DISS. ETH NO. 22325
THE ROLE OF GLIAL VERSUS NEURONAL NOGO-A IN
AXONAL REGENERATION IN THE MOUSE CENTRAL
NERVOUS SYSTEM
A thesis submitted to attain the degree of
DOCTOR OF SCIENCES of ETH ZURICH
(Dr. sc. ETH Zurich)
presented by
FLÓRA VAJDA
M.Sc. in Neuroscience, Eötvös Loránd University (Budapest)
born on 26.12.1986
citizen of Hungary
accepted on the recommendation of
Prof. Dr. Martin E. Schwab, examiner
Prof. Dr. Ueli Suter, co-examiner
Prof. Dr. Stephan Neuhauss, co-examiner
2014
Table of Contents
Table of Contents
Summary ................................................................................................................................................................... - 4 Zusammenfassung............................................................................................................................................... - 6 Context and Aims ................................................................................................................................................. - 8 Chapter 1 .................................................................................................................................................................. - 9 Introduction: Extracellular and intracellular limitations of axonal regeneration in the central
nervous system – special focus on Nogo-A and the visual system ..................................................... - 9 1 Introduction: Myelin associated neurite growth inhibitors - focus on Nogo-A ................ - 10 1.1 The central nervous system is a hostile environment for axonal regeneration:
history of discovery.................................................................................................................................. - 10 1.2 The neurite growth inhibitory protein Nogo-A: description of Nogo signalling and
possible pharmacological interventions ......................................................................................... - 11 1.3 Physiological functions of Nogo-A .............................................................................................. - 15 1.4 Nogo-A in CNS diseases ................................................................................................................... - 17 2 Regeneration and plasticity after CNS injury .................................................................................. - 17 2.1 Stimulation of regeneration by up-regulating intrinsic neuronal growth
mechanisms ................................................................................................................................................. - 18 2.2 Nogo-A neutralization improves regeneration and promotes plasticity in animal
models of spinal cord injury ................................................................................................................. - 19 2.3 Suppression of the Nogo-A pathway in animal models of spinal cord injury........... - 21 2.3.1 Nogo-A neutralization by antibodies ................................................................................ - 21 2.3.2 Blockade of Nogo-A receptors and signalling ............................................................... - 22 2.3.3 Preparing translation: preclinical studies for Nogo-A blocking agents ............. - 26 2.3.4 Interventions blocking Nogo-A signalling in clinical trials for spinal cord injury- 28 2.4 Regeneration after genetic deletion of Nogo-A and NgR1 ................................................ - 29 2.5 Regeneration in the visual system .............................................................................................. - 33 2.5.1 The optic nerve crush as an excellent model system to study axonal
regeneration in the CNS .................................................................................................................... - 33 2.5.2 Regeneration studies in the visual system ..................................................................... - 36 2.5.3 From the optic nerve to the spinal cord .......................................................................... - 39 3 Expression pattern of Nogo-A in the visual system: implications on intracellular and
extracellular cell-type specific functions .............................................................................................. - 39 4 Conclusions ................................................................................................................................................... - 42 References ......................................................................................................................................................... - 43 Chapter 2 ............................................................................................................................................................... - 57 Cell type-specific Nogo-A gene ablation promotes axonal regeneration in the injured adult
optic nerve .............................................................................................................................................................. - 57 1 Abstract........................................................................................................................................................... - 58 -
-1-
Table of Contents
2 Introduction .................................................................................................................................................. - 60 3 Results ............................................................................................................................................................. - 61 3.1 Targeted deletion of Nogo-A in oligodendrocytes ............................................................... - 61 3.2 Cnp-Cre-driven ablation of Nogo-A increases regenerative axonal sprouting after
optic nerve crush injury ......................................................................................................................... - 64 3.3 Nogo-A deletion in Cnp-Cre+/-xRtn4flox/flox mice enhances inflammation-induced
axonal regeneration after optic nerve injury ................................................................................ - 64 3.4 Three-dimensional analysis of the growth pattern of regenerating axons in the
transparent optic nerve.......................................................................................................................... - 66 3.5 Compensatory up-regulation of EphrinA3 and EphA4 in Cnp-Cre+/-xRtn4flox/flox mice- 66 3.6 Nogo-A distribution and neuronal survival in the retinae of Cnp-Cre+/-xRtn4flox/flox
mice................................................................................................................................................................. - 69 3.7 Nogo-A expression is required in retinal ganglion cells for optic axon regeneration- 69 3.8 The immunohistochemical signal for the Nogo receptor NgR1 is increased in CnpCre+/-xRtn4flox/flox retinae ........................................................................................................................ - 73 4 Discussion ...................................................................................................................................................... - 80 4.1 Axonal regeneration in conventional versus cell type-specific Nogo-A KO lines ... - 80 4.2 The limitations of axonal regeneration by Nogo-A and guidance molecules in the
injured optic nerve ................................................................................................................................... - 80 4.3 The role of Nogo-A in neuronal survival .................................................................................. - 81 4.4 Nogo-A and Nogo receptors in retinal ganglion cells: trans and cis-interaction? .. - 82 5 Materials and Methods ............................................................................................................................. - 83 References ......................................................................................................................................................... - 88 Chapter 3 ............................................................................................................................................................... - 93 Contribution of glial Nogo-A to molecular mechanisms underlying axonal regeneration and
cell survival in the visual system .................................................................................................................. - 93 1 Abstract .......................................................................................................................................................... - 94 2 Introduction .................................................................................................................................................. - 96 3 Results ............................................................................................................................................................. - 97 3.1 Müller cells injury response in glial Nogo-A KOs ................................................................. - 97 3.2 Regulation of ER stress-related genes in the retina of Cnp-Cre+/-xRtn4flox/flox mice - 99 3.3 The expression of autophagy related genes is not modified by glial deletion of
Nogo-A ........................................................................................................................................................... - 99 3.4 Regulation of Nogo-A receptors in the retina of Cnp-Cre+/-xRtn4flox/flox mice ........ - 102 3.5 Model systems: Mog-Cre+/-xRtn4flox/flox vs. Cnp-Cre+/-xRtn4flox/flox ............................... - 105 4 Discussion ................................................................................................................................................... - 108 4.1 Nogo-A and Müller cell reaction ............................................................................................... - 108 4.2 Possible neuro-protective mechanisms of Nogo-A in the retina ................................ - 109 4.3 NgR receptor complex changes upon glial deletion of Nogo-A.................................... - 110 4.4 Lack of significant Nogo-A down-regulation in Mog-Cre+/-xRtn4flox/flox mice ......... - 111 -
-2-
Table of Contents
5 Materials and methods .......................................................................................................................... - 112 References ...................................................................................................................................................... - 115 Chapter 4 ............................................................................................................................................................ - 119 In vitro investigation of the potential hindrance of Nogo-A receptor signaling by Nogo-A
expressed in cis position ................................................................................................................................ - 119 1 Abstract........................................................................................................................................................ - 120 2 Introduction ............................................................................................................................................... - 122 3 Results .......................................................................................................................................................... - 124 3.1 Expression of Nogo-A and Nogo-A receptors in the F11 neuronal cell-type ......... - 124 3.2 Down-regulation or deletion of Nogo-A: effect on neurite outgrowth and cell
spreading ................................................................................................................................................... - 126 3.3 Protein expression changes following Nogo-A up and down-regulation ................ - 126 4 Discussion ................................................................................................................................................... - 129 5 Materials and methods .......................................................................................................................... - 130 References ...................................................................................................................................................... - 133 Chapter 5 ............................................................................................................................................................ - 135 Concluding remarks......................................................................................................................................... - 135 1 Conclusions and Outlook ...................................................................................................................... - 136 1.1 Nogo-A as an extrinsic and intrinsic growth, synapse and survival regulator...... - 137 1.2 Contribution of guidance molecules and myelin inhibitory proteins to the blockade
of CNS axonal regeneration................................................................................................................ - 139 1.3 Model systems to study axonal regeneration in the CNS ............................................... - 140 1.4 Implications for clinical therapies targeting Nogo-A signaling ................................... - 141 1.5 Final conclusions............................................................................................................................. - 143 References ...................................................................................................................................................... - 144 Acknowledgements....................................................................................................................................... - 147 Curriculum vitae ............................................................................................................................................. - 148 -
-3-
Summary / Zusammenfassung
Summary
In the central nervous system (CNS), Nogo-A has been well described as a myelin-associated
inhibitory protein for axonal regeneration after injury. However, Nogo-A is also expressed in
neurons, especially in regions of the nervous system where plasticity is high, such as the
hippocampus, the cortex and dorsal root ganglia (DRGs). In addition to playing a major role
in the blockade of axon growth in the adult CNS, Nogo-A has been shown to modulate
neuronal progenitor migration, axon guidance and fasciculation, dendritic branching,
synaptic plasticity and even cell survival.
Our recent studies suggested that not only glial, but also neuronal Nogo-A could
influence axonal growth and that this neuronal counterpart may be beneficial for axonal
regeneration. Besides function-blocking antibodies and pharmacological inhibitors, so far
only conventional knock-out (KO) mouse lines have been available to study the functions of
Nogo-A. In these complete KO models, systemic gene deletion affected Nogo-A expression in
glial and neuronal cell populations at the same time, and led to modest axonal regrowth in
the injured CNS. We therefore hypothesized that the selective blockade of Nogo-A in
oligodendrocytes may increase axonal regeneration to a higher level than previously
observed in full KO mice.
To study the separate role of glial and neuronal Nogo-A/RTN4 on axonal regeneration,
we have generated cell-type specific conditional Nogo-A KO animals by using the Cre-lox
recombination system. Targeted Nogo-A deletion in oligodendrocytes and in neurons was
obtained by crossing a floxed Nogo-A mouse line (Rtn4flox/flox) with mice expressing Crerecombinase under the control of the oligodendrocyte-specific 2′,3′-cyclic nucleotide 3′phosphodiesterase promoter (Cnp-Cre+/-) or the neuron-specific Thy1 promoter (Thy1Cretg+), respectively. Acute excision of the Nogo-A gene in neurons was carried out by adenoassociated virus serotype 2 (AAV2).Cre virus injections in Rtn4flox/flox animals. We found that
Nogo-A was down-regulated to different extents in glia and neuron-specific knock-out mice,
in a manner consistent with the proportion of Nogo-A-expressing glial and neuronal cells in
the CNS. Axonal regeneration in the optic nerve after crush injury was increased in the gliaspecific Nogo-A knock-out mice, suggesting that the targeted deletion of glial Nogo-A
improves neuronal growth capacity more than previously observed after systemic Nogo-A
gene ablation. The increased axonal growth was associated with the up-regulation of growth
associated genes, such as GAP-43 and SPRR1A. Inversely, deletion of Nogo-A from retinal
ganglion cells (RGCs) impaired the regenerative growth response. We found that neuronal
Nogo-A in RGCs could participate in enhancing axonal sprouting, possibly by cis-interaction
with Nogo receptors at the cell membrane that may counteract trans Nogo-A signaling and
-4-
Summary / Zusammenfassung
Rho-A pathway activation. In addition, neuronal survival was also significantly improved in
the retinae of glial Nogo-A KO mice. Major cellular and molecular events that could
contribute to the mechanisms of axonal regeneration and cell survival were also
investigated. In these experiments, Nogo-A did not contribute to Müller cell gliosis, ERstress or autophagic processes. Although Nogo-A is mostly accounted as an extracellular
inhibitor of axonal regeneration by acting on the cytoskeleton through the Rho-A/ROCK
pathway, oligodendroglial Nogo-A in trans has additionally been implicated to suppress the
neuronal growth program by modulating CREB, mTOR and ERK1/2 activation.
The results presented in this thesis show that oligodendroglial and neuronal Nogo-A
play distinct roles in axonal regeneration in the central nervous system. While myelin NogoA presented in trans leads to growth inhibition, Nogo-A expressed extra- or intracellularly in
neurons might exert a positive function possibly by interacting with its receptors in cis
position. Therefore, inactivating Nogo-A in glia while preserving neuronal Nogo-A
expression may be the most successful strategy to promote axonal regeneration in the CNS.
The pioneer work presented in this thesis was carried out in the visual system and may be
followed by studies in other parts of the CNS, where traumatic lesions, such as spinal cord
injury, lead to permanent neurological impairments.
-5-
Summary / Zusammenfassung
Zusammenfassung
Im zentralen Nervensystem (ZNS) ist Nogo-A vor allem als Myelin-assoziiertes Protein,
welches axonale Regeneration nach Verletzungen inhibiert, beschrieben. Jedoch wird NogoA auch in Neuronen exprimiert, insbesondere in Regionen des Nervensystems mit hoher
Plastizität, wie dem Hippocampus, Neokortex und den Spinalganglien. Neben seiner
wichtige Rolle bei der Blockade von axonalem Wachstum im adulten ZNS beeinflusst Nogo-A
auch Migration von neuronalen Vorläufer-Zellen, axonale Wegleitung und NervenfaserFaszikulation, dendritische Verzweigung, synaptische Plastizität und sogar das Überleben
von Nervenzellen.
