteurella
spp., Pseudomonas aeruginosa, Treponema helminths spp., Clostridium
piliforme, and Eimeria spp. among other viral, bacterial, and parasitic diseases. On arrival at the Animal Care Unit at University of
Saskatchewan’s Western College of Veterinary Medicine, the 9 does
were mandatorily acclimated to the room for 1 wk. At the beginning
of the experimental trial, the rabbits were weighed (range: 1.8 to
2.3 kg), examined, treated with a local anesthetic (EMLA Cream;
Astra Zeneca Canada, Mississauga, Ontario), and tattooed on the
right ear. Rabbits were randomly assigned to 3 groups of 3 animals
each (Group 1, Group 2, and Group 3), group-housed in isolated
pens in a Containment Level-2 room, fed rabbit pellets (Whole Earth
Rabbit Ration; Federated Co-operatives, Saskatoon, Saskatchewan)
ad libitum, and maintained using standard husbandry conditions
(12/12 h light-dark cycle and 20°C 6 2°C room temperature).
All groups were housed in the same room, but were managed
separately, with particular care to assess Group 3 (uninfected controls) first. Animals were bedded on ventilated shavings. The base
of each pen was separated and isolated from other pens by PVC
compartments (40 to 50 cm high) and a stainless steel mesh at the top
of the pens prevented direct contact between rabbits in adjacent pens
and the mixing of bedding. Cleaning and disinfection procedures
were standardized for the facilities and a peroxide-based disinfectant (Peroxigard; Bayer, Toronto, Ontario) was used. This study was
approved by the Animal Research Ethics Board of the University of
Saskatchewan and conducted according to Canadian Council on
Animal Care (CCAC) guidelines.
Inoculum preparation
Lawsonia intracellularis inocula were prepared as described in a
previous paper (25). The infectious material was harvested during
necropsy of a foal diagnosed with EPE, for which clinical signs were
confirmed by histopathology and immunohistochemistry (IHC)
findings. The L. intracellularis harvested from the ileal mucosa were
subsequently cultured on McCoy cells [American Type Culture
Collection (ATCC) CRL-1696], as described in previous papers
(15,30). Two different doses of inocula were prepared and each was
suspended in 3 mL of buffered sucrose/phosphate/glutamate (SPG)
medium to be administered to rabbits in Group 1 and Group 2 (31).
Sham treatment (SPG medium only) was administered to Group 3
(controls). An SYBR green-based PCR quantitation assay was used
to determine the bacterial concentration of the inocula (32). This
assay targets the aspartate ammonia lyase gene (aspA gene), which
is represented just once on the L. intracellularis chromosome, so that
The Canadian Journal of Veterinary Research
111
FOR PERSONAL USE ONLY
each aspA gene copy corresponds to 1 organism (32). Since a lower
culture passage appears related to higher L. intracellularis virulence,
passage cultures lower than 20 (passages 9 and 10, for Groups 1
and 2, respectively) were used to infect the rabbits, but with different doses, to potentially compensate for the difference in passage.
Thus, Group 1 received a dose equivalent to 1.3 3 108 bacteria/rabbit
and Group 2 received a dose equivalent to 2.5 3 108 bacteria/rabbit.
These infecting doses, obtained from the same equine-infected isolate
previously used in the foal model, are approximately 150 to 200 times
smaller than the doses used to infect foals and 6 to 10 times larger
than the dose used to infect hamsters (25) (Sampieri F, Vannucci FA,
Allen AL, et al. 2012, University of Saskatchewan, Western College
of Veterinary Medicine).
Inoculation procedures
Rabbits were inoculated with L. intracellularis on the first day
after the acclimation period (1 wk after arrival). Prior to the infection, pooled fecal samples were collected from each separate pen,
each rabbit was weighed and its general health was assessed, and
a blood sample was collected from the central artery of the left ear,
which had previously been prepped with a local anesthetic cream
(EMLA Cream; Astra Zeneca Canada). A local lidocaine gel block
(Xylocaine Gel 2%; Astra Zeneca Canada) was applied inside the
right nostril and a 40-cm long feeding tube (Kendall Sovereign; Tyco
Healthcare Group, Mansfield, Massachusetts, USA) was inserted
through the nose into the stomach. Each rabbit received either a
3-mL L. intracellularis inoculum or a 3-mL SPG medium-only treatment naso-gastrically.
Collection of samples
Changes in body weight were monitored daily throughout the
21 d of the study. Demeanor, gross appearance, fecal consistency and
quality, appetite, and self- and mutual grooming were monitored
twice daily using a 5-step grading system, a score of 0 corresponding
to normal and 4 to severely abnormal findings. All rabbits readily
adapted to handling and their interest could be easily stimulated
with carrots and apples (treats). Treats were offered twice daily
to check appetite, as it is difficult to assess each individual’s food
intake in the group-housing setting. Lack of interest in treats was
considered a sign of decreased well-being (33).
Blood samples for serology were collected from the central artery
of the left or right ear of each rabbit once weekly and at the time
of euthanasia. Pooled fecal samples were also collected from each
separate pen once weekly and individual fecal samples were collected at the time of euthanasia. One doe per week in each group was
randomly selected and humanely euthanized with an intravenous
overdose (720 mg/rabbit) of pentobarbital (Euthanyl; BimedaMTC, Cambridge, Ontario). Necropsies were performed to observe
evidence of gross lesions and to collect multiple samples (1.25 to
2.5 cm long) from the intestinal tract for microscopic examination.
Samples were immediately placed in phosphate-buffered 10% formalin solution.
Sample analysis
Macroscopic examination — Shortly after euthanasia, the abdominal cavity was opened, the mesentery and mesocolon were dissected,
112
The Canadian Journal of Veterinary Research
and the organs were examined visually, from stomach to rectum.
Changes in thickness, discoloration, or content of the intestinal tract
were observed. The sample of duodenum was collected 2.5 cm distal
to the pylorus; 1 jejunal sample was collected approximately mid-­
distance between the end of the duodenum and the beginning of
ileum, whereas the terminal jejunal sample was collected proximal to
the last jejunal Peyer’s patch. The ileal sample was collected proximal
and adjacent to the ileal Peyer’s patch, approximately 5 cm proximal
to the ileocecal valve. The ileocecal valve was also collected in its
entirety, including the ampulla coli and sacculus rotundus. The sample
of cecum was collected in the transitional area between cecum and
appendix ceci and the terminal portion of the appendix ceci was also
collected. The sample of large colon was collected adjacent and distal
to the cecum, whereas the sample of terminal colon was collected at
a mid-distance between the end of the large colon and the rectum.
Histology and immunohistochemistry — Two adjacent formalinfixed, paraffin-embedded sections per sample were cut and stained
by hematoxylin-eosin method (H&E) and streptavidin method,
using anti-L. intracellularis-specific murine monoclonal antibody
(IHC), to observe for typical proliferative lesions of the intestinal
epithelium and the presence of the antigen within the cells (30,34).
The L. intracellularis-specific antigen in the enterocytes was blindly
evaluated with a 5-grade IHC scoring system as follows: grade 0 for
no antigen labeling in the tissue; grade 11 for up to 25% of crypts
labeled; grade 12 for 26% to 50% of crypts labeled; grade 13 for 51%
to 75% of crypts labeled; and grade 14 for 76% to 100% of crypts
labeled (30). For each rabbit, the negative control for each tissue section consisted of a correspondent tissue section IHC-labeled, except
for the primary antibody. Furthermore, pig ileal tissues, known to be
negative and positive for L. intracellularis infection, were labeled with
the murine anti-L. intracellularis monoclonal antibody to confirm the
antibody’s specificity and sensitivity, respectively.
Serology analysis — In serum, anti-L. intracellularis-specific IgG
concentration was measured by an immunoperoxidase monolayer
assay (IPMA), as reported in a previous paper (35). Positive serum
samples were end-point titrated, starting with a dilution of 1:30 up
to 1:1920. Control samples consisted of serum from a rabbit before
(negative control) and after (positive control) hyperimmunization
with L. intracellularis, purified from cell culture. Also, serum total
protein concentration was measured with the refractometer method
to investigate if changes in serum total protein concentration were
comparable to the values reported in foals naturally and experimentally infected with EPE (25).
Quantitative PCR analysis — qPCR analysis was conducted
on fecal samples, as described in a previous paper (25). The purified DNA was analyzed by qPCR for presence of L. intracellularis
aspA gene copies (1,36). For each target gene, 2 primers and
an internal, fluorescent-labeled TaqMan probe [59end, reporter
dye FAM (6-carboxyflourescein), 39end, quencher dye TAMRA
(6-carboxytetramethylrhodamine)] was designed using Primer
Express software (Applied Biosystems, Foster City, California,
USA) (Table I). TaqMan PCR systems were validated using 2-fold
dilutions of genomic DNA (gDNA), testing positive for the target
genes. Dilutions were analyzed in triplicate and a standard curve
was plotted against the dilutions. The slope of the standard curve
was used to calculate amplification efficiencies using the formula
2000;64:0–00
FOR PERSONAL USE ONLY
Table I. Specific forward and reverse primer sequences, along with probe, target gene, and accession numbers for the technique
of polymerase chain reaction (PCR) used to diagnose L. intracellularis fecal shedding in rabbits after infectious challenge with
pure cell bacteria. Note the rate of efficiency in the last column of the table
System
L. intra
Forward primer
Reverse primer
Probe
Target
Accession number
bcL.intra-114f bcL.intra-263r
bcL.intra-201p
AspartateEU127293.1
CACTTGCAAACAA CATTCATATTTGTACTTGTTCCTTGATCAATTTGTTGTGGATammonia
TAAACTTGGTCTTCCCCTGCA
TGTATTCAAGG
lyase
Pan-bacteriaPB.283f
PB.352r
PB.305
16S
GGATGATCAGCCACCAATATTCCTCACTGCTCCCGTAGGAGTCTGGACCGTGrRNA
CACTGGAGCC
TCTCA
Multi-sequence
alignment
Efficiency
95.6%
98.2%
at 60°C. Fluorescent signals were collected during the annealing
temperature and cycle threshold (Ct) values were extracted with a
threshold of 0.1 and baseline values of 3 to 12 for all samples using
SDS 2.2.1 (Applied Biosystems). Absolute quantitation was calculated by a standard curve and expressed as copy numbers of the
L. intracellularis aspA gene per gram of feces.
Statistics
In general, only descriptive statistics were used in this study as
sample numbers were insufficient for statistical analysis. However,
body weight and serum total protein concentration were analyzed
with a Kruskal-Wallis non-parametric test and Dunn post-hoc testing
for multiple comparisons among groups. A commercial software
(GraphPad Prism 5.4 Software, La Jolla, California, USA) was used,
with P value set at # 0.05.
Results
Figure 1. Weight gains throughout the experiment (21 DPI). In the 2 infected
groups, a trend to reduced weight gain and marginal weight loss can be
noted, although these were statistically not different than the control
weight gains (P = 0.87).
E = 10 1/-s21. Each system needed to achieve greater than 95% efficiency to be considered. The detection limit for “L.intra system” is
from 5 to 10 copies/mL of DNA (determined with plasmid DNA).
The “L.intra system” detects all L. intracellularis, regardless of the
host species. Known positive controls and no template controls were
run on every plate and met previously determined standardization
values. DNA quality was determined by the “PanBacteria system,”
with a control value under 30, to pass quality control (37).
RT-reaction and real-time TaqMan PCR — Each PCR reaction
contained 203 primer and probes for the respective TaqMan system,
with a final concentration of 400 nM for each primer and 80 nM
for the TaqMan probe and commercially available PCR Mastermix
(TaqMan Universal PCR Mastermix; Applied Biosystems) containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl2, 2.5 mM
deoxynucleotide triphosphates, and 0.625 U AmpliTaq Gold DNA
polymerase per reaction; 0.25 U AmpErase UNG per reaction; and
1 mL of the DNA sample in a final volume of 12 mL. The samples
were placed in a 384-well plate and amplified in an automated
fluorometer (ABI PRISM 7900 HTA FAST; Applied Biosystems).
Applied Biosystem’s standard amplification conditions were used:
2 min at 50°C, 10 min at 95°C, 40 cycles of 15 s at 95°C, and 60 s
2000;64:0–00
Clinical signs
During the entire duration of this study, no evidence of diarrhea,
overt signs of pain, e.g., bruxism, or prostration was detected in
the rabbits. Minor details of incomplete grooming around the tail
region were noted in rabbits of all groups, but these were observed
sporadically and deemed not relevant. No remarkable changes were
noted in any group during the first 7 DPI, except for a transient (1 d’s
duration only) weight loss, or a weight gain smaller than half the
individual’s average daily gain. This weight loss affected control
and infected rabbits alike on 1 DPI and was ascribed to the stressful
procedures on the day of infection (day 0). As the rabbits were still
growing, their body weight gain should have ranged from 100 to
200 g/week (or 14.2 to 28.5 g/day), as per the provider’s indications
(Charles River Laboratories). The averaged daily weight gains of
all rabbits were within limits, with 2 rabbits well above that range
(52 g and 49.1 g for Group 1 and Group 2, respectively). Negative
weight changes were not statistically significant (P = 0.87) in any of
the groups throughout the 21 DPI (Figure 1). However, weight losses
or gains smaller than half the individual’s average daily gain were
noted in infected rabbits in Group 1 and Group 2 from 12 to 17 DPI.
The only animal that showed depression and dullness between 12
(rated 1) and 14 (rated 2) DPI was the Group 1 doe euthanized at
14 DPI, which showed marked progressive weight loss and lack of
appetite. Additionally, although general self-grooming appeared
The Canadian Journal of Veterinary Research
113
FOR PERSONAL USE ONLY
normal, the normal residues of cecotrophes on the perineum of this
doe were not cleaned, which is deemed an abnormal behavior.
Necropsy findings
Gross lesions were not evident in any of the rabbits examined
on 7 DPI, but on 14 DPI, infected rabbits in Group 1 and Group 2
showed hyperemia and edematous corrugation of the serosal surface
of the jejunum (such as a “cobblestone-like” appearance) (Figure 2a)
compared to controls (Figures 2b and 2d). Additionally, typical proliferative enteropathy lesions were observed in the mucosal surface
(Figure 2c). There was a similar “cobblestone-like” appearance in the
ileum, particularly close to the ileocecal valve. These gross changes
were consistent with proliferative enteropathy lesions described
in rabbits, pigs, and horses (2,14,27). The cecum of the Group 1
infected rabbit appeared generally hyperemic, once opened, and it
was deemed non-specific for EPE. Hyperemia was not noticeable in
the cecum of does in Group 2 or Group 3.
By 14 DPI, the Group 1 rabbit that was euthanized had lost over
200 g in 3 d. In contrast, the rabbits in Group 2 and Group 3 gained
marginal or no weight, but did not lose weight. Also, the terminal
colon and rectum of the Group 1 rabbit were mostly empty, although
cecum and colon content did not differ from the control doe.
By 21 DPI, only mild, non-specific changes were noted on gross
pathology at necropsy. These changes included hyperemia and
mild wall-thickening (edema) of the serosal surface of the jejunum
of rabbits in both Group 1 and Group 2, both of which were more
pronounced in Group 1.
a
b
Histology and immunohistochemistry
c
d
Figure 2. Comparison of infected and uninfected jejunum in a rabbit model
for L. intracellularis infection. Scale bar, 1 cm. a — Serosal surface of the
mid-jejunum from an infected rabbit (Group 1 inoculum) at 14 DPI. Note
the cobblestone-like appearance of the serosal surface. A round jejunal
Peyer’s patch is visible on the left side (arrow). b — Serosal surface of
a mid-jejunum section of a control rabbit. c — Luminal surface of the
mid-jejunum from an infected rabbit (Group 1 inoculum) at 14 DPI. Note
the rugae of the mucosa. d — Luminal surface of the mid-jejunum from
an uninfected control rabbit. Note the smooth surface.
114
The Canadian Journal of Veterinary Research
Typical histological lesions, characterized by hyperplasia of
immature enterocytes and absence of goblet cells, were observed
by H&E staining, but no inflammation was detected. These proliferative changes were consistently associated with the presence of
intracellular bacteria identified by IHC (Figures 3a and 3b). Results
of IHC analysis on intestinal sections are summarized in Table II.
Immunohistochemistry analysis was conducted on intestinal sections from duodenum to rectum at 7, 14, and 21 DPI. At 7 DPI,
L. intracellularis antigen was found as multifocal (mild to diffuse)
labeling in the apical cytoplasm of enterocytes in the jejunum,
cecal tip, and colon of the infected rabbit in Group 1 and in the
jejunum, ileum, cecum, and colon of the infected rabbit in Group 2
(Figure 3a). The labeled antigen in cecal epithelium is shown in
Figure 3b. At 7 DPI, all stained antigen was in the enterocytes and
no L. intracellularis antigen was detectable in the lamina propria of
any of the intestinal sections.
At 14 DPI, the antigen was found in the epithelium and lamina
propria as focal to multifocal and diffuse labeling and the extent of
the microscopic lesions previously observed in the H&E staining
was associated with the increased IHC grading (grades 2 or 3). In
the infected rabbit in Group 2, L. intracellularis antigen was not found
in the lamina propria of the terminal jejunum, appendix ceci, or colon
samples, but the grading was higher due to the higher frequency of
antigen detection in the epithelium.
At 21 DPI, IHC analysis showed no detectable antigen in any of
the infected groups, except a focally labeled area noted in the lamina
propria of the cecal tip of the infected rabbit in Group 1. Thus, IHC
2000;64:0–00
FOR PERSONAL USE ONLY
a
Quantitative PCR analysis
The results of the qPCR analysis are shown in Figure 5. Lawsonia
intracellularis was detected in the feces of infected rabbits in Group 2
at 7 DPI and in rabbits in both Groups 1 and 2 at 14 DPI, becoming
undetectable at 21 DPI. In Group 3 rabbits (controls), L. intracellularis
organisms were never shed in feces throughout the experiment.
Discussion
b
Figure 3. Immunohistochemistry (IHC) stain. L. intracellularis antigenspecific staining with AEC substrate-chromogen and counterstained with
Mayer’s hematoxylin. a — Note ileal crypts of an experimentally infected
rabbit (14 DPI). Note the hyperplasia of immature enterocytes associated
with bacterial infection (apical membrane). Scale bar, 10 mm. b — Note
the cecal mucosa of an experimentally infected rabbit (14 DPI), showing
labeled antigen in the superficial epithelium. Scale bar, 100 mm.
labeling and histologic analysis demonstrated that the rabbits had
lesions from about 7 through 21 DPI, with highest severity noted at
14 DPI. No presence of labeled L. intracellularis antigen was detected
in the duodenum, terminal colon, or rectum of any groups. In addition, antigen was not detected in the intestinal tract of the control
rabbits (Group 3) at any point in the experiment.
Serum analyses
As shown in Figure 4, serologic responses were detectable by
immunoperoxidase monolayer assay (IPMA) analyses in the infected
groups at 14 DPI. Lawsonia intracellularis infection generated a high
serologic response in both infected groups, coinciding with the
severity of lesions. No significant differences (P = 0.72) were found
among groups with regard to total protein concentrations in sera.
2000;64:0–00
This study describes the initial development of a rabbit infection
model to investigate EPE in horses. Results show that there is merit
in substituting rabbits for horses in infection model studies for EPE,
as juvenile rabbits became infected after inoculation with a pure
cell culture equine strain of L. intracellularis. Such findings provide
a basis for pathogenesis studies, as this EPE infection model can be
obtained within a relatively short incubation period and lesions can
resolve quickly without subjecting animals to excessive discomfort.
Although purified through growth in cell culture, the equine strain
of L. intracellularis was pathogenic for rabbits. The infection did
not cause marked clinical illness, but macroscopic and microscopic
lesions were detected and confirmed by histopathology and IHC.
Such findings were comparable to those observed in foals naturally
and experimentally infected with EPE (6,25). Similarly, in the infected
rabbits, fecal qPCR findings and IPMA serology showed fecal shedding consistent with bacterial active replication and marked immune
response, respectively.
A trend of reduced growth performance was noted in rabbits in
Group 1 and Group 2 at around 12 and 17 DPI, which approximately
corresponded with the time of the infection’s peak (14 DPI) when
lesions appeared more severe on gross pathology and IHC labeling.
Moderate weight loss and dullness, along with decreased appetite,
were the most remarkable clinical signs noted. Overall, the clinical
signs observed were mild; the experimentally infected rabbits in this
model could probably have survived through the acute phase of the
infection. Diarrhea was never noted, contrary to what is reported
in both naturally infected rabbits and naturally and experimentally
infected foals (25,27).
The clinical condition of infected does in this study appeared
normal on 21 DPI, although the surviving rabbit in Group 1 (the
most clinically affected group) did not appear to gain weight at
the rate exhibited before the peak of disease (or less than half the
average daily weight gain). Even with no clinical support, recovery
appeared to occur by 21 DPI, as evidenced by improved weight gain
and the absence of major IHC labeling. Mild IHC labeling (grade 1)
in the cecum of the Group 1 rabbit could be consistent with ongoing
recovery. This differs from reports about rabbits exhibiting clinical
disease after natural exposure when clinical signs consist of marked
diarrhea, weight loss, and dehydration or from sub-clinically affected
rabbits, as they are commonly reported to be exposed to the disease
(1,27–28,38).
According to previous reports and personal communications
about infection of hamsters with porcine strain L. intracellularis
grown in cell culture, clinical signs are usually subtle or absent,
yet characteristic histopathology lesions are present (8,24). In the
rabbits of this study, gross lesions typical of EPE extended from the
The Canadian Journal of Veterinary Research
115
FOR PERSONAL USE ONLY
Table II. Immunohistochemistry (IHC) results in rabbits orally inoculated with
L. intracellularis. Results are separated by group and by days post-infection (DPI)
(7, 14, and 21)
Group 3 rabbits
(control)a
Group 1 rabbitsa
Group 2 rabbitsa
Section
7 d
14 d
21 d
7 d
14 d
21 d
7 d
14 d
21 d
Duodenum0
00 0000
0
0
Mid jejunum
0
0
0
0
130
11
110
End jejunum
11
110
12
120
0
0
0
Ileum
00 0 0
110
12
110
Cecum
00 0 12
12
11
12
110
Appendix ceci
110
11
110
0
0
0
0
Ileocecal valve
0
0
0
0
110
12
110
Colon
00 0 11
120
12
120
Terminal colon
0
00 0000
0
0
Rectum 0
00 0000
0
0
Note: Numbers in table refer to a 5-grade IHC scoring system. Grade 0 is equivalent to no antigen
labeling detected (no shading), grade 11 (light gray shading) equivalent to 25% antigen labeled,
grade 12 (gray shading) equivalent to 50%, grade 13 (dark gray shading) equivalent to 75%, and
grade 14 (very dark gray shading) equivalent to 100% antigen labeled.
aThe groups consisted of 3 rabbits each, which were euthanized once weekly, 1 per group. Group 1
was infected orally with 1.3 3 108 bacteria/rabbit and Group 2 with 2.5 3 108 bacteria/rabbit.
Group 3 was inoculated with medium only. Bacterial virulence of inocula was verified by challenge of
natural host (4 foals) with the same lot of bacteria in different studies (25,40).
mid-jejunum to the terminal ileum in spite of mild clinical signs
(6,11,14). In both horses and pigs, L. intracellularis is characteristically found free within the apical cytoplasm of small intestinal crypt
cells, particularly in the distal jejunum and ileum (2). At the disease’s
peak, cecal hyperemia was noted in the Group 1 rabbit and deemed
a non-specific change, although cecal and colonic proliferative
lesions are typically found in naturally infected rabbits (26). In this
cross-infection model, lesion location may be related to the bacterial
isolate involved, rather than to the animal species affected. In other
words, even in rabbits, it appears that EPE is located preferentially
in those sites typical for horses, such as the jejunum and ileum,
whereas mild, non-specific lesions are found only in sites observed
in overtly diseased rabbits, such as the cecum and colon (27,38).
However, further studies are warranted to confirm this suspicion.
Lesions were confirmed through IHC labeling starting at 7 DPI,
with their severity increasing at 14 DPI, but decreasing dramatically by 21 DPI. Such a finding is quite novel, as the incubation
period is longer in experimentally infected horses and pigs (2,25).
Furthermore, the presence of antigen in the lamina propria was noted,
particularly in the infected rabbit in Group 1, which suggests an
infection at an advanced stage or resolution of the lesions later on
(21 DPI), as antigen was observed in the macrophages in the lamina
propria (39).
The dose of bacterial challenge, administered orally as this is the
natural infection route, differed slightly in the 2 infected groups,
but this did not seem to have a major impact on results, as infection was achieved in both groups. For both inocula, the bacterial
virulence was verified by challenge of natural host (4 foals) with
the same lot of L. intracellularis in a different study, in which foals
developed clinical EPE, with severe manifestations (3 out of 4) and
demise (1 out of 4) (40).
116
The Canadian Journal of Veterinary Research
On gross inspection, the passage 9 inocula (Group 1) caused
marked lesions and temporary weight loss, whereas the passage
10 inocula (Group 2) caused milder lesions and even milder clinical
signs. Although studies in pig models show that increased (10-fold)
concentrations of inoculum are related to increased severity of
clinical signs, different virulence did not appear related to a 2-fold
increase in concentration in the rabbit model (31). Moreover, severity
of clinical appearance in this model could be related to a low passage
isolate, which somehow compensated for a lower concentration of
the inoculum. Although further investigation is needed, it is clear
at this stage that a low passage isolate can cause lesions in rabbits.
This L. intracellularis cross-infection study shows fecal shedding
in infected rabbits starting at 7 DPI and increasing by 14 DPI. As
the TaqMan PCR technique detects the presence of genetic material
whether it is viable or inactivated, it is interesting to note that fecal
shedding in rabbits appears limited to the presence of active infection (based on IHC lesions). Shedding was not detectable at 21 DPI,
when clinical signs had already subsided and IHC labeling was
drastically reduced. In the foal infection model, fecal shedding is
reported to last longer than 21 DPI, but a specific relation between
duration of fecal shedding, presence of lesions, and IHC labeling in
the equine model is not available, as the foals were enrolled in a survival study (25). In this initial experiment, the information gathered
about serologic conversion is limited due to the short experimental
timeline. Rabbits manifested a high serologic response on 14 DPI and
even higher responses (. 1920) in both diseased groups by the final
week. Such a high immune response showed that this EPE infection
model in rabbits could be considered a “time-compressed” course
of infection, compared to the equine EPE infection model, as such
high titers were achieved in foals only by 28 or 35 DPI (25). Contrary
to what is found in foals, a clinically significant hypoproteinemia
2000;64:0–00
FOR PERSONAL USE ONLY
Figure 4. Serologic response detected in experimentally infected rabbits and uninfected control rabbits after oral challenge with an equine
strain of L. intracellularis. The rabbits were infected with a strain proven
virulent in foals and did not show any circulating antibody until 14 DPI,
which indicates that the immune response requires a minimum time to
show and does not manifest equally in every individual (note the different
titers in different animals).
was not found in the rabbits of our model, nor was edema of the
limbs or abdomen ever detected, although these sequelae would
normally occur after 21 DPI. Further studies are needed with larger
numbers of rabbits and over a longer time period to investigate
the onset of hypoproteinemia and hypoalbuminemia in this rabbit
model.
On the basis of clinical, diagnostic, gross pathology, and IHC findings, it is concluded that the incubation period in rabbits infected
with an equine L. intracellularis isolate appears to be shorter than
it is for pigs and hamsters challenged with a pig isolate or for the
EPE infection model in foals (2,8,25). Moreover, intestinal lesions
appeared to resolve by 21 DPI. These time factors could constitute
an experimental advantage for the model in rabbits. Furthermore,
infection is reproducible with no discomfort or overt disease. In
pharmacology research, such a finding would represent an optimal
model for drug preclinical testing. In addition, rabbits, like horses,
are hindgut fermenters, and unlike laboratory rodents, offer the
advantages of a larger body weight and blood volume and accessible
blood vessels for collecting multiple blood samples. Further studies
with this infection model could be used for pathogenesis and epidemiology studies, particularly when associated with such a remarkable serologic response. In fact, the ability to overcome infection
quickly and without overt disease can represent an epidemiologic
risk, or may explain the limited success of prevention measures, if
the equine L. intracellularis strain can be carried sub-clinically by
rabbits living on the grounds of a horse farm (1).
Finally, the success of this cross-infection experiment and the
failure to generate infection in hamsters, which were previously
the animal model of choice for proliferative enteropathies, suggest
2000;64:0–00
Figure 5. Quantitative polymerase chain reaction (qPCR) results (represented by L. intracellularis DNA gene copies/g feces) in rabbits
experimentally infected with an equine strain of L. intracellularis and
in uninfected controls. Note that the represented fecal shedding was
obtained for each group, not for each individual. From these preliminary
results, the fecal shedding of L. intracellularis after cross-infection
from horses to rabbits can be noted as early as 7 DPI, but apparently
resolves by 21 DPI.
a selective, secondary host adaptation of a given L. intracellularis
strain. Further studies are necessary in order to define the details of
such a discovery and its multiple implications.
Acknowledgments
The authors thank Dr. Colette Wheler at the Animal Resources
Centre, the support staff of the Animal Care Unit at Western College
of Veterinary Medicine, University of Saskatchewan, Dr. Samantha
M. Mapes for her contribution to PCR use and description, and
Angela T. Gebhart for editing. Francesca Sampieri and Katherine
R. Ball are fellow trainees of the Canadian Institutes of Health
Research — Training Grant in Health Research Using Synchrotron
Techniques (CIHR-THRUST). Fabio A. Vannucci was supported by
the Brazilian Government sponsoring agency “Conselho Nacional
de Desenvolvimento Cientifico e Tecnologico” (CNPq).