Unsere jüngsten Studien zeigen, dass nicht nur Nogo-A exprimierende Gliazellen,
sondern auch neuronales Nogo-A selbst axonales Wachstum beeinflussen kann. Dieses
neuronale Nogo-A kann sogar vorteilhaft für axonale Regeneration sein. Neben
funktionsblockierenden Antikörpern und pharmakologischen Inhibitoren wurden bisher
nur konventionelle Knock-out (KO) Mauslinien untersucht, um die Funktionen von Nogo-A
zu erforschen. In diesen kompletten KO-Modellen sind jeweils die Nogo-A-Expression in
Gliazellen und neuronalen Zellpopulationen betroffen. Diese systemischen KO-Modelle
zeigten nur bescheidene axonale Regeneration nach einer Verletzung des ZNS. Wir haben
daher die Hypothese aufgestellt, dass die selektive Blockade von Nogo-A in
Oligodendrozyten zu einer höheren axonalen Regeneration führen könnte, als dies bisher in
kompletten KO-Mäusen beobachtet wurde.
Um die Rollen von Nogo-A in Gliazellen oder Neuronen getrennt voneinander zu
untersuchen, haben wir mit Hilfe des Cre-lox-Rekombinations-Systems Zelltyp-spezifische
Nogo-A-Knock-out-Tiere erzeugt. Gezielte Nogo-A Deletion in Oligodendrozyten und
Neuronen wurde durch das Kreuzen einer gefloxten Nogo-A-Mauslinie (Rtn4flox/flox) mit
Mäusen welche Cre-Rekombinase unter der Kontrolle des Oligodendrozyten-spezifischen 2',
3'-zyklische Nukleotide 3'-phosphodiesterase Promotors (Cnp-Cre+/-) oder des Neuronenspezifischen Thy1 (Thy1-Cretg+) Promotors exprimieren, erreicht. Akute Deletion des NogoA-Gens in Neuronen wurde durch Injektionen von Adeno-assoziierten Viren vom Serotyp 2
(AAV2).cre in Rtn4flox/flox Tiere erreicht. Wir fanden, dass Nogo-A in verschiedem Ausmaß in
Glial und Neuronen-spezifischen Knock-out-Mäusen herunterreguliert wurde, und zwar in
einer Weise, die mit dem Anteil der Nogo-A-exprimierenden Gliazellen und den neuronalen
Zellen im ZNS korrelierte. Des Weiteren war die axonale Regeneration im Sehnerv nach
einer Quetschverletzung in den Glia-spezifischen Nogo-A-Knock-out-Mäusen erhöht, was
darauf
hindeutet,
dass
die
gezielte
Deletion
von
Glia-Nogo-A
die
neuronale
Wachstumskapazität stärker erhöht, als bisher nach systemischer Nogo-A-Gen-Ablation
-6-
Summary / Zusammenfassung
beobachtet wurde. Das erhöhte axonale Wachstums war zusätzlich mit der Hochregulierung
Wachstums-assoziierter Gene wie GAP-43 und SPRR1A verbunden.
Im Gegensatz zur Glia-spezifischen Nogo-A Deletion verringerte die Deletion von
Nogo-A in retinalen Ganglienzellen die Regeneration. Wir fanden, dass neuronales Nogo-A in
retinalen Ganglienzellen die Verstärkung der axonalen Aussprossung möglicherweise durch
Wechselwirkung mit Nogo-Rezeptoren in cis auf der Zellmembran hervorruft. Diese cisInteraktion könnte somit dem inhibierenden trans-Nogo-A Signal und der Rho-A-SignalwegAktivierung entgegenwirken. Darüber hinaus war das Überleben der Neuronen in der
Netzhaut von Glia-Nogo-A KO-Mäusen nach der Läsion signifikant erhöht. Zusätzlich haben
wir auch zelluläre und molekulare Prozesse, welche zur axonalen Regeneration und dem
Überleben der Zellen beitragen, untersucht. In diesen Experimenten fanden wir keinen
Effekt von Nogo-A auf Müller-Zell-Gliose, ER-Stress oder autophagische Prozesse. Obwohl
Nogo-A vor allem für die Aktivierung des Rho/ROCK Signalweges und die Modulierung des
Zytoskeletts
bekannt
ist,
kann
oligodendrogliales
trans-Nogo-A
auch
das
Wachstumsprogramm von Nervenzellen unterdrücken indem es die Aktivität von CREB,
mTOR und ERK1/2 moduliert.
Die Ergebnisse in dieser Arbeit zeigen, dass oligodendrogliales und neuronales NogoA unterschiedliche Rollen in der axonalen Regeneration im zentralen Nervensystem spielen.
Während Myelin-Nogo-A in trans zu Wachstumshemmung führt, könnte extra-
oder
intrazelluläres Nogo-A in Neuronen eine positive Funktion haben, welche möglicherweise
durch die Interaktion mit Nogo Rezeptoren in cis-Stellung zustande kommt. Inaktivierung
von Nogo-A in Gliazellen unter der Wahrung von neuronaler Nogo-A-Expression könnte
daher die erfolgreichste Strategie zur Förderung von axonaler Regeneration im verletzten
ZNS sein. Die Erkenntnisse, welche in dieser Doktorarbeit präsentiert werden, wurden im
visuellen System gewonnen und sollten durch Studien in anderen Teilen des ZNS, in denen
traumatische Verletzungen, wie zum Beispiel Rückenmarksverletzung, zu bleibenden
neurologischen Beeinträchtigungen führen, ergänzt werden.
-7-
Context and Aims
Context and Aims
The membrane protein Nogo-A is a well-known myelin inhibitory factor for axonal
regeneration after injury, however, several studies demonstrated that Nogo-A also plays a
major role in regulating neuronal development and plasticity in the central nervous system.
The fact that Nogo-A is not only expressed by oligodendrocytes, but also by neuronal cell
populations further complicates our understanding on the physiological role of Nogo-A.
Chapter 1 of this thesis summarizes the discovery, structure and function of Nogo-A, and
provides an overview on the therapeutic potential of Nogo-A neutralization in improving
axonal regeneration and functional recovery after spinal cord injury in clinically relevant
and knock-out mouse studies. Furthermore, Chapter 1 introduces the visual system and the
optic nerve crush injury as a fundamental in vivo model to understand the molecular
mechanisms underlying regenerative growth inhibition in the central nervous system.
The main goal of my thesis was to investigate cell type specific functions of Nogo-A in
axonal regeneration, and to this aim we generated glial and neuronal conditional Nogo-A
knock-out mouse lines in our laboratory. In Chapter 2, the characterization of these mouse
lines revealed successful, cell-type dependent deletion of Nogo-A in various parts of the CNS.
Axonal regeneration and neuronal survival was evaluated in the optic nerve and retina,
respectively. To determine both the amount and growth pattern of regenerating axons,
three-dimensional analysis of whole mounted, transparent optic nerves was carried out. In
addition to the genetic deletion of Nogo-A, the effect of adeno-associated virus-mediated
recombination of the Nogo-A gene in neurons on axonal regeneration was also tested. The
changes in growth/regeneration and cell survival related signaling pathways were
investigated by Western blotting, qRT-PCR and biochemical assays and revealed a possible
mechanism by which neuronal Nogo-A exerts a positive function on neurite outgrowth.
Following the deletion of Nogo-A from glial cells, the compensatory up-regulation of related
myelin inhibitory proteins and guidance molecules was also investigated. In Chapter 3,
further functions, such as gliosis/inflammation, Nogo-A receptor expression, autophagy and
ER stress were screened to detect possible alterations explaining the regeneration and
survival phenotype we observed in the glial conditional knock-outs. Finally another
alternative myelin/oligodendrocyte-specific Nogo-A conditional knock-out is introduced in
this chapter.
In order to further investigate a possible cell-autonomous role for Nogo-A, multiple in
vitro experiments were carried out in fibroblasts and a neuronal cell line with the aid of
gain- and loss-of-function approaches. These studies are presented in Chapter 4.
-8-
Chapter 1
Introduction: Extracellular and intracellular limitations of axonal
regeneration in the central nervous system – special focus on NogoA and the visual system
by Flóra Vajda
Further contributions by:
Anna Guzik-Kornacka, Vincent Pernet, Martin E. Schwab
Contributions:
F.V. wrote the manuscript (revised by V.P. and M.E.S.). F.V. and A.GK. prepared the figures.
(Parts of this chapter (printed in grey) were written for the book ‘Translational
Neuroscience’ (Mark Tuszynski ed., Springer, 2015) under the title: “Blocking the Nogo-A
signalling pathway to promote regeneration and plasticity after spinal cord injury and
stroke”.)
-9-
Chapter 1: Introduction
1 Introduction: Myelin associated neurite growth inhibitors - focus on Nogo-A
1.1 The central nervous system is a hostile environment for axonal regeneration:
history of discovery
Already the early 1900s, Ramón y Cajal described that lesioned axons in the CNS do not
regenerate but retract and form dystrophic end-bulbs after an injury; only occasional
sprouting over short distances can be observed (Ramón y Cajal et al., 1991). This lack of
axonal regeneration within the CNS after large lesions leads to irreversible functional
deficits, e.g. to impaired locomotion or hand function in spinal cord injured or stroke
patients.
In the peripheral nervous system (PNS), a high level of regenerative capacity can
enable the reinnervation of target organs, which in turns leads to functional recovery. In
1911, a pupil of Ramón y Cajal, Tello, showed massive ingrowth of silver stained fibers of
cortical origin into a peripheral nerve graft implanted into the forebrain cortex of rabbits.
Further experiments in the 1980s also demonstrated that PNS axons (that otherwise
regenerate) fail to grow in the CNS milieu, but CNS axons elongated for unprecedented
distances when the CNS environment was replaced by peripheral nerves (David and Aguayo,
1981). Therefore these studies demonstrated that under favourable conditions CNS neurons
are able to regenerate and opened the avenue for research on determining the molecular
differences between the growth-permissive PNS and hostile CNS environment.
Several components of the CNS myelin were discovered to inhibit axonal growth after
an injury. Experiments in the late 1980s that compared outgrowth inhibition properties of
CNS and PNS myelin extracts (Caroni and Schwab, 1988) lead to the discovery of Nogo-A
(initially named ‘IN-250’) (Spillmann et al., 1998, Chen et al., 2000), a myelin membrane
protein contributing to the regeneration failure in the CNS after an injury (Schnell and
Schwab, 1990). Further components of CNS myelin have been shown to have inhibitory
properties:
myelin-associated
glycoprotein
(MAG)
(McKerracher
et
al.,
1994,
Mukhopadhyay et al., 1994) and oligodendrocyte myelin glycoprotein (OMgp) (Wang et al.,
2002b) are also located in the myelin sheaths of oligodendrocyte and play a role in
inhibiting regrowth of injured neurons, at least in vitro. Versican V2 and brevican, two
chondroitin sulphate proteoglycans (CSPG) are present in the CNS myelin and also suppress
neurite outgrowth (Niederost et al., 1999, Schmalfeldt et al., 2000). CSPGs in the
extracellular matrix (ECM) contribute to the formation of a growth inhibitory glial scar
around the injury site, which together with the aggregation of infiltrating immune and
activated CNS glial cells form a barrier for regenerating axons (Morgenstern et al., 2002). In
- 10 -
Chapter 1: Introduction
addition, sulfatide, a major lipid constituent of CNS myelin was recently identified as a novel
myelin-associated inhibitor of neurite outgrowth (Winzeler et al., 2011).
Some axonal guidance cues that are inevitable during development for correct path
finding of growing axons have been shown to be inhibitors of axonal regeneration when
expressed by oligodendrocytes in adulthood. A well described example is EphrinB3, known
for its developmental midline repellent function, which strongly inhibits axonal growth
(Benson et al., 2005). Furthermore, EphA4, a receptor for several Ephrin ligands, has been
shown to limit axonal regeneration in the adult CNS (Goldshmit et al., 2004, Goldshmit et al.,
2011, Kempf et al., 2013, Joly et al., 2014). Semaphorin 4D is also present in myelinating
oligodendrocytes and inhibits axon growth (Moreau-Fauvarque et al., 2003).
A cascade of molecular and cellular events is triggered by an injury in the CNS that
leads to the formation of the glial scar. The infiltration of the CNS by peripheral
inflammatory and immune cells (neutrophils, macrophages and eventually T cells) together
with the activation of resident microglia cells will lead to the secretion of multiple factors
(cytokines such as TNFα, IL-1, IL-8 or prostaglandins) that can support or hamper neurite
growth (Jones et al., 2005). At the same time, both activated astrocytes and oligodendrocyte
precursor cells start producing CSPGs and release them in the extracellular matrix (ECM),
contributing to the formation of the glial scar around the injury site together with the
aggregation of the above mentioned immune and CNS cells (Morgenstern et al., 2002). The
increased expression of CSPGs contributes to the non-permissive nature of the glial scar.
The wide spectrum of myelin inhibitors and ECM molecules that restrict axonal
growth raises questions about their physiological function. The onset of myelination
correlates with the decline of neuronal growth in the maturing CNS (Kapfhammer and
Schwab, 1994), suggesting myelin and myelin associated inhibitors might serve as a signal
terminating the growth phase leading to the consolidation of neuronal circuits during CNS
development (Schwab and Strittmatter, 2014).