References
1. Pusterla N, Mapes S, Rejmanek D, Gebhart C. Detection of
Lawsonia intracellularis by real-time PCR in the feces of freeliving animals from equine farms with documented occurrence
of equine proliferative enteropathy. J Wildl Dis 2008;44:992–998.
The Canadian Journal of Veterinary Research
117
FOR PERSONAL USE ONLY
2. Lawson GH, Gebhart CJ. Proliferative enteropathy. J Comp Pathol
2000;122:77–100.
3. McOrist S, Gebhart CJ, Boid R, Barns SM. Characterization of
Lawsonia intracellularis gen. nov., sp. nov., the obligately intracellular bacterium of porcine proliferative enteropathy. Int J Syst
Bacteriol 1995;45:820–825.
4. Cooper DM, Swanson DL, Barns SM, Gebhart CJ. Comparison of
the 16S ribosomal DNA sequences from the intracellular agents
of proliferative enteritis in a hamster, deer, and ostrich with the
sequence of a porcine isolate of Lawsonia intracellularis. Int J Syst
Bacteriol 1997;47:635–639.
5. Hotchkiss CE, Shames B, Perkins SE, Fox JG. Proliferative
enteropathy of rabbits: The intracellular Campylobacter-like
organism is closely related to Lawsonia intracellularis. Lab Anim
Sci 1996;46:623–627.
6. Pusterla N, Gebhart C. Equine proliferative enteropathy caused
by Lawsonia intracellularis. Equine Vet Educ 2009;8:415–418.
7. Wong DM, Alcott CJ, Sponseller BA, Young JL, Sponseller BT.
Impaired intestinal absorption of glucose in 4 foals with Lawsonia
intracellularis infection. J Vet Intern Med 2009;23:940–944.
8. Vannucci FA, Borges EL, de Oliveira JS, Guedes RM. Intestinal
absorption and histomorphometry of Syrian hamsters (Mesocricetus
auratus) experimentally infected with Lawsonia intracellularis. Vet
Microbiol 2010;145:286–291.
9. Brees DJ, Sondhoff AH, Kluge JP, Andreasen CB, Brown CM.
Lawsonia intracellularis-like organism infection in a miniature
foal. J Am Vet Med Assoc 1999;215:511–514.
10. Williams NM, Harrison LR, Gebhart CJ. Proliferative enteropathy
in a foal caused by Lawsonia intracellularis-like bacterium. J Vet
Diagn Invest 1996;8:254–256.
11. Schumacher J, Schumacher J, Rolsma M, Brock KV, Gebhart CJ.
Surgical and medical treatment of an Arabian filly with proliferative enteropathy caused by Lawsonia intracellularis. J Vet Intern
Med 2000;14:630–632.
12. Duhamel GE, Wheeldon EB. Intestinal adenomatosis in a foal.
Vet Pathol 1982;19:447–450.
13. Frazer ML. Lawsonia intracellularis infection in horses: 2005–2007.
J Vet Intern Med 2008;22:1243–1248.
14. Lavoie JP, Drolet R, Parsons D, et al. Equine proliferative enteropathy: A cause of weight loss, colic, diarrhoea and hypoproteinaemia in foals on three breeding farms in Canada. Equine
Vet J 2000;32:418–425.
15. Lawson GH, McOrist S, Jasni S, Mackie RA. Intracellular bacteria
of porcine proliferative enteropathy: Cultivation and maintenance in vitro. J Clin Microbiol 1993;31:1136–1142.
16. Jasni S, McOrist S, Lawson GH. Experimentally induced proliferative enteritis in hamsters: An ultrastructural study. Res Vet
Sci 1994;56:186–192.
17. Stills HF, Jr. Isolation of an intracellular bacterium from hamsters
(Mesocricetus auratus) with proliferative ileitis and reproduction of the disease with a pure culture. Infect Immun 1991;59:
3227–3236.
18. Murakata K, Sato A, Yoshiya M, et al. Infection of different
strains of mice with Lawsonia intracellularis derived from rabbit
or porcine proliferative enteropathy. J Comp Pathol 2008;139:
8–15.
118
The Canadian Journal of Veterinary Research
19. Stills HF, Jr, Hook RR, Jr. Experimental production of proliferative ileitis in Syrian hamsters (Mesocricetus auratus) by using an
ileal homogenate free of Campylobacter jejuni. Infect Immun
1989;57:191–195.
20. Stills HF, Fox JG, Plaster BJ, Dewhirst FE. A ‘new’ Clamydia sp
strain SFPD isolated from transmissible proliferative ileitis in
hamsters. Microb Ecoln Health Dis 1991;4:S99.
21. Stills HF, Jr, Hook RR, Jr, Sprouse RF. Utilization of monoclonal
antibodies to evaluate the involvement of Campylobacter jejuni
in proliferative ileitis in Syrian hamsters (Mesocricetis auratus).
Infect Immun 1987;55:2240–2246.
22. Boutrup TS, Schauser K, Agerholm JS, Jensen TK. Application
of a pig ligated intestinal loop model for early Lawsonia intracellularis infection. Acta Vet Scand 2010;52:17.
23. Boutrup TS, Boesen HT, Boye M, Agerholm JS, Jensen TK. Early
pathogenesis in porcine proliferative enteropathy caused by
Lawsonia intracellularis. J Comp Pathol 2010;143:101–109.
24. Jasni S, McOrist S, Lawson GH. Reproduction of proliferative
enteritis in hamsters with a pure culture of porcine ileal symbiont intracellularis. Vet Microbiol 1994;41:1–9.
25. Pusterla N, Wattanaphansak S, Mapes S, et al. Oral infection of
weanling foals with an equine isolate of Lawsonia intracellularis,
agent of equine proliferative enteropathy. J Vet Intern Med 2010;
24:622–627.
26. Schoeb TR, Fox JG. Enterocecocolitis associated with intraepithelial Campylobacter-like bacteria in rabbits (Oryctolagus cuniculus). Vet Pathol 1990;27:73–80.
27. Horiuchi N, Watarai M, Kobayashi Y, Omata Y, Furuoka H.
Proliferative enteropathy involving Lawsonia intracellularis
­infection in rabbits (Oryctlagus cuniculus). J Vet Med Sci 2008;
70:389–392.
28. Watarai M, Yoshiya M, Sato A, Furuoka H. Cultivation and
characterization of Lawsonia intracellularis isolated from rabbit
and pig. J Vet Med Sci 2008;70:7731–7733.
29. Harcourt-Brown F. Biological characteristics of the domestic rabbit (Oryctolagus cuniculi). In: Harcourt-Brown F, ed. Textbook of
Rabbit Medicine. Woburn: Elsevier Health Sciences, 2002:1–18.
30. Guedes RM, Gebhart CJ. Comparison of intestinal mucosa
homogenate and pure culture of the homologous Lawsonia
intracellularis isolate in reproducing proliferative enteropathy
in swine. Vet Microbiol 2003;93:159–166.
31. Guedes RM, Winkelman NL, Gebhart CJ. Relationship between
the severity of porcine proliferative enteropathy and the infectious dose of Lawsonia intracellularis. Vet Rec 2003;153:432–433.
32. Wattanaphansak S, Gebhart CJ, Anderson JM, Singer RS.
Development of a polymerase chain reaction assay for quantification of Lawsonia intracellularis. J Vet Diagn Invest 2010;22:
598–602.
33. Johnson-Delaney C. Anatomy and physiology of the rabbit
and rodent gastrointestinal system. 2006 Proc Assoc Avian Vet
2006:9–17.
34. Guedes RM, Gebhart CJ. Preparation and characterization of
polyclonal and monoclonal antibodies against Lawsonia intracellularis. J Vet Diagn Invest 2003;15:438–446.
35. Guedes RM, Gebhart CJ, Deen J, Winkelman NL. Validation of
an immunoperoxidase monolayer assay as a serologic test for
2000;64:0–00
FOR PERSONAL USE ONLY
porcine proliferative enteropathy. J Vet Diagn Invest 2002;14:
528–530.
36. Pusterla N, Jackson R, Wilson R, Collier J, Mapes S, Gebhart C.
Temporal detection of Lawsonia intracellularis using serology
and real-time PCR in Thoroughbred horses residing on a farm
endemic for equine proliferative enteropathy. Vet Microbiol
2009;136:173–176.
37. Leutenegger CM, Mislin CN, Sigrist B, Ehrengruber MU,
Hoffmann-Lehmann R, Lutz H. Quantitative real-time PCR
for the measurement of feline cytokine mRNA. Vet Immun
Immunopath 1999;71:291–305.
2000;64:0–00
38. Duhamel GE, Klein EC, Elder RO, Gebhart CJ. Subclinical proliferative enteropathy in sentinel rabbits associated with Lawsonia
intracellularis. Vet Pathol 1998;35:300–303.
39. Jensen TK, Møller K, Leser TD, Jorsal SE. Comparison of histology, immunohistochemistry and polymerase chain reaction for
detection of Lawsonia intracellularis in natural porcine proliferative enteropathy. Eur J Vet Pathol 1997;3:115–123.
40. Pusterla N, Vannucci FA, Mapes SM, et al. Efficacy of an avirulent live vaccine against Lawsonia intracellularis in the prevention
of proliferative enteropathy in experimentally infected weanling
foals. Am J Vet Res 2012;73:741–746.
The Canadian Journal of Veterinary Research
119
FOR PERSONAL USE ONLY
Article
Effects of vitamin E supplementation on cellular a-tocopherol
concentrations of neutrophils in Holstein calves
Hidetoshi Higuchi, Erina Ito, Hidetoma Iwano, Shin Oikawa, Hajime Nagahata
Abstract
The effects of vitamin E supplementation on cellular a-tocopherol concentrations of neutrophils from Holstein calves and the
mechanism of scavenger receptor class B type I (SR-BI)-mediated uptake of a-tocopherol were examined. Cellular a-tocopherol
concentrations in vitamin E-treated calves increased from 3.5 6 0.38 to 7.2 6 0.84 μg/107 cells, respectively, within 14 d after
vitamin E supplementation; these concentrations were significantly higher than those of control calves (P , 0.01). The expression
indices of SR-BI [a major receptor that recognizes high-density lipoprotein (HDL)] mRNA in neutrophils were two to five times
higher (P , 0.01) in neutrophils obtained from vitamin E-supplemented calves compared with those from control calves, and
anti-SR-B1 antibody, ranging from 0.1 to 1.0 μg/mL, significantly (P , 0.01) decreased cellular a-tocopherol concentrations of
neutrophils. Cytochalasin D and latrunculin B, major inhibitors of actin polymerization of neutrophils, significantly decreased
cellular a-tocopherol concentrations of neutrophils (P , 0.01). Our results demonstrated that in vitamin E-supplemented calves:
1) a-tocopherol is mainly distributed with HDL, 2) a-tocopherol within HDL is recognized by SR-BI on the surface of neutrophils,
and 3) rearrangement of the actin cytoskeleton is a crucial step for the uptake of a-tocopherol by neutrophils.
Résumé
On a examiné les effets d’un supplément de vitamine E sur les concentrations cellulaires d’a-tocophérol des neutrophiles provenant de veaux
Holstein et le mécanisme de prise d’a-tocophérol médié par les récepteurs ramasseurs de classe B type I (SR-BI). Les concentrations cellulaires
d’a-tocophérol chez les veaux traités avec de la vitamine E ont augmenté de 3,5 6 0,38 à 7,2 6 0,84 mg/107 cellules, respectivement, à
l’intérieur d’un délai de 14 j après une supplémentation en vitamine E; ces concentrations étaient significativement plus élevées que celles
des veaux témoins (P , 0,01). Les taux d’expression d’ARNm de SR-BI [un récepteur majeur qui reconnaît les lipoprotéines de haute-densité
(HDL)] dans les neutrophiles étaient 2 à 5 fois plus élevés (P , 0,01) dans les neutrophiles obtenus de veaux ayant reçu un supplément de
vitamine E comparativement à ceux des veaux témoins, et des anticorps anti-SR-B1, allant de 0,1 à 1,0 mg/mL, ont réduit significativement
(P , 0,01) les concentrations cellulaires d’a-tocophérol des neutrophiles. La cytochalasine D et la latrunculine B, des inhibiteurs majeurs de la
polymérisation de l’actine des neutrophiles, ont diminué de manière significative les concentrations cellulaires d’a-tocophérol des neutrophiles
(P , 0,01). Nos résultats ont démontré que chez les veaux recevant un supplément de vitamine E : 1) l’a-tocophérol est principalement
distribué avec les HDL, 2) l’a-tocophérol dans les HDL est reconnu par les SR-BI sur la surface des neutrophiles, et 3) le réarrangement du
cytosquelette d’actine est une étape cruciale pour la prise d’a-tocophérol par les neutrophiles.
(Traduit par Docteur Serge Messier)
Introduction
Vitamin E is an integral component of all lipid membranes and
protects them from attack by reactive oxygen species (ROS) (1,2).
Polyunsaturated fatty acids of membranes are vulnerable to attack
by ROS, which can initiate a chain reaction of lipid destruction that
destroys the membrane of the cell. Vitamin E can quench peroxidation reactions in membranes and is probably the most important
antioxidant present in cell membranes (3). The newborn dairy calf
has minimal reserves of lipid-soluble vitamins and fetal uptake is
limited (4,5). Vitamin E supplementation has been shown to have
positive effects on the immune system of young dairy calves (6,7).
We have reported that providing vitamin E supplementation to
newborn calves activates killing ability and intracellular signal
transduction, including protein kinase C, intracellular Ca21, and
tyrosine kinase of neutrophils (8). It has been reported that cellular
a-tocopherol concentrations of red blood cells were approximately
5 times higher in vitamin E-supplemented Holstein calves than in
control calves (9). However, levels of alpha (a)-tocopherol concentration in neutrophils from calves have not yet been examined.
The cellular uptake of a-tocopherol within high-density lipoprotein (HDL) is reported to be mediated by scavenger receptor class B,
type I (SR-BI) (10,11). Moreover, a previous study using SR-BIdeficient mice has shown a deficiency in the uptake of a-tocopherol
from plasma lipoproteins to specific tissues (12). Rajapaksha et al
(13) sequenced the bovine SR-BI and examined changes in e­ xpression
Animal Health Laboratory (Higuchi, Ito, Nagahata), Department of Veterinary Herd Health (Oikawa), Department of Health and Environmental
Sciences and Veterinary Biochemistry, and Department of Bioscience (Iwano), School of Veterinary Medicine, Rakuno Gakuen University,
Ebetsu, Hokkaido 069-8501, Japan.
Address all correspondence to Dr. Hidetoshi Higuchi; telephone/fax: 81-11-388-4844; e-mail: [email protected]
Received October 31, 2011. Accepted May 13, 2012.
120
The Canadian Journal of Veterinary Research
2013;77:120–125
FOR PERSONAL USE ONLY
Neutrophils
a-tocopherol (mg/dL)
a-tocopherol (mg/107 cells)
Serum
Days after supplementation
Days after supplementation
Figure 1. Serum and cellular a-tocopherol concentrations in control and vitamin E-supplemented calves. Values are expressed
as mean 6 standard error of the mean (SEM).  control calves;  vitamin E-supplemented calves. *Significantly different
(P , 0.01) from values in control calves.
of messenger ribonucleic acid (mRNA) of SR-BI during corpus
luteum development in vivo and granulosa cell luteinization in vitro.
Sequencing of the bovine HDL-receptor showed that it codes for a
protein of 509 amino acids with close identity to hamster, mouse,
rat, and human sequences (13). Examination of the tissue distribution of the HDL-receptor mRNA showed high levels in adrenal
cortex and corpus luteum and lower levels in spleen and liver (13).
However, expression levels of SR-BI mRNA and the mechanism
for SR-BI-mediated uptake of a-tocopherol have not been clarified
with bovine neutrophils. It has been reported that cytochalasin D,
latrunculin B, and jasplakinolide are chemical reagents for actin
polymerization of neutrophils and were effective in determining if
the rearrangement of the neutrophil cytoskeleton is related to the
uptake of a-tocopherol (14–16).
In this study, we examined the effects of vitamin E supplementation on the cellular a-tocopherol concentrations of neutrophils from
Holstein calves and the mechanism for SR-BI-mediated uptake of
a-tocopherol.
Materials and methods
at Rakuno Gakuen University, which are based on the Guide for the
Care and Use of Laboratory Animals (Institute of Laboratory Animal
Resources, 1996).
Blood sampling
Thirty milliliters of blood was drawn from the jugular vein of
each calf into a tube containing heparin (20 IU/mL) for neutrophil
preparation and into a plain tube for serum preparation. Blood
samples were collected on the day of supplementation (0 d) and 1,
3, 7, 14, 21, and 28 d after supplementation.
Isolation of neutrophils
Neutrophils were isolated from heparinized blood by FicollConray solution (specific gravity 1.078), followed by hypotonic red
blood cell lysis, as described in a previous paper (17). Neutrophils
were resuspended in Hanks’ balanced salt solution containing Ca21
and Mg21 (HBSS; Nissui Pharmaceutical, Tokyo, Japan) to a concentration of 1 3 107 cells/mL. The resulting cell population was made
up of . 95% neutrophils, as determined by Wright-Giemsa staining,
and . 99% of the cells were viable when assessed by trypan blue
dye exclusion.
Calves
Lipoprotein separation
Fourteen newborn Holstein calves were randomly divided into
2 groups of 7 calves each. Each calf was given 4 L of the same colostrum within 2 h of birth and then injected intramuscularly with
physiological saline (control calves) or 25 IU/kg body weight (BW)
of vitamin E (dl-a-tocopherol; Nihon Zenyaku, Fukushima, Japan)
(vitamin E-supplemented calves) 48 h after birth. The control calves
were also used for preparing neutrophils 7 d after physiological
saline injection (9 d of age) to examine the effects of anti-SR-B1 antibody, cytochalasin D, latrunculin B, and jasplakinolide on cellular
a-tocopherol concentrations in vitro. All experimental procedures
complied with the guidelines of the Committee for Animal Welfare
Serum collected from both groups was used immediately
for lipoprotein separation without freezing. Lipoprotein separation was done based on the method described in a previous
paper (18) using a fixed-angle rotor (TLA-110; Beckman Coulter,
Fullerton, California, USA) in an ultracentrifuge (OPTIMA TLX;
Beckman Coulter) at 16°C. Chylomicrons (CM; 117 000 3 g for
10 min, d , 0.95), very low-density lipoprotein (VLDL; 657 000 3 g
for 2 h and 55 min, d , 1.006), low-density lipoprotein (LDL;
657 000 3 g for 4 h and 20 min, d , 1.063), and high-density
lipoprotein (HDL; 657 000 3 g for 7 h and 15 min, d , 1.21) were
prepared.
2000;64:0–00
The Canadian Journal of Veterinary Research
121
FOR PERSONAL USE ONLY
Effect of anti-SR-BI antibody on a-tocopherol
concentrations of neutrophils
a-tocopherol (mg/dL)
Neutrophils isolated from 7 control calves (7 d after physiological saline supplementation, 9 d of age) were used to examine the
effects of anti-SR-B1 antibody on cellular a-tocopherol concentrations of neutrophils. Neutrophils (2 3 107/mL) were pre-incubated
with 0.01 to 10 mg/mL of anti-SR-BI antibody (Novus Biologicals,
Littleton, Colorado, USA) at 37°C for 5 min, and treated with bovine
serum containing 800 mg/mL of a-tocopherol at 37°C for 30 min.
Cellular a-tocopherol concentrations of neutrophils were measured
as previously described.
Effects of cytochalasin D, latrunculin B, and
jasplakinolide on cellular a-tocopherol
concentrations of neutrophils in vitro
a-tocopherol (mg/dL)
Lipoprotein fraction
Neutrophils isolated from 7 control calves (7 d after physiological saline supplementation, 9 d of age) were used to examine the
effects of cytochalasin D, latrunculin B, and jasplakinolide on cellular a-tocopherol concentrations of neutrophils. Cytochalasin D,
latrunculin B, and jasplakinolide were dissolved in HBSS at final
concentrations of 0.01 to 1 mg/mL (14–16). Neutrophils (2 3 107/mL)
were pre-incubated with 0.1 to 1 mg/mL each of cytochalasin D,
latrunculin B, and jasplakinolide at 37°C for 5 min, and treated with
bovine serum containing 800 mg/mL of a-tocopherol at 37°C for
30 min. Cellular a-tocopherol concentrations of neutrophils were
measured as previously described.
Statistics
Lipoprotein fraction
Figure 2. Concentrations of a-tocopherol in lipoprotein fractions obtained
from control and vitamin E-supplemented calves at 0 h and 24 h after
supplementation. Values are expressed as mean 6 SEM.
control
calves;
vitamin E-supplemented calves. *Significantly different
(P , 0.01) than values in the control calves.
All data were expressed as mean 6 standard error of the mean
(SEM). Groups were compared for statistical difference by using
Student’s t-test with Bonferroni correction for changes in serum and
cellular a-tocopherol concentrations, a-tocopherol concentrations of
lipoprotein fractions, and gene expression of SR-B1 of neutrophils.
One-way analysis of variance (ANOVA), followed by Tukey’s test,
was used to study the effect of anti-SR-BI antibody, cytochalasin D,
latrunculin B, and jasplakinolide treatment on cellular a-tocopherol
concentrations. Values of P , 0.05 were regarded as significant.
Results
Concentrations of a-tocopherol
Serum and cellular a-tocopherol concentrations
Concentrations of a-tocopherol in serum, lipoproteins, and neutrophils were measured by high performance liquid chromatography
(HPLC), as described by Ametaj et al (19) and Campbell et al (20).
Changes in serum and cellular a-tocopherol concentrations
of neutrophils for both control calves and those given vitamin E
are shown in Figure 1. Serum a-tocopherol concentrations in the
vitamin E-supplemented calves increased from 352.2 6 29.7 to
805.6 6 30.0 mg/dL within 14 d after vitamin E supplementation. These concentrations were significantly higher (P , 0.01)
than those in control calves, which ranged from 186.2 6 26.2 to
235.6 6 23.9 mg/dL. Similarly, cellular a-tocopherol concentrations of
neutrophils isolated from vitamin E-supplemented calves increased
from 3.5 6 0.38 to 7.2 6 0.84 mg/107 cells within 14 d after vitamin E supplementation and these concentrations were significantly
higher (P , 0.01) than those in control calves, which ranged from
1.8 6 0.42 to 2.6 6 0.46 mg/107 cells.
SR-BI mRNA levels of neutrophils
Neutrophils isolated from both control and vitamin E-supplemented
calves were analyzed for SR-BI mRNA expression. Reverse
transcription-­polymerase chain reaction (RT-PCR) amplification of
SR-BI and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
mRNA as a housekeeping gene were carried out as previously
described by Rajapaksha et al (13). The expression index of SR-B1
was calculated by dividing the quantity of SR-B1 mRNA by the
quantity of GAPDH mRNA.
122
The Canadian Journal of Veterinary Research
2000;64:0–00
Expression index
a-tocopherol (mg/107 cells)
FOR PERSONAL USE ONLY
Days after supplementation
Anti-SR-BI concentration (mg/mL)
Figure 3. Data on SR-BI mRNA expression of neutrophils obtained from
control and vitamin E-supplemented calves at 0 to 21 d after vitamin E
supplementation. Values are expressed as mean 6 SEM. control calves
vitamin E-supplemented calves. *Significantly different (P , 0.01) than
values in the control calves.
Figure 4. Effect of anti-SR-BI antibody on cellular a-tocopherol concentrations of neutrophils in vitro. Values are expressed as mean 6 SEM.
*Significantly different (P , 0.01) than values in mg/mL of anti-SR-BI
antibody.
Concentrations of a-tocopherol in lipoprotein
fractions
sin D were significantly decreased (P , 0.01). Similarly, latrunculin B
at concentrations of 0.1 and 1 mg/mL also significantly decreased
(P , 0.01) the cellular a-tocopherol concentrations of neutrophils.
In contrast, jasplakinolide at concentrations of 0.1 and 1 mg/mL
significantly enhanced (P , 0.01) cellular a-tocopherol concentrations of neutrophils.
Changes in concentrations of a-tocopherol in each lipoprotein
fraction at 0 h and 24 h after vitamin E supplementation are shown
in Figure 2. Twenty-four hours after vitamin E supplementation,
a-tocopherol concentrations of HDL fractions (603.2 6 27.2 mg/dL)
were significantly higher (P , 0.01) than those of control calves.
No significant differences of CM, VLDL, and LDL fractions were
detected between control and vitamin E-supplemented calves.
Gene expression of SR-B1 of neutrophils
Data on SR-BI mRNA expression of neutrophils obtained from
control and vitamin E-supplemented calves at 0 to 21 d after vitamin E supplementation are shown in Figure 3. The expression indices of SR-B1 mRNA levels of vitamin E-supplemented calves were
approximately 1.5 to 5 times higher (P , 0.01) than those of control
calves at 1, 3, 7, and 14 d after vitamin E supplementation.
Effect of anti-SR-BI antibody on cellular
a-tocopherol concentrations
Data on the effect of anti-SR-BI treatment on cellular ­a-tocopherol
concentrations of neutrophils are shown in Figure 4. Cellular
a-tocopherol concentrations of neutrophils were significantly
(P , 0.01) decreased after anti-SR-BI treatment, with concentrations
ranging from 0.1 to 10 mg/mL.
Effects of cytochalasin D, latrunculin B, and
jasplakinolide treatment on cellular a-tocopherol
concentrations of neutrophils
Data on the effects of cytochalasin D, latrunculin B, and jasplakinolide treatment for cellular a-tocopherol concentrations of
neutrophils in vitro are shown in Figure 5. Cellular a-tocopherol
concentrations of neutrophils treated with 1 mg/mL of cytochala-
2000;64:0–00
Discussion
Vitamin E is a potent, lipid-soluble, chain-breaking antioxidant
that maintains membrane integrity by reducing oxidation of polyunsaturated fatty acids in membranes (1–3). We have previously
shown that vitamin E supplementation enhanced killing activity
and modified intracellular signal transduction of neutrophils from
Holstein calves (8). The effect of vitamin E supplementation on cellular a-tocopherol concentrations of neutrophils, however, has not
been examined. The present study showed that cellular a-tocopherol
concentrations of neutrophils obtained from vitamin E-supplemented
calves were significantly higher than those in control calves, similar
to the changes in serum a-tocopherol concentrations. Our results
indicated that changes in cellular a-tocopherol concentrations of
neutrophils were paralleled with that of serum a-tocopherol concentrations. Roquet et al (9) reported that cellular a-tocopherol concentrations of red blood cells from Holstein calves were approximately
5 times higher in vitamin E-supplemented calves than in control
calves. However, cellular a-tocopherol concentrations of neutrophils
in calves have not been reported. This is the first report to describe
cellular a-tocopherol concentrations of neutrophils from Holstein
calves and their changes with vitamin E supplementation.
We examined the distribution of supplemented a-tocopherol
in each lipoprotein fraction after vitamin E supplementation and
found that a-tocopherol concentrations of HDL fractions were
approximately 2 times higher than those of the control calves.
The Canadian Journal of Veterinary Research
123
a-tocopherol (mg/107 cells)
FOR PERSONAL USE ONLY
Cytochalasin D
a-tocopherol (mg/107 cells)
Cytochalasin D (mg/mL)
Latrunculin B
a-tocopherol (mg/107 cells)
Latrunclin B (mg/mL)
Jasplakinolide
Jasplakinolide (mg/mL)
Figure 5. Effect of cytochalasin D, latrunculin B, and jasplakinolide
treatment on cellular a-tocopherol concentrations of neutrophils in vitro.
Values are expressed as mean 6 SEM. *Significantly different (P , 0.01)
than concentrations of mg/mL of each inhibitor.
No obvious differences were observed in a-tocopherol concentrations in other lipoprotein fractions isolated from control and vitamin E-supplemented calves. Our results suggest that a-­tocopherol
is mainly distributed in HDL fractions isolated from vitamin E-supplemented calves. These results were similar to previous
findings, which showed that 80% to 95% of total plasma a-tocopherol
is associated with HDL among mouse plasma lipoprotein (21,22).
It has been reported that endothelial cells and enterocytes have
a scavenger receptor class B, type I (SR-BI) to recognize HDL,
which is important for the uptake of HDL-associated lipids (10,11).
Rajapaksha et al (13) sequenced the bovine SR-BI (HDL receptor)
and examined the changes in expression of its mRNA during corpus
124
The Canadian Journal of Veterinary Research
luteum development in vivo and granulosa cell luteinization in vitro.
Sequencing of the bovine SR-BI showed that it codes for a protein
of 509 amino acids with close identity to hamster, mouse, rat, and
human sequences (13). Examination of the tissue distribution of
the SR-BI mRNA showed high levels in the adrenal cortex and
corpus luteum and lower levels in the spleen and liver. Using a
semi-­quantitative RT-PCR, levels of SR-BI mRNA were measured
in corpora lutea from cattle at known stages of the estrus cycle and
in bovine granulosa cells luteinized in culture (13). This evidence
prompted us to hypothesize that SR-BI plays a key role in the
uptake of HDL-associated a-tocopherol with bovine neutrophils.