1.2 The neurite growth inhibitory protein Nogo-A: description of Nogo signalling and
possible pharmacological interventions
Nogo-A (RTN4A) is a 1200 amino acid (aa)-long transmembrane protein containing a Cterminal reticulon homology domain (RHD). Alternative splicing and alternative promoter
usage of the Rtn4 gene give rise to two further proteins, Nogo-B (expressed in many tissue
of the body) and Nogo-C (expressed mostly in muscles) (Chen et al., 2000, GrandPre et al.,
2000, Prinjha et al., 2000). All three Nogo isoforms share the common C-terminus of 180aas,
which consists of two hydrophobic, membrane anchored regions and a short (60-70aa-long)
- 11 -
Chapter 1: Introduction
hydrophilic region, known as the growth limiting Nogo-66 domain (Fournier et al., 2001).
Nogo-A contains a long 800aa unique sequence that contains a second neurite growth
inhibitory region, the Nogo-A-∆20 domain (rat aa544-725) (Oertle et al., 2003).
Nogo-A is enriched in the membrane of the endoplasmatic reticulum (ER), where it
has been shown to be involved in the formation and maintenance of the tubular ER
morphology (Voeltz et al., 2006, Kiseleva et al., 2007, Jozsef et al., 2014). However, a
functionally active fraction of Nogo-A is localized in the cell surface membrane of
oligodendrocytes and neurons (Dodd et al., 2005).
The two highly active inhibitory domains of Nogo-A inducing growth cone collapse
and neurite outgrowth inhibition, Nogo-66 and Nogo-A-∆20, signal through separate
receptors, the Nogo-66 receptor1 (NgR1) receptor complex (Fournier et al., 2001), and the
sphingosine-1-phosphate receptor 2 (S1PR2) (Kempf et al., 2014), respectively (Figure 1).
Both receptors activate the small GTPase RhoA and its effector, Rho-associated protein
kinase (ROCK) (Schwab, 2010) (Figure 1A).
Nogo-66 binds to the glycoprotein receptor NgR1 (Nogo-66 receptor 1) (Fournier et
al., 2001) and also directly interacts with the paired immunoglobulin-like receptor B (PirB)
(Atwal et al., 2008). As NgR1 is a glycophosphatidylinositol (GPI)-anchored cell surface
protein lacking an intracellular signaling domain, it interacts with p75NTR (low affinity
neurotrophin receptor) (Wang et al., 2002a, Wong et al., 2002) or TROY (tumor necrosis
factor - TNFα - receptor superfamily member 19) (Park et al., 2005, Shao et al., 2005) to
transduce signals intracellularly. Both receptors are transmembrane proteins of the TNF
receptor family, but as the expression of p75 is only detectable in subpopulations of mature
neurons, TROY can act as a functional co-receptor of NgR1 in neurons lacking p75NTR.
Another co-receptor, LINGO-1 (leucine rich repeat - LRR - and IgG domain containing Nogo
receptor interacting protein 1) functions as an adaptor protein for Nogo-66 signaling
through NgR1/p75 signaling complex (Mi et al., 2004).
Interestingly, the two other structurally unrelated myelin associated inhibitors, MAG
and OMgp, share the same NgR1 receptor complex with Nogo-A (Domeniconi et al., 2002,
Liu et al., 2002, Wang et al., 2002b), therefore share a common intracellular signaling
pathway. The additional NgR family members, namely NgR2 and NgR3, have also been
implicated in binding growth inhibitory ligands, MAG (Venkatesh et al., 2005) and CSPGs
(Dickendesher et al., 2012, Baumer et al., 2014) with high affinity. NgR1 has also been
described to interact with two secreted proteins, leucine-rich glioma inactivated (LGI1) and
olfactomedin-1, which were proposed to antagonized Nogo-66 binding and myelin induced
growth inhibition (Thomas et al., 2010, Nakaya et al., 2012).
- 12 -
Chapter 1: Introduction
Figure 1. Nogo-A signalling pathways and functional blockers. Nogo-A exerts its inhibitory
function mainly through two domains, the Nogo-66 (red) and the Nogo-A-∆20 region (green). Nogo66 binds to the NgR1 receptor. As NgR1 is a GPI-anchored protein, it forms a complex with LINGO-1
and p75 or Troy, co-receptors that enable signal transduction. The NgR1 signalling complex activates
Rho-A-GTPase which regulates cytoskeleton dynamics and mediates growth inhibitory action of
Nogo-A. The Nogo-A-∆20 domain binds to sphingosine 1-phosphate receptor 2 (S1PR2) activating
G13 and LARG, which in turn also activates Rho-A. (A) Therefore, signalling from both Nogo-A
inhibitory domains converges on Rho-A and its effector, Rho-associated protein kinase (ROCK),
leading to F-actin depolymerization, microtubule disassembly and myosin II contractility. (B) When
internalized, the Nogo-A-∆20 fragment can form signalling endosomes and modulate growth related
gene expression by decreasing CREB phosphorylation. (C) The Nogo-A-∆20 fragment has also been
shown to mediate growth cone collapse in a protein synthesis dependent way involving the mTOR
pathway. Additionally, the ∆20 region has also been shown to indirectly inactivate integrin signalling.
The inhibitors and blocking agents against different molecules involved in Nogo-A, MAG and OMgp
and CSPG signalling are depicted on the figure in red: function blocking antibodies against Nogo-A
(IN-1, 11C7, 7B12, human anti-human Nogo-A antibody (Novartis Pharma, ATI355), humanized antiNogo-A antibody (GlaxoSmithKline, GSK1223249, Ozanezumab)); NgR1 blocker (NEP1-40); NgR1 or
LINGO-1 decoy proteins (NgR1(310)ecto-Fc, LINGO-1-Fc); S1PR2 blocker (JTE-013); CSPG digestion
(ChABC); pharmacological Rho or ROCK blockers (C3 transferase, Cethrin (BA-210), Y-27632, fasudil
or KD025). (The figure is as seen in Translational Neuroscience, Chapter 25.)
- 13 -
Chapter 1: Introduction
Functional receptors for Nogo-A-∆20 have long been searched for, and the
mechanisms of how this N-terminal region of Nogo-A exerts its inhibitory function have
been unclear till recently. One study demonstrated that Nogo-A-∆20 inhibits the function of
certain integrins and its action mechanism depends on the composition of the ECM (Hu and
Strittmatter, 2008). An orphan G-protein coupled receptor, GPR50 has also been found to
interact with Nogo-A-∆20, although exerting opposite functional effects on neurite
outgrowth (Grunewald et al., 2009). However, recently a high-affinity functional receptor
has been discovered for Nogo-A-∆20: the sphingosine-1-phosphate receptor 2 (S1PR2)
(Kempf et al., 2014). S1PR2 shows high expression levels in the developing nervous system
and interestingly, after activation by its well described natural ligand sphingosine-1phosphate, the S1PR2 receptor signals through Rho-A (Pyne and Pyne, 2010). Nogo-A-∆20
binding to S1PR2 triggers the activation of G protein G13, the Rho GEF LARG, and finally also
Rho-A, the common operator leading to growth cone collapse and outgrowth inhibition
(Figure 1A).
CNS neurons respond to Nogo-A and other myelin inhibitors with growth cone
collapse and neurite outgrowth arrest, which suggests that the underlying intracellular
mechanisms must involve altered dynamics of the cytoskeleton. Rho-A activation as a
consequence of both NgR1 and S1PR2 signaling is one of the key signaling mechanisms for
Nogo-A mediated growth inhibition (Alabed et al., 2006). GTPases, such as Rho-A, Rac1 and
Cdc42 trigger downstream cytoskeletal rearrangements; actin depolymerization and
actomyosin contraction for retraction in case of Rho-A and actin polymerization for growth
in case of Rac1. The signaling cascade activated by Nogo-A binding does not only activate
Rho-A, but also decrease the activity of Rac-1 (Niederost et al., 2002), putting a double break
on actin cytoskeleton dynamics. Downstream signaling from Rho-A and ROCK involves the
phosphorylation of cofilin by LIM kinase (LIMK) and activation of mysion light chain (MLC)
II, leading to F-actin depolymerization and myosin II contractility, respectively (Nash et al.,
2009). Besides affecting the actin cytoskeleton, myelin derived inhibitors also destabilize
the microtubule assembly by ROCK dependent phosphorylation of the collapsing response
mediator protein-2 (CRMP-2) (Mimura et al., 2006).
Nogo-A also initiates an intracellular Ca2+ rise mediating the collapse of neuronal
growth cones (Bandtlow et al., 1993). Other signaling components of Nogo-A involve protein
kinase C (PKC) (Sivasankaran et al., 2004) and epidermal growth factor receptor (EGFR)
(Koprivica et al., 2005), pathways which may act in concert with RhoA. Subsequent to the
local cytoskeleton reorganization Nogo-A evokes, Nogo-A-∆20 has been shown to be
internalized by a Pincher dependent mechanism and to be retrogradely transported to the
neuronal cell bodies, leading to Rho-A activation and deactivation of the cAMP response
- 14 -
Chapter 1: Introduction
element (CREB) (Joset et al., 2010) (Figure 1B). This pathway resembles the ones
neurotrophic factors utilize to elicit growth and neuronal plasticity, opposite functions than
Nogo-A-∆20 (Shao et al., 2002). Along this line, it had been shown that up-regulation of
cAMP and phospho-CREB by neurotrophic factor treatment helps neurons to overcome
myelin growth inhibition (Cai et al., 2002, Gao et al., 2004). Interestingly, signaling from
negative and positive growth regulators converge on the same transcription factor and this
observation might be generalized for the regulation of other growth controllers, such as the
mammalian target of rapamycin (mTOR), the synaptic expression of which was observed to
be decreased by Nogo-A (Baldwin et al., 2011). Additionally, recently, Nogo-A-∆20 but not
Nogo-66 mediated growth cone collapse has been shown to be dependent on the mTOR
pathway-activated protein translation (Manns et al., 2014) (Figure 1C).
Multiple ways have been developed to suppress Nogo-A/Nogo receptor interactions
and the underlying signalling pathways (Gonzenbach and Schwab, 2008). Neutralizing
Nogo-A either by function blocking antibodies (IN-1 (Schnell and Schwab, 1990), 11C7 and
7B12 (Liebscher et al., 2005), human anti-human Nogo-A antibody (Novartis, ATI355),
humanized anti-Nogo-A antibody (GlaxoSmithKline, GSK1223249, Ozanezumab)) or by
interfering with Nogo-A receptors (NEP1-40 (GrandPre et al., 2002), NgR(310)ecto-Fc (Li et
al., 2004), Lingo-Fc (Ji et al., 2006), JTE-013) and underlying signalling pathways
(pharmacological Rho or ROCK blocker: C3 transferase, Cethrin, Y-27632, fasudil, KD025)
have been shown to reduce the inhibitory effects of CNS myelin on neurite growth, cell
spreading and cell migration in vitro, and to boost regenerating, compensatory sprouting
and functional recovery after CNS injury in vivo (Figure 1; red blocking arrows).
1.3 Physiological functions of Nogo-A
In the adult CNS, the bulk of Nogo-A protein is found in myelin (Huber et al., 2002) and its
inhibitory function has been well described for axonal growth, plasticity and regeneration
after CNS injury; reviewed in (Schwab, 2004, Pernet and Schwab, 2012). In
oligodendrocytes, Nogo-A localizes mainly to the outer and innermost adaxonal myelin
sheath (to the axon-oligodendrocyte contact zones) and to synaptic sites (Wang et al.,
2002c). The developmental expression of Nogo-A in oligodendrocytes correlates with the
course of myelination, and Nogo-A has been proposed to stabilize neuronal circuits at the
end of CNS maturation (Schwab, 2010). By controlling spatial segregation and myelin extent
Nogo-A was shown to be a key factor for precise myelination of the developing CNS (Pernet
et al., 2008, Chong et al., 2012).
- 15 -
Chapter 1: Introduction
However, in addition to oligodendrocytes and myelin, Nogo-A is highly expressed in
growing, immature neurons and also in subpopulations of mature neurons (Huber et al.,
2002, Wang et al., 2002c). During development, Nogo-A is down-regulated in immature
neurons at the time of synaptogenesis (Aloy et al., 2006, Petrinovic et al., 2013), however in
plastic brain regions such as the hippocampus, Nogo-A remains expressed and is located at
synapses (Wang et al., 2002c) where it was shown to negatively regulate synaptic plasticity
(Mironova and Giger, 2013). Several studies investigated further potential neuronal Nogo-A
functions. During development, neuronal Nogo-A influenced neuronal migration
(Mingorance et al., 2004, Mathis et al., 2010), survival (Mi et al., 2012, Guo et al., 2013), cell
spreading and neurite growth (Oertle et al., 2003, Petrinovic et al., 2010).