In this study, we have clarified that the expression indices of the
SR-BI mRNA levels of vitamin E-treated calves were 1.5 to 5 times
higher than those in control calves. Eggermont (23) reported that
­a-tocopherol is not only an antioxidant, but also regulates gene
expression by binding to nuclear receptors. The precise mechanism
for regulating gene expression, however, is still unknown. Our
results clarified that a-tocopherol is one of the factors regulating the
expression of SR-BI mRNA in bovine neutrophils.
We investigated whether SR-BI was functionally involved in the
uptake of HDL-associated a-tocopherol with neutrophils. Cellular
a-tocopherol concentrations were significantly decreased after antiSR-BI treatment, ranging from 0.1 to 10 mg/mL. These results were
similar to previous findings that determined the effects of SR-BI on
vitamin E uptake of the enterocyte (10). Our results suggest that
SR-BI is a crucial surface receptor that allows bovine neutrophils to
recognize HDL-associated a-tocopherol.
Cytochalasin D and latrunculin B are major inhibitors of actin
polymerization and depress phagocytosis of monocytes and
neutrophils (14,15), while jasplakinolide is an enhancer of actin
polymerization of neutrophils (15,16). We investigated the effects
of ­cytochalasin D, latrunculin B, and jasplakinolide on cellular
a-tocopherol concentrations of neutrophils to determine if the
rearrangement of the actin cytoskeleton of neutrophils was related
to the uptake of a-tocopherol. Cellular a-tocopherol concentrations of neutrophils treated with cytochalasin D were significantly
decreased at concentrations of 1 mg/mL. Similarly, latrunculin B
at concentrations of 0.1 and 1 mg/mL also significantly decreased
cellular a-tocopherol concentrations of neutrophils. In contrast,
jasplakinolide at concentrations of 0.1 and 1 mg/mL significantly
increased cellular a-tocopherol concentrations of neutrophils. The
final concentrations of these chemicals that induced changes in
cellular a-tocopherol concentrations of neutrophils were similar
to previous findings (14–16). These results suggested that the actin
polymerization of the cell membrane is an important process in the
uptake of a-tocopherol by bovine neutrophils.
In summary, in vitamin E-supplemented calves: 1) a-tocopherol is
mainly distributed with HDL; 2) a-tocopherol within HDL is recognized by SR-BI on the surface of neutrophils; 3) actin polymerization
of cell membranes is a crucial step for the uptake of a-tocopherol
by neutrophils; and 4) expression of SR-BI mRNA may be regulated
by a-tocopherol. This is the first report to describe the mechanism
of the uptake of a-tocopherol of neutrophils from Holstein calves.
Our results should stimulate further study aimed at determining
the mechanisms by which a-tocopherol supplementation enhance
neutrophil functions.
2000;64:0–00
FOR PERSONAL USE ONLY
References
1. Rice DA, Kennedy S. Assessment of vitamin E, selenium and
polyunsaturated fatty acid interactions in the aetiology of disease in the bovine. Proc Nutr Soc 1988;47:177–184.
2. Burton GW, Traber MG. Vitamin E: Antioxidant activity, biokinetics, and bioavailability. Annu Rev Nutr 1990;10:357–382.
3. Putnam ME, Comben N. Vitamin E. Vet Rec 1987;121:541–545.
4. Malone JI. Vitamin passage across the placenta. Clin Perinatol
1975;2:295–307.
5. Van Saun RJ, Herdt TH, Stowe HD. Maternal and fetal vitamin E
concentrations and selenium-vitamin E interrelationship in dairy
cattle. J Nutr 1989;119:1156–1164.
6. Cipriano JE, Morrill JL, Anderson NV. Effect of dietary vitamin E
on immune responses of calves. J Dairy Sci 1982;65:2357–2365.
7. Eicher-Pruiett SD, Morrill JL, Blecha F, Higgins JJ, Anderson NV,
Reddy PG. Neutrophil and lymphocyte response to supplementation with vitamins C and E in young calves. J Dairy Sci
1992;75:1635–1642.
8. Higuchi H, Nagahata H. Effects of vitamins A and E on superoxide production and intracellular signaling of neutrophils in
Holstein calves. Can J Vet Res 2000;64:69–75.
9. Roquet J, Nockels CF, Papas AM. Cattle blood plasma and red
blood cell a-tocopherol levels in response to different chemical
forms and routes of administration of vitamin E. J Anim Sci 1992;
70:2542–2550.
10. Reboul E, Klein A, Bietrix F, et al. Scavenger receptor class B
type I (SR-BI) is involved in vitamin E transport across the
enterocyte. J Biol Chem 2006;281:4739–4745.
11. Tachikawa M, Okayasu S, Hosoya K. Functional involvement
of scavenger receptor class B, type I, in the uptake of alphatocopherol using cultured rat retinal capillary endothelial cells.
Mol Vis 2007;13:2041–2047.
12. Trigatti B, Rayburn H, Viñals M, et al. Influence of the high density lipoprotein receptor SR-BI on reproductive and cardiovascular pathophysiology. Proc Natl Acad Sci USA 1999;96:9322–9327.
13. Rajapaksha WR, McBride M, Robertson L, O’Shaughnessy PJ.
Sequence of the bovine HDL-receptor (SR-BI) cDNA and changes
2000;64:0–00
in receptor mRNA expression during granulosa cell luteinization
in vivo and in vitro. Mol Cell Endocrinol 1997;134:59–67.
14. Gavrilin MA, Bouakl IJ, Knatz NL, et al. Internalization and
phagosome escape required for Francisella to induce human
monocyte IL-1beta processing and release. Proc Natl Acad Sci
USA 2006;103:141–146.
15. Hwang I, Sprent J. Role of the actin cytoskeleton in T cell
absorption and internalization of ligands from APC. J Immunol
2001;166:5099–5107.
16. Bengtsson T, Orselius K, Wetterö J. Role of the actin cytoskeleton
during respiratory burst in chemoattractant-stimulated neutrophils. Cell Biol Int 2006;30:154–163.
17. Higuchi H, Nagahata H. Comparison of superoxide production,
protein kinase C and tyrosine kinase activities in neutrophils
from neonatal calves and cows. Res Vet Sci 1998;65:139–143.
18. Oikawa S, Mizunuma Y, Iwasaki Y, Tharwat M. Changes of
very low-density lipoprotein concentration in hepatic blood
from cows with fasting-induced hepatic lipidosis. Can J Vet Res
2010;74:317–320.
19. Ametaj BN, Nonnecke BJ, Franklin ST, et al. Dietary vitamin A modulates the concentrations of RRR-alpha-tocopherol
in plasma lipoproteins from calves fed milk replacer. J Nutr
2000;130:629–636.
20. Campbell SE, Stone WL, Lee S, et al. Comparative effects of RRRalpha- and RRR-gamma-tocopherol on proliferation and apoptosis in human colon cancer cell lines. BMC Cancer 2006;6:13.
21. Sattler W, Levak-Frank S, Radner H, Kostner GM, Zechner R.
Muscle-specific overexpression of lipoprotein lipase in transgenic mice results in increased alpha-tocopherol levels in skeletal
muscle. Biochem J 1996;318:15–19.
22. Kostner GM, Oettl K, Jauhiainen M, Ehnholm C, Esterbauer H,
Dieplinger H. Human plasma phospholipid transfer protein
accelerates exchange/transfer of alpha-tocopherol between
lipoproteins and cells. Biochem J 1995;305:659–667.
23. Eggermont E. Recent advances in vitamin E metabolism and
deficiency. Eur J Pediatr 2006;165:429–434.
The Canadian Journal of Veterinary Research
125
FOR PERSONAL USE ONLY
Article
Preliminary study on factors influencing rabbit doe reproductive
efficiency: Effect of parity, day of mating, and suckling on ovarian status
and estrogen levels at day 6 of pregnancy
Maria Laura Marongiu, Corrado Dimauro
Abstract
The rabbit corpus luteum becomes an estradiol-dependent tissue by day 6 of gestation, and adequate estrogen is critical to avoid
pregnancy failure. The aim of this study was to investigate the effect of parity (primiparous or multiparous), day of mating (11 or
21 d postpartum), and suckling status (suckling or nonsuckling) on various reproductive traits in hybrid rabbit does (n = 96).
Ovarian structures on day 6 after coitus were evaluated by means of ultrasonography. Blood samples were collected that day,
and the serum was analyzed for estradiol-17b by radioimmunoassay (RIA). Parity and suckling had significant effects on mating
rate (P , 0.01 and P , 0.05, respectively). More does accepted the male on day 11 than on day 21 (P , 0.05). Ovulation frequency
was significantly affected by parity (P , 0.05), day of mating (P , 0.01), and suckling (P , 0.01). Fewer ovarian large follicles and
lower estradiol-17b levels were detected in suckling compared with nonsuckling rabbits (P , 0.01). Since estrogen concentrations
are commonly used to assess follicular growth and steroidogenic capacity, the lower hormonal levels in the suckling rabbits may
reveal poorer ovarian activity, which could result in reduced reproductive efficiency. Our observations confirm the existence of
a partial antagonism between lactation and reproduction in rabbits. Further research is needed to elucidate these phenomena,
including when artificial insemination is done. Ultrasonography could represent a noninvasive and reliable method for studying
several reproductive functions and dysfunctions in rabbits.
Résumé
Chez la lapine le corps jaune devient un tissu dépendant de l’œstradiol au 6 e jour de la gestation, et une quantité adéquate d’estrogène est
critique pour éviter l’interruption de la gestation. L’objectif de l’étude était d’examiner, chez des lapines hybrides (n = 96), l’effet de la parité
(primipare ou multipare), le jour de l’accouplement (11 ou 21 jours post-partum), et si elles allaitaient ou non, sur différentes caractéristiques
de reproduction. Les structures ovariennes au jour 6 après le coït ont été évaluées par échographie. Des échantillons de sang ont été prélevés la
même journée et le sérum analysé par radio-immunoessai (RIA) pour l’œstradiol-17b. La parité et le fait d’allaiter avaient un effet significatif
sur le taux de conception (respectivement P , 0,01 et P , 0,05). Plus de lapines étaient réceptives au mâle au jour 11 comparativement
au jour 21 (P , 0,05). La fréquence d’ovulation était affectée de manière significative par la parité (P , 0,05), le jour de l’accouplement
(P , 0,01) et le fait d’allaiter (P , 0,01). Moins de larges follicules ovariens et des niveaux plus faibles d’œstradiol-17b ont été trouvés chez
les lapines qui allaitaient comparativement à celles qui ne le faisaient pas (P , 0,01). Étant donné que les concentrations d’œstrogène sont
fréquemment utilisées pour évaluer la croissance folliculaire et la capacité de stéroidogénèse, les niveaux plus faibles d’hormones chez les
lapines qui allaitent peuvent révéler une activité ovarienne plus pauvre, qui pourrait se traduire par une efficacité reproductrice moindre.
Nos observations confirment l’existence d’un antagonisme partiel entre la lactation et la reproduction chez les lapins. De la recherche
supplémentaire est nécessaire afin d’élucider ces phénomènes, incluant lorsque l’insémination artificielle est utilisée. Chez les lapins,
l’échographie pourrait s’avérer une méthode non-invasive et fiable pour étudier plusieurs fonctions reproductrices ainsi que des dysfonctions.
(Traduit par Docteur Serge Messier)
Introduction
Control of the interval from parturition to subsequent conception
is crucial to the optimal reproductive rate for a species. The remating
program [interval from kindling (parturition) to mating] most widely
used in the rabbit industry is the semi-intensive rhythm, which is
11 to 12 d postpartum. This should represent a compromise between
the doe’s need for recovering energy after parturition and the economic demand for increased numbers of kits weaned per year. Since
a negative energy balance can be detrimental to the reproductive
process (1), one of the main reasons for lengthening the remating
interval is to prolong the dry period so that the doe, especially if
primiparous, recovers body energy completely (2–4).
Ovulation does not occur spontaneously in rabbits: it is a neuroendocrine reflex triggered by copulation. Even though rabbit does
can be mated just after kindling and be concurrently pregnant and
lactating, their reproductive efficiency varies considerably with parity (the number of times the doe has kindled), physiological state
Dipartimento di Agraria, Sezione di Scienze Zootecniche, Università di Sassari, Via De Nicola 9, 07100 Sassari, Italia.
Address all correspondence to Dr. Maria Laura Marongiu; telephone: 139 079 229304; fax: 139 079 229302; e-mail: [email protected]
Received November 15, 2011. Accepted February 14, 2012.
126
The Canadian Journal of Veterinary Research
2013;77:126–130
FOR PERSONAL USE ONLY
(whether lactating or not and the stage of lactation), and sexual
receptivity at mating (5). The current study aimed to investigate the
effects on various aspects of rabbit reproduction of parity, suckling,
and remating interval. The ovarian structures were examined by
means of ultrasound scanning, which allowed the experiment to be
conducted entirely in vivo and by a noninvasive procedure.
In previous studies of the relationship between different managerial strategies and rabbit ovarian function (ovulation response,
ovulation rate, fertilization rate, embryo survival before and after
implantation, pregnancy rate), the females were slaughtered and
their reproductive tracts removed and dissected (6) or, alternatively,
the ovaries were recovered by laparotomy (7). Even though ultrasonography has been used for pregnancy diagnosis (8), to characterize
fetal growth (9), and to evaluate the maternal and fetal vessels (10),
there is a paucity of information in the literature regarding specific
study of the rabbit ovaries by this method.
In this work special focus was given to the ovarian population of
large follicles (LF; diameter greater than 1.5 mm) present at day 6 of
pregnancy because this follicular category, being steroidogenically
active, should be crucial to survival of the developing corpora lutea
(CL) and thus to reproductive efficiency. Blood estradiol levels in
plasma were measured to evaluate the steroidogenic capability of
the follicles through the first days of pregnancy.
Materials and methods
Animals and experimental design
The 96 hybrid rabbit does used in the study were housed in individual metal cages under controlled light conditions (14 h of light,
10 h of darkness), were fed ad libitum a commercial pelleted diet,
and had free access to tap water. The protocols involving the care
and use of the animals were approved by the Bioethics Committee
of the University of Sassari, Sassari, Italy.
The 50 primiparous and 46 multiparous does were studied in a
2 3 2 3 2 factorially designed experiment. The variables considered
were parity, day of attempted mating [day 11 (n = 46) or day 21
(n = 50)] after parturition, and whether the doe suckled the litter
after the day of parturition [S (n = 46)] or did not [N (n = 50)]. The
time that a doe was exposed to a given male (of proven fertility)
ranged from 60 to 120 s. If copulation occurred, the female was
removed immediately and classed as mating. A nonmating doe was
defined as one that had been exposed to 6 males for a total of about
12 min. Mating performance was assessed in the morning and after
controlled lactation (1 period of suckling per day for 15 min).
The CL and follicle populations of the mated females (S and N)
were evaluated by means of transabdominal real-time B-mode
ultrasound scanning on day 6 after coitus, which corresponded to
postpartum days 17 (groups 11-N and 11-S) and 27 (groups 21-N
and 21-S). Blood samples were obtained from the central ear artery
(11) on the same day and were processed to yield serum, which
was stored at 220°C until assayed. The concentration of estradiol17b (E2) in the serum was determined by radioimmunoassay (RIA)
with a commercial kit (Radim, Pomezia, Italy) based on competition
between antigens labeled with iodine 125 (radioactive conjugate) and
nonlabeled antigens (calibrator sample) for specific binding sites in
2000;64:0–00
antiserum-coated tubes. After incubation, all unbound material was
removed and radioactivity measured. Uncoated tubes were prepared
for measurements of total activity (T) and nonspecific binding (NSB).
Tubes coated with rabbit antibody against E2 were prepared for
measurements in the zero calibrator (Bo), calibrators 1 to 6, control
serum, and samples as follows. First, 100 μL of Bo was added to the
NSB tube, and 100 μL of each additional calibrator as well as the
control serum and samples was pipetted into the corresponding tube.
Next, 500 μL of the radioactive conjugate was pipetted into all the
tubes, whose contents were then mixed by vortex. After incubation
for 3 h 6 5 min at 37°C 6 2°C the contents were carefully aspirated
by pump from all tubes except the uncoated T tube. The radio­
activity in the tubes was measured with a g-counter. The sensitivity
of the assay was 2 pg. The intra-assay coefficient of variation (CV)
was 3%.
Scanning procedure
For ultrasound scanning the nonsedated rabbit does were put in
the supine position. The abdominal skin was shaved at the beginning
of the experiment, and before each scanning session the abdominal
area was covered with scanning gel. The scans were done with a
10-MHz transducer (model UST-987.7.5; Aloka, Tokyo, Japan) with a
real-time B-mode ultrasound scanner (SSD-900; Aloka). During each
scanning session the scanner settings that affect image attributes
(overall time gain, near-field and far-field gains, compensation, and
beam focus) were kept at predetermined levels. The images were
displayed at maximum magnification.
To scan the left and the right ovaries the rabbits were laid in a
dorsolateral position. The ovaries were located by first identifying
the kidney as a major landmark and then moving the transducer a
few millimeters caudolaterally from the caudal edge of the kidney,
remembering that the ovaries have a superficial location under the
skin. The best technique was to start with the left ovary, which was
in general easier to find. One or more on-screen images of both
ovaries were studied to assess the follicular and luteal structures.
To investigate the follicular populations, individual follicles on
each ovary were identified, measured, and classified by diameter
as small (# 1.5 mm) or large (. 1.5 mm). The total number of LF
was calculated by counting those on both ovaries. The occurrence
of ovulation was evaluated by the presence of CL, since rabbits are
induced ovulators, and functional CL should not be present in the
ovaries of unmated females. The ovulation rate was determined, as
recommended by the International Rabbit Reproduction Group (12),
by counting the number of CL on both ovaries.
Statistical method
Statistical analysis was done using SAS software, version 8.1 (SAS
Institute, Cary, North Carolina, USA). A mixed procedure was used
according to an autoregressive model to analyze repeated measures,
including the effects of parity, remating interval, suckling, and their
interactions on mating rate (number of does accepting the male/
number of observed does 3 100) (12), ovulation frequency (number of ovulating does/number of mated does 3 100) (12), ovarian
structures, and E2 concentrations. Means were compared with a
protected t-test; differences were considered significant when the
P-value was less than 0.05.
The Canadian Journal of Veterinary Research
127
FOR PERSONAL USE ONLY
Table I. Effects of parity, day of mating, suckling, and their interactions on reproductive traits of rabbit does
Mean 6 standard error and level of statistical significancea
Reproductive trait Mating Ovulation
Corpora
Large
Estradiol-17b
or interaction
rate (%)
frequency (%)
lutea (n)folliclesb (n)
level (pg/mL)
Parity (P)
Primiparous
66.0 6 4.9**
79.7 6 5.8*
8.9 6 0.2
15.0 6 1.5
14.5 6 1.3
Multiparous
95.6 6 6.7**
68.2 6 4.5*
10.3 6 0.8
16.2 6 1.7
15.3 6 1.5
Day of mating
(D; number of days
postpartum)
11
86.8 6 6.5*
69.6 6 3.1**
9.0 6 0.2
15.9 6 1.3
14.9 6 1.9
21
74.0 6 5.1*
50.0 6 3.9**
10.0 6 0.7
15.3 6 1.8
14.8 6 1.6
Suckling status (S)
Suckling
76.0 6 5.9*
47.8 6 3.7**
9.4 6 0.9
12.1 6 1.1**
12.6 6 1.7**
Not suckling
88.1 6 6.3*
68.1 6 4.2**
9.9 6 0.6
19.01 6 2.2**
17.5 6 2.1**
P 3 D
**
*
NS
NS
NS
S 3 P
NS
**
NS
NS
NS
D 3 S
*
*
NS
NS
NS
aAsterisks indicate a significant difference between a pair of means or a significant interaction at P-values of , 0.05 (*) or , 0.01 (**). The remaining pairs of means did not differ significantly. The interaction P 3 D 3 S was not significant.
bThose more than 1.5 mm in diameter.
NS — not significant.
Results
Results from the statistical analyses are depicted in Table I. Parity
and suckling had significant effects on mating rate (P , 0.01 and
P , 0.05, respectively). More does accepted a male on day 11 than
on day 21 (P , 0.05). There were significant interactions between
parity and day as well as between day and suckling with respect
to mating rate. Ovulation frequency was depressed by suckling
(P , 0.01) and was significantly affected by parity (P , 0.05), day
of mating (P , 0.01), and the interactions parity 3 day, suckling 3
parity, and day 3 suckling.
The ovarian follicles generally appeared as anechoic wide circular
areas on the ultrasound scans. However, when numerous within the
same ovary they were sometimes flattened and packed together; in
this situation there is a risk that the total number will be underestimated. There were fewer LF, accompanied by lower serum E2 levels,
in suckling does than in nonsuckling does (P , 0.01). In contrast, the
numbers of LF and the serum E2 levels were not influenced by parity
or by day of mating. Data on LF number and E2 levels referred to the
rabbit does that ovulated. The number of CL, visible as moderately
hyperechoic structures, was not affected significantly by parity, day
of mating, suckling, or their interactions. Luteal structures were in
some cases not clearly discernible because they appeared almost
isoechoic with the ovarian parenchyma rather than hyperechoic.
Discussion
The higher percentage of rabbit does mating on day 11 than on
day 21 postpartum is presumably consistent with greater sexual
receptivity, and in fact the sexual behavior of does varies with the
lactation stage. The percentage of does that accept a male is very high
on the day of parturition, decreases at day 4 postpartum, increases
128
The Canadian Journal of Veterinary Research
at day 11 postpartum, and returns to the highest level after weaning
(5). The primiparous lactating rabbits in our study had very poor
mating performance on day 21 postpartum, the day of maximum
milk production and lowest live body weight for primiparous rabbits
(1): an energy deficit could have affected sexual receptivity.
Mating was not followed by ovulation in some does, both suckling and nonsuckling, in this study. However, in the primiparous
subjects this lack of ovulation occurred only in the suckling group,
which may indicate different effects exerted by suckling upon the
hypothalamic centers regulating sexual receptivity and the release
of luteinizing hormone (13). A possible relationship with parity
requires further investigation.
The small difference in follicular population was not unexpected,
since the rabbit doe maintains a relatively constant supply of preovulatory follicles. In domestic rabbits, in which there is no spontaneous gonadotropin surge, follicles undergo waves of continuous
maturation, such that ovulable follicles are present at nearly any
given time (14). The lower population of LF in the suckling group
might be responsible for the lower serum E2 levels of this group
compared with the nonsuckling group. Since E2 concentrations have
been commonly used to assess follicular growth and steroidogenic
capacity (15,16), the lower hormonal levels in the suckling rabbits
may reveal poorer ovarian activity, which could result in reduced
reproductive efficiency.
Ovulation frequency was negatively affected by suckling, which
confirms that in nursing rabbits, as in other species, sexual receptivity and fertility after natural mating and artificial insemination
appear to be depressed during the period of lactation. Indeed, these
does are less fertile as a direct consequence of the lack of ovulation, fertility failure, or embryo death (5). The existence of a partial
antagonism between lactation and reproduction, reflecting the corresponding hormonal antagonism between prolactin and the release
2000;64:0–00
FOR PERSONAL USE ONLY
of gonadotropins in the rabbit, has been widely reported (17,18). In
the current study prolactin was not assayed, but it is well known
that secretion of this hormone is increased during lactation (19).
In this study, the serum E2 levels were lower in suckling than
in nonsuckling rabbits on day 6 after coitus. Estrogens have been
shown to play a key role in the maintenance of CL in the rabbit, prompting Hilliard and Eaton (20) to refer to estradiol as the
“ultimate luteotropin” in this species. The rabbit CL becomes an
estradiol-dependent tissue by day 6 of pregnancy, as reported by
Miller and Keyes (21), who demonstrated that adequate E2 at day 6
of pregnancy and pseudopregnancy is critical to continued development of the CL. The luteotropic E2 is supplied by ovarian LF, whose
destruction leads to immediate failure of the CL and termination of
pregnancy and pseudopregnancy (22–24).
Suckling had a depressive effect on both ovulation frequency and
LF number in this study. Regarding the steroidogenic capability of
the follicles present through the first days of pregnancy, early studies indicated that LF generally have a higher steroid content than
small follicles and that the appearance of new LF may be reflected
in the rise in serum E2 concentration by day 4 to 6 after ovulation
(20,25). Moreover, Mills et al (26) postulated a relationship between
the estrogen secretion and the wave of follicle growth occurring
in the first 6 d after mating. More recently Marongiu and Gulinati
(27) used ultrasound scanning to inquire into this relationship after
inducing ovulation by injection of human chorionic gonadotropin.
By performing transabdominal real-time ultrasonography, this
trial demonstrated that rabbit ovaries can be evaluated in vivo. This
noninvasive technique was found effective since the ultrasonic image
allows immediate interpretation in most circumstances. Indeed,
ultrasound scanning could represent a reliable method for studying
several reproductive functions in the rabbit.
Since the ovulation response and fertility after artificial insemination are high in rabbits that accept mating and significantly lower
when they are not receptive to the male (5), the data from the current experiment appear suitable to support additional research
aimed to elucidate the same postpartum reproductive phenomena
when artificial insemination is done. Nevertheless, further studies
are necessary to clarify follicular growth patterns, overall ovarian
dynamics, and uterus changes during simultaneous pregnancy and
lactation, with the aim of optimizing reproductive efficiency through
breeding systems adapted to rabbit doe physiology.
Acknowledgments
This research was supported by F.A.R. (Fondo di Ateneo per la
Ricerca) of the University of Sassari, Sassari, Italy, and by the Bank
of Sardinia Foundation. The authors thank Dr. Ana Helena Dias
Francesconi for English revision.
References
1. Rebollar PG, Pérez-Cabal MA, Pereda N, et al. Effects of parity
order and reproductive management on the efficiency of rabbit
productive systems. Livest Sci 2009;121:227–233.
2. Partridge GG, Allan SJ, Findlay M, et al. The effects of reducing the remating interval after parturition on the reproductive
2000;64:0–00
performance of the commercial doe rabbit. Anim Prod 1984;
39:465–472.
3. Cervera CJ, Fernandez-Carmona J, Viudes P, et al. Effect of
remating interval and diet on the performance of female rabbits
and their litters. Anim Prod 1993;56:399–405.
4. Marongiu ML, Gulinati A, Bomboi G, et al. Lengthening of the
remating interval improves body condition and reproduction
efficiency of lactating rabbit does. Ital J Anim Sci 2009;8:822
(Abstract).
5. Theau-Clément M. Preparation of the rabbit doe to insemination:
A review. World Rabbit Sci 2007;5:61–80.
6. Fortun L, Prunier A, Lebas F. Effects of lactation on fetal survival
and development in rabbit does mated shortly after parturition.
J Anim Sci 1993;71:1882–1886.
7. Garcia-Garcia RM, Arias-Alvarez M, Rebollar PG, et al. Influence
of different reproductive rhythms on serum estradiol and testosterone levels, features of follicular population and atresia
rate, and oocyte maturation in controlled suckling rabbits. Anim
Reprod Sci 2008;114:423–433.
8. Ypsilantis P, Saratsis PH. Early pregnancy diagnosis in the
rabbit by real time ultrasonography. World Rabbit Sci 1999;7:
95–99.
9. Chavatte-Palmer P, Laigre P, Simonoff E, et al. In utero characterisation of fetal growth by ultrasound scanning in the rabbit.
Theriogenology 2008;69:859–869.
10. Polisca A, Scotti L, Orlandi R, et al. Doppler evaluation of
maternal and fetal vessels during normal gestation in rabbits.
Theriogenology 2010;73:358–366.
11. Marongiu ML, Gulinati A, Floris B. A procedure for rabbit blood
serial collection. Ital J Anim Sci 2007;6:773 (Abstract).
12. International Rabbit Reproduction Group. Recommendations
and guidelines for applied reproduction trials with rabbit does.
World Rabbit Sci 2005;13:147–164.
13. Pau K-Y, Orstead KM, Hess DL, et al. Feedback effects of ovarian
steroids on the hypothalamic–hypophyseal axis in the rabbit.
Biol Reprod 1986;35:1009–1023.
14. Fleming MW, Rhodes RC, Dailey RA. Compensatory responses
after unilateral ovariectomy in rabbits. Biol Reprod 1984;30:
82–86.
15. Wallach EE, Noriega C. Effects of local steroids on follicular
development and atresia in the rabbit. Fertil Steril 1970;21:
253–267.
16. Ubilla E, Rebollar PG. Influence of the postpartum day on
plasma oestradiol concentrations, sexual behaviour, and conception rate, in artificially inseminated lactating rabbits. Anim
Reprod Sci 1995;38:337–344.
17. Theau-Clément M, Roustan A. A study on relationships between
receptivity and lactation in the doe and their influence on reproductive performances. J Appl Rabbit Res 1992;15:412–421.
18. Boiti C. Underlying physiological mechanisms controlling the
reproductive axis of rabbit does. In: Proceedings of the 8th World
Rabbit Congress, 2004 Sept 7–10, Puebla, Mexico; World Rabbit
Science Assoc, Castanet-Tolosan, France:186–206.
19. Durand P, Djiane J. Lactogenic activity in the serum of rabbits
during pregnancy and early lactation. J Endocrinol 1977;75:
33–42.
The Canadian Journal of Veterinary Research
129
FOR PERSONAL USE ONLY
20. Hilliard J, Eaton LW. Estradiol-17b, progesterone and 20a
hydroxypregn-4-en-3-one in rabbit ovarian venous plasma.