Recently a new concept emerged regarding the physiological role of myelin associated
inhibitors. A number of repulsive axon guidance cues and myelin inhibitory molecules have
been shown to also play a role in circuitry stabilization, synapse formation, function and
plasticity (Shen and Cowan, 2010, Mironova and Giger, 2013). The expression and
localization of Nogo-A first in neurons then in glial cells, in close proximity to synaptic
contacts (Wang et al., 2002c) suggests a developmental function in synaptogenesis and later
in synaptic transmission. Oligodendroglial Nogo-A has been shown to restrict the plasticity
of the ocular dominance columns in the visual cortex by an NgR and PirB - Nogo-A receptordependent manner (McGee et al., 2005, Syken et al., 2006), possibly contributing to ending
the so-called “critical-period”. In the hippocampus, pre and post-synaptically expressed
Nogo-A and NgR1 has been shown to regulate synaptic plasticity (Lee et al., 2008, Delekate
et al., 2011). Antibody-mediated neutralization of Nogo-A or NgR1 induces sprouting of
CA1/3 dendritic arbors and CA3 axons (Zagrebelsky et al., 2010), and increases long-term
potentiation (LTP) on acute hippocampal slices (Delekate et al., 2011). Accordingly, Nogo-66
or OMgp application attenuated LTP (Raiker et al., 2010). Although genetic deletion of NogoA, NgR1 or PirB have not lead to substantial increase in LTP (Karlen et al., 2009, Raiker et al.,
2010) probably due to compensatory mechanisms in the mutant mice, NgR1 has been
shown to limit the number of excitatory synapses during brain development (Wills et al.,
2012). In the hippocampus and motor cortex of Nogo-A down-regulating transgenic rats
increased LTP was observed (Tews et al., 2013). Acute treatment of brain slices with
function-blocking antibodies against Nogo-A or against NgR1 increased LTP in the intact
motor cortex, whereas in vivo, intrathecal application of Nogo-A-blocking antibodies
resulted in a higher dendritic spine density and improved motor learning of skilled
forelimb-reaching tasks (Zemmar et al., 2014). Likewise, NgR1 knock-out animals exhibited
increased plasticity in the somatosensory cortex (Akbik et al., 2013).
- 16 -
Chapter 1: Introduction
These
studies
suggest
that
although
the
observed
morphological
and
electrophysiological changes are more likely to rely on altered receptor/ligand interactions
on the cells surface, cell autonomous effects of Nogo-A cannot be completely excluded. After
injury, the effects of neuronal Nogo-A are not yet well understood. The presence of Nogo-A
in plastic brain regions and its up-regulation in neurons after CNS injuries (Cheatwood et al.,
2008, Pernet et al., 2011) suggest that neuronal Nogo-A possesses a distinct, potentially
positive role for plasticity.
1.4 Nogo-A in CNS diseases
Interestingly, the expression of Nogo-A is altered in multiple neurodegenerative diseases of
the CNS, changes that have been implicated in influencing the disease progression. In
amyotrophic lateral sclerosis (ALS), also referred to as motor neuron disease (MND), NogoA is up-regulated in spinal cord motoneurons and muscles, suggesting its possible
involvement in the pathophysiology of the disease (Dupuis et al., 2002, Jokic et al., 2006,
Pradat et al., 2007). In patients with multiple sclerosis (MS), soluble Nogo-A fragments are
found in the cerebrospinal fluid (CSF) that may correlate with the disease progression
(Reindl et al., 2003, Jurewicz et al., 2007). Both in motoneuron (ALS) and myelin (MS)
diseases therefore Nogo-A might serve as a marker for diagnosis. Furthermore, the findings
that NgR1 might bind the amyloid precursor protein APP suggests the involvement of NogoA in Alzheimer’s disease (Park et al., 2006, Zhou et al., 2011), but further data are required
in order to understand the possible roles Nogo-A and NgR1 might play in APP and β-amyloid
(Aβ) processing.
2 Regeneration and plasticity after CNS injury
Depending on the lesion size and localization, the consequences of CNS injuries are complex.
Patients and experimental animals with large lesions have to cope with permanent and
severe functional deficits. Smaller lesions of the spinal cord or the motor cortex have a
relatively good prognosis due to adaptive changes in the neuronal circuitries of the spinal
cord and brain allowing spontaneous functional improvements (Bareyre et al., 2004,
Starkey and Schwab, 2014). In animal models, injured and spared fibers can sprout and
grow collaterals, initiating the remodelling of intraspinal circuits e.g. by forming ‘detour’
pathways (Raineteau and Schwab, 2001, Bareyre et al., 2004). The distances covered by
sprouting fibers are short in general, and the growth response of the neurons is down-
- 17 -
Chapter 1: Introduction
regulated within a few days, possibly because of the presence of growth inhibitory factors
like Nogo-A, CSPGs or scar-associated molecules (Schwab and Bartholdi, 1996).
Two key questions and aims in the field of CNS repair are therefore to enhance the
growth capacity of the neurons, and overcome the inhibitory properties of the CNS
environment to allow regeneration of fibers over long distances and around large spinal
cord or brain lesion sites.
2.1 Stimulation of regeneration by up-regulating intrinsic neuronal growth
mechanisms
Immature CNS neurons in early developmental stages possess robust axon growth and
regenerative ability, which is down regulated at adult stages in most types of CNS neurons,
possibly through a decrease in trophic support and the influence of inhibition of growth
(Tuszynski and Gage, 1995, Blesch et al., 2012, Schwab and Strittmatter, 2014). One way
neurite growth and regeneration can be stimulated is the up-regulation of the intrinsic
growth machinery of neurons, in particular via stimulating the mTOR (mammalian target of
rapamycin) and STAT3 (signal transducer and activator of transcription 3) pathways (Liu et
al., 2011). Eliminating the gene encoding for the tumour suppressor phosphatase and tensin
homolog (PTEN) promoted robust extension of retinal ganglion cell axons and injured
corticospinal tract fibers, an effect that was dependent on the mTOR pathway (Park et al.,
2008, Liu et al., 2010). Although the manipulation of these intracellular growth regulators
induces powerful long-distance axonal regeneration in the optic nerve and to a lesser extent
in the spinal cord after injury, only few reports on the functional consequences of this
neurite growth stimulation exist so far (de Lima et al., 2012b). However, excessive
stimulation of mTOR can lead to epileptic seizures and tumour formation, suggesting that
over-stimulated neurite growth may lead to the formation aberrant neuronal connections,
or that the growth machinery might get out of control and this would results in the overproliferation of glial cells (Akhavan et al., 2010, Pun et al., 2012). The down-regulation or
the deletion of the growth repressor Krüppel-like factor 4 (KLF4), a zinc-finger transcription
factor, also increased the number and length of regenerating retinal ganglion cell axons after
optic nerve crush (Moore et al., 2009). Up-regulation of growth-activating neurotrophic
factors such as ciliary neurotrophic factor (CNTF) leads to the activation of the JAK/STAT3
pathway and thereby to increased axonal regeneration (Leaver et al., 2006, Muller et al.,
2007, Pernet et al., 2013a). Up-regulation of STAT3 or down-regulation of suppressor of
cytokine signalling 3 (SOCS3), the negative feedback controller of this pathway, both elicited
- 18 -
Chapter 1: Introduction
increased axonal regeneration in the lesioned rodent optic nerve (Smith et al., 2009, Pernet
et al., 2013b).
Two extracellular growth inhibitory factors, MAG and Nogo-A, were recently shown to
negatively affect the mTOR pathway suggesting that the final growth response is a result of
interconnected intrinsic and extrinsic signalling pathways (Figure 1C) (Peng et al., 2011,
Manns et al., 2014).
An important consideration for stimulated axonal growth in the injured adult CNS is
that these fibers have to find functionally meaningful targets where they should form
synapses, avoiding synapse formation on targets that would lead to malfunctions. Thus, in
addition to a growth permissive extracellular environment, guidance and positional cues as
well as target recognition signals should be provided to the regenerating axons. At present,
however, almost no information is available in the literature on these mechanisms in adult,
injured model systems.
2.2 Nogo-A neutralization improves regeneration and promotes plasticity in animal
models of spinal cord injury
After blockade of the Nogo-A pathways, two types of anatomical repair phenomena were
observed: enhanced axonal sprouting and increased regeneration (Figure 2B). Regenerative
sprouting can frequently be observed after fiber tract lesions, as collateral sprouting close to
the lesion site or from the injury site directly. If these fibers elongate over longer distances
(beyond 1 mm) they are considered as regenerating axons (regenerative growth). In the
injured spinal cord such axons can grow around the lesion and scar area and extend beyond
the lesion site towards potential targets in the lower spinal cord. Fiber numbers often drop
off at >2-5mm, but regenerating axons covering >10 mm could also be observed.
Corticospinal tract (CST) and serotoninergic fibers were studied most extensively.
Additionally to injured axons, the non-injured, spared fibers can respond to the injury with
sprouting, a phenomenon often called compensatory sprouting (Figure 2B). In experimental
stroke, recovery is predominantly mediated by compensatory collateral sprouting of the
uninjured tracts.
Depending on the type of CNS injury, complete or incomplete, long distance
regeneration or local sprouting could be more relevant for the functional recovery.
- 19 -
Chapter 1: Introduction
Figure 2. Anatomical and behavioral aspects of Nogo-A signalling inhibition in spinal cord
injury. (A) Scheme of a rat spinal cord cross-section depicting localization of the dorsal, dorsolateral
and ventral corticospinal tracts and a T-shaped transection (grey shaded area) which interrupts all of
those tracts and is a widely used model in experimental spinal cord injury research. (B) Scheme
illustrating axonal regeneration versus sprouting after spinal cord injury: regenerating axons
originate from the cut end of injured axons (red); however the shafts of damaged axons and preexisting, non-injured, spared fibers sprout also in response to the injury (green). (C) After spinal cord
injury, the irregular horizontal ladder test is widely used for the assessment of locomotion and fine
motor control in rats. (D) Camera lucida reconstruction of the spinal hemicord with regenerating
corticospinal fibers rostral and caudal to the lesion site (light area) in control IgG and anti-Nogo-A
antibody (mAb 11C7 and mAb 7B12) treated rats. In the anti-Nogo-A antibody treated rats
corticospinal fibers regenerated over ventrolateral tissue bridges into the caudal spinal cord. This
regenerative growth was absent in the control antibody treated animals. Reprinted with permission
from Ann Neurol. (Liebscher et al., 2005). (The figure is as seen in Translational Neuroscience,
Chapter 25.)
- 20 -
Chapter 1: Introduction
2.3 Suppression of the Nogo-A pathway in animal models of spinal cord injury
2.3.1 Nogo-A neutralization by antibodies
As reviewed in Table 1, multiple in vivo studies were carried out in spinal cord injury (SCI)
animal models to explore the future possibility of clinical studies with Nogo-A/NgR1
receptor blocking agents.
In the early 1990s, Schnell and Schwab (Schnell and Schwab, 1990) reported that the
delivery of the monoclonal antibody called IN-1, an IgM recognizing and neutralizing NogoA, through implantation of antibody producing hybridoma cells in the brain increased the
regeneration of cut axons past the lesion site in an incomplete rat SCI model. This
experiment with IN-1 treatment has been repeated in multiple species (rat, marmoset
monkey) and lesion paradigms, and demonstrated increased functional recovery as
assessed by various locomotor tests (Basso, Beattie and Bresnahan (BBB), narrow beam,
horizontal ladder (Figure 2C), etc.) (Bregman et al., 1995, Thallmair et al., 1998, Brosamle et
al., 2000, Merkler et al., 2001, Raineteau et al., 2001, Raineteau et al., 2002, Fouad et al.,
2004). Highly purified new monoclonal antibodies directed against the Nogo-A specific
domains of the rat protein (11C7 and 7B12 antibodies) allowed repeating these
experiments in clinically more relevant settings. These antibodies were delivered
intrathecally via an osmotic minipump for two weeks, starting immediately after the injury.
After mid-thoracic T-lesion (Figure 2A), anti-Nogo-A antibody treated animals had a much
higher number of regenerating CST and serotoninergic fibers (Figure 2D) and consistently
showed substantial functional recovery associated to this regenerative improvement in rats
and macaque monkeys (Liebscher et al., 2005, Freund et al., 2006, Freund et al., 2007,
Mullner et al., 2008, Freund et al., 2009).
As most of these in vivo studies were performed with acute antibody delivery (starting
at the time of the SCI), delayed anti-Nogo-A antibody treatment regimens were also tested.
These experiments showed that delaying the antibody delivery in rats by one week was still
efficient in increasing CST axon regeneration and hindlimb recovery, whereas a delay of two
weeks until treatment start led to poorer outcomes (Gonzenbach et al., 2010, Gonzenbach et
al., 2012). Combination of Nogo-A neutralization with several pharmacological treatments
led to even more enhanced anatomical reorganization and functional improvements. The
effects of anti-Nogo antibody treatment were strengthened by simultaneous neurotrophin-3
(NT-3) and NMDA-receptor 2d (NR2d) subunit delivery, which promotes neuronal growth
capacity, survival and synaptic plasticity, respectively (Schnell et al., 1994, Schnell et al.,
2011). CSPGs and peri-neural net proteins exert additional inhibition on axonal growth.
- 21 -
Chapter 1: Introduction
Combined treatments reducing CSPGs by chondroitinase ABC (ChABC) and applying antiNogo-A antibodies were found to be beneficial for CST sprouting, regeneration and for the
recovery of forelimb functions after high cervical contusion lesions (Zhao et al., 2013).
Anti-Nogo-A antibodies bind to cell membrane Nogo-A and may led to internalization
of the protein-antibody complex eventually leading to down-regulation of Nogo-A tissue
levels (Weinmann et al., 2006). Additionally, due to the large size of the antibodies, steric
blockade of the Nogo-A-Nogo receptor interaction mayt be a mechanism for Nogo-A action
neutralization.
2.3.2 Blockade of Nogo-A receptors and signalling
Another approach to block Nogo-A function is to block the activation of the NgR1 receptor
complex with a function-blocking peptide (NEP1-40) or soluble NgR1-Fc proteins. One
advantage of this approach is the possible simultaneous blockade of several myelin
associated inhibitory NgR1 ligands, such as Nogo-A, MAG and OMgp, eventually even CSPGs
(Dickendesher et al., 2012). Both acute and delayed intrathecal, subcutaneous or
intraperitoneal delivery of NEP1-40 was reported to increase the regeneration of both
corticospinal and raphespinal fibers and to lead to increased BBB scores and grid-walk
performance (GrandPre et al., 2002, Li and Strittmatter, 2003, Steward et al., 2008).
Experiments applying the NgR1(310)ecto-Fc (soluble function-blocking NgR ectodomain)
intrathecally or intracerebroventricularly led to a similar increase of regeneration and
sprouting of corticospinal and serotoninergic fibers together with increased locomotor
recovery (Li et al., 2004, Wang et al., 2011, Wang et al., 2014). The studies by Wang et al. in
2011 and 2014 were performed with spinal cord contused rats, applying NgR1(310)ecto-Fc
treatment in a close-to-reality SCI model. Triple therapy combining NgR1(310)ecto-Fc,
ChABC for degrading CSPGs and peripheral nerve preconditioning increased the intrinsic
growth potential of dorsal root ganglion neurons and allowed axons to regenerate
millimetres past the spinal cord injury site (Wang et al., 2012b).
Although only shown by a single study, blocking LINGO-1, a co-receptor of NgR1, by
soluble LINGO-1-Fc fragments also resulted in elevated rubrospinal and corticospinal fiber
sprouting and led to improved functional recovery in the cylinder test and in BBB scores (Ji
et al., 2006).
Multiple studies showed that inhibition of Rho-A/ROCK signalling leads to increased
axonal regeneration and improved functional recovery. The C3 transferase or Y-27632
(Dergham et al., 2002), Cethrin (BA-210) (Lord-Fontaine et al., 2008, McKerracher and
- 22 -
Chapter 1: Introduction
Guertin, 2013), or fasudil (Sung et al., 2003) treatments led to similar enhancement of
anatomical reorganization and behavioral improvements.
Table 1. Key in vivo studies on Nogo-A signalling inhibition in spinal cord injury
Treatment
Study
Species age
SCI model
gender
Rats, 14-47 Half to twodays old
third dorsal, T5Lewis
7, complete
transection
Route of
administration
Hybridoma cells
secreting IN-1 Ab
into the dorsal
fronto-parietal
cortex,
unilaterally, 7-10
days before the
SCI.
Anti-Nogo-A
mAb IN-1
(Schnell
and
Schwab,
1990)
Anti-Nogo-A
mAb IN-1
(Bregman
et al., 1995)
Rats, 6-8
wks Lewis
(150200g)
Overhemisection
(right), T6
Hybridoma cells
secreting IN-1 Ab
into the CSF at
the time of the
SCI.
Anti-Nogo-A
mAb IN-1
(Thallmair
et al., 1998)
Rats, 2-3
months
Lewis
Unilateral
pyramidotomy
rIN-1 Fab
(humanized)
(Brosamle
et al., 2000)
Rat, 68wks
female
Lewis
Dorsolateral
hemisection, T8
Anti-Nogo-A
mAb IN-1
(Merkler et
al., 2001)
Rats, Lewis Dorsal over(200hemisection, T8
250g)
Hybridoma cells
secreting IN-1 Ab
into the cortex
contralateral to
the lesion at the
time of the
pyramidotomy.
Intrathecal rIN-1
Fab delivery by
osmotic
minipump for
2wks at the
time/site of SCI.
Hybridoma cells
secreting IN-1 Ab
into the
hippocampus
unilaterally, at
the time of the
SCI.
Anti-Nogo-A
mAb IN-1
(Raineteau
et al., 2001,
Raineteau
et al., 2002)
Rats, adult
Lewis
(175275g)
NEP1-40
(Nogo-66
antagonistic
peptide)
NEP1-40
(Nogo-66
antagonistic
peptide)
Bilateral
pyramidotomy
Hybridoma cells
secreting IN-1 Ab
into the left
hippocampus, at
the time of the
SCI.
(GrandPre Rats, female
et al., 2002) SpragueDawley
(175–250g)
Dorsal
hemisection,
T6-7
(Li and
Strittmatter
, 2003)
Dorsal overhemisection,
T6-7
Intrathecal NEP140 delivery by
osmotic
minipump for
4wks at the
time/site of SCI.
Subcutaneous
NEP1-40
treatment at the
time, 4 hours or 7
days after SCI.
Mouse, 8–
10 wks
C57BL/6
- 23 -
Anatomical readout
and effect
2-3 wks after SCI,
labelling of the CST with
wheat germ agglutininHRP. Increased
sprouting and
regeneration up to 711mm past the lesion
site.
Up to 9 wks post SCI,
increased CST (up to 711mm, BDA tr.)
serotoninergic and
noradrenergic fiber
growth
(immunostaining).
2 wks post-lesion,
increased sprouting of
intact contralateral CST
fibers in different
brainstem nuclei and in
the SC (BDA tracing).
rIN-1 Fab treatment
promoted long-distance
CST axonal re-growth
within 2wks (BDA
tracing).
N.A. Lesion sizes are
comparable between
treatment groups.
Functional readout
and effect
N.A.
After 4-6 wks recovery,
80% of IN-1 treated rats
recovered contact
placing responses, and
stride length (foot print
analysis).
Close to full recovery (at
42 days) in skilled
forelimb (single pellet
reaching) task, further
motor (rope climbing)
and sensory tests (sticky
paper).
N.A.
5 wks after the injury
increased performance
in locomotor tests: open
field locomotor score,
grid walk, misstep
withdrawal
response, narrow-beam
crossing.
2-4wks past injury
1-4wks past injury
rubrospinal tract (RST)
precision movements of
tracing from red nucleus the forelimb (single
and CST tracing from
pellet reaching task)
cortex by BDA. 2-fold
almost completely
increase in the number
recovered. Intracortical
of collaterals emerging
or red nucleus
from the RST.
microstimulation
induced forelimb
response and confirmed
the reorganization of the
RST system, respectively.
4 wks after SCI both
Significantly higher BBB
corticospinal (BDA
scored in the NEP1-40
tracing) and raphespinal treated group 14-28
axon (immunostaining) days after SCI.
regeneration is
promoted.
3-4 wks past SCI dCST
BBB score increase at 17
sprouting (BDA tracing) or 28 days post SCI
significantly increased
(acute or delayed
both in acute and
respectively). Additional
delayed NEP1-40
foot-print and grid-walk
Chapter 1: Introduction
NgR(310)ectoFc (soluble
functionblocking NgR
ectodomain)
(Li et al.,
2004)
Rats,
Dorsal overfemale
hemisection,
SpragueT6-7
Dawley
(190–250g)
Intrathecal
NgR(310)ecto-Fc
delivery by
osmotic
minipump for
4wks.
Anti-Nogo-A
mAb IN-1
(Fouad et
al., 2004)
Marmoset
monkeys
of either
sex (280–
440g)
Hemisection, T8
Anti-Nogo-A
mAb 11C7 and
mAb 7B12
(Liebscher
et al., 2005)
Rat, 3
months
Lewis
Half dorsal
transection (Tlesion), T8
Hybridoma cells
secreting IN-1 Ab
into the
hippocampus
unilaterally, at
the time of the
SCI.
2wks of
intrathecal
catheter delivery
of purified antiNogo-A
monoclonal IgGs.
Anti-Nogo-A
mAb 7B12 and
mAb h-Nogo-A
(Freund et
al., 2006)
Macaque
Dorsolateral
monkeys of transection, C7either sex
8
Anti-Nogo-A
mAb 7B12 and
mAb h-Nogo-A
(Freund et
al., 2007)
Macaque
monkeys
of either
sex
Dorsolateral
transection, C78
NEP1-40
(Nogo-66
antagonistic
peptide)
(Steward et
al., 2008)
Mouse, 8–
10 wks
C57BL/6
Dorsal overhemisection,
T6-7
Anti-Nogo-A
mAb 11C7 and
mAb 7B12
(Mullner et
al., 2008)
Rat, 2
months
Lewis
(160180g)
Half dorsal
transection (Tlesion), T8
2wks of
intrathecal
catheter delivery
of purified antiNogo-A
monoclonal IgGs.
Anti-Nogo-A
mAb 11C7
(Freund et
al., 2009)
Macaque
monkeys
of either
sex
Dorsolateral
transection, C78
Anti-Nogo-A
mAb 11C7
(Maier et
al., 2009)
Rats,
female
SpragueDawley
(200–
250g)
Half dorsal
transection (Tlesion), T8
Intrathecal antiNogo-A Ab
delivery by
osmotic
minipump for
4wks at the
time/site of SCI.
Intrathecal antiNogo-A Ab
delivery by
osmotic
minipump for
2wks at the
time/site of SCI
Intrathecal antiNogo-A Ab
delivery by
osmotic
minipump for
4wks at the
time/site of SCI.
Intrathecal antiNogo-A Ab
delivery by
osmotic
minipump for
4wks at the
time/site of SCI.
Intraperitoneal
NEP1-40
treatment 5 hours
or 7 days after
SCI.
- 24 -
treatment groups. BDA/
synaptophysin doublelabelings suggest
synapse formation.
Increased axonal
sprouting of dCST (BDA
tracing) and raphespinal
fibers (immunostaining).
Increased occurance of
BDA or 5-HT–
synaptophysin doublelabeled varicosities.
2 wks post-lesion, in four
out of five mAb IN-1treated animals fine
labeled neurites had
grown into, through and
around the lesion site.
improvement.
9 wks after SCI, CST
sprouting and
regenerating fiber
numbers at 0.5, 2 and
5mm caudal to the lesion
were significantly higher
in anti–Nogo-A
antibody–treated
animals (BDA tracing).
Increased cumulative
arbor length of BDA
traced CST fibers caudal
to the lesion in antiNogo-A Ab treatmed
animals.
Improvement in BBB
score and various motor
tasks, sensory cortex
activation (contralateral
hindpaw stimulation),
absence of disfunctions
(14-55days post SCI).
60-80days post SCI, BDA
labelled CST fibers
displayed lower number
of retraction bulbs,
increased number of
sprouting and midline
crossing fibers.
46days post SCI no
significant differences in
the density of CST axon
arbors or in the density
of serotonergic axons
caudal to the injury.
9 wks after lesion
nearly complete and
lamina-specific
restoration of
serotonergic raphespinal fibres
(immunostaining).
N.A. Lesion sizes were
compared between
treatment groups.
N.A.
Both trained and nontrained 11C7 treated
groups displayed
increased CST fiber
number caudal to the
lesion (BDA tracing)
and higher 5-HT fibre
density in lamina VII.
Tested by bipedal
stepping, 9 wks post
SCI, non-trained 11C7
treated rats
demonstrated
consistent step cycles,
low paw drags and
improved
coordination. Parallel
Ab treatment and
treadmill training
Improved spinal cord
electrical conduction and
BBB scores at 14 and 28
days past SCI. Additional
foot-print and grid-walk
improvement.
N.A.
Improved manual
dexterity (“modified
Brinkman board”,
“reach and grasp
drawer”), unchanged
hindlimb function.
Increased BBB
between 7-14 days,
but not during further
assessments or by foot
print and grid walk
analysis.
N.A.
Confirmed faster
recovery and
significantly better
scores for vertical and
horizontal slot and the
contact time.
Chapter 1: Introduction
Anti-Nogo-A
mAb 11C7 and
mAb 7B12
(Gonzenbac
h et al.,
2010)
Rats,
female
Lewis
(180300g)
Half dorsal
transection (Tlesion), T8
NgR-Fc decoy
protein (AANgR(310)ectoFc)
(Wang et
al., 2011)
Rats, adult
female
SpragueDawley
(250270g)
Moderate
contusion
injury, T7 (10g,
25mm)
Anti-Nogo mAb
(11C7) +
Neurotrophin-3
(NT-3) +
NMDA-receptor
2d (NR2d)
subunit
(Schnell et
al., 2011)
Rats, adult
female
SpragueDawley
Hemisection,
T10
Anti-Nogo-A
mAb 11C7
(Gonzenbac
h et al.,
2012)
Rats, 8–10
wks,
female
Lewis
(180200g)
Half dorsal
transection (Tlesion), T8
NgR1(310)ectoFc decoy protein
+
chondroitinase
ABC (ChABC) +
preconditioning
peripheral
sciatic
nerve axotomy
(Wang et
al., 2012b)
Rats, 1112wks
female
SpragueDawley
(250270g)
Dorsal crush
SCI, T7
Anti-Nogo-A
mAb (11C7) +
chondroitinase
ABC (ChABC)
(Zhao et al.,
2013)
Rats, adult Dorsal column
male Lister lesion, C4
hooded
(150–
200g)
Human
NgR1(310)-Fc
(Wang et
al., 2014)
Rats, 1011wks
female
SpragueDawley
(220240g)
Moderate
contusion
injury, T7 (10g,
25mm)
Intrathecal antiNogo-A Ab
delivery by
osmotic
minipump for
2wks at the time
or 7 days delayed
past SCI.