II. From mating through implantation. Endocrinology 1971;89:
522–527.
21. Miller JB, Keyes PL. Transition of the rabbit corpus luteum
to estrogen dependence during early luteal development.
Endocrinology 1978;102:31–38.
22. Keyes PL, Nalbandov AV. Maintenance and function of corpora
lutea in rabbits depend on estrogen. Endocrinology 1967;80:
938–946.
23. Rennie P. Luteal–hypophyseal interrelationship in the rabbit.
Endocrinology 1968;83:323–328.
24. Niswender GD, Juengel JL, Silva PJ, et al. Mechanisms controlling the function and life span of the corpus luteum. Physiol Rev
2000;80:1–29.
130
The Canadian Journal of Veterinary Research
25. Challis JR, Davies IJ, Ryan KJ. The concentration of progesterone,
estrone and estradiol-17b in the plasma of pregnant rabbits.
Endocrinology 1973;93:971–976.
26. Mills T, Copland A, Osteen K. Factors affecting the postovulatory
surge of FSH in the rabbit. Biol Reprod 1981;25:530–535.
27. Marongiu ML, Gulinati A. Ultrasound evaluation of ovarian
follicular dynamics during early pseudopregnancy as a tool
to inquire into the high progesterone (P1) syndrome of rabbit
does. In: Xicato G, Trocino A, Lukefahr SD, eds. Proceedings of
the 9th World Rabbit Congress, 2008 June 10–13, Verona, Italy;
World Rabbit Science Assoc, Castanet-Tolosan, France:393–397.
2000;64:0–00
FOR PERSONAL USE ONLY
Article
The effect of nitrous oxide on the minimum alveolar concentration (MAC)
and MAC derivatives of isoflurane in dogs
Debra A. Voulgaris, Christine M. Egger, M. Reza Seddighi, Barton W. Rohrbach,
Lydia C. Love, Thomas J. Doherty
Abstract
This study investigated the effects of 70% nitrous oxide (N2O) on the minimum alveolar concentration (MAC) of isoflurane (ISO)
that prevents purposeful movement, the MAC of ISO at which there is no motor movement (MAC NM), and the MAC of ISO at
which autonomic responses are blocked (MACBAR) in dogs.
Six adult, healthy, mixed-breed, intact male dogs were anesthetized with ISO delivered via mask. Baseline MAC, MAC NM,
and MACBAR of ISO were determined for each dog using a supra-maximal electrical stimulus (50 V, 50 Hz, 10 ms). Nitrous oxide
(70%) was then administered and MAC and its derivatives (N2O-MAC, N2O-MACNM, and N2O-MACBAR) were determined using
the same methodology. The values for baseline MAC, MACNM, and MACBAR were 1.39 6 0.14, 1.59 6 0.10, and 1.72 6 0.16,
respectively. The addition of 70% N2O decreased MAC, MACNM, and MACBAR by 32%, 15%, and 25%, respectively.
Résumé
Cette étude avait comme objectif d’évaluer chez des chiens les effets de 70 % d’oxyde nitreux (N2O) sur la concentration alvéolaire minimum
(MAC) d’isoflurane (ISO) qui empêche les mouvements volontaires, la MAC d’ISO à laquelle il n’y a pas de mouvement moteur (MACNM),
et la MAC d’ISO à laquelle les réponses autonomes sont bloquées (MAC BAR).
Six chiens mâles intacts adultes de race mélangée ont été anesthésiés avec de l’ISO administré via un masque. Les valeurs de base de MAC,
MACNM et de MACBAR d’ISO ont été déterminées pour chaque chien à l’aide d’un stimulus électrique supra-maximal (50 V, 50 Hz, 10 ms).
De l’oxyde nitreux (70 %) fut ensuite administré et la MAC et ses dérivées (N2O-MAC, N2O-MACNM et N2O-MACBAR) déterminées à l’aide
de la même méthodologie. Les valeurs des données de base de MAC, MAC NM et MACBAR étaient respectivement 1,39 6 0,14, 1,59 6 0,10
et 1,72 6 0,16. L’ajout de 70 % de N2O a entrainé des diminutions de MAC, MACNM et MACBAR de 32 %, 15 % et 25 %, respectivement.
(Traduit par Docteur Serge Messier)
Introduction
The minimum alveolar concentration (MAC) of an inhalational
anesthetic is defined as the alveolar concentration at sea level
at which there is no purposeful movement in 50% of patients in
response to a supra-maximal stimulus (1–3). Recent studies in
dogs have investigated MAC derivatives, such as the MAC at
which there is no motor movement (MACNM) (4) and the MAC
at which the autonomic response to noxious stimuli is blocked
(MACBAR) (5,6).
Nitrous oxide (N2O) is a colorless, non-flammable gas that is used
in humans for its analgesic, immobilizing, and anxiolytic effects
(7–9). Compared with other inhalational anesthetics, however, N2O is
low in potency and is less potent in dogs than in humans. Reported
MAC values for N2O in dogs vary from 188% (2) to 222% (10) and
N2O is used primarily as an adjunct to volatile anesthetics for its
MAC-decreasing properties. In a recent study, the authors found that
70% N2O decreased the MAC, MACNM, and MACBAR of sevoflurane
in dogs by 24%, 25%, and 35%, respectively (5).
The purpose of this study was to evaluate the effects of 70% N2O
on the MAC, MACNM, and MACBAR of isoflurane (ISO) in dogs. It
was hypothesized that 70% N2O would significantly decrease the
MAC, MACNM, and MACBAR of ISO.
Materials and methods
Animals
Six adult (2 to 3 y of age), purpose-bred, mixed-breed, intact male
dogs (14 6 1 kg) were determined to be healthy based on physical
examination. Food was withheld for 12 h before anesthesia, but
access to water was allowed. Each dog was anesthetized once. The
MAC, MACNM, and MACBAR were determined in that order for ISO
alone (baseline) and then for ISO with 70% N 2O (treatment). This
sequence of determination of MAC and its derivatives was used to
expedite the process and is standard procedure in our laboratory.
The study protocol was approved by the Institutional Animal
Care and Use Committee at the University of Tennessee and was
California Animal Rehabilitation, Santa Monica, California, USA (Voulgaris); Department of Small Animal Clinical Sciences (Egger), Department
of Large Animal Clinical Sciences (Seddighi, Doherty), and Department of Biomedical and Diagnostic Sciences (Rohrbach), University of
Tennessee, Knoxville, Tennessee, USA; Animal Emergency and Referral Associates, Fairfield, New Jersey, USA (Love).
Address all correspondence to Dr. Christine M. Egger; telephone: (865) 974-8387; fax: (865) 974-5554; e-mail: [email protected]
Received November 8, 2011. Accepted February 15, 2012.
2013;77:131–135
The Canadian Journal of Veterinary Research
131
FOR PERSONAL USE ONLY
carried out in accordance with the Guide for the Care and Use of
Experimental Animals.
Anesthesia
Anesthesia was induced with ISO (IsoFlo; Abbott Animal Health,
Abbott Park, Illinois, USA) in oxygen delivered via mask from a
circle breathing system. After tracheal intubation, anesthesia was
maintained with ISO in oxygen (2 L/min) using a small animal
anesthetic machine (North American Drager, Telford, Pennsylvania,
USA). Ventilation was controlled to maintain the end-tidal carbon
dioxide partial pressure (Pe9CO 2) at between 35 to 45 mmHg.
Arterial blood samples were drawn from each subject at the time
of each MAC, MACNM, and MACBAR determination to ensure that
arterial carbon dioxide tension (PaCO2), arterial partial pressure of
oxygen (PaO2), and acid-base status were within normal limits. Dogs
were placed in lateral recumbency, a 20-ga cephalic catheter (MILA
International, Erlanger, Kentucky, USA) was placed, and lactated
Ringer’s solution (Abbott Animal Health) was infused (3 mL/kg
body weight per h).
End-tidal ISO (E9ISO), end-tidal N2O (E9n2o), and Pe9CO2 were
monitored continuously with an infrared gas analyzer (Criticare
Systems, Waukesha, Wisconsin, USA). Samples were drawn from the
proximal end of the endotracheal tube at a rate of 150 mL/min. At
the beginning of the study, the monitor was calibrated with the calibration gases supplied by the manufacturer (1% ISO in 5% CO2 and
60% N2O; Criticare Systems). Body temperature was monitored using
an esophageal probe (Criticare Systems). A circulating warm water
blanket and a warm air blanket (Bair Hugger; Arizant Healthcare,
Eden Prairie, Minnesota, USA) were used to maintain body temperature within the normal range (37.5°C to 38.5°C). Arterial blood
pressure was monitored continuously from a 20-ga catheter placed
in a dorsal pedal artery, using a monitor (Criticare Systems) and a
disposable transducer (Baxter Healthcare Corporation, Deerfield,
Illinois, USA). The middle of the sternum was taken as the zero point
for blood pressure measurement. Heart rate and electrocardiogram
(ECG) were monitored continuously using a 3-lead system and
hemoglobin saturation (SpO2) was monitored continuously using a
tongue probe (Criticare Systems).
and did not occur. All MAC values were determined in duplicate
and the mean value was taken as the baseline MAC for that animal.
If the difference between these values was greater than 10%, a third
value was determined and the mean of these 3 values was taken as
the baseline MAC for that animal.
Determination of baseline MACNM
After MAC was determined, the E9ISO was maintained at 1.5% for
at least 15 min before the baseline MACNM was determined using
the same methodology as for MAC. The MACNM was defined as the
lowest E9ISO at which there was no motor movement, purposeful or
non-purposeful, in response to the noxious stimulus. Twitching of
the stimulated limb was not considered a positive response.
Determination of baseline MACBAR
After baseline MACNM was determined, the E9ISO was maintained
at 1.5% for at least 15 min before initiating baseline MACBAR determination. During each pre-stimulus period, heart rate (HR) and
mean arterial pressure (MAP) values were recorded from the arterial
line and were stable for at least 5 min, varying by less than 1%. The
greatest HR and MAP values during this time period were taken as
the baseline. The baseline MACBAR was determined using the same
methodology as for MAC and MACNM. MACBAR was defined as
the lowest E9ISO that prevented a $ 15% increase in baseline MAP
and HR in response to the noxious stimulus during the 60-s period
beginning at the time of the first stimulus.
Administration of N2O
After baseline MAC, MACNM, and MACBAR were determined,
administration of 70% N2O began. After a 15-min equilibration
period with the E9n2o maintained at 70% and the E9ISO at 1.5%, the
treatment MAC endpoints (N2O-MAC, N2O-MACNM, and N2OMACBAR) were determined using the same methods previously
described for the baseline MAC and its derivatives.
Time recording began immediately after the initial equilibration
period and time to determination of MAC, MACNM, and MACBAR
was cumulative. The dogs were evaluated for tissue damage, lameness, and pain for 24 h after recovery.
Determination of baseline MAC
Statistical analysis
The determination of baseline MAC began approximately 45 min
after induction of anesthesia and with the E9ISO held constant at
1.5% for at least 15 min. A supra-maximal stimulus (50 V, 50 Hz,
10 ms) was delivered (Grass Instrument Company, West Warwick,
Rhode Island, USA) via two 25-ga electrode needles inserted subcutaneously 5 cm apart over the mid-ulnar area. Two single stimuli
with a 5-s interval were delivered initially, followed 5 s later by a
continuous stimulus of 5 s duration, which was repeated after 5 s
(11). Purposeful movement was defined as gross movement of the
head or extremities. Twitching of the stimulated limb, coughing,
swallowing, rigidity, tail movement, or chewing were not considered
purposeful movements. If purposeful movement occurred, the E9ISO
was increased by 0.1% or 0.2% depending on the magnitude of the
response; otherwise, it was decreased by 0.1% and the stimulus was
reapplied after a 15-min equilibration period. The MAC was defined
as the mean of the lowest E9ISO at which purposeful movement did
Percent change in MAC, MACNM, and MACBAR was calculated
according to the formula:
132
The Canadian Journal of Veterinary Research
(treatment value 2 baseline value)/(baseline value) 3 100
A mixed-model analysis of variance (ANOVA) (PROC MIXED)
was used to determine the effect of treatment on MAC, MAC NM,
and MACBAR. Dog was included as a random factor in the model.
Dog, treatment, and endpoint were included as class variables.
Independent variables included treatment, endpoint, time, and the
2-way interaction between endpoint and treatment. A second mixedmodel ANOVA was used to compare the percent change in MAC
among endpoints (MAC, MACNM, and MACBAR). Class variables
included in the model were dog and endpoint. Endpoint was the
independent variable and dog was included as a random factor in
the model. A multiple range test according to the method of Tukey
was used to adjust for multiple comparisons. Fit of the models was
2000;64:0–00
FOR PERSONAL USE ONLY
Table I. Baseline and treatment MAC, MAC NM, and MACBAR
values of isoflurane and percent change in each value after
adding 70% N2O in 6 male dogs
MAC endpoint Baseline
Treatment
% Change
MAC1.39 6 0.14a0.98 6 0.14b 231.9 6 3.31
MACNM1.59 6 0.10c1.37 6 0.10c
214.9 6 3.32
MACBAR1.72 6 0.16d1.31 6 0.12e 224.9 6 3.31
MAC — minimum alveolar concentration; MACNM — minimum alveolar concentration at which there is no motor movement; MACBAR —
minimum alveolar concentration at which autonomic response is
blocked.
a,b,c,d,e
Values in the same row with different letters are significantly
different.
1,2
Values in the same column with different numbers are significantly
different (P # 0.05). All values are presented as least squares mean 6
standard error of the mean.
evaluated using the -2 log likelihood ratio and the fit of residuals
from the model to a normal distribution. Residuals were evaluated
using the test statistic of Shapiro-Wilk. Effect of treatment on percent
change in MAC at each endpoint was evaluated using a paired t-test
[PROC UNIVARIATE]. Data are expressed as least squares means
(LSM) and standard error of the mean (SEM). A P-value of # 0.05
was considered significant.
Results
The mean baseline values for MAC, MACNM, and MACBAR were
1.39%, 1.59%, and 1.72%, respectively (Table I). Administering 70%
N2O decreased these values by 32%, 15%, and 25%, respectively.
Baseline MACNM was not significantly different than N2O-MACNM.
While the percent change in MACBAR was not significantly different
than the percent change in MAC, the percent change in MACNM was
significantly different than the percent change in MAC and MACBAR
(Table I). The estimated hemoglobin saturation was . 95% and PaO2,
PaCO2, and acid-base status were normal at all times before and during administration of N2O. Recovery from anesthesia was uneventful
and the dogs resumed normal activities within 2 to 3 h of recovery.
The stimulated limbs appeared normal at all times.
Discussion
In this study, administering 70% N2O decreased MAC, MACNM,
and MACBAR (Table I). The baseline MAC value of 1.39% was comparable to the values reported for dogs in previous studies: 1.38% (12),
1.28% (13), and 1.34% (11). While interindividual variation in MAC
values of 10% to 20% is typical (3), variation was minimized in this
study by the use of only 1 observer. The MAC can also be affected
by extremes of PaCO2, PaO2, body temperature, and arterial blood
pressure. These variables were maintained within normal range in
each patient throughout the experiment.
The addition of 70% N2O decreased the MAC by 32%, which is
comparable with the MAC-sparing effects of N2O reported in previous studies. In halothane-anesthetized dogs, 75% N 2O decreased
MAC by 34% (10) and in sevoflurane-anesthetized dogs, 70% N 2O
2000;64:0–00
decreased MAC by 24% (5). In a clinical study of dogs undergoing
ovariohysterectomy, a 37% decrease in requirement for isoflurane
was reported when 64% N2O was included in the anesthetic protocol
(14). These results are also consistent with the effects of N2O in other
species. For example, 70% N2O decreased the MAC of isoflurane in
rats by 40% (15) and 75% N2O decreased the MAC in swine by 38%
(16). In desflurane-anesthetized dogs, however, 70% N2O decreased
the MAC by only 16% (17). Differences among studies are likely due
to individual variation, sample size, inhalational anesthetic, and
experimental design.
The MACNM in this study was 1.59% or 1.14 MAC (Table I). This
ratio of MACNM/MAC is comparable to the reported ratio of 1.16 for
sevoflurane MACNM/MAC in dogs (5). These data are also in general
agreement with a study of human surgical patients, which reported
that the E9ISO that prevented movement in 95% of the population was
approximately 25% greater than the MAC (18). In contrast, a comparable endpoint in halothane-anesthetized ponies was equivalent
to 1.6 MAC (19), which may reflect differences among species and
inhalational anesthetics. The addition of 70% N2O decreased MACNM
by 15% (Table I), but there was wide variability among dogs. To the
authors’ knowledge, there are no published reports on the effect of
N2O on MACNM in dogs. In another study, the authors determined
that 70% N2O decreased sevoflurane MACNM in dogs by 25% (5).
In this study, baseline MACBAR was 1.72% or 1.24 MAC (Table I).
This endpoint is typically greater than the other MAC derivatives,
as autonomic responses are activated at lower stimulus levels and
are more resistant to blockade than movement responses (20).
Suppression of this response may be clinically relevant because
autonomic activation can have deleterious effects on the patient
(20–22). There is limited information on MACBAR in dogs and other
veterinary species, and most MACBAR studies in humans include
N2O in the baseline anesthetic protocol, which makes it difficult to
compare results. Recent studies by the authors reported MAC BAR
values of 1.27 MAC (5) and 1.4 MAC (6) for sevoflurane. Reported
MACBAR values vary widely in other species. A study of isofluraneanesthetized goats reported a MACBAR of 2.8 MAC (23), but in cats
anesthetized with isoflurane, the MACBAR was only 1.1 MAC (24).
In rats, the MACBAR for sevoflurane did not differ significantly from
the MAC (25), and MACBAR values of 2.58 MAC (26) and 3.9 MAC
(27) for sevoflurane have been reported in human female patients.
Variations of such magnitude are likely due to the same factors as
those discussed previously for MAC.
In the present study, the mean decrease in MAC BAR with the
addition of 70% N2O was 25%. To the authors’ knowledge, there
are no published reports on the effect of 70% N2O on the MACBAR of
isoflurane in dogs. In a previous study, however, the authors found
that 70% N2O decreased the MACBAR of isoflurane by approximately
35% in dogs (5).
Decreases in MAC and its derivatives with N 2O could be due to
its analgesic and/or immobilizing effects. Although the mechanisms
of action of N2O are not completely understood, its analgesic actions
are likely separate from its immobilizing effects (9,28). Immobility
during general anesthesia is mediated by motor neurons located
in the ventral horn of the spinal cord (29,30). Interestingly, it has
been shown that neurons in the ventral horn are more sensitive to
the depressant effects of N2O than are neurons in the dorsal horn
The Canadian Journal of Veterinary Research
133
FOR PERSONAL USE ONLY
(31). The immobilizing effects of N2O may be due to N-methyl-Daspartate (NMDA) receptor blockade in the ventral horn (32,33),
although mechanisms involving monoaminergic pathways have
also been suggested (34).
Numerous mechanisms have been proposed to explain the analgesic actions of N2O. Although still controversial, prevailing evidence
supports the involvement of opioid and alpha-2 adrenergic receptors
(28,35,36). Specifically, nitrous oxide induces analgesia by activating
opioidergic neurons in the periaqueductal gray matter and noradrenergic neurons in the locus coeruleus. This results in modulation
of nociceptive transmission at the level of the spinal cord (7,37–39).
In this study, the decrease in MAC and its variants with the addition of 70% N2O ranged from 15% to 32%. It therefore appears that
N2O provides a clinically important reduction in MAC. The difference in the magnitude of the effect of N2O on MAC and MACNM is
surprising because they are both presumably mediated at the level
of the spinal cord. This difference may be due to the small sample
size and variability among subjects.
In this study, the determination of MAC and its derivatives was
not randomized. Determining MAC provides a starting point for
the determination of MACNM or MACBAR, as previously published
studies and experience have indicated that MACNM and MACBAR
are usually higher than MAC (5,23,26,27). Determining MAC and
its derivatives in this order expedites the process. The current study
and a previous study (5) from our laboratory demonstrated that the
time to determine MAC and its derivatives has no significant effect
on outcome, although this does not completely rule out an effect of
order of determination.
The benefits of administering N2O must be weighed against its
potential adverse effects on patients, personnel, and the environment.
The patient’s oxygenation must be monitored continuously throughout the perioperative period, as hypoxemia is more likely when using
N2O. Long-term exposure to N2O can have adverse effects on personnel, including bone marrow suppression, spontaneous abortion,
teratogenicity, genotoxicity, and myelinopathies (39–41). In addition,
N2O contributes to ozone depletion in the environment (40,41).
In conclusion, adding 70% N2O significantly decreased the MAC,
MACNM, and MACBAR of isoflurane (ISO) in dogs by 32%, 15%, and
25%, respectively.
Acknowledgment
The authors thank Abbott Animal Health for donating IsoFlo for
this study. Abbott Animal Health had no role, however, in the study
design; collection, analysis, or interpretation of the data; writing
of the manuscript; or in the decision to submit the manuscript for
publication.
References
1. Merkel G, Eger EI 2nd. A comparative study of halothane and
halopropane anesthesia including a method for determining
equipotency. Anesthesiology 1963;24:346–357.
2. Eger EI 2nd, Saidman LJ, Brandstater B. Minimum alveolar
anesthetic concentration: A standard of anesthetic potency.
Anesthesiology 1965;26:756–763.
134
The Canadian Journal of Veterinary Research
3. Quasha AL, Eger EI 2nd, Tinker JH. Determination and applications of MAC. Anesthesiology 1980;53:315–334.
4. Seddighi R, Egger C, Rohrbach B, Cox S, Doherty T. The effects
of midazolam on the end-tidal concentration of isoflurane
necessary to prevent movement in dogs. Vet Anaesth Analg
2011;38:195–202.
5. Seddighi R, Egger CM, Rohrbach BW, Hobbs M, Doherty TJ. The
effect of nitrous oxide on sevoflurane MAC and MAC derivatives in dogs. Am J Vet Res 2012;73:341–345.
6. Love L, Egger C, Rohrbach B, Cox S, Hobbs M, Doherty T. The
effect of ketamine on the MACBAR of sevoflurane in dogs. Vet
Anaesth Analg 2011;38:292–300.
7. Maze M, Fujinaga M. Pharmacology of nitrous oxide. Best Pract
Res Clin Anaesthesiol 2001;15:339–348.
8. Emmanouil DE, Quock RM. Advances in understanding the
actions of nitrous oxide. Anesth Prog 2007;54:9–18.
9. Jinks SL, Carstens E, Antognini JF. Nitrous oxide-induced analgesia does not influence nitrous oxide’s immobilizing requirements. Anesth Analg 2009;109:1111–1116.
10. Steffey EP, Gillespie JR, Berry JD, Eger EI 2nd, Munson ES.
Anesthetic potency (MAC) of nitrous oxide in the dog, cat, and
stump-tail monkey. J Appl Physiol 1974;36:530–532.
11. Valverde A, Morey TE, Hernandez J, Davies W. Validation of
several types of noxious stimuli for use in determining the
minimum alveolar concentration for inhalation anesthetics in
dogs and rabbits. Am J Vet Res 2003;64:957–962.
12. Yang XL, Ma HX, Yang ZB, et al. Comparison of minimum
alveolar concentration between intravenous isoflurane lipid
emulsion and inhaled isoflurane in dogs. Anesthesiology 2006;
104:482–487.
13. Steffey EP, Howland D Jr. Isoflurane potency in the dog and cat.
Am J Vet Res 1977;38:1833–1836.
14. Duke T, Caulkett NA, Tataryn JM. The effect of nitrous oxide
on halothane, isoflurane and sevoflurane requirements in ventilated dogs undergoing ovariohysterectomy. Vet Anaesth Analg
2006;33:343–350.
15. Santos M, Kuncar V, Martinez-Taboada F, Tendillo FJ. Large
concentrations of nitrous oxide decrease the isoflurane minimum
alveolar concentration sparing effect of morphine in the rat.
Anesth Analg 2005;100:404–408.
16. Tranquilli WJ, Thurmon JC, Benson GJ. Anesthetic potency of
nitrous oxide in young swine (Sus scrofa). Am J Vet Res 1985;
46:58–60.
17. Nishimori CT, Nunes N, Paula DP, Rezende ML, Souza AP,
Santos PSP. Effects of nitrous oxide on minimum alveolar concentration of desflurane in dogs. Arquivo Brasileiro de Medicina
Veterinária e Zootecnia 2007;59:97–104.
18. de Jong RH, Eger EI 2nd. MAC expanded AD50 and AD95 values of common inhalation anesthetics in man. Anesthesiology
1975;42:384–389.
19. Doherty TJ, Geiser DR, Frazier DL. Comparison of halothane minimum alveolar concentration and minimum effective concentration in ponies. J Vet Pharmacol Ther 1997;20:
408–410.
20. Desborough JP. The stress response to trauma and surgery. Br J
Anaesth 2000;85:109–117.
2000;64:0–00
FOR PERSONAL USE ONLY
21. Ben-Eliyahu S, Page GG, Schleifer SJ. Stress, NK cells and cancer:
Still a promissory note. Brain Behav Immun 2007;21:881–887.
22. Bartal I, Melamed R, Greenfeld K, et al. Immune perturbations
in patients along the perioperative period: Alterations in cell
surface markers and leukocyte subtypes before and after surgery.
Brain Behav Immun 2010;24:376–386.
23. Antognini JF, Berg K. Cardiovascular responses to noxious
stimuli during isoflurane anesthesia are minimally affected by
anesthetic action in the brain. Anesth Analg 1995;81:843–848.
24. March PA, Muir WW 3rd. Minimum alveolar concentration measures of central nervous system activation in cats anesthetized
with isoflurane. Am J Vet Res 2003;64:1528–1533.
25. Docquier MA, Lavand’homme P, Ledermann C, Collet V,
De Kock M. Can determining the minimum alveolar anesthetic concentration of volatile anesthetic be used as an objective tool to assess antinociception in animals? Anesth Analg
2003;97:1033–1039.
26. Nakata Y, Goto T, Ishiguro Y, Terui K, Nimi Y, Morita S.
Anesthetic doses of sevoflurane to block cardiovascular
responses to incision when administered with xenon or nitrous
oxide. Anesthesiology 1999;91:369–373.
27. Ura T, Higuchi H, Taoda M, Sato T. Minimum alveolar concentration of sevoflurane that blocks the adrenergic response to
surgical incision in women: MACBAR. Eur J Anaesthesiol 1999;
16:176–181.
28. Koyama T, Fukuda K. Involvement of the kappa-opioid receptor
in nitrous oxide-induced analgesia in mice. J Anesth 2010;24:
297–299.
29. Rampil IJ, King BS. Volatile anesthetics depress spinal motor
neurons. Anesthesiology 1996;85:129–134.
30. Jinks S, Bravo M, Hayes SG. Volatile anesthetic effects on midbrain-elicited locomotion suggest that the locomotor network
in the ventral spinal cord is the primary site for immobility.
Anesthesiology 2008;108:1016–1024.
31. Kim J, Yao A, Atherley R, Carstens E, Jinks SL, Antognini JF.
Neurons in the ventral spinal cord are more depressed by iso-
2000;64:0–00
flurane, halothane, and propofol than are neurons in the dorsal
spinal cord. Anesth Analg 2007;105:1020–1026.
32. Sonner JM, Antognini JF, Dutton RC, et al. Inhaled anesthetics
and immobility: Mechanisms, mysteries, and minimum alveolar
anesthetic concentration. Anesth Analg 2003;97:718–740.
33. Antognini JF, Atherley RJ, Dutton R, Laster MJ, Eger EI 2nd,
Carstens E. The excitatory and inhibitory effects of nitrous oxide
on spinal neuronal responses to noxious stimulation. Anesth
Analg 2007;104:829–835.
34. Petrenko AB, Yamakura T, Kohno T, Sakimura K, Baba H.
Reduced immobilizing properties of isoflurane and nitrous
oxide in mutant mice lacking the N-methyl-D-aspartate receptor GluR1 subunit are caused by the secondary effects of gene
knockout. Anesth Analg 2010;110:461–465.
35. Guo TZ, Davies MF, Kingery WS, Patterson AJ, Limbird LE,
Maza M. Nitrous oxide produces antinociceptive response
via alpha 2B and/or alpha 2C adrenoceptor subtypes in mice.
Anesthesiology 1999;90:470–476.
36. Sawamura S, Kingery WS, Davies MF, et al. Antinociceptive
action of nitrous oxide is mediated by stimulation of noradrenergic neurons in the brainstem and activation of [alpha]2b
adrenoceptors. J Neurosci 2000;20:9242–9251.
37. Zhang C, Davies MF, Guo TZ, Maze M. The analgesic action
of nitrous oxide is dependent on the release of norepinephrine in the dorsal horn of the spinal cord. Anesthesiology
1999;91:1401–1407.
38. Fujinaga M, Maze M. Neurobiology of nitrous oxide-induced
antinociceptive effects. Mol Neurobiol 2002;25:167–189.
39. Sanders RD, Weimann J, Maze M. Biologic effects of nitrous
oxide: A mechanistic and toxicologic review. Anesthesiology
2008;109:707–722.
40. Myles PS, Leslie K, Silbert B, Paech MJ, Peyton P. A review of the
risks and benefits of nitrous oxide in current anaesthetic practice.
Anaesth Intensive Care 2004;32:165–172.