Intracerebroventr
icular cannula for
AANgR(310)ectoFc therapy
starting from
10wks post SCI
for 12wks
(delayed).
Intrathecal 11C7
(2w) application,
NT-3 producing
fibroblasts on the
lesion, HSV-1
amplicon vector
NR2d delivery
from the time of
the lesion.
Intrathecal antiNogo-A Ab
delivery by
osmotic
minipump for
2wks at the time,
1wk or 2wks
delayed past SCI.
Intrathecally
NgR1(310)ectoFc (for 28days
from SCI),
intracerebroventr
ically ChABC (6x),
with or without
sciatic nerve
injury (7days pre
or 3days postSCI).
Acutely
intrathecally
11C7 (2wks),
delayed ChABC
injection and
infusion from
3wks (10days),
training from
4wks.
Intracerebroventr
icular infusion
(continuous) or
bolus delivery to
the lumbar
intrathecal space
(once every4
day).
N.A. Lesion sizes were
compared between
treatment groups.
worsened the stepping
qualities.
As locomotor training,
anti–Nogo-A antibody
treatment had a
preventive effect on
the development of
muscle spasms.
Induced raphespinal
growth (5-HT
immunostaining).
Recovery of weight
bearing and BBB
scores in chronic
conditions - 90180days post
contusion SCI.
10wks post SCI
increased numbers
midline-crossing fibers
below the lesion in the
Nogo-Ab + NT-3 +
NR2d group.
Probably polysynaptic
responses recorded
slightly better motor
function in the absence
of adverse effects (e.g.
pain).
10wks post SCI higher
numbers of labeled
CST fibers (BDA
tracing) in the acute
and 1wk delayed
treatment groups, but
not in the 2wk delayed
Ab application.
5wks after SCI, triple
therapy combining
NgR1 decoy, ChABC
and preconditioning,
allows sensory afferent
axons to regenerate
mms past the SCI site
(CTB retrograde
tracing in the sciatic
nerve).
Increased BBB scores,
swimming and narrow
beam recovery in acute
and 1wk treatment
group, but not in the
2wk-delayed group.
Reduction of muscle
spasms.
N.A.
11C7: >3m diameter
axons, ChABC: finer
axons with varicosities,
combinational
treatment: highest
sprouting and
regeneration (BDA
tracing).
Increased forelimb
function in skilled paw
reaching task
(Montoya staircase) in
the combinational
therapy group.
8wks post injury,
increased the fiber
density of raphespinal
axons caudal to the SCI
(5-HT
immunostaining).
Lumbar bolus dosing
schedule promoted
locomotor recovery
from SC contusion as
effectively as
continuous infusion in
open field (increased
BBB scores) and grid
walking tasks.
Abbreviations: BBB Basso, Beattie and Bresnahan locomotor activity test; BDA tr., biotinylated
dextran amine tracing; CST, corticospinal tract; ChABC, chondroitinase ABC; CTB, cholera toxin-βsubunit; mAb, monoclonal antibody; N.A. not assessed; SCI, spinal cord injury, wk week
- 25 -
Chapter 1: Introduction
2.3.3 Preparing translation: preclinical studies for Nogo-A blocking agents
The significant number of studies with Nogo-A/NgR1 signalling suppression paved the path
to clinical studies that are currently being carried out or planned in CNS injured, MS and ALS
patients (Hug and Weidner, 2012).
Pre-clinical spinal cord and cortical lesion studies with anti-Nogo-A antibodies were
conducted both on rodents and on primates. As the motor system organization, the tissue
reaction in response to injury and the behaviour of non-human primates resemble the
human situation, these studies were an important step for the clinical translation (Courtine
et al., 2007). The efficacy of the anti-Nogo-A antibody treatment was confirmed by studies
on macaque monkeys and showed substantial recovery of hand dexterity as well as
sprouting and regeneration of CST axons without signs of pain or other side effects (Freund
et al., 2006, 2009). Toxicological studies with the clinical, human anti-Nogo-A antibody were
also carried out on two species, rats and primates.
The severity, location and extent of spinal cord injury or stroke define the possible
treatment options and their efficacy. In complete spinal cord injured patients, for example,
in addition to growth promoting interventions, bridges would be required to allow
axotomized fibers to cross the lesion site (Bunge, 2001, Tetzlaff et al., 2011). In cases of
anatomically incomplete lesions, regenerating fibers are able to bypass the injury site when
supported by tissue bridges and pharmacological treatments, e.g. anti-Nogo-A, CSPG
degradation or stimulation of intrinsic neuronal growth mechanisms. The damage after
spinal cord injury in humans often occurs in the ventral spinal cord frequently affecting
more than one spinal segment, whereas in the experimental models the spinal cord is
lesioned by a dorsal approach with a well-defined transection or small contusion. Studies
with clinically more relevant lesions such as large compressions and contusions would be
valuable for direct comparison with clinical cases (Filli and Schwab, 2012). A recent study in
spinal cord contused rats treated with humanized NgR1(310)-Fc showed that regeneration
and locomotor recovery was promoted (Wang et al., 2014). Optimal treatments may need to
be defined depending on whether long distance regeneration or local sprouting of injured or
intact compensatory fibers are more desirable in a lesion with given location and extent.
For many of the animal experiments with Nogo pathway blockers acute treatment
regimens were applied. Delayed delivery of both Nogo-A and NgR1 neutralizing agents were
tested in rat models of spinal cord injury; the efficiency of the treatments was good with
treatment start at one week after injury, but declined
at two weeks after injury
(Gonzenbach et al., 2012, Wang et al., 2014). Interestingly, in stroke models delayed
treatment was effective even when started nine weeks after the infarct (Lee et al., 2004, Tsai
- 26 -
Chapter 1: Introduction
et al., 2011). For combined pharmacological and rehabilitative training therapy the timing
and the optimal time windows need to be taken into account. Parallel intensive treadmill
training together with anti-Nogo-A antibody treatment in the first two weeks after a spinal
cord lesion resulted in very poor functional recovery despite of a strong regenerative fiber
response (Maier et al., 2009). A similar result was seen after stroke. However, a sequential
treatment, first with the antibody followed in time by rehabilitative training was strongly
beneficial (Wahl et al., 2014). It is probable that the injured CNS goes through an initial
phase of sprouting and plasticity which can be enhanced by Nogo-A neutralization.
Subsequently, the newly formed connections have to be stabilized and functionally
meaningless connections have to be pruned by activity-dependent processes which can be
enhanced by intense rehabilitative training.
An important point concerns the best route of application of a drug. The blood-brainbarrier prevents or severely restricts access of many compounds, including antibodies, to
the intact CNS (Pardridge, 2002). At lesion or inflammatory sites, however, the blood-brainbarrier is open temporarily, allowing antibodies to penetrate into the surrounding CNS
tissue. In most of the spinal cord injury and stroke preclinical experiments, a direct
intrathecal way of application of antibodies, peptides or fusion proteins was chosen. By
lumbar subdural catheter infusion with osmotic minipumps, high levels of drugs can be
reached over 2-4 wks in the spinal cord. Distributed by the CSF circulation, antibodies can
also reach the brain in rats and monkeys (Weinmann et al., 2006).
Translating in vivo experiments to clinical studies also faces the challenge of
comparable and relevant functional outcome measures. For rats and higher vertebrates, a
detailed kinematic gait analysis, which is modelled after the human analysis techniques,
(Zorner et al., 2010) should replace the current simple, widely used, but subjective and nonlinear locomotor scores (Basso et al., 1995). Objective and quantitative assessments for
hand function, balance or bladder function are being developed for experimental animals.
Clinically, neurophysiological assessments (motor and somatosensory evoked potentials,
fMRI, TMS) also play important roles; many of these testing methods have been successfully
used in animals too (Curt et al., 2004). Additionally, the standardization of diagnosis and
functional assessment protocols is of high importance. Clinical data are collected in
databases (EMSCI, European Multicentre Study about Spinal Cord Injury; NACTN, North
American Clinical Trial Network) and serve as valuable data bases for the design and as
historical controls for future clinical studies.
The deficits of the bladder, bowel, and sexual function, and complications like chronic
pain or spasticity have a strong impact on the life quality of spinal cord injured patients.
These functions have not been extensively addressed in the preclinical studies. Anti-Nogo-A
- 27 -
Chapter 1: Introduction
antibody-treated rats with partial spinal cord transections regained autonomous bladder
function seven to nine days earlier than control antibody-administered rats. Furthermore, in
these animals the pain threshold was not altered (Liebscher et al., 2005), and the occurrence
and severity of spastic cramps were decreased (Gonzenbach et al., 2010, Gonzenbach et al.,
2012), suggesting that the treatment led to the stabilization of functionally correct circuits
for these functions. Importantly, none of the studies with Nogo-A suppressing treatments
reported pain, increased spasticity, discomfort or behavioural disturbances associated to
the therapy (Gonzenbach and Schwab, 2008).
In the long run and for the repair of very large lesions, multiple approaches are going
to be required in order to optimize regeneration and functional recovery. Alongside
treatments to overcome growth inhibition by myelin and the glial scar, well balanced and
timed stimulation of the neuronal growth program and implantation of artificial or cellular
bridges could be used. These pharmacological treatments then should be coordinated with
rehabilitative training to support the plastic changes in the CNS leading to functional
recovery.
2.3.4 Interventions blocking Nogo-A signalling in clinical trials for spinal cord injury
The first in-human anti-Nogo-A antibody phase I clinical trial was conducted with 52 acutely
spinal cord injured patients suffering of severe para- and tetraplegia in several centres in
Europe and Canada and was completed in September 2011 (Abel R et al., 2011)
(http://clinicaltrials.gov/ct2/show/NCT00406016). This study assessed the technical
feasibility, safety and pharmacokinetics of administering the fully human anti-Nogo-A
human antibody ATI355 (Novartis Pharma) intrathecally to patients with acute spinal cord
injury and confirmed AIS-A and B clinical classification. The antibody administration started
at 4-28 days after the injury by either continuous intrathecal infusion for up to 28 day or in
6 intrathecal bolus injections over 4 weeks. Infusions and injections were made into the
lumbar liquor space. The ATI355 antibody was very well tolerated and no serious adverse
events were reported. The bolus application had increased safety in comparison with
catheter-mediated infusions from external pumps. A multinational, multicentre phase II
placebo-controlled clinical trial is currently in preparation to assess the efficacy of the
treatment. This trial, which will be conducted in severe incomplete spinal cord injured
patents, requires optimized early diagnosis and sensitive, well standardized outcome
measures in all participating centres.
- 28 -
Chapter 1: Introduction
2.4 Regeneration after genetic deletion of Nogo-A and NgR1
Besides antibodies and pharmacological blockers aiming at Nogo-A signaling inhibition,
multiple genetically modified mouse lines lacking Nogo or its receptors have been generated
to study axonal regeneration in vivo (Table 2).
In 2003, three independent laboratories generated different Nogo-A deficient mice in
order to study the role of Nogo-A in axonal regeneration (Kim et al., 2003, Simonen et al.,
2003, Zheng et al., 2003). In Nogo-A knock-outs (KO), in which Nogo-B or –C expression is
preserved, in addition to enhanced regeneration of lesioned fibers, collateral sprouting of
intact nerve fibers was observed (Simonen et al., 2003). Extensive sprouting and improved
regeneration was only found in young mice lacking Nogo-A/B used by the Strittmatter
laboratory, which was associated with increased locomotor recovery (BBB scores) (Kim et
al., 2003). In these two studies, axonal regeneration could be increased to variable extents
by genetic deletion if Nogo-A in mice. In the third study, where a different line of Nogo-A/B
KOs and mice lacking Nogo-A/B/C were studied, the mice showed some CST sprouting, but
no longer distance regeneration (Zheng et al., 2003). The contradictory results obtained in
these Nogo KO studies were attributed to the age, genetic background and gene targeting
method of the mouse lines used, to the applied lesion paradigm and to the compensatory
up-regulation of other Nogo or growth inhibitory proteins (Woolf, 2003). Back-crossing
experiments indicated a major regeneration-enhancing effect of Nogo-A deletion in mice
and a strong influence of the genetic background (Dimou et al., 2006). Inhibitory guidance
cues (EphrinA3, EphA4, Sema4D and 3F and plexinB2) were shown to be up-regulated after
the loss of Nogo-A and are likely to contribute to the blockade of regeneration, as suggested
by the increased sprouting in Nogo-A/EphA4 double KO mice (Kempf et al., 2013).
Additionally, as the other common ligands, MAG and OMgp, for NgR1 are still present upon
deletion of Nogo-A, they, too, could hinder the initiated increased growth. To test this
hypothesis, Nogo-A, OMgp and MAG triple mutants were generated and were found to
exhibit greater axonal growth and improved locomotion, consistent with a principal role of
Nogo-A and overlapping actions of MAG and OMgp through their shared receptors (Cafferty
et al., 2010). However, a parallel study with independently generated Nogo-A, OMgp and
MAG triple KOs failed to show the synergistic effect of the three inhibitors in axonal
sprouting and functional recovery.