41. Ryan SM, Nielsen CJ. Global warming potential of inhaled anesthetics: Application to clinical use. Anesth Analg 2010;111:92–98.
The Canadian Journal of Veterinary Research
135
FOR PERSONAL USE ONLY
Article
Oxidative stress, superoxide production, and apoptosis of neutrophils
in dogs with chronic kidney disease
Adriana Carolina Rodrigues Almeida Silva, Breno Fernando Martins de Almeida,
Carolina Soares Soeiro, Wagner Luis Ferreira, Valéria Marçal Félix de Lima, Paulo César Ciarlini
Abstract
Oxidative stress is a key component in the immunosuppression of chronic kidney disease (CKD), and neutrophil function
may be impaired by oxidative stress. To test the hypothesis that in uremic dogs with CKD, oxidative stress is increased and
neutrophils become less viable and functional, 18 adult dogs with CKD were compared with 15 healthy adult dogs. Blood count
and urinalysis were done, and the serum biochemical profile and plasma lipid peroxidation (measurement of thiobarbituric acid
reactive substances) were determined with the use of commercial reagents. Plasma total antioxidant capacity (TAC) was measured
with a spectrophotometer and commercial reagents, superoxide production with a hydroethidine probe, and the viability and
apoptosis of neutrophils with capillary flow cytometry and the annexin V-PE system. The plasma concentrations of cholesterol
(P = 0.0415), creatinine (P , 0.0001), and urea (P , 0.0001) were significantly greater in the uremic dogs than in the control dogs.
The hematocrit (P = 0.0004), urine specific gravity (P = 0.015), and plasma lipid peroxidation (P , 0.0001) were significantly
lower in the dogs that were in late stages of CKD than in the control group. Compared with those isolated from the control
group, neutrophils isolated from the CKD group showed a higher rate of spontaneous (0.10 6 0.05 versus 0.49 6 0.09; P = 0.0033;
median 6 standard error of mean) and camptothecin-induced (18.53 6 4.06 versus 44.67 6 4.85; P = 0.0066) apoptosis and lower
levels of superoxide production in the presence (1278.8 6 372.8 versus 75.65 6 86.6; P = 0.0022) and absence (135.29 6 51.74
versus 41.29 6 8.38; P = 0.0138) of phorbol-12-myristate-13-acetate stimulation. Thus, oxidative stress and acceleration of
apoptosis occurs in dogs with CKD, the apoptosis diminishing the number of viable neutrophils and neutrophil superoxide
production.
Résumé
Le stress oxydatif est un élément clé dans l’immunosuppression de maladie rénale chronique (MRC), et la fonction des neutrophiles peut
être affectée par le stress oxydatif. Afin de vérifier l’hypothèse que chez les chiens urémiques avec MRC le stress oxydatif est augmenté et
les neutrophiles deviennent moins viables et fonctionnels, 18 chiens adultes avec MRC ont été comparés à 15 chiens adultes en santé. Des
analyses sanguines et urinaires ont été effectuées, de même que le profil biochimique sérique et la peroxydation des lipides plasmatiques
(mesures des substances réactives à l’acide thiobarbiturique) ont été déterminés au moyen de réactifs commerciaux. La capacité antioxydante
plasmatique totale (CAT) a été mesurée à l’aide d’un spectrophotomètre et de réactifs commerciaux, la production de superoxyde avec une
sonde hydroéthidine, et la viabilité et l’apoptose des neutrophiles avec un cytomètre à flux capillaire et le système d’annexine V-PE. Les
concentrations plasmatiques de cholestérol (P = 0,0415), de créatinine (P , 0,0001) et d’urée (P , 0,0001) étaient significativement plus
élevées chez les chiens urémiques comparativement aux chiens témoins. L’hématocrite (P = 0,0004), la gravité spécifique de l’urine (P = 0,015),
et la peroxydation des lipides plasmatiques (P , 0,0001) étaient significativement plus faibles chez les chiens dans les stades avancés de
MCR que chez les chiens témoins. Comparativement aux neutrophiles provenant des chiens témoins, ceux provenant des chiens avec MRC
montraient un taux plus élevé d’apoptose spontanée (0,10 6 0,05 versus 0,49 6 0,09; P = 0,0033; médiane 6 écart-type) et d’apoptose
induite par la camptothécine (18,53 6 4,06 versus 44,67 6 4,85; P = 0,0066) et des niveaux plus faibles de production de superoxyde en
présence (1278,8 6 372,8 versus 75,65 6 86,6; P = 0,0022) et en absence (135,29 6 51,74 versus 41,29 6 8,38; P = 0,0138) de stimulation
par l’acétate de phorbol-12-myristate-13. Ainsi, le stress oxydatif et l’accélération de l’apoptose surviennent chez des chiens avec MRC,
l’apoptose diminuant le nombre de neutrophiles viables et la production de superoxyde par les neutrophiles.
(Traduit par Docteur Serge Messier)
Department of Clinics, Surgery, and Animal Reproduction, College of Veterinary Medicine of Araçatuba, São Paulo State University,
793 Clóvis Pestana Street, 16050-680, Araçatuba, São Paulo, Brazil.
Address all correspondence to Dr. Paulo César Ciarlini; e-mail: [email protected]
Received December 16, 2011. Accepted April 5, 2012.
136
The Canadian Journal of Veterinary Research
2013;77:136–141
FOR PERSONAL USE ONLY
Introduction
In humans, kidney disease is an important cause of immunosuppression (1) that increases the risk of death from bacterial infection
owing to the neutrophil dysfunction (2) associated with oxidative
stress (3).
Neutrophils produce reactive oxygen species (ROS) when nicotinamide adenine dinucleotide phosphate oxidase is activated,
generating the superoxide anion essential to the bactericidal function of neutrophils (4). Although the ROS derived from superoxide
are required for the defence mechanism of neutrophils, free radicals
produced in excess can damage a number of cellular structures,
thus inducing lipid peroxidation and accelerating apoptosis (5).
The increase in superoxide anion in the neutrophils of humans with
chronic kidney disease (CKD) alters the function of endothelial cells,
mesangial cells, and podocytes and reduces renal sodium flow and
excretion (6,7).
The immunosuppressive effect associated with CKD has rarely
been investigated in veterinary medicine. Recently, Kralova, Leva,
and Toman (8) verified that, unlike that which occurs in humans,
CKD in dogs does not alter the phagocytic ability of neutrophils. In
contrast, Barbosa, Mori, and Ciarlini (9) verified in vitro that, as in
humans, the oxidative metabolism and apoptosis of neutrophils is
affected in uremic dogs. Oxidative stress due to a decrease in plasma
antioxidant capacity and an increase in neutrophil oxidative metabolism has also been observed in cats with CKD (10). It is accepted
that the viability and function of human neutrophils are affected
by oxidative stress and uremic toxins (11), and there is evidence in
late stages of CKD of increased apoptosis and decreased superoxide
production in human neutrophils (12). However, investigators who
evaluated the total and endogenous antioxidant status, such as
by measuring uric acid and albumin levels, in humans with CKD
reported conflicting results (13,14).
Since the progression of CKD in humans (14) and cats (10) is
associated with the harmful effects of oxidative stress, it is important
to investigate whether such stress also occurs in dogs and whether
it alters superoxide production and neutrophil survival. Therefore,
the hypothesis that oxidative stress occurs in dogs with CKD and
that in this condition neutrophils become less viable and functional
was tested.
Materials and methods
Animal selection
For the CKD group, 18 uremic adult dogs were selected that were
being treated at the Veterinary Hospital of the Araçatuba College of
Veterinary Medicine, São Paulo, Brazil, and had CKD equivalent to
stage III or IV in the International Renal Interest Society (IRIS) staging system (15). The control group consisted of 15 adult dogs with
no history of chronic or systemic disease and normal results of physical examination, blood count, urinalysis, and measurement of the
plasma concentrations of albumin, cholesterol, creatinine, urea, and
uric acid. The experimental groups were formed after all the dogs,
which were of various breeds and both sexes, had been examined
on at least 2 occasions; the control animals had to show no change
2000;64:0–00
in physical and laboratory findings. Dogs with a history of recent
treatment that could affect renal function or leukocytes were not
included. The study was approved by the Animal Experimentation
Ethics Committee of the Faculty of Veterinary Medicine of São
Paulo State University, and samples were obtained with consent of
the owners.
Sample preparation
Blood was collected from the dogs into polypropylene heparinized vacuum tubes (Vacutainer Plus Plastic Sodium Heparin; Becton,
Dickinson and Company, Rutherford, New Jersey, USA) that were
protected from light; immediately, 4 mL was used for neutrophil
isolation, and 3 mL was centrifuged to obtain plasma, which was
stored at −20°C, protected from light, for a maximum of 2 wk, pending biochemical analyses, quantification of lipid peroxidation, and
determination of total antioxidant capacity (TAC). Another 3 mL of
whole blood was collected into plastic tubes containing potassium
ethylene diamine tetraacetic acid (K2EDTA) (Vacutainer Plus Plastic
K2EDTA; Becton Dickinson) for a complete blood cell count, which
was done immediately.
Complete blood cell count, urinalysis, and
biochemical analyses
The overall concentrations of leukocytes, erythrocytes, and hemoglobin were obtained by means of an electronic veterinary blood
cell counter (model CC-530; CELM, São Paulo, Brazil), and the
hematocrit was determined with the Strumia microcapillary method
(centrifugation for 5 min at 12 700 3 g). The differential leukocyte
count was done on blood smears stained by quick Panotic dye
(Instant-Prov; Newprov Produtos para Laboratórios, Pinhais, Brazil)
in accordance with the guidelines and criteria outlined by Jain (16).
All the biochemical tests were performed with the use of commercial
reagents (BioSystems, Barcelona, Spain) at 37°C in an automated
analyzer (BTS-370 plus; BioSystems) previously calibrated with commercial calibrator and the reactions monitored with control levels I
and II. The plasma concentrations of albumin were determined by
the bromocresol green assay, cholesterol by the oxidase/peroxidase
enzymatic assay, creatinine by the alkaline picrate kinetic assay, urea
by the urease/glutamate dehydrogenase-coupled ultraviolet enzymatic assay, and uric acid by the uricase/peroxidase enzymatic assay.
Measurement of oxidative stress
Besides determining plasma levels of the antioxidants albumin
and uric acid, the plasma TAC was quantified in an automated
analyzer by a method that inhibits 2.29-azino diethylbenzothiazoline sulfonic acid cation formation (Randox Laboratories, London,
England). The TAC analyses were monitored with a standard antioxidant specific for automation (Randox Laboratories).
Plasma lipid peroxidation was determined by quantifying plasma
thiobarbituric acid reactive substances (TBARS) by means of a commercial reagent kit (TBARS Assay Kit; Cayman Chemical Company,
Ann Arbor, Michigan, USA). Absorbance (at 530 nm) of the reactions
was measured in a plate reader (Spectra Count Reader; Packard
BioScience, Meriden, Connecticut, USA) in accordance with the
manufacturer’s recommendations, starting with a standard commercial malondialdehyde (MDA) solution (500 mM) and using a
The Canadian Journal of Veterinary Research
137
FOR PERSONAL USE ONLY
Table I. Laboratory findings in healthy control dogs and dogs with chronic kidney disease
(CKD)a
Mean and standard deviation
Measure
ControlCKD
P-value
Hematocrit (%)
48.27 6 2.9b31.26 6 13.93c
, 0.0004**
Leukocyte count (3 103/mL)13 6 3.37b21.05 6 11.51c
, 0.0203**
Urine specific gravity
1.044 6 0.018b1.016 6 0.002c
, 0.0105**
Plasma concentration
Albumin (g/L)
30.36 6 3.29b25.73 6 3.7c
, 0.0033*
Cholesterol (mg/dL)
208.0 6 76.74b299 6 121.78c
, 0.0415*
Creatinine (mg/dL)
1.07 6 0.13b4.55 6 3.02c
, 0.0001**
Urea (mg/dL)
46.45 6 9.85b315.21 6 159.95c
, 0.0001**
Uric acid (mg/dL)
1.33 6 0.59b1.05 6 0.82b
, 0.3589*
TBARS (nmol/mL)
43.4 6 8.39b21.51 6 9.39c
, 0.0001*
Plasma TAC (mmol/L)
2.73 6 0.24b2.08 6 0.43c
, 0.0002**
aNoncoincident letters in the same row represent significant differences in the unpaired t-test (*)
and the unpaired t-test with Welch’s correction (**).
TBARS — thiobarbituric acid reactive substances, representing plasma lipid peroxidation; TAC — total
antioxidant capacity.
computer program (GraphPad Prism, version 4; GraphPad Software,
San Diego, California, USA). A curve for final concentrations of 0,
0.625, 1.25, 2.5, 5, 10, 25, and 50 nmol/mL of MDA was developed.
Each point on the curve was obtained from the mean value for
10 repetitions.
Neutrophil isolation
To isolate neutrophils, 4 mL of whole blood containing 10 IU of
heparin per milliliter of blood was transferred to sterile conical polypropylene tubes containing a double-gradient separation composed
of equal volumes (3 mL each) of Histopaque-1119 and 1077 (Sigma
Chemical Company, St. Louis, Missouri, USA). After centrifugation
at 340 3 g for 30 min, the layer of polymorphonuclear (PMN) cells
was aspirated and washed twice with aqueous ammonium chloride
(0.14 M) for complete lysis of residual erythrocytes. Next, the sample
was centrifuged (at 100 3 g) for 5 min in Hanks’ balanced salt solution (Sigma) without Ca21 or Mg21, and 1 mL of RPMI medium
(Sigma) was added to the cell sediment. Cell concentration was
determined in a hemocytometer, and cell viability was estimated
by the trypan blue exclusion method (17). The sample of isolated
PMN cells was diluted in RPMI to obtain a final cell concentration
of 106/mL, with the purity and viability of the neutrophils 90% and
95% or greater, respectively.
Measurement of neutrophil superoxide
production
A hydroethidine (HE) (dihydroethidium bromide; Polysciences,
Warrington, Pennsylvania, USA) probe was used to measure superoxide production from the neutrophils (18). Briefly, 180 mL of neutrophils (106/mL) suspended in RPMI medium was added to 20 mL of
HE buffer solution (0.1 mmol/L) with and without 20 mL of phorbol
12-myristate 13-acetate (PMA; Sigma), 3.2 μmol/L. After incubation
at 37°C for 15 min, the sample was maintained on ice and protected
from light until the reading. Mean fluorescence was measured in a
capillary flow cytometer (Guava EasyCyte Mini Flow Cytometry
System; Guava Technologies, Hayward, California, USA) adjusted
138
The Canadian Journal of Veterinary Research
to the wavelength of maximum emission (593 nm) and excitation
(473 nm) of ethidium bromide. To eliminate debris, the neutrophil
population characterized by the largest cell size was selected.
Ten thousand events were acquired and analyzed with a specific
computer program (Guava Express CytoSoft Data Acquisition and
Analysis Software, Personal Cell Analysis System, version 4.1, 2006;
Guava Technologies). Superoxide production was quantified from
the intensity of the fluorescence in spontaneous and stimulated
oxidation of HE.
Measurement of the apoptotic index of the
neutrophils
The percentages of apoptotic and viable neutrophils were determined with use of the Guava Nexin® Reagent (Guava Technologies,
Millipore, Hayward, California, USA). The procedure for each test
and proper instrument performance were verified in accordance
with the manufacturer’s recommendations. Briefly, 2 samples of
100 mL of neutrophils (106/mL) suspended in RPMI medium were
incubated at 37°C for 1 h with 100 mL of camptothecin (CAM)
(19.8 mmol/L; Sigma) and with 100 mL of RPMI medium (CAM
absent). After incubation, 100 mL of each sample was transferred to
a microtube with 100 mL of annexin V-PE reagent and stored at room
temperature, protected from light, for 10 min. In a capillary flow
cytometer 10 000 events were acquired, and the size of the viable
and apoptotic populations of neutrophils were determined with a
specific computer program.
Statistical analysis
After studying the distributions of the variables for normality and
homoscedasticity, as recommended by Zar (19), statistical differences
between groups were determined with use of the unpaired t-test, the
unpaired t-test with the Welch correction, and the Mann–Whitney
test. Statistical analyses were performed with statistical software
[SAS System, release 9.2 (2008); SAS Institute, Cary, North Carolina,
USA]. A P-value of less than 0.05 was considered significant for all
tests.
2000;64:0–00
FOR PERSONAL USE ONLY
Figure 1. Viability of neutrophils from healthy dogs (Normal) and dogs
with chronic kidney disease (CKD) not activated (A) or activated (B) by
camptothecin (CAM). The values of upper quartile, median, and lower
quartile are indicated in each box, and the bars outside the box indicate
semiquartile ranges. Differences between the 2 groups of dogs significant at *P = 0.0026 and **P = 0.0022.
Figure 2. Superoxide production measured by the mean fluorescence of
ethidium bromide in neutrophils from healthy dogs (Normal) and dogs
with chronic kidney disease (CKD) not activated (A) or activated (B) by
phorbol 12-myristate 13-acetate. The values of upper quartile, median,
and lower quartile are indicated in each box, and the bars outside the
box indicate semiquartile ranges. Differences between the 2 groups of
dogs significant at *P = 0.0138 and **P = 0.0022.
Discussion
Figure 3. Total apoptosis of neutrophils from healthy dogs (Normal) and
dogs with chronic kidney disease (CKD) not activated (A) or activated
(B) by camptothecin (CAM). The values of upper quartile, median, and
lower quartile are indicated in each box, and the bars outside the box
indicate semiquartile ranges. Differences between the 2 groups of dogs
significant at *P = 0.0033 and **P = 0.0066.
Results
The hematologic profile and results of urinalysis and plasma
biochemical analysis are summarized in Table I. The hematocrit,
urine specific gravity, plasma albumin concentration, and TBARS
and TAC concentrations were significantly lower in the uremic dogs
than in the control dogs. The plasma concentrations of cholesterol,
creatinine, and urea in the dogs with CKD were significantly above
baseline, but there was no difference between the groups for uric
acid. The viability (Figure 1) and superoxide production (Figure 2)
of neutrophils from the dogs with CKD were lower both at rest
and after stimulation with CAM (Figure 1) or PMA (Figure 2). An
increase in the rate of neutrophil apoptosis was also observed in the
dogs with CKD (Figure 3).
2000;64:0–00
The ​​hematologic and biochemical profiles of the healthy dogs
selected for the control group remained within the reference ranges
(20), demonstrating their health status. The clinical signs, increased
plasma concentrations of cholesterol, creatinine, and urea, decreased
plasma albumin concentration, and nonregenerative normochromic
normocytic anemia observed during selection of the CKD group persisted for at least 2 wk, demonstrating IRIS stage III or IV of kidney
disease at the time of assessment (15).
Although the plasma concentration of the antioxidant uric acid
was lower in the dogs with CKD than in the control group, the difference was not statistically significant. The results for plasma uric acid
concentration in human patients with kidney disease are conflicting,
probably owing to the use of different methodologies (13,14).
The lower level of plasma albumin observed in the dogs with CKD
could have contributed to their lower TAC. According to Terawaki
et al (21), albumin exerts an important antioxidant role in CKDrelated oxidative stress.
The TAC was significantly lower in the dogs with CKD than in
the healthy control group, confirming that the oxidative stress previously described in humans (13,14) and cats (10) also occurs in dogs.
The observed difference supports the hypothesis that an antioxidant
other than uric acid is decreased in dogs with CKD.
The lower antioxidant capacity did not promote the expected
increase in TBARS. On the contrary, lipid peroxidation in the plasma
was lower in the dogs with CKD than in the control group. The
lower production of superoxide in the dogs with CKD may have
contributed to reduced formation of TBARS. Although TBARS measurement is a commonly reported method of detecting MDA, it is
insufficiently sensitive and is affected by interference from related
species or overestimation due to stressing conditions during sample
manipulation (22).
The lower superoxide production in the dogs with CKD fully
supports the hypothesis that uremic toxins in dogs with IRIS
The Canadian Journal of Veterinary Research
139
FOR PERSONAL USE ONLY
stage III or IV kidney disease contribute to the diminished oxidative
metabolism of the neutrophils, a potentially important mechanism
that affects the innate immune response of dogs with renal failure,
as previously reported for humans (23) and cats (10), as well as from
in vitro experiments involving dog cells (9). However, this result
is in disagreement with the observation by McLeish et al (24) and
Rysz et al (3) of an increase in ROS production in human patients
with uremia and the lack of observation of alterations in neutrophil
oxidative metabolism in other studies of such patients (2,25,26). The
results of investigations into the oxidative metabolism of human
neutrophils in CKD remain highly contradictory; however, some of
these differences are known to be due to the methods of neutrophil
isolation and quantification of ROS (23).
As in humans (27), CKD in dogs causes a significantly higher rate
of spontaneous and induced neutrophil apoptosis than in healthy
controls. Our results contradict the report by Kralova, Leva, and
Toman (8) that CKD does not alter the production of reactive oxygen
radicals in neutrophils from dogs. Those investigators used chemiluminescence, a method that is not specific for superoxide detection,
as well as different procedures for isolation and incubation of the
neutrophils. The results of the current study are consistent with
the observations reported by Barbosa, Mori, and Ciarlini (9), who
obtained in vitro evidence that uremic toxins in dogs promote the
initial activation of the oxidative metabolism of neutrophils that
subsequently induces the acceleration of apoptosis and diminished
superoxide production. These findings support the hypothesis of
Cendoroglo et al (12) that in the early stages of CKD an increase in
the oxidative metabolism of neutrophils occurs, such that oxidants
accumulate and eventually cause cell damage capable of accelerating apoptosis and affecting superoxide production at a later stage.
How the mechanisms of oxidative stress in late stages of CKD
accelerate apoptosis and diminish the oxidative metabolism of
neutrophils in dogs remains to be determined.
In conclusion, oxidative stress occurs in dogs with CKD, as demonstrated by the lower plasma TAC in those dogs as compared with
healthy controls. This change occurs concomitantly with inhibition
of oxidative metabolism and acceleration of neutrophil apoptosis.
Acknowledgment
This work was graciously funded by the São Paulo Research
Foundation.
References
1. Vanholder R, Van Laecke S, Glorieux G. What is new in uremic
toxicity? Pediatr Nephrol 2008;23:1211–1221.
2. Anding K, Gross P, Rost JM, et al. The influence of uraemia and
haemodialysis on neutrophil phagocytosis and antimicrobial
killing. Nephrol Dial Transplant 2003;18:2067–2073.
3. Rysz J, Kasielski M, Apanasiewicz J, et al. Increased hydrogen
peroxide in the exhaled breath of uraemic patients unaffected
by haemodialysis. Nephrol Dial Transplant 2004;19:158–163.
4. Huimin J, Qinjun X, Peijun Z, et al. Impaired GP-91PHOX gene
expression and dysfunction of peripheral blood neutrophils in
patients maintaining hemodialysis. Chin Med J 2000;113:120–123.
140
The Canadian Journal of Veterinary Research
5. Kato S, Chmielewski M, Honda H, et al. Aspects of immune
dysfunction in end-stage renal disease. Clin J Am Soc Nephrol
2008;3:1526–1533.
6. Vaziri ND, Dicus M, Ho ND, et al. Oxidative stress and dysregulation of superoxide dismutase and NADPH oxidase in renal
insufficiency. Kidney Int 2003;63:179–185.
7. Nistala R, Whaley-Connell A, Sowers JR. Redox control of renal
function and hypertension. Antioxid Redox Signal 2008;10:
2047–2089.
8. Kralova S, Leva L, Toman M. Polymorphonuclear function
in naturally occurring renal failure in dogs. Vet Med (Praha)
2009;54:236–243.
9. Barbosa TS, Mori CK, Ciarlini PC. P.C. Efeito inibidor do soro
urêmico sobre o metabolismo oxidativo dos neutrófilos de cães.
Arq Bras Med Vet Zootec 2010;62:1352–1358.
10. Keegan RF, Webb CB. Oxidative stress and neutrophil function
in cats with chronic renal failure. J Vet Intern Med 2010;24:
514–519.
11. Chonchol M. Neutrophil dysfunction and infection risk in endstage renal disease. Semin Dial 2006;19:291–296.
12. Cendoroglo M, Bertrand LJ, Balakrishnan VS, Perianayagam M,
King AJ, Pereira BJG. Neutrophil apoptosis and dysfunction in
uremia. J Am Soc Nephrol 1999;10:93–100.
13. Clermont G, Lecour S, Lahet JJ, et al. Alteration in plasma antioxidant capacities in chronic renal failure and hemodialysis
patients: A possible explanation for the increased cardiovascular
risk in these patients. Cardiovasc Res 2000;47:618–623.
14. Erdogan C, Ünlücerci Y, Türkmen A, et al. The evaluation of
oxidative stress in patients with chronic renal failure. Clin Chim
Acta 2002;322:157–161.
15. International Renal Interest Society. IRIS Staging of CKD. 2006.
Available at http://www.iris-kidney.com/guidelines/en/
staging_ckd.shtml (last accessed 2013 Jan 11).
16. Jain NC. Schalm’s Veterinary Hematology. 4th ed. Philadelphia:
Lea & Febiger, 1986:5p.
17. Metcalf JA, Gallin JI, Nauseef WM, Root RK. Laboratory Manual
of Neutrophil Function. New York: Raven Press, 1986:10p.
18. Walrand S, Valeix S, Rodriguez C, et al. Flow cytometry study of
polymorphonuclear neutrophil oxidative burst: A comparison of
3 fluorescent probes. Clin Chim Acta 2003;331:103–110.
19. Zar JH. Biostatistical Analysis. 2nd ed. Englewood Cliffs,
New Jersey: Prentice Hall, 1984:93–95.
20. Stockham SL, Scott MA. Fundamentals of Veterinary Clinical
Pathology. Ames, Iowa: Iowa State University Press, 2002:384.
21. Terawaki H, Yoshimura K, Hasegawa T, et al. Oxidative stress
is enhanced in correlation with renal dysfunction: Examination
with the redox state of albumin. Kidney Int 2004;66:1988–1993.
22. Del Rio D, Stewart AJ, Pellegrini N. A review of recent studies
on malondialdehyde as toxic molecule and biological marker of
oxidative stress. Nutr Metab Cardiovasc Dis 2005;15:316–328.
23. Sardenberg C, Suassuna P, Andreoli MCC, et al. Effects of uraemia and dialysis modality on polymorphonuclear cell apoptosis
and function. Nephrol Dial Transplant 2006;21:160–165.
24. McLeish KR, Klein JB, Lenderer EL, et al. Azotemia, TNF alpha,
and LPS prime the human neutrophil oxidative burst by distinct
mechanisms. Kidney Int 1996;50:407–416.
2000;64:0–00
FOR PERSONAL USE ONLY
25. Paul JL, Roch-Arveiller M, Man NK, Luong N, Moatti N,
Raichvarg D. Influence of uremia on polymophonuclear leukocytes oxidative metabolism in end-stage renal disease and
dialyzed patients. Nephron 1991;57:428–432.
26. Gastadello K, Husson C, Wens R, et al. Role of complement and
platelet-activating factor in the stimulation of phagocytosis
2000;64:0–00
and reactive oxygen species production during haemodialysis.
Nephrol Dial Transplant 2000;15:1638–1646.
27. Majewska E, Baj Z, Sulowska Z, et al. Effects of uraemia and haemodialysis on neutrophil apoptosis and expression of apoptosisrelated proteins. Nephrol Dial Transplant 2003;18:2582–2588.
The Canadian Journal of Veterinary Research
141
FOR PERSONAL USE ONLY
Article
Correlation of tumor-infiltrating lymphocytes to histopathological
features and molecular phenotypes in canine mammary carcinoma:
A morphologic and immunohistochemical morphometric study
Jong-Hyuk Kim, Seung-Ki Chon, Keum-Soon Im, Na-Hyun Kim, Jung-Hyang Sur
Abstract
Abundant lymphocyte infiltration is frequently found in canine malignant mammary tumors, but the pathological features
and immunophenotypes associated with the infiltration remain to be elucidated. The aim of the present study was to evaluate
the relationship between lymphocyte infiltration, histopathological features, and molecular phenotype in canine mammary
carcinoma (MC). The study was done with archived formalin-fixed, paraffin-embedded samples (n = 47) by histologic and
immunohistochemical methods. The degree of lymphocyte infiltration was evaluated by morphologic analysis, and the T- and
B-cell populations as well as the T/B-cell ratio were evaluated by morphometric analysis; results were compared with the
histologic features and molecular phenotypes. The degree of lymphocyte infiltration was significantly higher in MCs with
lymphatic invasion than in those without lymphatic invasion (P , 0.0001) and in tumors of high histologic grade compared
with those of lower histologic grade (P = 0.045). Morphometric analysis showed a larger amount of T-cells and B-cells in MCs
with a higher histologic grade and lymphatic invasion, but the T/B ratio did not change. Lymphocyte infiltration was not
associated with histologic type or molecular phenotype, as assessed from the immunohistochemical expression of epidermal
growth factor receptor 2, estrogen receptor, cytokeratin 14, and p63. Since intense lymphocyte infiltration was associated with
aggressive histologic features, lymphocytes may be important for tumor aggressiveness and greater malignant behavior in the
tumor microenvironment.
Résumé
Une infiltration lymphocytaire abondante est fréquemment retrouvée dans les tumeurs mammaires malignes chez le chien, mais les
caractéristiques pathologiques et les immunophénotypes associés avec l’infiltration restent à être élucidés. L’objectif de la présente étude
était d’évaluer la relation entre l’infiltration lymphocytaire, les caractéristiques histopathologiques, et le phénotype moléculaire dans les
carcinomes mammaires canins (CM). Cette étude a été réalisée en utilisant des méthodes histologiques et immunohistochimiques sur des
échantillons archivés fixés à la formaline et enrobés de paraffine (n = 47). Le degré d’infiltration lymphocytaire a été évalué par analyse
morphologique, et les populations de lymphocytes T et B ainsi que le ratio de cellules T/B ont été évalués par analyses morphométriques;
les résultats ont été comparés avec les caractéristiques histologiques et les phénotypes moléculaires. Le degré d’infiltration lymphocytaire
était significativement plus élevé dans les CM avec invasion lymphatique que dans ceux sans invasion lymphatique (P , 0,001) et dans les
tumeurs de grade histologique élevé comparativement à ceux avec un grade histologique faible (P = 0,045). Les analyses morphométriques
ont montré une quantité plus grande de cellules T et B dans les CM ayant un grade histologique élevé et invasion lymphatique, mais le ratio
T/B n’a pas changé. L’infiltration lymphocytaire n’était pas associée avec le type histologique ou le phénotype moléculaire, tel qu’évalué par
l’expression immunohistochimique du récepteur 2 du facteur de croissance épidermique, du récepteur d’estrogène, de cytokératine 14, et de
p63. Étant donné que l’infiltration lymphocytaire marquée était associée avec des caractéristiques histologiques d’agressivité, les lymphocytes
pourraient être importants pour l’agressivité des tumeurs et le comportement de malignité plus important dans le microenvironnement de la
tumeur.
(Traduit par Docteur Serge Messier)
Small Animal Tumor Diagnostic Center, Department of Veterinary Pathology, College of Veterinary Medicine, Konkuk University,
1 Hwayang-dong, Kwangjin-gu, Seoul 143-701, Korea (J.-H. Kim, Im, N.-H. Kim, Sur); Hyu Animal Clinic, Iksan, Jeollabuk-do, Korea (Chon).
Address all correspondence to Dr. Jung-Hyang Sur; telephone: 82-2-450-4153; fax: 82-2-455-8124; e-mail: [email protected]
Dr. Seung-Ki Chon contributed equally to this work.
Dr. Jong-Hyuk Kim’s current address is the Department of Veterinary Clinical Sciences, College of Veterinary Medicine, University of
Minnesota, St. Paul, Minnesota 55108, USA.
Received December 19, 2011. Accepted April 5, 2012.
142
The Canadian Journal of Veterinary Research
2013;77:142–149
FOR PERSONAL USE ONLY
Introduction
The relationship between inflammation and cancer has been
evaluated because the immune system is important in the tumor
microenvironment (1). Large numbers of leukocytes infiltrate solid
and metastasized tumors (2). Lymphocyte infiltration primarily stimulates the host immune response against tumors (3), and
T-lymphocytes constitute most of the lymphocyte infiltration in
human breast cancer (HBC) (2). Recently it has been suggested
that a balance between the adaptive and innate immune responses
mediated by lymphocytes may affect HBC progression and regression (4). Cytotoxic T-lymphocytes (CTLs) kill tumor cells directly,
and T helper 1 (Th1) cells, which secrete antitumor cytokines,
exert mainly antitumor effects (4–6). Regulatory T (Treg-cells) and
T helper 2 (Th2) cells promote tumor development by suppressing
the antitumor immune response (4,7,8).
Abundant lymphocyte infiltration is frequently found not only in
HBC but also in canine malignant mammary carcinoma (MC) (9).
Canine MC may be regarded as a potent, spontaneous animal model
of HBC (10,11) because canine MC and HBC have similar biologic
and pathological features (11). Studies have shown that various features, including histologic features, clinical course, hormone levels,
molecular markers, proliferation markers, and genetic mutations,
are similar in canine MC and HBC (11). Hence, investigating the
pathogenesis and biologic features of canine mammary tumors could
improve our understanding of HBC and help identify new therapeutics (11). Recently some articles reported the phenotypic features
and prognostic implications of lymphocytes; the level of lymphocyte
infiltration may be an important prognostic biomarker for canine MC
(12–14). However, the identification of tumor-infiltrating lymphocytes and the relationship between various pathological features of
canine MC remain to be investigated.
Some authors have also reported on the identification and application of molecular phenotypes of canine MC because of the heterogeneity of this disease according to human classifications (15,16).
The molecular phenotypes of HBC correlate with prognosis and
clinical outcome and are classified as follows: luminal A [estrogen
receptor (ER)1 and HER (epidermal growth factor)-2–]; luminal
B (ER1/HER-21); HER-2-overexpressing (ER–/HER-21); basal
(ER–/HER-2–/basal cell marker1); and negative/null (ER–/HER2–/basal cell marker–) (15–17). Luminal phenotypes are based on
positive expression of ER, and basal phenotypes are determined by
negative expression of ER and basal cell markers such as cytokeratin
(CK) 5/6, CK14, p63, and P-cadherin (15–17). In human medicine,
patients with HER-2-overexpressing cells and basal phenotypes have
significantly shorter survival than those with luminal phenotypes
(18,19). In canine MC, 2 previous reports correlated molecular phenotypes with survival data; however, the results were inconsistent:
1 study showed that the basal phenotype was significantly associated
with lower survival rates (15), whereas the other study found that
patients with the basal phenotype had a better outcome than those
with the luminal phenotypes, those with the luminal B phenotype
having a worse outcome than those with the luminal A phenotype
(16). A high degree of lymphocyte infiltration correlated with HER2-positive HBC (20), and HER-2 may be an appropriate target for
immunotherapy because T-lymphocytes respond to HER-2 peptides
2000;64:0–00
(21,22). Therefore, lymphocyte infiltration is required to explore and
investigate the relationship between molecular phenotypes in MC.
Because canine MC is a heterogeneous disease, it is challenging
to explain the precise biologic features of MC, make a prognosis,
and apply effective therapy; thus, specific tumor behavior and biologic features must be examined. In addition, the involvement of
the immune response in the tumor microenvironment was recently
highlighted in both human and animal cancer. Therefore, the aim
of this study was to investigate whether lymphocytes infiltrate and
affect a specific biologic condition or subtype of canine MC with
heterogeneous biologic features by determining the total lymphocyte
count, the T- and B-cell populations, and the T/B-cell ratio, correlating lymphocyte infiltration with histologic variables, and correlating
the results with the molecular phenotypes.
Materials and methods
Samples
All mammary samples were originally obtained from the
Veterinary Medical Teaching Hospital of Konkuk University, Seoul,
Korea, or from private animal clinics. The samples had been submitted between 2006 and 2008 to the Small Animal Tumor Diagnostic
Center, Department of Veterinary Pathology, Konkuk University.
The 47 MC samples were obtained from purebred or mixed-breed
female dogs aged 2 to 19 y [mean 10.6 6 3.9 (standard deviation)
y; median 10.6 y]. Samples of normal mammary tissue from 3 clinically healthy dogs were used as negative controls for HER-2 and as
positive controls for the CK and p63 immunostaining.
Histologic examination and classification
Histopathological examination was conducted on 4-mm-thick
sections of formalin-fixed, paraffin-embedded samples of canine
mammary gland tissue that had been stained with hematoxylin and
eosin (H&E). Canine MCs were classified according to the World
Health Organization International Histological Classification of
Tumors of Domestic Animals (23). Evidence of lymphatic invasion
and the presence of tumor necrosis were recorded. The tumors were
classified histologically as well-differentiated (grade I), moderately
differentiated (grade II), or poorly differentiated (grade III) carcinomas according to the Elston and Ellis grading system (24,25).
Immunohistochemical examination and scoring
Primary antibodies included anti-CD3, anti-CD79a
(DakoCytomation, Glostrup, Denmark), anti-HER-2, antiER (BioGenex, Fremont, California, USA), anti-CK14 (Abcam,
Cambridge, England), and anti-p63 (Santa Cruz Biotechnology,
Santa Cruz, California, USA). Sections were dewaxed in xylene and
hydrated in graded ethanol. Endogenous peroxidase activity was
blocked with 3% hydrogen peroxide in phosphate-buffered saline
(PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 2 mM
KH2PO4), pH 7.4, for 20 min at room temperature (RT), and then
3 washes in PBS were done. Antigen retrieval was accomplished by
boiling CD3, ER, CK14, and p63 in tris-ethylene diamine tetraacetic
acid buffer (pH 9.0) and CD79a in citric acid buffer (pH 6.0) in a
microwave oven (at 750 W). Slides with ER were incubated with
The Canadian Journal of Veterinary Research
143
FOR PERSONAL USE ONLY
Table I. Primary antibodies used for immunohistochemical analysis of canine mammary carcinomas (MCs)
Target Antibody
antigentype
Clone
Sourcea
Antigen retrieval
Dilution
Incubation
Isotype
CD3
Pab
IgG fraction
DakoCytomation
HIER for 10 min
1:150
2.5 h, RT
Rabbit Ig fraction
CD79a
Mab
HM57
DakoCytomation
HIER for 10 min
1:150
Overnight, 4°C
Mouse IgG1
HER-2
Mab
CB11
BioGenex
None
1:100
3 h, RT
Mouse IgG1
ER
Mab
ER88
BioGenex
HIER for 20 min
1:60
3 h, RT
Mouse IgG1
CK14
Mab
LL002
Abcam
HIER for 10 min
1:300
3 h, RT
Mouse IgG3
p63
Mab
4A4
Santa Cruz Biotechnology
HIER for 15 min
1:100
Overnight, 4°C
Mouse IgG2a
a
DakoCytomation, Glostrup, Denmark; BioGenex, Fremont, California, USA; Abcam, Cambridge, England; Santa Cruz Biotechnology, Santa Cruz,
California, USA.
HER-2 — epidermal growth factor receptor 2; ER — estrogen receptor; CK14 — cytokeratin 14; Pab — rabbit polyclonal antibody; Mab — mouse
monoclonal antibody; Ig — immunoglobulin; HIER — heat-induced epitope retrieval; RT — room temperature.
Figure 1. Lymphocyte infiltration classified according to morphologic analysis. A — Inflammatory cells (asterisk) moderately infiltrate the stroma near
the tumor cells (arrows). The degree of lymphocyte infiltration is 2. B — High-density lymphocyte infiltration (asterisk) around tumor nests (arrows).
The degree of lymphocytic infiltration is 3. Hematoxylin and eosin. Bar = 70 mm.
5% normal goat serum for 30 min at RT. Sections were subsequently
incubated with the primary antibodies, and primary antibody binding was detected with the 2-step EnVision horseradish peroxidase
system (REAL EnVision Kit; DakoCytomation). The secondary
polymer was applied to each slide for 40 min at RT, and the slides
were washed 4 times with PBS before incubation with the appropriate substrates. The colorimetric reaction was stopped by 2 washes
in distilled water, and the sections were counterstained with Harris
hematoxylin. The primary antibodies, including isotype antibodies,
are listed in Table I. The isotype negative controls were as follows:
mouse IgG1 (eBioscience, San Diego, California, USA) for CD79a,
HER, and ER; rabbit immunoglobulin fraction (DakoCytomation)
for CD3; IgG3 (Abcam) for CK14; and IgG2a (BioLegend, San José,
California, USA) for p63. The following positive controls were used:
canine lymph node for CD3/CD79a, uterus for ER, myoepithelial
cells from a normal mammary gland for CK14 and p63, and mammary carcinoma tissues for HER-2 overexpression, as in our previous
study of HER-2 (26).
The immunohistochemical score was assigned through semiquantitative analysis. The HER-2 immunoreactivity was scored on
144
The Canadian Journal of Veterinary Research
a 4-point scale (0 to 31) according to the HercepTest scoring system
(DakoCytomation) (27): 0 = no staining or membrane staining of
less than 10% of the tumor cells; 11 = weak, incomplete membrane
staining; 21 = weak or moderate, complete membrane staining of
more than 10% of the tumor cells; and 31 = strong, complete membrane staining of more than 10% of the tumor cells. Scores of 0 and
11 were considered negative, whereas scores of 21 and 31 were
consistent with HER-2 overexpression. The ER immunoreactivity
was considered positive when more than 10% of the tumor cells
had immunolabeled nuclei (15). Positivity for CK14 was defined as
the detection of strong cytoplasmic staining in more than 1% of the
invasive tumor cells (18), and positivity for p63 was defined as the
detection of immunolabeling in the nuclei of more than 50% of the
neoplastic cells (15). The percentage of positive cells was evaluated in
10 representative high-power fields (each with more than 1000 cells).
Morphologic and morphometric analysis of
lymphocyte infiltration
In the H&E sections the degree of lymphocytic infiltration was
morphologically classified by distribution and intensity in the
2000;64:0–00
FOR PERSONAL USE ONLY
Figure 2. Overexpression of epidermal growth factor 2 leads to strong,
complete staining of the tumor cell membrane according to the
HercepTest scoring system (DakoCytomation, Glostrup, Denmark).
Intratumoral necrosis is also observed (asterisk). EnVision horseradish peroxidase immunohistochemistry system (REAL EnVision Kit;
DakoCytomation) with hematoxylin counterstain. Bar = 36 mm.
Figure 3. Strong immunoreaction for estrogen receptors in the nuclei
of the tumor cells. EnVision system with hematoxylin counterstain.
Bar = 36 mm.
Figure 4. Tumor cells are diffusely immunolabeled with cytokeratin 14
in the cytoplasm. EnVision system with hematoxylin counterstain. Bar =
36 mm.
Figure 5. Positive p63 immunostaining in the nuclei of the tumor cells.
EnVision system with hematoxylin counterstain. Bar = 36 mm.
i­ ntratumoral areas according to previous studies (12,14). Distribution
was classified as follows: focal = presence of 1 to 3 inflammatory foci;
multifocal = presence of more than 3 inflammatory foci; and diffuse =
even distribution of inflammatory cells in the tumor section. Density
was classified as follows: 1 = discrete; 2 = moderate; and 3 = intense.
The scores for distribution and intensity were multiplied. In this
classification system the infiltration degree varies between 1 and 9
and is classified as follows: degree 1 = score 1 to 3; degree 2 = score 4
to 6; and degree 3 = score 7 to 9 (Figures 1A and 1B).
Morphometric image analysis was done by a method described
previously (28). Digital images were acquired with an Olympus
microscope (model BX41; Olympus, Tokyo, Japan) and digi-
tal image transfer software (Leica Application Suite 2.7; Leica
Microsystems, Heerbrugg, Germany). Morphometric analysis of
T- and B-lymphocytes was accomplished with computerized image
analysis software (Image Pro Plus 5.1; Media Cybernetics, Bethesda,
Maryland, USA) according to a previous study (28). For each slide,
20 fields of immunolabeled images were acquired at a magnification
of 4003 (403 objective, 103 ocular). The positive areas per 1.6 mm2
were calculated by converting the positive pixels into square millimeters; the areas included the nuclear areas of the lymphocytes. The
CD3-positive area divided by the CD79a-positive area represented
the CD3/CD79a ratio. The total T/B-lymphocyte population was
calculated by adding the CD3-positive and CD79a-positive areas.
2000;64:0–00
The Canadian Journal of Veterinary Research
145
FOR PERSONAL USE ONLY
Table II. Evaluation of the degree of lymphocyte infiltration by morphologic analysis of
histologic features and molecular phenotype
Degree of infiltration;
number (and %) of MCs
Variable (n = 47)
1
2
3
P-valuea
Histologic type
NS
Simple (n = 22)
10 (45)
4 (18)
8 (36)
Complex (n = 3)
1 (33)
1 (33)
1 (33)
Mixed (n = 7)
2 (29)
3 (43)
2 (29)
Squamous cell (n = 15)
1 (7)
7 (47)
7 (47)
Lymphatic invasion
P , 0.0001
Presence (n = 21)
1 (5)
6 (28)
14 (67)
Absence (n = 26)
13 (50)
9 (35)
4 (15)
Histologic grade
I (n = 11)
7 (64)
3 (27)
1 (9)
P = 0.045
II (n = 14)
4 (28)
4 (28)
6 (43)
III (n = 22)
3 (14)
8 (36)
11 (50)
NecrosisNS
Presence (n = 27)
5 (18)
10 (37)
12 (44)
Absence (n = 20)
9 (45)
5 (25)
6 (30)
Molecular phenotype
NS
Luminal A (n = 14)
7 (50)
5 (36)
2 (14)
Luminal B (n = 7)
1 (14)
3 (43)
3 (43)
Basal (n = 15)
3 (20)
4 (27)
8 (53)
HER-2-overexpressing (n = 9)
2 (22)
3 (33)
4 (44)
aWith Pearson’s chi-square test. NS — not significant.
Molecular phenotyping
The MC molecular phenotypes were defined according to a
modified classification system (15,16) as follows: luminal A = ER1,
HER-2–, and any CK14 or p63; luminal B = ER1, HER-21, and any
CK14 or p63; HER-2-overexpressing = ER–, HER-21, and any CK14
or p63; basal = ER–, HER-2–, CK141, and/or p631); and negative/
null = ER–, HER-2–, CK14–, and p63–.
Statistical analysis
Differences in the degree of lymphocyte infiltration, histologic
categorical variables, and molecular phenotypes were evaluated
with Pearson’s chi-square test for categorical analysis. The normality of the distribution was assessed by the Kolmogorov–Smirnov
test, and the associations between the means for the 2 groups were
examined by Student’s t-test or the Mann–Whitney U-test. Analysis
of variance or the Kruskal–Wallis test was used to compare more
than 2 groups. Statistical significance was established at P , 0.05.
Statistical analysis was done with the use of SPSS, version 17.0 (SPSS,
Chicago, Illinois, USA).
Results
The canine MCs included simple carcinomas (n = 22), complex
carcinomas (n = 3), carcinomas in benign mixed tumors (n = 7), and
mammary squamous cell carcinomas (n = 15). Lymphatic invasion
of tumor cells was identified in 21 cases. Of the 47 tumors, 11 were
grade I, 14 grade II, and 22 grade III. The HER-2 protein was detected
146
The Canadian Journal of Veterinary Research
by immunohistochemical staining of the membrane of tumor cells
(Figure 2) in 16 (34%) of the 47 MCs. Nuclear ER immunoreactivity
(Figure 3) was positive in 21 (45%) of the 47 MCs, and positivity for
CK14 or p63 was detected in 76%, as determined from immunolabeling in the cytoplasm and the nuclei of the tumor cells, respectively (Figures 4 and 5). From the immunohistochemical staining,
the molecular phenotypes of the MCs were classified as follows:
luminal A, 14; luminal B, 7; basal, 15; HER-2-overexpressing, 9; and
negative/null, 2.
The degree of lymphocyte infiltration was not associated with histologic type of the MC (P = 0.042), presence of intratumoral necrosis
(P = 0.178), or molecular phenotype (P = 0.052) according to morphologic analysis (Table II). However, a high degree of lymphocyte
infiltration (31) was most frequent in the squamous cell subtype,
whereas a low degree (11) was most frequent in the simple subtype.
The degree of lymphocyte infiltration was significantly higher in
MCs with lymphatic invasion than in those without lymphatic invasion (P , 0.0001) and in tumors of high histologic grade compared
with those of low histologic grade (P = 0.045).
Morphometric image analysis showed significantly greater infiltration of CD31 T-lymphocytes in MCs of high histologic grade
(P = 0.035) and MCs undergoing lymphatic invasion (P = 0.008)
and of CD79a1 B-lymphocytes in high-grade MCs (P = 0.011) and
tumors undergoing lymphatic invasion (P = 0.001), compared with
MCs of lower histologic grade and those not invading the lymphatics (Table III). Total lymphocytes were abundant in high-grade MCs
(P = 0.020) and those with lymphatic invasion (P = 0.005). Again,
no statistical associations were observed between lymphocyte
2000;64:0–00
FOR PERSONAL USE ONLY
Table III. Comparison of lymphocyte subpopulations by morphometric analysis of histologic features
and molecular phenotype
Lymphocyte subpopulation, positive area/1.6 mm2 (mean 6 standard deviation)a
VariableCD31 T-cells
CD79a1 B-cells
Total T/B-cells
CD31/CD79a1 ratio
Histologic type
NS*NS*NS*NS†
Simple
0.078 6 0.102
0.027 6 0.052
0.106 6 0.143
0.277 6 0.79
Complex
0.028 6 0.032
0.008 6 0.012
0.036 6 0.033
14.38 6 0.54
Mixed
0.043 6 0.055
0.011 6 0.012
0.055 6 0.066
2.73 6 0.58
Squamous cell
0.119 6 0.120
0.028 6 0.035
0.147 6 0.144
3.36 6 0.95
Lymphatic invasion
P = 0.008‡
P = 0.001‡
P = 0.005‡NS§
Presence
0.118 6 0.112
0.038 6 0.049
0.157 6 0.148
2.70 6 0.72
Absence
0.055 6 0.085
0.013 6 0.031
0.067 6 0.105
3.92 6 1.02
Histologic grade
P = 0.035*
P = 0.011*
P = 0.020*
NS†
I
0.025 6 0.047
0.003 6 0.004
0.029 6 0.047
3.05 6 1.04
II
0.072 6 0.087
0.023 6 0.040
0.096 6 0.119
4.31 6 0.99
III
0.118 6 0.119
0.035 6 0.049
0.153 6 0.152
2.72 6 0.73
NecrosisNS‡NS‡NS‡NS§
Presence
0.103 6 0.113
0.027 6 0.045
0.131 6 0.143
3.26 6 0.85
Absence
0.055 6 0.080
0.020 6 0.037
0.075 6 0.113
3.01 6 0.84
Molecular phenotype
NS*NS*NS*NS†
Luminal A
0.028 6 0.043
0.005 6 0.007
0.033 6 0.045
5.84 6 0.59
Luminal B
0.133 6 0.141
0.049 6 0.052
0.182 6 0.181
2.53 6 0.76
Basal
0.111 6 0.111
0.038 6 0.059
0.148 6 0.157
2.91 6 0.83
HER-2-overexpressing 0.076 6 0.095
0.016 6 0.015
0.092 6 0.097
2.09 6 0.76
aStatistical significance determined by * the Kruskal–Wallis test, † analysis of variance, ‡ the Mann–Whitney U-test,
and § Student’s t-test.
i­ nfiltration and histologic type, necrosis, and molecular phenotype.
The histologic features and molecular phenotypes were not associated with the CD3/CD79a ratio.
Discussion
Mammary gland tumors are the most common neoplasms in
female dogs and are a heterogeneous group with different prognoses
(29). Although the classification of histologic features and biologic
and molecular identification for making a prognosis have been
explored, the immune response and the relationship between tumor
behavior and lymphocyte infiltration are still unclear.
In this study, lymphocyte infiltration of canine MC tissues was
assessed by morphologic and morphometric image analyses, and the
results from these 2 methods consistently showed that lymphocyte
infiltration was associated with an aggressive histologic grade and
lymphatic invasion. Morphologic evaluation revealed that a high
degree of lymphocyte infiltration was significantly correlated with
lymphatic invasion and a high histologic grade. A previous morphologic analysis of inflammatory cells found that a high intensity
of lymphocyte infiltration was associated with lymph node metastasis, advanced clinical stage, and low survival rate (12); our results
are consistent with these results. Although we have no clinical or
survival data, we suggest that an abundance of tumor-infiltrating
lymphocytes in canine MC tissue is associated with aggressive tumor
behavior and a higher degree of malignancy.
By morphometric image analysis, greater numbers of CD31
T-cells, CD79a1 B-cells, and total lymphocytes were observed in
MCs of high histologic grade with lymphatic invasion. Recent
2000;64:0–00
studies reported that an abundance of intratumoral CD31 T-cells
correlated with tumor invasiveness and shorter overall survival
in canines with malignant mammary tumors (13,14). One of those
studies showed that the number of T-cells increased more in the
malignant mammary tumors than in benign tumors (14), whereas
the other study showed that the number of intratumoral T-cells was
higher in benign tumors than in malignant tumors (13). The T-cell
count is likely different in benign and malignant tumors; however,
for malignant tumors, a high degree of T-cell infiltration was correlated with a poor prognosis in both studies. In addition, the latter
study showed that a greater abundance of intratumoral T-cells was
associated with tumor invasiveness (13); our T-cell infiltration results
are consistent with this observation. For B-cells, the infiltration likely
increases in canine MCs compared with benign tumors, although this
difference is not statistically significant (14). Another study showed
that the percentage of B-cells in MCs is higher in dogs with lymph
node metastasis (12). In HBC, B-cell infiltration is associated with
progression of malignant tumors (30). Because our results revealed
that more B-cells are observed in high-grade MCs with lymphatic
invasion, we suggest that greater infiltration of B-cells is associated
with aggressive tumor behavior in canine MC.
In addition, the data for total infiltration of T- and B-cells obtained
by morphometric analysis were similar to those obtained by morphologic analysis: greater lymphocyte infiltration was associated
with higher histologic grade and increased lymphatic invasion.
This suggests that the infiltrating lymphocytes are crucial for
tumor malignancy in canine MC and supports the HBC reports
that ­abundant lymphocyte infiltration in high-grade and invasive
carcinomas correlates with metastasis and poor prognosis (4,31,32).
The Canadian Journal of Veterinary Research
147
FOR PERSONAL USE ONLY
We investigated whether the relative amount of T- and B-cells in
the infiltration is related to the immune response; however, no
tumor features correlated with the relative amount of T- and B-cells.
Additional insights will likely require the investigation of T-cell
subpopulations, including CTLs and Treg- and Th-cells, rather than
estimation of the ratio of T- and B-cells.
Furthermore, the lymphocyte infiltration data were statistically
evaluated to investigate a possible association with molecular phenotype because some reports have shown a correlation between
molecular phenotype and tumor behavior or prognosis in both HBC
and canine MC (15,16,33). Basal and HER-2-overexpressing phenotypes are aggressive and correlate with a poor prognosis for HBC
patients (18,19,33). In canine MCs, although controversial results
have been reported, the basal phenotype correlating with a high
histologic grade (15) or a low grade (16), the molecular phenotype
correlation might provide significant information on the biologic and
pathological features of MCs. However, morphologic and morphometric analyses failed to show an association between lymphocyte
infiltration and molecular phenotype in the present study. Further
studies are thus required to clarify whether molecular phenotype
correlates with prognosis and whether lymphocytes are involved in
determining the molecular phenotype of canine MCs.
In conclusion, a large number of lymphocytes, including T- and
B-cells, consistently infiltrate canine MCs and are associated with
lymphatic invasion and a high histologic grade. The results of this
study suggest that tumor-infiltrating lymphocytes are important for
tumor progression and metastatic potential and not tumor killing or
regression. This is the first report of the histopathological features of
lymphocyte infiltration in different molecular phenotypes. Although
the distinct functions of T- and B-cells remain to be determined —
including by studies of the involvement of subpopulations of T-cells
and the clinical implications of lymphocyte infiltration — this study
has provided important data that support the relationship between
lymphocytes and cancer in dogs.
Acknowledgments
This study was supported by Konkuk University in 2012. The
authors thank Mrs. Rae-Hwa Jang for excellent technical assistance.
They also acknowledge the private veterinary clinics for providing
the canine mammary samples.
References
1. Coussens LM, Werb Z. Inflammation and cancer. Nature 2002;
420:860–867.
2. O’Sullivan C, Lewis CE. Tumour-associated leucocytes: Friends
or foes in breast carcinoma. J Pathol 1994;172:229–235.
3. Ben-Baruch A. Host microenvironment in breast cancer development: Inflammatory cells, cytokines and chemokines in breast
cancer progression: Reciprocal tumor–microenvironment interactions. Breast Cancer Res 2003;5:31–36.
4. DeNardo DG, Coussens LM. Inflammation and breast cancer.
Balancing immune response: Crosstalk between adaptive and
innate immune cells during breast cancer progression. Breast
Cancer Res 2007;9:212.
148
The Canadian Journal of Veterinary Research
5. Moss RB, Moll T, El-Kalay M, et al. Th1/Th2 cells in inflammatory disease states: Therapeutic implications. Expert Opin Biol
Ther 2004;4:1887–1896.
6. Munk ME, Emoto M. Functions of T-cell subsets and cytokines in
mycobacterial infections. Eur Respir J Suppl 1995;20:668s–675s.
7. Tan TT, Coussens LM. Humoral immunity, inflammation and
cancer. Curr Opin Immunol 2007;19:209–216.
8. Johansson M, Tan T, de Visser KE, Coussens LM. Immune cells
as anti-cancer therapeutic targets and tools. J Cell Biochem
2007;101:918–926.
9. Rutten VP, Misdorp W, Gauthier A, et al. Immunological aspects
of mammary tumors in dogs and cats: A survey including own
studies and pertinent literature. Vet Immunol Immunopathol
1990;26:211–225.
10. Rivera P, von Euler H. Molecular biological aspects on canine
and human mammary tumors. Vet Pathol 2011;48:132–146. Epub
2010 Dec 7.
11. Queiroga FL, Raposo T, Carvalho MI, Prada J, Pires I. Canine
mammary tumours as a model to study human breast cancer:
Most recent findings. In Vivo 2011;25:455–465.
12. Estrela-Lima A, Araujo MS, Costa-Neto JM, et al. Immuno­
phenotypic features of tumor infiltrating lymphocytes from
mammary carcinomas in female dogs associated with prognostic
factors and survival rates. BMC Cancer 2010;10:256.