The relatively weak growth improvement in conventional Nogo-A KOs was attributed
to the ablation of the Nogo-A gene in both glial and neuronal cells. In the optic nerve, Nogo-A
KOs showed no regenerative improvement, however inflammation induced retinal ganglion
cell (RGC) growth was enhanced when Nogo-A was overexpressed in the RGCs of Nogo-A
- 29 -
Chapter 1: Introduction
KOs. Silencing Nogo-A in RGCs on the other hand, reduced axonal growth (Pernet et al.,
2011). The limited enhancement of axonal regeneration observed after CNS injury in
conventional, full KO mice therefore may partially be due to the lack of neuronal Nogo-A
expression that was shown to exert a positive function on the growth of RGC neurons.
Several studies with genetic NgR1 modulations were carried out in parallel to the
work on Nogo-A KOs. Studies with both conventional and conditional NgR1 gene deletions
show increased growth of corticospinal or raphespinal axons in the spinal cord (Kim et al.,
2004, Wang et al., 2011) and increased regeneration of RGCs after optic nerve crush injury
(Fischer et al., 2004a, Wang et al., 2012b). Other NgR family members have also been
reported to bind inhibitory molecules (NgR1 and 2: OMgp and MAG, NgR1, 2 and 3: CSPG)
(Dickendesher et al., 2012); Nogo receptor triple mutants (NgR1/2/3 KO) or NgR1 and
NgR3 double mutants showed enhanced axonal regeneration in the optic nerve.
Interestingly, the acute neutralization of Nogo-A or NgR1 consistently promoted
stronger regeneration of axons, suggesting that compensatory expression changes of other
inhibitory factors might play an important role in repressing axonal growth in the
genetically modified animals. Overall, a high degree of similarity is observed in acute
blocking treatments, irrespectively of the ways used to disrupt Nogo-A signaling (ligand,
receptor, intracellular signaling cascade). In light of a potential clinical application of these
interventions, however, it is encouraging that neutralization of Nogo-A and the underlying
signaling cascades leads to increased regeneration and improved functional recovery
without any adverse effects such as aberrant outgrowth from intact axons and hyperalgesia.
- 30 -
Chapter 1: Introduction
Table 2. Key in vivo studies with Nogo-A/NgR1 modified transgenic mouse lines
Knock-out
mouse line
Nogo-A KO
Study
Age, gender,
genetics
(Simonen
8-17wks,
et al., 2003) C57BL/6 and
129/SvJ crossed
mice, both
genders
Injury model
Verification of the model,
anatomical readout and effect
Complete Nogo-A KO, Nogo-B
strongly up-regulated. Decreased
inhibitory effect of spinal cord
extracts, 2wks past SCI increased
CST (BDA tracing) regrowth
towards and in lesion, more
frequent caudal sprouts from intact
fibers.
Myelin is less potent in inducing
growth cone collapse. 3wks post
SCI, axons in young adult Nogo-A/B
KO mice CST (BDA tracing) sprout
extensively rostral to a transection
and regenerate into distal cord
segments.
Nogo-A/B KO myelin has reduced
inhibitory activity, but 2-3wks post
SCI no obvious CST (BDA tracing)
sprouting or regeneration.
Functional readout and
effect
Only intact mice, no
major obvious
behavioral alterations.
Nogo-A/B KO
(trap allele)
(Kim et al.,
2003)
7-14wks,
129/SvJ 3-6
generations
backcrossed to
C57BL/6, female
SCI: dorsal
hemisection, T6
Nogo-A/B (atg
allele) and NogoA/B/C KO
(Zheng et
al., 2003)
SCI: dorsal
hemisection, T7-8
NgR1 KO
(Kim et al.,
2004)
6-14wks,
C57BL/6 and
129/SvJ crossed
mice
7-10wks,
C57BL/6 and
129/SvJ crossed
mice, female
SCI: dorsal
hemisection or
complete
transection, T8
CST regeneration is not affected
(BDA tracing), but raphespinal (5HT immunohistochemistry), likely
to mediate the improvement of
weight bearing postures) and
rubrospinal (Fluorogold retrograde
tracing) fiber sprouting occurs.
AAV mediated
NgR1DN or WT
NgR1
transduction in
female Sprague
Dawley rats
(160–180g)
ONC + lens injury
(Li et al.,
2005)
2-6months
C57BL/6 mice,
GFAP-driven
expression of
NgR(310)ecto.
SCI: dorsal overhemisection, T6
2wks after ONC, NgRDN-transfected
optic nerves increased axon
regeneration (GAP-43 staining)
several-fold but only along with
growth program activation.
Overexpression of WT NgR1
blocked almost all regeneration
even in lens-injured animals.
Gfap::ngr(310)ecto mice exhibit
enhanced raphespinal raphespinal
(5-HT immunohistochemistry) and
corticospinal (BDA tracing) axonal
sprouting into the lumbar SC.
Baseline hypoactivity
and motor impairment,
but increased recovery
of motor function (BBB
score) 2-21 days after
incomplete and 6wks
after complete SCI.
More enhanced
transcranial magnetic
motor-evoked
potentials.
N.A.
dominantnegative
NgR1 (NgR1DN)
(Fischer et
al., 2004a)
Transgenic
NgR(310)ecto
expression from
ascrocyte
NgR1 KO
(Zheng et
al., 2005)
6-13wks,
C57BL/6 and
129/SvJ crossed
mice, female
SCI: dorsal
hemisection, T7-8
Nogo-A/B (atg
allele) KO and
NgR1 KO
(Cafferty
and
Strittmatte
r, 2006)
7-9wks,
backcrossed to
C57BL/6
SCI : unilateral
pyramidotomy
(PyX)
Nogo-A KO,
different genetic
background
(Dimou et
al., 2006)
6-7wks,
C57BL/6 or
129X1/SvJ mice
SCI: dorsal bilateral
lesion, T8
Nogo-A/B KO
(trap and atg
allele)
(Steward et Both lines 8al., 2007)
10wks,
backcrossed to
C57BL/6
SCI: dorsal
hemisection, T8
SCI: dorsal
hemisection, T8
- 31 -
2-3wks post ONC, no obvious
differences in the regenerative
responses of the CST (BDA tracing)
of WT and NgR mutant mice were
observed.
4-6wks post PyX, pronounced
collateral sprouting of intact CST
fibers across the midline and into
denervated spinal cord in both
Nogo-A/B (atg allele) and NgR1
KOs.
2wks after SCI, 129X1/SvJ Nogo-A
knock-out mice had 2-4 times more
regenerating CST fibers (BDA
tracing) in the caudal SC than
C57BL/6 Nogo-A KO mice.
Dramatic pattern of ectopic axonal
labeling (with BDA tracing at the
time of injury, possibly by BDA
leakage into the cerebral ventricle)
in both knockout
and control mice, that is absent
BBB scores of adult
Nogo-A/B KO mice are
significantly higher
between 2–21 days
post-lesion.
Lack of improvement
in the BBB behavioral
score.
4 wks past SCI
recovery of BBB scores
and locomotion (gait:
cadence and stride
length) is improved in
the gfap::ngr(310)ecto
mice.
N.A.
4wks post PyX, in both
KOs recovery of paw
preference in the food
pellet retrieval task.
N.A.
N.A.
Chapter 1: Introduction
Nogo-A/B KO
(trap and atg
allele)
(Cafferty et 8 or 14wks,
al., 2007)
backcrossed to
C57BL/6
SCI: bilateral dorsal
hemisection, T7
Nogo-A, MAG,
and OMgp triple
KOs
(Cafferty et 2-4months,
al., 2010)
backcrossed to
C57BL/6
SCI: dorsal
hemisection, T6
Nogo-A, MAG,
and OMgp triple
KOs
(Lee et al.,
2010)
8-10wks,
C57BL/6 or
129X1/SvJ mice
SCI: T8 dorsal or
lateral hemisection,
complete
transection or
pyramidotomy
Nogo-A KO
(Pernet et
al., 2011)
2–4month, male
C57BL/6 mice
ONC + AAV2 virus
manipulations
(overexpression/si
lencing Nogo-A)
NgR1flox/floxxActin-Cre,
inducible CKO
(Wang et
al., 2011)
11-12wks,
C57BL/6, NgR1
deletion before
ONC or 75225days post
SCI.
ONC and SCI:
dorsal hemisection
NgR1, NgR2, NgR3
triple KOs
(Dickendes 6-8wks,
her et al.,
C57BL/6
2012)
ONC +/- Zymosan
NgR1 KO
(Wang et
al., 2012b)
11-12wks,
C57BL/6
ONC with Zymosan
at the time of the
injury
Nogo-A, EphA4
double KOs
(Kempf et
al., 2013)
20wks,
C57BL/6
SCI: (bilateral)
dorsal hemisection,
T8
when delaying BDA tracing by
4wks.
3wks post SCI, 14wk-old Nogo-A/B
KOtrap/trap have significantly less
regenerating CST and raphespinal
fibers than the 8wk-old KOs. NogoA/B KOtrap/trap mice have
significantly more axons caudal to
the lesion than do Nogo-A/B
KOtrap/atg or Nogo-A/B KOatg/atg mice.
Myelin lacking all three
inhibitors is less inhibitory
than Nogo-A-deficient myelin.
Also, 4wks post SCI, rostral CST
sprouting, CST regeneration
(BDA tracing) and 5-HT fiber
growth is the most enhanced in
the Nogo-A, MAG,
and OMgp triple KOs.
Deleting any of the three
inhibitors in mice enhanced
sprouting of corticospinal or
raphespinal serotonergic axons
(Nogo KO: CST, MAG or OMgp:
serotonergic axon sprouting), but
no synergstic effect was observed
in the triple KOs.
Nogo-A KOs show no regenerative
improvement, however
inflammation induced RGC growth
is enhanced when Nogo-A is
overexpressed in RGCs in Nogo-A
KOs. Silencing Nogo-A reduced
axonal growth capacity (CTB
tracing).
Increased RGC regeneration in the
NgR1 CKOs 2wks after ONC (GAP43 staining). Delayed deletion of
NgR1 75days post-SCI increased
5HT fiber density in the lumbar
cord.
3 wks post SCI, 14wkold Nogo-A/B KOtrap/trap
mice recovered less
well in BBB scores
than did the 8wk-old
mice of the same
genotype.
The triple-mutant mice
exhibit greater
improved locomotion
(BBB scores).
No behavioral
improvement
associated to
regeneration.
N.A.
Deletion of NgR1 in
chronic SCI condition
leads to improved
stepping performance,
motor behavior. Strong
correlation of 5HT
axon density with the
parameters measured
kinematically.
N.A.
Nogo receptor triple mutant or
NgR1 and NgR3 double mutant, but
not single mutants showed
enhanced axonal regeneration
(GAP-43 staining).
NgR1−/− mice show substantial
N.A.
optic nerve regeneration, and NgR1
disruption synergizes with
macrophage activation (Zymosan),
>2mm regenerating fibers (GAP-43
stained) past the ONC site.
Nogo-A/EphA4 double KO mice
N.A.
show increased axonal sprouting
and regeneration 24 days after SCI
(BDA tracing).
Abbreviations: AAV, adeno-associated virus; BDA, biotinylated dextran amine; CKO, conditional
knock-out; CST, corticospinal tract; CTB, cholera toxin-β-subunit; KO, knock-out; N.A. not assessed;
ONC, optic nerve crush; RGC, retinal ganglion cell; SCI, spinal cord injury; wk, week.
- 32 -
Chapter 1: Introduction
2.5 Regeneration in the visual system
2.5.1 The optic nerve crush as an excellent model system to study axonal regeneration in the
CNS
The retina and the optic nerve are developmentally derived from the anterior part of the
neural tube, from the diencephalon, and therefore are part of the CNS. The retina is
composed of layers of specialized neurons, and axons in the optic nerve stem from a single
cell population or projection neurons, the retinal ganglion cells (RGCs). These axons are
myelinated by brain-derived oligodendrocytes (Ono et al., 1997). In rodents, there are no
oligodendrocytes in the retina, only in the optic nerve, and no neuronal cell bodies are
present in the optic nerve. The retina and optic nerve therefore provide a well
compartmentalized system to separately study the role of neurons and oligodendrocytes in
axonal regeneration.
The retina and optic nerve offer a number of advantages to investigate the
mechanisms underlying several CNS pathologies (London et al., 2013). The eye shares many
anatomical, functional and immunological features with other CNS regions; much of our
understanding regarding the processes of neuroprotection, cell renewal and axonal
regeneration has emerged from studies performed in the retina and optic nerve.
Spontaneous axonal regeneration after an injury is, as in other CNS regions, relatively
poor in the adult optic nerve. This lack of RGC axonal regrowth is due to their insufficient
intrinsic neuronal growth potential, the axotomy-induced apoptotic cell death and the
growth-inhibiting environment composed of the myelin, the glial scar formed by reactive
astrocytes and the repulsive extracellular matrix. Early studies from Cajal’s student, F. Tello,
demonstrated that some RGCs can extend axons into peripheral nerve grafts attached to the
cut optic nerve of rabbits (Ramón y Cajal et al., 1991). This observation was the first hint
showing that mature CNS neurons retain some capacity to regenerate their axons. Further
systematic experiments by Aguayo and his colleagues confirmed this finding (Aguayo et al.,
1987), using the regrowth of optic nerve axons through peripheral nerve grafts as bridges
up to visual targets such as the superior colliculus.