13. Carvalho MI, Pires I, Prada J, Queiroga FL. T-lymphocytic
infiltrate in canine mammary tumours: Clinic and prognostic
implications. In Vivo 2011;25:963–969.
14. Saeki K, Endo Y, Uchida K, Nishimura R, Sasaki N, Nakagawa T.
Significance of tumor-infiltrating immune cells in spontaneous canine mammary gland tumor: 140 cases. J Vet Med Sci
2012;74:227–230. Epub 2011 Sep 22.
15. Gama A, Alves A, Schmitt F. Identification of molecular phenotypes in canine mammary carcinomas with clinical implications: Application of the human classification. Virchows Arch
2008;453:123–132.
16. Sassi F, Benazzi C, Castellani G, Sarli G. Molecular-based tumour
subtypes of canine mammary carcinomas assessed by immunohistochemistry. BMC Vet Res 2010;6:5.
17. Matos I, Dufloth R, Alvarenga M, Zeferino LC, Schmitt F. p63,
cytokeratin 5, and P-cadherin: Three molecular markers to distinguish basal phenotype in breast carcinomas. Virchows Arch
2005;447:688–694. Epub 2005 Oct 19.
18. Kim MJ, Ro JY, Ahn SH, Kim HH, Kim SB, Gong G. Clinicopatho­
logic significance of the basal-like subtype of breast cancer:
A comparison with hormone receptor and Her2/neuoverexpressing phenotypes. Hum Pathol 2006;37:1217–1226.
19. Sorlie T, Perou CM, Tibshirani R, et al. Gene expression patterns
of breast carcinomas distinguish tumor subclasses with clinical
implications. Proc Natl Acad Sci U S A 2001;98:0869–10874.
20. Alexe G, Dalgin GS, Scanfeld D, et al. High expression of
lymphocyte-associated genes in node-negative HER21 breast
cancers correlates with lower recurrence rates. Cancer Res 2007;
67:10669–10676.
21. Baxevanis CN, Sotiriadou NN, Gritzapis AD, et al. Immunogenic
HER-2/neu peptides as tumor vaccines. Cancer Immunol
Immunother 2006;55:85–95.
2000;64:0–00
FOR PERSONAL USE ONLY
22.Milano F, Guarriera M, Rygiel AM, Krishnadath KK.
Trastuzumab mediated T-cell response against HER-2/neu
overexpressing esophageal adenocarcinoma depends on intact
antigen processing machinery. PLoS One 2010;5:e12424.
23. Misdorp W, Else RW, Hellmen E, Lipscomb TP. Histological
classification of mammary tumors of the dog and the cat. In:
International Histological Classification of Tumors of Domestic
Animals. Washington DC: Armed Forces Institute of Pathology,
1999:18–25.
24. Elston CW, Ellis IO. Pathological prognostic factors in breast cancer. I. The value of histological grade in breast cancer: Experience
from a large study with long-term follow-up. Histopathology
2002;41:154–161.
25. Karayannopoulou M, Kaldrymidou E, Constantinidis TC,
Dessiris A. Histological grading and prognosis in dogs with
mammary carcinomas: Application of a human grading method.
J Comp Pathol 2005;133:246–252.
26. Kim JH, Im KS, Kim NH, Yhee JY, Nho WG, Sur JH. Expression
of HER-2 and nuclear localization of HER-3 protein in canine
mammary tumors: Histopathological and immunohistochemical
study. Vet J 2011;189:318–322.
27. Reis-Filho JS, Pinheiro C, Lambros MB, et al. EGFR amplification
and lack of activating mutations in metaplastic breast carcinomas. J Pathol 2006;209:445–453.
2000;64:0–00
28. Kim JH, Yu CH, Yhee JY, Im KS, Kim NH, Sur JH. Canine classical seminoma: A specific malignant type with human classifications is highly correlated with tumor angiogenesis. BMC Cancer
2010;10:243.
29. Misdorp W. Tumors of the mammary gland. In: Meuten DJ, ed.
Tumors in Domestic Animals. 4th ed. Ames, Iowa: Iowa State
University Press, 2002:575–606.
30. Coronella-Wood JA, Hersh EM. Naturally occurring B-cell
responses to breast cancer. Cancer Immunol Immunother 2003;
52:715–738.
31. Wong PY, Staren ED, Tereshkova N, Braun DP. Functional analysis of tumor-infiltrating leukocytes in breast cancer patients.
J Surg Res 1998;76:95–103.
32. Chin Y, Janseens J, Vandepitte J, Vandenbrande J, Opdebeek L,
Raus J. Phenotypic analysis of tumor-infiltrating lymphocytes
from human breast cancer. Anticancer Res 1992;12:1463–1466.
33. van’t Veer LJ, Dai H, van de Vijver MJ, et al. Gene expression
profiling predicts clinical outcome of breast cancer. Nature
2002;415:530–536.
The Canadian Journal of Veterinary Research
149
FOR PERSONAL USE ONLY
Article
Clotting factor VIII (FVIII) and thrombin generation in camel plasma:
A comparative study with humans
Abdel Galil M. Abdel Gader, Abdul Karim M. Al Momen, Abdulqader Alhaider, Marjory B. Brooks,
James L. Catalfamo, Ahmed A. Al Haidary, Mansour F. Hussain
Abstract
The objective of this study was to characterize the highly elevated levels of clotting factor VIII (FVIII) in camel plasma. Whole
blood was collected from healthy camels and factor VIII clotting activity (FVIII:C) assays were conducted using both the clotting
and the chromogenic techniques. The anticoagulant citrate phosphate dextrose adenine (CPDA) produced the highest harvest
of FVIII:C, the level of plasma factor VIII, compared to heparin:saline and heparin:CPDA anticoagulants. Camel FVIII can be
concentrated 2 to 3 times in cryoprecipitate. There was a significant loss of camel FVIII when comparing levels of FVIII in camel
plasma after 1 h of incubation at 37°C (533%), 40°C (364%), and 50°C (223%). Thrombin generation of camel plasma is comparable
to that of human plasma. It was concluded that camel plasma contains very elevated levels of FVIII:C, approaching 8 times
the levels in human plasma, and that these elevated levels could not be attributed to excessive thrombin generation. Unlike
human FVIII:C, camel FVIII:C is remarkably heat stable. Taken together, these unique features of camel FVIII could be part of
the physiological adaptation of hemostasis of the Arabian camel in order to survive in the hot desert environment.
Résumé
L’objectif de la présente étude était de caractériser les niveaux très élevés du facteur de coagulation VIII (FVIII) dans le plasma de chameau.
Du sang entier a été prélevé de chameaux en santé et des épreuves d’activité de coagulation du facteur VIII (FVIII:C) ont été effectuées en
utilisant des techniques chromogéniques et de coagulation. L’anticoagulant citrate phosphate dextrose adénine (CPDA) a permis la récolte
la plus élevée de FVIII:C, le niveau plasmatique de facteur VIII, comparativement aux anticoagulants héparine:saline et héparine CPDA. Le
FVIII de chameau peut être concentré 2 à 3 fois dans des cryoprécipités. Il y avait une perte significative de FVIII de chameau lorsque l’on
comparait les niveaux de FVIII dans le plasma de chameau après 1 h d’incubation à 37 °C (533 %), 40 °C (364 %), et 50 °C (223 %). La
génération de thrombine dans le plasma de chameau est comparable à celle dans le plasma humain. Il a été conclu que le plasma de chameau
contient des niveaux très élevés de FVIII:C, atteignant près de 8 fois le niveau dans le plasma humain, et que ces niveaux élevés ne pouvaient
pas être attribué à une génération excessive de thrombine. Comparativement au FVIII:C humain, le FVIII:C de chameau est très stable à la
chaleur. Prises dans leur ensemble, ces caractéristiques uniques du FVIII de chameau pourraient faire partie de l’adaptation physiologique
de l’hémostase du chameau arabe afin de lui permettre de survivre dans l’environnement chaud du désert.
(Traduit par Docteur Serge Messier)
Introduction
The Arabian, or one-humped, camel (Camelus dromedarius) makes
up about 94% of the world’s camel population, at a total of 17.5 million (1). Due to its unique adaptation to drought and heat, its ability to sustain thirst, and to subsist, produce, and reproduce under
conditions untenable for the survival of other species of domestic
mammals, the camel continues to be indispensable in some parts of
the Arabian Peninsula and Africa as a source of milk and meat as
well as a means of transportation.
The camel has many prompt and highly efficient complex mechanisms for maintaining the volume of body fluids and preventing
their loss, especially of blood. In a series of recent studies, we
showed that camel platelet functions (agonist-induced aggregation and PFA100 closure time) (2) and the ultrastructure of camel
platelets are significantly different in many respects from that of
human platelets (3,4). In the most detailed study yet on hemostasis
in the camel (5), we also reported much higher levels of clotting factor VIII activity (FVIII:C) in camel plasma than in humans. Whether
of human or porcine origin, clotting factor VIII (FVIII) is still the
most used clotting factor in replacement therapy. Further studies of
this factor in the camel or in any other animal are of interest as they
may lead to further understanding of the biology of this factor and
to finding other sources with potential therapeutic value.
The Coagulation Research Laboratory, Physiology Department, College of Medicine and King Khalid University Hospital (Gader, Al Momen,
Alhaider) and College of Agriculture and Food Sciences (Al Haidary, Hussain), King Saud University, Riyadh 11461, Saudi Arabia; Comparative
Coagulation Section, Animal Health Diagnostic Center, Cornell University, Ithaca, New York, USA (Brooks, Catalfamo).
Address all correspondence to Professor A.M. Abdel Gader; telephone: (966) 1-467-1042; fax: (966) 1-467-2567; e-mail: [email protected];
[email protected]
Received May 1, 2011. Accepted March 7, 2012.
150
The Canadian Journal of Veterinary Research
2013;77:150–157
FOR PERSONAL USE ONLY
The present study aimed at characterizing the elevated levels of
FVIII activity in camel plasma compared with human plasma. This
includes selecting the most appropriate anticoagulant solution to
ensure the highest recovery of FVIII, investigating the heat stability
of FVIII, and determining whether the elevated activity of FVIII
can be concentrated further in cryoprecipitate and accounted for by
excessive thrombin generation.
Materials and methods
Camels
Samples were obtained from the Najdi breed of Arabian onehumped camels (Camelus dromedarius) at the College of Agriculture
and Food Sciences farm, King Saud University, as well as from
private camel farms in Riyadh, Saudi Arabia. These camels were
disease-free, and under continuous veterinary care. Camels were
provided with water ad libitum. The study was approved by the
College of Medicine Research Centre Ethical Committee. The animals
studied were all females aged 5 to 11 y [mean 6 standard deviation
(SD): 7.4 6 2.4 y]. As on dairy farms, female camels are traditionally reared as a source of milk, while males are butchered for meat.
Blood collection and processing
Blood was collected from a large vein in the leg directly into
250-mL blood bags (Single Whole Blood Bag; Terumu Corporation,
Tokyo, Japan), which contained 35 mL of citrate phosphate dextrose adenine (CPDA-1) anticoagulant. The blood was drawn for
5 to 7 min and collected in sample tubes containing sodium citrate
(0.11 M) by cutting the blood bag tubing close to the needle and
allowing blood to flow freely into the citrate tubes up to a predetermined level, to give a blood:citrate ratio of 9:1. Blood in blood
bags and sample tubes was mixed thoroughly with anticoagulant
before being put in insulated containers (Electrolux, Luton, UK) for
transport.
For laboratory assay purposes, platelet-poor plasma was separated by centrifuging blood samples in a refrigerated (4°C to 8°C)
centrifuge (Jouan SA, Cedex, France), 3000 rpm, for 15 min. Aliquots
of plasma were frozen at 280°C until assayed in batches at a later
date. Assays in frozen plasma aliquots were undertaken within 1 mo
of blood collection.
Laboratory procedures in Riyadh
Bags containing whole blood were centrifuged soon after collection in a refrigerated (4°C to 8°C) centrifuge (Jouan SA) at 4000 rpm/
min for 15 min. The blood bag was then placed on a manual plasma
expresser and plasma was expressed into a second satellite bag that
was sealed off by a di-electric sealer. The plasma bag was stored
flat at 280°C. Plasma was frozen less than 3 h after the phlebotomy.
Anticoagulant solutions used
Camel whole blood was collected in 3 blood collection bags containing 3 different anticoagulants: citrate, phosphate, dextrose, adenine
(CPDA) (Terumu, Tokyo, Japan); heparin only (4 units/mL of blood —
heparin sodium 25 000 IU/mL, Batch # 0482; HIKMA Pharmaceuticals,
Amman, Jordon); and CPDA:heparin (equal volumes).
2000;64:0–00
Heat stability of camel factor VIII
Frozen camel and human plasmas (n = 26) were thawed at 37°C
and then sampled further in 2 aliquots: 1 was incubated for 1 h in a
water bath at 40°C and the other in a water bath at 50°C. Factor VIII
chromogenic assay was undertaken on the 3 samples at 37°C, 40°C,
and 50°C.
Laboratory assays (Riyadh)
Fibrinogen was assayed as functional (clottable) fibrinogen by the
turbidimetric method of Ellis and Stransky (6).
Clotting activity (FVIII:C): The 1-stage assay (7) was used with
the initial 1:10 dilution for camel plasma using human hemophilic
plasma (Immuno-depleted plasma for factor VIII assay; Diagnostica
Stago, Asnières sur Seine, France). The assay was carried out in an
automated coagulometer (STA Compact; Diagnostica Stago). The
necessary 1:10 dilution for the factor VIII assay was undertaken by
the machine, which provides a printout of the final level of activity
of the plasma sample.
Clotting factor VIII chromogenic activity was undertaken in an
automated coagulometer (STA Compact; Diagnostica Stago) using
commercial kits (Coamatic Factor VIII; Chromogenix, Lexington,
Massachusetts, USA) according to the manufacturer’s instructions.
Normal human standard plasma was obtained by pooling fresh
plasma from 20 healthy adults, most of whom were blood donors.
Aliquots were stored at 280°C. Camel standard plasma was pooled
from 10 camels, 5 of each gender.
Studies at the Animal Health Diagnostic Center,
Cornell University, USA
Single units of fresh frozen plasma (FFP) (approximately 150 mL
of FFP/unit) with paired 5-mL aliquots of citrate plasma were collected from 20 camels. An additional 10 camels (5 of each gender)
were sampled to prepare 5-mL aliquots of citrate plasma alone. The
samples remained frozen in transit from Riyadh and were stored at
270°C on arrival. To prepare camel cryoprecipitate, the FFP units
were slowly thawed at 3°C for 24 h. The thawed FFP was then spun
under refrigeration in centrifuge tubes for 10 min at 1400 3 g. Before
assay, the plasma samples and cryoprecipitate pellets were thawed
at 37°C for 15 min and then held on wet ice. The 5-mL aliquots from
10 individual camels were pooled after thawing for use as a samespecies plasma standard.
Assay methods
Functional (clottable) fibrinogen was measured by the Clauss
method using a 100 National Institutes of Health (NIH) U/mL human
thrombin reagent and human fibrinogen standard (Fibrinogen;
Diagnostica Stago, Parsippany, New Jersey, USA) in an automated,
mechanical endpoint coagulation instrument (STA Compact;
Diagnostica Stago).
Factor VIII clotting activity (FVIII:C) was measured in a 1-stage
activated partial thromboplastin time (aPTT) assay using human
factor VIII-deficient substrate plasma (George King Biomedical,
Overland Park, Kansas, USA), a commercial rabbit brain cephalin and ellagic acid aPTT reagent (Actin; Dade Behring, Newark,
Delaware, USA), and a mechanical endpoint detection instrument
The Canadian Journal of Veterinary Research
151
FOR PERSONAL USE ONLY
(ST4; Diagnostica Stago). The assay was performed by incubating 50 mL of the test sample or standard with 50 mL of deficient
plasma and 50 mL of aPTT reagent for 3 min at 37°C, then triggering
coagulation by adding 50 mL of 0.025 M calcium chloride (CaCl2).
A standard curve was derived from serial dilutions (1:5; 1:10; 1:20)
of a commercial calibrator plasma (FACT; George King Biomedical)
containing 1 IU/mL (100%) human FVIII:C. In a preliminary experiment, the pooled camel plasma was assayed in serial dilutions (1:10
through 1:160) to obtain a clotting time comparable to the midpoint
of the human standard curve. For subsequent assays, a 4-point
standard curve was generated from serial dilutions of the pooled
camel plasma (1:20; 1:40; 1:80; 1:160; r2 . 0.96). The test samples
(camel plasma and cryoprecipitate) were assayed at a 1:160 dilution. All samples and standards were assayed in duplicate. The
mean clotting times of the test samples were calculated using loglog transformation, as percentage FVIII:C compared to the human
and camel standards, containing 100% human or camel FVIII,
respectively.
The concentration of von Willebrand factor antigen (vWF:Ag)
in plasma was measured in a double-sandwich enzyme-linked
immuno­sorbent assay (ELISA) configured with polyclonal antihuman von Willebrand factor (vWF) antibodies, as described in a
previous study (8). The vWF:Ag content of individual camel plasma
and cryoprecipitate samples was reported as the percentage of the
human reference plasma (FACT) and the pooled camel plasma.
Thrombin generation (TG) of the human FACT plasma and
the pooled camel plasma was determined using an assay kit
(Technothrombin TGA; Technoclone, Vienna, Austria) and the kit
manufacturer ’s software application (Gen5 Software Protocol;
Technothrombin TGA) on a microplate reader (Biotek Instruments,
Winooski, Vermont, USA). In this assay, the amount of thrombin
generated over time in the test sample was detected by cleavage of a
fluorogenic thrombin substrate (9). In separate experiments, thrombin generation was initiated using 1 of 3 reagents: low concentration
of phospholipid and low tissue factor (2 pM human tissue factor;
Technothrombin TGA RB), low concentration of phospholipid but
high tissue factor (5 pM human tissue factor; Technothrombin TGA
152
The Canadian Journal of Veterinary Research
Figure 2. Factor VIII clotting activity (FVIII:C) in camel plasma (n = 21)
collected in 3 different anticoagulants: CPDA (citrate, phosphate, dextrose, adenine); CPDA:heparin; and saline:heparin. FVIII was assayed by
the chromogenic technique. Results are presented as means and vertical
bars represent standard deviation.
FVIII (%)
Figure 1. Summary of factor VIII clotting activity (FVIII:C) in camel plasma
(n = 29) using human plasma and camel plasma as standards. Results
are presented as means and vertical bars represent standard deviation.
Figure 3. The effect of heat on levels of factor VIII clotting activity
(FVIII:C) in camel and human plasma (n = 10) after 1 h of incubation at
37°C, 40°C, and 50°C. Results are presented as means and vertical bars
represent standard deviation. The level of FVIII:C was measured by the
chromogenic technique and the results are expressed as % of human
pooled plasma, representing 100% activity.
RC-L), or high concentration of phospholipid with high tissue factor
(Technothrombin TGA RC-H).
The data output included lag phase, peak thrombin, time to peak
thrombin, area under curve (AUC), and qualitative thrombin generation curves (thrombogram). These parameters were measured for the
human FACT plasma, the human FVIII-deficient plasma, the pooled
camel plasma, and 1:1 mixtures of human FVIII-deficient plasma
with either human FACT plasma or pooled camel plasma.
2000;64:0–00
FOR PERSONAL USE ONLY
Table I. Summary of the assays for fibrinogen, factor VIII clotting activity (FVIII:C), and
von Willebrand factor antigen (vWF:Ag) carried out at Cornell University (USA) in 10 camel
plasma samples
Human standard
Camel standard
Sample Serial
Fibrinogen
FVIII:C
vWF:Ag
FVIII:C
vWF:Ag
number
numbermg/dL
%
%
%
%
1
126
167
81
15
13
51
2
127
169
309
12
73
57
3
128
227
484
14
131
77
4
129
216
215
13
46
68
5
130
180
289.5
12
67
95
6
131
243
549
12
154
93
7
132
306
421
18
109
138
8
133
264
452
23
120
177
9
134
216
299
17
70
101
10
140 259
26214
59 96
Mean
224.7
336.215.0
84.2 95.3
SD
45.0 140.46.8 43.1 36.1
239
370
14
92
110
Camel pool
Human control
312
93
95
4
660
Note: FVIII:C was measured against both the human and camel pooled standards. The human
calibrator contained 1 IU/mL (100%) of FVIII:C. Camel plasmas were assayed at an 8-fold higher
dilution than the human calibrator and results are presented for this dilution with no correction
factor.
SD — standard deviation.
Statistical methods
The Statistical Package for Social Sciences (SPSS), version 11, was
used for data analysis. The data were expressed as mean 6 SD. The
1-way analysis of variance (ANOVA) was used to compare all parameters for different groups of data and the multiple comparisons were
used to find the significance between every 2 groups. Where appropriate, the correlation coefficient was worked out to find the relation
between the different parameters for normal and abnormal groups.
Results
Riyadh assays
Factor VIII clotting activity (FVIII:C) in camel plasma
Using the 1-stage clotting assay and human standard, the FVIII:C
was found to be almost 8 times higher using the camel plasma as a
standard (Figure 1).
Effect of different anticoagulant solutions on factor VIII clotting
activity (FVIII:C)
Citrate phosphate dextrose adenine (CPDA) gave the highest yield
of camel FVIII:C compared to CPDA:heparin and saline:heparin
anticoagulants (Figure 2).
Heat stability of camel factor VIII
There was a significant drop in FVIII activity after 1 h of incubation of camel plasma compared to activity at 37°C (mean 6 SD:
532.2 6 186.9%), 40°C (364.4 6 111.3%; a drop of 33%), and 50°C
(223.3 6 66.1%; a drop of 58%) (Figure 3). It must be noted, however,
2000;64:0–00
that even after 1 h of incubation at 50°C, the FVIII activity of the
camel plasma remained quite high (223.3 6 66.1%). The differences
in the mean values are statistically significant (P # 0.001; 1-way
ANOVA).
The respective levels in human FVIII activity were 108.3 6 29.0%,
69.6 6 14.9%; (a drop of 28%), and 38.4 6 10.3% (a drop of 58%). The
differences in the mean values are statistically significant (P # 0.001).
Cornell assays
Plasma fibrinogen, FVIII, and vWF:Ag
Camel plasma FVIII:C and vWF:Ag were assayed against both the
pooled camel and human control plasmas, which represent 100%
activity (Table I).
The fibrinogen content of camel plasma was found to be similar to that of humans, with all camels having values within 150
to 400 mg/dL, which is the expected range for healthy subjects.
The mean fibrinogen for the resultant pooled camel plasma was
239 mg/dL (Table I). There were differences in species, however,
in results for FVIII:C and vWF:Ag analyses. Similar to the findings in the Riyadh assay system, clotting times in camel plasma in
the 1-stage FVIII assay were much faster than in human plasma.
Although the camel plasmas were assayed at an 8-fold higher
dilution to “harmonize” the clotting times so that they fell on the
human standard curve, the mean FVIII:C for these dilutions was
approximately 300% that of the human calibrator (Table I). While the
calculated values of FVIII:C derived from the same-species standard
curve were lower, the relative FVIII:C for the individual camels was
consistent between the human and camel assay standards (r2 = 0.99).
The apparent vWF concentration of camel plasma was approximately
The Canadian Journal of Veterinary Research
153
FOR PERSONAL USE ONLY
Table II. Summary of results of assays of camel plasma fibrinogen, factor VIII clotting
activity (FVIII:C), and von Willebrand factor antigen (vWF:Ag) in both camel plasma and
cryoprecipitate (cryoppt) undertaken in 10 camels
Plasma Cryoppt Plasma Cryoppt PlasmaCryoppt
Serial fibrinogenfibrinogenFVIII:CFVIII:CvWF:Ag
vWF:Ag
number
(mg/dL)
(mg/dL)
(%)(%)(%)(%)
135 208
317 103 296 108205
142 191
409 66 315 76101
143 310
562 158 440 88147
144 266
424 83 341 84245
145 322
677
64.5387
89 160
150 268 1124 114 297 105541
155 214
316 133 190 106152
156 279
568 199 225 84200
158 541 1424 75 175 80236
160 326
750 245 267 162262
Mean 292.5
Median273.5
SD
99.5
SD — standard deviation.
657.1 124.05293.3
565
108.5 296.5
362.1 60.6 83.7
15% to 20% of human plasma, with little discriminatory value among
individuals using the human standard (Table I). The affinity and
specificity of the anti-vWF antibodies used in this assay to detect
camel vWF are unknown. It is possible that variable antibody reactivity, rather than relative vWF protein deficiency, caused the observed
low concentration of vWF:Ag in camel plasma.
Camel cryoprecipitate
Camel FFP was thawed for 32 h, which is longer than the usual
24 h, in order to enhance the harvest of cryoprecipitate. The cryoprecipitate was recovered from 90 mL of starting plasma after 10 min of
centrifugation at 1400 3 g. The results of the assays undertaken in
10 camels (3 females and 7 males) are shown in Table II.
The mean volume of recovered cryoprecipitate per 90 mL of camel
FFP was 2.6 mL (SD: 0.65 mL; 2 to 3.5 mL range). In the experience
of 2 of the authors (MB and JC), this volume was approximately half
that of the expected volume obtained from canine plasma using this
slow-thaw technique. Nevertheless, the harvested cryoprecipitate
produced an approximately 2.5-fold mean increase in hemostatic
proteins [fibrinogen, FVIII:C, and vWF:Ag content compared with
the starting camel plasma (Table II)]. Similarly, combined results
from all 10 camels (Table II) showed that fibrinogen had been concentrated in the cryoprecipitate fraction to more than twice (approximately 2.5-fold) its concentration in plasma (P , 0.001).
Thrombin generation (TG)
Pronounced inter-species variability was also found in TG experiments, with camel plasma consistently demonstrating lower peak
thrombin and overall endogenous thrombin potential (AUC) than
human plasma (Table III). The reagent composition influenced
thrombin generation in the camel plasma more than in human
plasma. In human plasma, an increase in tissue factor content from
2 pM to 5 pM with high phospholipid produced a less than 10%
increment in AUC. In contrast, increasing the tissue factor and particularly the phospholipid content in the trigger reagent resulted
154
The Canadian Journal of Veterinary Research
98.2 224.9
88.5 202.5
25.1121.9
in a pronounced, almost 6-fold, increase in camel AUC (Table III).
While camel factor VIII supported thrombin generation when
combined with human factor VIII-deficient plasma, thrombogram
values approached that of the human plasma factor VIII-deficient
mixture only in the high tissue factor and high phospholipid reagent
(Reagent RC-H).
Discussion
An elevated level of factor VIII clotting activity (FVIII:C) in camel
plasma (. 3 to 5 times) compared to that of humans was a consistent
finding in this study. The activity is best demonstrated when whole
blood is collected in citrate anticoagulants rather than in heparin and
can be further concentrated (2 to 3 times) in cryoprecipitate. We also
found that camel factor VIII could support thrombin generation in
human FVIII-deficient plasma.
The high FVIII:C in camel plasma was demonstrable in both
1-stage and 2-stage assays in spite of the marked differences in the
configuration and endpoints of these assays. In the 1-stage assay,
coagulation is initiated through contact activation and generation
of factor XIIa with sequential activation of the intrinsic pathway
factors. Thrombin is generated through the subsequent assembly of
tenase and prothrombinase complexes, and then acts on fibrinogen to
form the fibrin clot endpoint. The human substrate-deficient plasma
in the assay mixture contains sufficient fibrinogen and coagulation
factors to form a fibrin clot, providing that the test plasma can supply FVIII:C to allow assembly of a functional tenase complex. In the
absence of same-species factor VIII-deficient plasma, measurement
of animal FVIII:C in 1-stage assays requires a heterologous system
in which species differences in contact activation, protease activity,
and endogenous inhibitors may affect clotting time independently
of the FVIII:C in the assay mixture.
On the other hand, 2-stage assays do not require substrate-­
deficient plasmas and their configuration reduces the reagent/
2000;64:0–00
FOR PERSONAL USE ONLY
Table III. Summary of the lag time, peak thrombin, time to peak, and AUC (area under curve)
for thrombin generation (TG) test on both camel and human plasma
TG parameters
Peak
Time to
TG
Lag time
thrombin
peak
Sample
reagent (min)
(nm) (min)AUC
Human plasmaaRBb
13.6 208.3 21.63890
Camel plasma
RBb
20.6
11.9
26.1 184
FVIII-deficient plasma
RBb
. 60
0
NA
NA
FVIII-deficient 1 human plasma
RBb
24.6
70.3 36.62416
FVIII-deficient 1 camel plasma
RBb
24.1
13.9
34.1 415
Human plasma
RC-Lc
14.6 233.3 22.14155
Camel plasma
RC-Lc
21.1
16.7
27.1 314
FVIII-deficient plasma
RC-Lc
. 60
0
NA
NA
FVIII-deficient 1 human plasma
RC-Lc
20.1
97.8 32.13035
FVIII-deficient 1 camel plasma
RC-Lc
31.1
9.2
40.6 218
Human plasma
RC-He 11.1 377.4 16.64251
Camel plasma
RC-Hd 11.6
82.7 18.11095
FVIII-deficient plasma
RC-Hf
. 60
0
NA
NA
FVIII-deficient 1 human plasma
RC-He 16.1 225.6 25.13587
FVIII-deficient 1 camel plasma
RC-He 12.6 169.8 19.12670
aFACT human reference plasma (George King Biomedical).
bRB = Triggering solution with low phospholipid and low tissue factor.
cRC-L = Triggering solution with low phospholipid.
dRC-L = Triggering solution with low phospholipid and high tissue factor.
eRC-H = Triggering solution with high phospholipid.
f RC-H = Triggering solution with high phospholipid and high tissue factor.
NA = Not available.
endpoint variability inherent in clotting time tests. In the first stage
of the assay, an intrinsic tenase complex is assembled and in the
second stage, the amount of factor Xa formed is determined by the
cleavage of a factor Xa substrate. The assay used in this study contains a bovine factor reagent containing factor IX, factor X, thrombin,
and phospholipid and the test sample provides FVIII:C. The results
obtained in this assay are comparable across species, since all the
components of the tenase complex, exclusive of factor VIII, are
present in the assay mixture and the endpoint is cleavage of a small
peptide substrate.
Our finding that camel FVIII consistently demonstrated relatively
high cofactor activity compared to human FVIII in both 1-stage and
2-stage assays indicates an inherent difference in FVIII:C between
species that cannot be attributed solely to assay conditions.
Previous studies have found that the use of the primary anticoagulant heparin for collecting human blood doubles FVIII recovery
in FFP and cryoprecipitate compared to conventional ACD or CPD
anticoagulants (10,11). In these 2 studies (10,11), the presence of
heparin in plasma was controlled for by either neutralizing heparin
with protamine or adding equivalent amounts of heparin to the
plasma standard, as the researchers used the 1-stage FVIII:C clotting assay, which is not suited for heparinized plasma. In this study,
we used the chromogenic method according to the manufacturer’s
instructions. It was shown that the chromogenic method was more
2000;64:0–00
suitable for measuring elevated levels of FVIII, demonstrating the
best inter-assay variation compared to the 1-stage clotting and
antigenic assays, in addition to being unaffected by the presence of
heparin (12). All assays were also run simultaneously on the same
day on all samples collected in different anticoagulant solutions. It
is not clear why blood collected in CPDA-1 anticoagulant gave the
highest yield of camel FVIII (Figure 2). We can only speculate on
the basis of our early finding that camel platelets were remarkably
activated when camel blood was collected in heparin (2). It is possible that platelet activation would be accompanied by secondary
activation of coagulation and some consumption of FVIII. Similar
platelet activation could not be seen when human whole blood was
collected in citrate anticoagulant (2).
As for the heat stability of camel FVIII (Figure 3), we noted with
much interest the significant drop in levels of camel FVIII after 1 h of
incubation at 37°C, 40°C, and 50°C. It must also be noted, however,
that even after 1 h of incubation at 50°C, the levels of camel FVIII
remained quite high (220.4%). Even after prolonged (1 h) incubation
at 50°C, camel FVIII contained approximately twice the FVIII:C of
our pooled human plasma standard when measured in the chromogenic FVIII:C assay (Figure 3). This heat stability was not absolute,
as raising the temperature incrementally from 40°C to 50°C resulted
in a progressive loss in activity. Nevertheless, further investigation
is warranted to define the property of camel FVIII that allows it to
The Canadian Journal of Veterinary Research
155
FOR PERSONAL USE ONLY
participate in the assembly of a highly active tenase complex after
remaining at a temperature well above the physiologic body temperature of human beings. Camels live and survive in deserts where the
ambient temperatures during the summer could be well above 50°C.
Camels maintain their body temperature at 37°C when hydrated and
this increases by 6°C to 7°C when they become dehydrated (13,14).
In a previous study, we found that camel platelets showed minimal
changes in ultrastructure when heated to 50°C, while at the same
temperature, human platelets were destroyed, the cytoplasm was
dissolved, and most granules were lost (4).
To explain the very elevated levels of FVIII:C in camel plasma, we
probed the possibility that excessive thrombin generation (TG) could
be a factor. While currently available thrombin generation assays are
sensitive to FVIII activity, many other hemostatic proteins and their
inhibitors influence TG. In the 3 TG assay configurations we followed, camel plasma generated lower amounts of thrombin than the
human control plasma. The reaction conditions optimized for human
plasma, however, may not support maximal TG in other species. The
endogenous thrombin potential of human plasma (summarized as
AUC) (Table III) increased only slightly in reaction mixtures containing increasing amounts of tissue factor and phospholipid. In contrast,
a high content of tissue factor and phospholipid reagent produced an
approximately 10-fold increase in AUC in camel plasma compared
to the low tissue factor/phospholipid reagent. High phospholipids
in the reaction mixture particularly enhanced the rate of TG in camel
plasma as evidenced by a shortening of the lag time and time to peak
thrombin. The enhancement of TG we observed in a mixture of camel
plasma and human factor VIII-deficient plasma may reflect the role
of human factor VIIa in activating tissue factor, in addition to phospholipid supplied by residual human cell-derived microparticles
and perhaps dilution of endogenous coagulation inhibitors in camel
plasma. The TG assay system must be further modified in order to
investigate these species differences.
Further analyses of camel FVIII cofactor activity are warranted to
investigate these species differences. Regions within the C2 domain
of human FVIII are involved in FVIII binding to phosphatidylserine
(15), and therefore sequence analyses of the homologous region in
the camel FVIII gene may complement functional analyses to further
clarify how phospholipid interaction with camel FVIII influences its
cofactor activity. Ultimately, identifying the properties of camel FVIII
that produce a “superior” cofactor activity will provide a greater
understanding of mechanisms underlying assembly and/or function
of the intrinsic tenase complex.
The results of the present study raise the question of whether
camel FVIII could have therapeutic use in a manner similar to porcine FVIII that is widely used to manage bleeding in patients with
hemophilia who develop inhibitors to human FVIII. Could camel
FVIII be a potential alternative treatment for hemophiliacs? Certainly,
camel clotting factor VIII (FVIII:C) is of interest in the context of
hemophilia therapy due to its remarkably elevated clotting levels,
its heat stability, and the recently emerging knowledge of the homology between camel antibodies and human heavy-chain variable
domains (VHHs) and their low immunogenic potential (16,17). It is
tempting to suggest an approach similar to that used in developing
the currently available recombinant human and porcine factor VIII
(18). This development is the result of early efforts in the prepara-
156
The Canadian Journal of Veterinary Research
tion of FVIII concentrate from human and porcine plasma to the
deployment of gene technology to produce recombinant FVIII. Basic
preliminary work needs to be done, however, in order to characterize
the molecular biology of camel FVIII before any steps are taken to
develop a therapeutic product made of camel FVIII.
It was concluded that the remarkably elevated levels of FVIII
in camel plasma found in this study support the idea of a more
active state of the coagulation system in the camel; elevated factor VIII levels are a known index of hypercoagulability (19) and
present a risk of arterial and venous thrombosis (20). In addition
to the heat stability of FVIII, this may be yet another physiological
adaptation that protects the camel from excessive loss of blood or
fluids in hot, arid desert conditions. Given the unique immune system of the camel, further studies may be carried out to investigate
the possibility of using camel FVIII as a starting material for treating
hemophilia.
Acknowledgments
The authors thank Mohamed Hamid and Luman Gasmelsid for
technical assistance, Abdul Rahman Garelnabi and Ali Al-Sheehi
for camel blood collection, and Farah Chatila for secretarial help.
This work is supported by a grant from the Deanship of Research
(National Programs; No. AR-18), College of Medicine Research
Centre King Saud University in Riyadh, Saudi Arabia.
References
1. Youssef OK, Babiker SA. The desert camel as meat animal. Meat
Sci 1989;26:245–254.
2. Gader AMA, Ghumlas AK, Hussain MF, Al-Haidary AI. Platelet
aggregation and platelet function analyser 100 (PFA-100) closure
time in camels — A comparative study with humans. Comp Clin
Pathol 2006;15:31–37.
3. Gader AMA, Ghumlas AK, Hussain MF, Al-Haidary A, White JG.
Ultrastructure of camel blood platelets: A comparative study
with human, bovine, and equine cells. Platelets 2008;19:51–58.
4. Al-Ghumlas AK, Gader AMA, Hussain MF, Al-Haidary A,
White JG. Effects of heat on camel platelet structure and function — A comparative study with humans. Platelets 2008;19:
163–171.
5. Hussein MF, Al-Momen AK, Gader AMA. Haemostatic parameters in the camel (Camelus dromedarius) comparison with humans.
Comp Haematol Int 1992;2:92–96.
6. Ellis BC, Stransky AA. A quick and accurate method for the
determination of fibrinogen in plasma. J Lab Clin Med 1961;58:
477–488.
7. Sirridge MA, Shannon R. Laboratory Evaluation of Hemostasis
and Thrombosis. 3rd ed. Philadelphia, Pennsylvania: Lea &
Febiger, 1983:58–160.
8. Benson RE, Catalfamo JL, Dodds WJ. A multispecies enzymelinked immunosorbent assay for von Willebrand’s factor. J Lab
Clin Med 1992;119:420–427.
9. Hemker HC, Al Dieri R, DeSmedt E, Béguin S. Thrombin generation, a function test of the haemostatic-thrombotic system.
Thromb Haemost 2006;96:553–561.
2000;64:0–00
FOR PERSONAL USE ONLY
10. Rock GA, Cruickshank WH, Tackaberry ES, Palmer DS.
Improved yields of factor VIII from heparinized plasma. Vox
Sang 1979;36:294–300.
11. Palmer DS, Rosborough D, Perkins H, Bolton T, Rock G,
Ganz PR. Characterization of factors affecting the stability of
frozen heparinized plasma. Vox Sang 1993;65:258–270.
12. Chandler WL, Ferrel C, Lee J, Tun T, Kha H. Comparison of three
methods for measuring factor VIII levels in plasma. Am J Clin
Pathol 2003;120:34–39.
13. Al-Faraj A, Al-Haidary A. Measurement and stimulation of
camel core body temperature response to ambient temperature.
Int J Agri Biol 2006;4:531–534.
14. Al-Haidary A. Effect of dehydration on core body temperature
of young Arabian camels (Camelus dromedarius). J King Saud
Univ Agri Sci 2005;18:1–7.
15. Foster PA, Fulcher CA, Houghten RA, Zimmerman TS. Synthetic
factor VIII peptides with amino acid sequences contained within
2000;64:0–00
the C2 domain of factor VIII inhibit factor VIII binding to phosphatidylserine. Blood 1990;75:1999–2004.
16. Harmsen MM, De Haard HJ. Properties, production, and applications of camelid single-domain antibody fragments. Appl
Microbiol Biotechnol 2007;77:13–22.
17. Muyldermans S, Baral TN, Retamozzo VC, et al. Camelid
immunoglobulins and nanobody technology. Vet Immunol
Immunopathol 2009;128:178–183.
18. Gangadharan B, Parker ET, Ide LM, Spencer HT, Doering CB.
High-level expression of porcine factor VIII from genetically
modified bone marrow-derived stem cells. Blood 2006;107:
3859–3864.
19. Bobrow RS. Excess factor VIII: A common cause of hypercoagulability. J Am Board Fam Pract 2005;18:147–149.
20. Kamphuisen PW, Eikenboom CJ, Bertina RM. Elevated factor VIII levels and the risk of thrombosis arteriosclerosis.
Thromb Vasc Biol 2001;21:731–738.
The Canadian Journal of Veterinary Research
157
FOR PERSONAL USE ONLY
Short Communication
Communication brève
Differences in virulence gene expression between atypical
enteropathogenic Escherichia coli strains isolated from diarrheic
and healthy ruminants
Pilar Horcajo, Gustavo Domínguez-Bernal, Javier Carrión, Ricardo De La Fuente,
José A. Ruiz-Santa-Quiteria, José A. Orden
Abstract
Differences in the pathogenicity of atypical enteropathogenic Escherichia coli (EPEC) strains may be due, at least partially, to
different expression patterns of some virulence genes. To investigate this hypothesis, the virulence gene expression patterns
of 6 atypical EPEC strains isolated from healthy and diarrheic ruminants were compared using quantitative real-time reverse
transcription polymerase chain reaction after growing the bacteria in culture medium alone or after binding it to HeLa epithelial
cells. Some virulence genes in strains from diarrheic animals were upregulated relative to their expression in strains from healthy
animals. When bacteria were cultured in the presence of HeLa cells, the ehxA and efa1/lifA genes, previously associated with the
production of diarrhea, were expressed at higher levels in strains from diarrheic animals than in strains from healthy animals.
Thus, the expression levels of some virulence genes may help determine which atypical EPEC strains cause diarrhea in ruminants.
Résumé
Des différences dans la pathogénicité de souches atypiques d’Escherichia coli entéropathogènes (EPEC) peuvent être dues, au moins en partie,
à différents patrons d’excrétion de quelques-uns des gènes de virulence. Pour étudier cette hypothèse, les patrons d’expression des gènes de
virulence de six souches atypiques d’EPEC isolées de ruminants en santé et avec diarrhée ont été comparés par une épreuve quantitative en
temps réel de réaction d’amplification en chaîne par la polymérase par transcription réverse après avoir fait croître la bactérie dans un milieu
de culture seul ou après l’avoir liée à des cellules épithéliales HeLa. Quelques gènes de virulence dans des souches provenant d’animaux
avec diarrhée étaient régulés à la hausse relativement à leur expression dans les souches provenant d’animaux en santé. Lorsque les bactéries
étaient cultivées en présence de cellules HeLa, les gènes ehxA et efa1/lifA, précédemment associés avec la production de diarrhée, étaient
exprimés à des niveaux plus élevés dans les souches provenant d’animaux diarrhéiques que dans les souches provenant d’animaux en santé.
Ainsi les niveaux d’expression de certains gènes de virulence pourraient aider à déterminer quelles souches atypiques d’EPEC causent de
la diarrhée chez les ruminants.
(Traduit par Docteur Serge Messier)
Atypical enteropathogenic Escherichia coli (EPEC) are a cause of
diarrhea in ruminants and humans, although these bacteria can also be
isolated from healthy ruminants and humans (1,2). These bacteria cause
a characteristic attaching and effacing (AE) lesion in the gut mucosa
because of the intimate bacterial adhesion to the enterocytes and
effacement of the brush border microvilli (2). Formation of AE lesions
is governed by the locus of enterocyte effacement (LEE). This locus
contains the eae gene, which encodes an outer membrane protein called
intimin, necessary for intimate attachment to epithelial cells (2). The
LEE also encodes a type III secretion system; EPEC-secreted proteins
(Esp), such as EspA, which is essential for the delivery of proteins
into the host cell; and LEE-encoded regulator (Ler), which positively
regulates virulence factors (3,4). Additional non-LEE-encoded virulence
factors have been described, such as Efa1/LifA, which is encoded by
the pathogenicity island PAI OI-122, and enterohemolysin, which is
encoded by large plasmids, such as pO157 (5,6).
Molecular characterization of atypical EPEC strains isolated from
humans and ruminants has revealed a tremendous diversity of
virulence genes among different strains (1,6,7). Therefore, it is possible that different atypical EPEC strains have different pathogenic
potential and that only some of them can cause disease in humans
and animals. It seems likely that only the atypical EPEC strains
possessing certain virulence genes, such as efa1/lifA and ehxA, can
cause disease (1,5,6). However, it is also possible that differences
in pathogenicity among strains may be due, at least partially, to
different expression patterns of some virulence genes. In support
of this hypothesis, a previous study has found that expression of
virulence genes differs among enterohemorrhagic E. coli O157:H7
strains depending on whether their genotype is predominant among
human clinical cases or among bovines (8). Despite this evidence
suggesting a link between expression profiles of virulence genes
and pathogenicity, the authors are unaware of studies that compare
Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad Complutense, 28040 Madrid, Spain.
Address all correspondence to Dr. José A. Orden; telephone: 1 34 91 394 3704; fax: 1 34 91 394 3795; e-mail: [email protected]
Received May 16, 2012. Accepted June 7, 2012.
158
The Canadian Journal of Veterinary Research
2013;77:158–160
FOR PERSONAL USE ONLY
Virulence gene
Virulence gene
Figure 1. Expression of virulence genes in strains of atypical enteropathogenic Escherichia coli isolated from diarrheic ruminants relative to their
expression in strains isolated from healthy ruminants. A — Strains grown
in Dulbecco’s modified Eagle medium. B — Strains grown in contact with
HeLa cells. NM — nonmotile.
levels of virulence gene expression among atypical EPEC strains
isolated from healthy and diarrheic ruminants.
The aim of this study was to establish whether differences in virulence gene expression can be detected between atypical EPEC strains
that share the same serotype and virulence gene profile, but differ
in whether they were isolated from healthy or diarrheic ruminants.
Six strains were tested in this study in pairs, with one strain coming from a diarrheic ruminant and the paired strain coming from
a normal ruminant. The strain pairs were as follows: O153:HNM
strains (NM indicates non-motile) isolated from a diarrheic lamb and
a healthy sheep, O26:HNM strains isolated from a diarrheic calf and
a healthy cow, and O26:H11 strains isolated from a diarrheic lamb
and a healthy goat. The genes analyzed were eae, espA, ler, efa1/lifA,
and ehxA, which encode enterohemolysin. The strains used in this
study have previously been characterized (1) and possess all 5 genes
analyzed, except for the O26:HNM strains, which lack ehxA.
Virulence gene expression in enteropathogenic bacteria is regulated by environmental conditions (9), so expression was analyzed
in the present study under 2 sets of conditions: after culturing the
bacteria in Dulbecco’s modified Eagle medium (DMEM; Lonza,
Verviers, Belgium) and after co-culturing them in the same medium
together with HeLa cells. Dulbecco’s modified Eagle medium was
chosen because it provides a controlled environment with minimal
variation in growth conditions, and it has also been shown to induce
2000;64:0–00
expression of LEE genes (8,10). The HeLa epithelial cells were used
because growth in the presence of epithelial cells may better simulate the gastrointestinal tract environment than growth in DMEM
(8). In the first set of conditions, strains were grown to exponential
phase in DMEM, the bacteria were sedimented by centrifugation
(5000 3 g for 5 min) and the pellet was stored in RNA stabilization
solution (RNA later; Invitrogen, Prat de Llobregat, Barcelona, Spain)
for subsequent RNA purification. In parallel, under the second set
of conditions, HeLa cells were infected with “preactivated” bacteria,
which had been grown to early- or mid-log phase at 37°C in DMEM
(9), at a multiplicity of infection of 100:1. After 5 h of incubation, the
HeLa cells were washed vigorously to remove nonadhering bacteria,
and cells with adhered bacteria were collected in RNA stabilization
solution until RNA isolation. Culturing of the atypical EPEC strains
alone in DMEM or in the presence of HeLa cells was carried out at
37°C in an atmosphere of 5% CO2.
Total bacterial RNA was extracted using a commercial RNA
isolation kit (High Pure RNA Isolation kit; Roche Applied Science,
Sant Cugat del Vallés, Barcelona, Spain) and cDNA was synthesized using a commercial kit (qScript cDNA SuperMix kit; Quanta
Biosciences, Gaithersburg, Maryland, USA) according to the manufacturer’s instructions. Quantitative real-time reverse transcription
polymerase chain reaction (qRT-PCR) was done using a RT-PCR
thermocycler (7300 Real-Time PCR System; Applied Biosystems, Tres
Cantos, Madrid, Spain) and a commercial dye (FastStart Universal
SYBR Green Master Mix; Roche Applied Science). Samples were
tested in duplicate. Previously published primers were used to
amplify the eae, ler, and ehxA genes (11–13). In addition, primers were designed in the present study to amplify the espA gene
(espAq-F: 59-GATGCCTCATTCATATCAGC-39 and espAq-R:
59-TCGGTGTTTTTCAGGCT GC-39) and efa1/lifA gene (efaF-RT:
59-TGGTAGTCAGGTATACATCCGTATTTC-39 and efaR-RT:
59-GCTGAAAACCGGCACAAT-39). Data were analyzed using Gene
Expression’s CT Difference method and individual PCR efficiencies
were determined using LinRegPCR, as previously described (14). The
16S rRNA housekeeping gene was used as the internal control (15).
Genes whose expression in strains from diarrheic animals relative to
their expression in strains from healthy animals that changed 0.5- to
1.5-fold, were classified as unchanged.
When cultured in DMEM, there was no difference in gene expression
except for eae, espA, and ler in the pair of O26:H11 strains (Figure 1A).
These 3 genes were expressed at levels 3- to 6-fold higher in bacteria
isolated from a diarrheic lamb than from a healthy goat.
When virulence gene expression was compared between strains
from diarrheic and healthy hosts after being cultured in contact with
HeLa cells, the eae and espA genes were expressed at similar levels
between strains, whereas ler, ehxA, and efa1/lifA were expressed at
levels 2- to 7-fold higher in O153:HNM and O26:H11 strains isolated
from diarrheic animals (Figure 1B). The presence of the ehxA and
efa1/lifA genes has been previously associated with diarrhea caused
by atypical EPEC in children and neonatal ruminants (1,5,6). In
addition, the results of this study suggest that overexpression of
these genes may also determine whether atypical EPEC strains can
cause diarrhea in neonatal ruminants. Our results on the expression
of the eae and espA genes in the pair of O26:H11 strains grown in
contact with epithelial cells are not in agreement with those results
The Canadian Journal of Veterinary Research
159
FOR PERSONAL USE ONLY
obtained using the same strains grown in DMEM or with the results
of Vanaja et al (8), who found an association between overexpression of LEE genes in E. coli O157:H7 strains grown in DMEM and
virulence. It is possible that these differences may be due to the
influence of environmental conditions on bacterial gene expression.
Thus explaining how Jandu et al (16) were able to find differences in
gene expression when E. coli O157:H7 strains were cultured in the
presence and absence of epithelial cells.
In summary, the results of this study show that some virulence
genes are upregulated in strains isolated from diarrheic animals
relative to their expression in strains isolated from healthy animals.
Thus, the expression levels of some virulence genes may help
determine which atypical EPEC strains cause diarrhea in ruminants.
Since this is a preliminary study involving a small number of strains,
further studies are required to confirm the role of virulence gene
expression in the production of diarrhea by atypical EPEC strains
in neonatal ruminants.
Acknowledgment
This study was supported by a grant from Banco SantanderUniversidad Complutense (INBAVET 920338).
References
1. Horcajo P, Domínguez-Bernal G, de la Fuente R, et al. Compari­
son of ruminant and human attaching and effacing Escherichia
coli (AEEC) strains. Vet Microbiol 2012;155:341–348.
2. Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol
Rev 1998;11:142–201.
3. Elliott SJ, Sperandio V, Girón JA, et al. The locus of enterocyte
effacement (LEE)-encoded regulator controls expression of both
LEE- and non-LEE-encoded virulence factors in enteropathogenic and enterohemorrhagic Escherichia coli. Infect Immun
2000;68:6115–6126.
4. Garmendia J, Frankel G, Crepin VF. Enteropathogenic and
enterohemorrhagic E. coli infections: Translocation, translocation,
translocation. Infect Immun 2005;73:2573–2585.
5. Afset JE, Bruant G, Brousseau R, et al. Identification of virulence
genes linked with diarrhea due to atypical enteropathogenic
Escherichia coli by DNA microarray analysis and PCR. J Clin
Microbiol 2006;44:3703–3711.
160
The Canadian Journal of Veterinary Research
6. Scaletsky ICA, Aranda KRS, Souza TB, Silva NP, Morais MB.
Evidence of pathogenic subgroups among atypical enteropathogenic Escherichia coli strains. J Clin Microbiol 2009;47:3756–3759.
7. Beutin L, Kaulfuss S, Herold S, Oswald E, Schmidt H. Genetic
analysis of enteropathogenic and enterohemorrhagic Escherichia
coli serogroup O103 strains by molecular typing of virulence and
housekeeping genes and pulsed-field gel electrophoresis. J Clin
Microbiol 2005;43:1552–1563.
8. Vanaja SK, Springman AC, Besser TE, Whittam TS, Manning
SD. Differential expression of virulence and stress fitness genes
between Escherichia coli O157:H7 strains with clinical or bovinebiased genotypes. Appl Environ Microbiol 2010;76:60–68.
9.Rosenshine I, Ruschkowski S, Finlay BB. Expression of
attaching/­effacing activity by enteropathogenic Escherichia coli
depends on growth phase, temperature, and protein synthesis upon contact with epithelial cells. Infect Immun 1996;64:
966–973.
10. Abe H, Tatsuno I, Tobe T, Okutani A, Sasakawa C. Bicarbonate
ion stimulates the expression of locus of enterocyte effacementencoded genes in enterohemorrhagic Escherichia coli O157:H7.
Infect Immun 2002;70:3500–3509.
11. Chassagne L, Pradel N, Robin F, et al. Detection of stx1, stx2,
and eae genes of enterohemorrhagic Escherichia coli using SYBR
Green in a real-time polymerase chain reaction. Diagn Microbiol
Infect Dis 2009;64:98–101.
12. Poirier K, Fauche SP, Béland M, et al. Escherichia coli O157:H7
survives within human macrophages: Global gene expression
profile and involvement of the Shiga toxins. Infect Immun
2008;76:4814–4822.
13. Rashid RA, Tabata TA, Oatley MJ, et al. Expression of putative
virulence factors of Escherichia coli O157:H7 differs in bovine and
human infections. Infect Immun 2006;74:4142–4148.
14.Schefe JH, Lehmann KE, Buschmann IR, Unger T,
Funke-Kaiser H. Quantitative real-time RT-PCR data analysis:
Current concepts and the novel “gene expression’s CT difference” formula. J Mol Med 2006;84:901–910.
15. Spano G, Beneduce L, Terzi V, Stanca AM, Massa S. Real-time
PCR for the detection of Escherichia coli O157:H7 in dairy and
cattle wastewater. Lett Appl Microbiol 2005;40:164–171.
16. Jandu N, Ho NKL, Donato KA, et al. Enterohemorrhagic
Escherichia coli O157:H7 gene expression profiling in response to
growth in the presence of host epithelia. PLoS One 2009;4:e4889.
2000;64:0–00
FOR PERSONAL USE ONLY
Produits et services
Canadian Journal
of Veterinary Research
available online now!
Articles are now easily accessible
over the Internet at
PubMed Central
www.pubmedcentral.com
RENEW YOUR SUBSCRIPTION
NOW!
RENOUVELEZ VOTRE ABONNEMENT
DÈS MAINTENANT!
Supplies and services
Reaching Canada’s Veterinarians
Get your message into
The Canadian
Veterinary Journal
For more information contact:
Laima Laffitte
Advertising Manager
Tel.: (613) 673-2659
Fax: (613) 673-2462
e-mail: [email protected]
Four issues of the
Canadian Journal of Veterinary Research for 2013
(online)
Quatre numéros de la
Revue canadienne de recherche vétérinaire pour 2013
$150 $ ( applicable GST/HST; Canadian/Canadien
TPS/TVH en vigueur)
$165 $ US/É.-U.
Foreign/Étranger
$50 $ ( applicable GST/HST) Back issues/Anciens numéros
each/chacun
Contact/Communiquez avec :
Beverley Kelly
Editorial Coordinator/Coordonnatrice de la rédaction
Canadian Journal of Veterinary Research
Revue canadienne de recherche vétérinaire
339 rue Booth Street
Ottawa, Ontario K1R 7K1
Canada
Tel./Tél. : (613) 236-1162, x117
Fax/Télécopieur : (613) 236-9681
E-mail/Courriel : [email protected]
w w w . c a n a d i a n v e t e r i n a r i a n s . n e t
Tables of contents
Coming events
Article abstracts
Classified advertising
Subscription information
Instructions for authors
Tables des matières
Événements à venir
Résumés d’articles
Annonces classées
Information sur l’abonnement
Directives à l’intention des auteurs
w w w . v e t e r i n a i r e s a u c a n a d a . n e t
The effect of nitrous oxide on the
minimum alveolar concentration (MAC)
and MAC derivatives of isoflurane in
dogs
Debra A. Voulgaris, Christine M. Egger,
M. Reza Seddighi, Barton W. Rohrbach,
Lydia C. Love, Thomas J. Doherty . . . . . . . . . . 131
Oxidative stress, superoxide production,
and apoptosis of neutrophils in dogs
with chronic kidney disease
Adriana Carolina Rodrigues Almeida Silva,
Breno Fernando Martins de Almeida,
Carolina Soares Soeiro, Wagner Luis Ferreira,
Valéria Marçal Félix de Lima,
Paulo César Ciarlini . . . . . . . . . . . . . . . . . . . . . 136
Correlation of tumor-infiltrating
lymphocytes to histopathological
features and molecular phenotypes
in canine mammary carcinoma: A
morphologic and immunohistochemical
morphometric study
Jong-Hyuk Kim, Seung-Ki Chon,
Keum-Soon Im, Na-Hyun Kim,
Jung-Hyang Sur . . . . . . . . . . . . . . . . . . . . . . . . 142
Clotting factor VIII (FVIII) and thrombin
generation in camel plasma: A comparative
study with humans
Abdel Galil M. Abdel Gader,
Abdul Karim M. Al Momen,
Abdulqader Alhaider, Marjory B. Brooks,
James L. Catalfamo, Ahmed A. Al Haidary,
Mansour F. Hussain . . . . . . . . . . . . . . . . . . . . . 150
Short Communication/
Communication brève
Differences in virulence gene expression
between atypical enteropathogenic
Escherichia coli strains isolated from
diarrheic and healthy ruminants
Pilar Horcajo, Gustavo Domínguez-Bernal,
Javier Carrión, Ricardo De La Fuente,
José A. Ruiz-Santa-Quiteria,
José A. Orden . . . . . . . . . . . . . . . . . . . . . . . . . 158