The popularity of the optic nerve crush (ONC) injury model in the orbit (Figure 3A)
stems from the easy accessibility of the optic nerve and from the simple way RGCs can be
experimentally manipulated by intra-ocular injections. Detailed knowledge can be acquired
from this system; comprehensive, general conclusions regarding regeneration and neuronal
survival in the CNS can be drawn from experiments performed in the visual system. The
advantages using the ONC model are threefold:
- 33 -
Chapter 1: Introduction
Figure 3. Optic nerve crush (ONC) as model to study axonal regeneration and cell survival
after CNS injury. (A) In order to perform retro-bulbar optic nerve crush, the optic nerve is exposed
intra-orbitally and then crushed by tying a knot with a 9-0 suture at ~0.5mm from the back of the
eye. Careful removal of the suture ensures a well-defined lesion site that disrupts all RGC axons and a
consequent fundus examination controls the integrity of the ophthalmic artery. (B) By intraocular
injection RGCs are readily accessible for pharmacological treatments and gene therapy. After ONC,
the optic axons can be anterogradely traced by intraocularly injecting cholera toxin B conjugated to
Alexa594 (CTB-A594). (C) CTB-A594-positive regenerating axons can be observed on longitudinal
optic nerve sections (D) or on whole-mounted, transparent optic nerves. (E) RGC survival can be
examined on retinal flat-mount preparations stained for a neuronal marker, III-Tubulin.
- 34 -
Chapter 1: Introduction
1) RGCs are readily accessible for pharmacological treatments and gene therapy by
intraocular injection (Figure 3B). Sustained expression of growth factors can be required to
reach significant levels of axon growth stimulation after injury. For example, depending on
the half-life of cytokines and neurotrophic factors, their injection into the eyeball result in
high concentrations in the vitreous liquid and due to their anatomical proximity, RGCs can
be directly targeted. In addition, recently a new serotype of the adeno-associated virus
(AAV), AAV2 has been shown to specifically infect RGCs with high rate, allowing targeted
manipulation of signaling pathways involved in cell survival and regeneration (Cheng et al.,
2002, Pernet et al., 2005). However, other AAV variants have been shown to efficiently and
selectively infect Müller cells, thereby opening new possible ways for drug delivery
(Klimczak et al., 2009, Pernet et al., 2013a). Additionally, RGCs take up and anterogradely
transport cholera toxin B (in many cases conjugated with Alexa594) with high efficiency and
this provides an excellent tracing method labelling almost 100% of RGC axons in the optic
nerve.
2) The optic nerve consists of a long, continuous tract of axons that are not
interrupted by interneurons, rendering the optic nerve ideal for regeneration studies. Both
local sprouting after the lesion site and long distance regeneration to the targets can be
addressed in this system on longitudinal tissue sections, or recently also in whole mounted
transparent optic nerves (Figure 3C and D). Shortly after the lesion site, local arborization
and branching of regenerating axons can be studied in the complex environment composed
by CNS myelin, the glial scar and the surrounding extracellular matrix (ECM). In the
retrobulbar ONC model, re-growing axons need to regenerate several millimeters towards
the brain for successful target innervation. By overcoming the intrinsic limitations and
extrinsic hurdles affecting regeneration, recent studies reported full regrowth of a few RGC
axons to the brain (de Lima et al., 2012a). However, there are new questions such as path
finding and guidance, target recognition, synapse formation, pruning and formation of
functional circuits for these re-growing axons; they can be addressed by newly developed 3dimensional tracing techniques of individual axons in the transparent optic nerve and brain
(Luo et al., 2013, Pernet and Schwab, 2014).
3) Besides axonal regeneration, neuronal survival can also be studied after an optic
nerve injury. More than 80% of the RGCs undergo apoptosis 2 weeks after the injury
(Berkelaar et al., 1994). RGCs start dying 5-6 days after intraorbital optic nerve injury, and
this distance-dependent onset of apoptosis may be due to the lack of target-derived
neurotrophic factors. Neuronal survival can be investigated on flat-mount preparations of
injured retinae (Figure 3E). Interestingly, although promoting neuronal survival should
logically lead to increased regenerative potential, as survival of RGCs is a prerequisite for
- 35 -
Chapter 1: Introduction
axonal regeneration, the two phenomena can involve distinct and sometimes antagonistic
mechanisms (Goldberg and Barres, 2000, Pernet and Di Polo, 2006, Huntwork-Rodriguez et
al., 2013, Watkins et al., 2013).
2.5.2 Regeneration studies in the visual system
In the 1980s, the optic nerve injury paradigm became a model of choice and early
experiments reported improved survival and/or regeneration after peripheral nerve graft
implantation or by intraocular neurotrophic factor injection (Bray et al., 1991, MansourRobaey et al., 1994). Since then important milestones has been reached by using this model,
demonstrating that under certain conditions mature RGCs can be transformed into a
regenerative state allowing cell survival and axonal regrowth (Figure 4).
During development, RGCs are in an active growth state and express axon growth
associated genes, but this growth rate dramatically decreases by postnatal day 2 (Goldberg
et al., 2002). The first robust regeneration results in adult RGCs were reported after
experimental lens injury (Fischer et al., 2000, Leon et al., 2000) and this intervention led to
the up-regulation of SPRR1A and GAP43, two important growth-associated genes (Bonilla et
al., 2002, Fischer et al., 2004b). The same regeneration phenotype was observed after
intravitreal injection of Toll-like receptor agonists (Zymosan or Pam3Cys) leading to
experimental inflammation (Yin et al., 2003, Hauk et al., 2008, Hauk et al., 2010, Pernet et al.,
2011). The underlying mechanisms of lens injury and Zymosan induced regeneration were
shown to be the infiltration of activated macrophages and neutrophils and the expression of
multiple factors promoting cell survival and regeneration, such as oncomodulin (Yin et al.,
2006, Yin et al., 2009, Kurimoto et al., 2013). Moreover, retinal astrocytes and Müller cells
also undergo activation and secrete ciliary neurotrophic factor (CNTF) and leukemia
inhibitory factor (LIF) for RGCs under these inflammatory conditions (Muller et al., 2007,
Leibinger et al., 2009) (Figure 4A). However, after ONC injury, the loss of target-derived
neurotrophic support, mainly the lack of brain-derived neurotrophic factor (BDNF) leads to
progressive RGC apoptosis (Liu et al., 2011) (Figure 4A).
Switching adult RGCs into a growth state by modulating transcription factors such as
KLFs (Moore et al., 2009, Moore et al., 2011, Steketee et al., 2014) or by the
blockade/release of signaling pathways strongly promoted axonal regeneration (Liu et al.,
2011) (Figure 4A). Activation of a major growth-regulator, mTOR, shed light on the
importance of the PI3K/AKT/mTOR pathway in axonal regeneration, first in RGCs and
subsequently in the spinal cord. Activation of mTOR by genetic deletion of PTEN, its
negative regulator, induced axonal regeneration and enhanced neuroprotection in RGCs
- 36 -
Chapter 1: Introduction
Figure 4. Cellular and molecular mechanisms limiting regeneration and axon guidance in the
optic nerve. Factors that limit axonal regeneration are present both in the retina and in the optic
nerve. (A) Besides the intrinsic growth potential of RGCs defining their regenerative capacity,
activated Müller cells and infiltrating immune cells secrete pro or anti-regeneration/survival factors
such as CNTF, BDNF, LIF, oncomodulin or IL-6. (B) The combination of reactive astrocytes and
infiltrating macrophages contribute to the formation of glial scar around the optic nerve lesion site
that expresses CSPGs and represent a first line of barrier for re-growing axons. Additionally, the
myelin debris, myelin associated inhibitory proteins (Nogo-A, MAG, OMgp) and repulsive axon
guidance molecules (Ephrins and Semaphorins) render the adult optic nerve a hostile environment
for regeneration. (C) Following intense growth program activation, a number of RGC axons reach the
optic chiasm and follow normal trajectories in the contralateral optic tract (green). However, some of
- 37 -
Chapter 1: Introduction
these axons regenerating to long distances misroute to the contralateral optic nerve (blue) or
ipsilateral optic tract (purple). In the optic nerve, past the lesion site, several aberrant grow
phenotypes such as axonal branching (red) or axonal U-turn (yellow) can be observed.
(Park et al., 2008) and was further potentiated by the co-deletion of SOCS3, a feedback
inhibitor of the JAK/STAT3 pathway (Sun et al., 2011). Likewise, the activation of STAT3
was found to be important in initiating axonal growth (Muller et al., 2009, Pernet et al.,
2013b). In another line of research, elevating the intracellular levels of cyclic adenosine
monophosphate (cAMP) in combination with CNTF treatment was shown to be sufficient to
switch RGCs into growth state and helped them overcoming inhibition by the myelin
environment (Cai et al., 2002, Cui et al., 2003, Gao et al., 2004).
In order to promote long distance and abundant regeneration of RGCs reaching the
target regions, many laboratories applied combinational treatment regimens. Deletion of
PTEN along with SOCS3 yielded lengthy regeneration with newly grown axons reaching the
optic chiasm (Sun et al., 2011). Even more impressive regeneration was observed when
along with PTEN deletion, inflammatory molecules (oncomodulin) and cell permeable cAMP
(CPT-cAMP) were administered into the eyeball at the time of optic nerve injury (Kurimoto
et al., 2010). By applying a similar treatment regimen (PTEN deletion, Zymosan, CPT-cAMP),
Lima et al. found that some regenerating RGC axons extended all the way till their targets
(the lateral geniculate nucleus in the thalamus and superior colliculus in the midbrain) and
that this regeneration led to partial visual recovery (de Lima et al., 2012a). As promising as
these results are, so far these findings could not be reproduced (Diekmann et al., 2013, Luo
et al., 2013).
Beside the intrinsic insufficiency of RGCs to regrow their axons, the previously
described extracellular inhibitory environment represents a great barrier for long distance
regeneration (Figure 4B). Not surprisingly, acting on the myelin inhibitory environment (by
NgR or Nogo-A deletion) in combination with boosting the intrinsic growth program (by
Zymosan or Pam3Cys induced inflammation) yielded synergetic effects on axonal
regeneration (Pernet et al., 2011, Wang et al., 2012a). Combined application of anti-Nogo-A
antibody (IN-1) and CNTF had a synergistic effect in the intraorbital ON crush paradigm (Cui
et al., 2004). Additionally, Stat3 overexpression together with the application of a ROCK
blocker leading to Rho-A signaling inhibition also led to further increased regeneration
(Pernet et al., 2013b). In this and further studies, the importance of not only the distance but
also the directionality and guidance of regenerating axons arose. Few laboratories reported
that although the number regrowing axons can be successfully promoted, these fibers very
often follow irregular trajectories, show abnormal morphologies and misrouting at decision
points, such as the optic chiasm (Giger et al., 2010, Diekmann et al., 2013, Luo et al., 2013,
- 38 -
Chapter 1: Introduction
Pernet et al., 2013a, Pernet et al., 2013b) (Figure 4C). These observations were enabled by
the improved tissue clearing methods and 3D analysis of regenerating axons. Further
research should be carried out with detailed growth analysis in order to understand how we
can provide regenerating RGC axons the correct guidance cues, and enable them to reestablish functionally relevant connections in the visual targets.
2.5.3 From the optic nerve to the spinal cord
In summary, the ONC injury paradigm serves as a model on its own providing valuable
insights for finding the best treatment promoting axonal regeneration. Importantly, it was
also proved to provide a link to spinal cord injury research. Target innervation and
functional recovery is a challenging goal in the regenerating optic nerve, where axons need
to regenerate for long distances in a hostile environment composed of mostly myelinated
tracts. In the spinal cord, however, regenerating or sprouting axons can extend towards
intact neuronal circuits that are in their close proximity and can form new connections with
these neurons. Additionally, the pre-existing, non-injured, spared fibers respond to the
injury with intensive sprouting and compensate for the lost connections. Another point of
difference is the substantial cell death that follows a retrobulbar optic nerve injury (given
the fact that the RGC cell bodies are in direct vicinity to the injury), but is absent from other
CNS areas, as the neurons projecting to the injured tracts are mostly located further away.
Even though the two systems possess different anatomical and neuronal survival features,
transferability of the results from the optic nerve to the spinal cord helped the progress of
finding a cure for devastating CNS injuries.
3 Expression pattern of Nogo-A in the visual system: implications on intracellular and
extracellular cell-type specific functions
Possible neuronal functions of Nogo-A are the subject of increasing interest, especially those
fulfilled during development, in plastic CNS regions and after injury, when the expression
level of the protein suggests crucial roles in neurite growth. On the cellular level Nogo-A is
particularly abundant in the endoplasmic reticulum (ER), however, it is also present on the
cell surface, both on the axon shafts and growth cones of neurons (Dodd et al., 2005).
Neutralization of neuronal Nogo-A by a function-blocking antibody, genetic ablation of
Nogo-A, or function blocking antibodies against the Nogo receptor NgR1 have been shown
to increase fasciculation and decrease branching of cultured dorsal root ganglion axons
(Petrinovic et al., 2010). Localization of Nogo-A to the axon shaft might render
- 39 -
Chapter 1: Introduction
unmyelinated neurite surfaces repulsive to each other, suggesting that neuron-to-neuron
inhibitory Nogo-A signaling takes places during development. Another study suggested that
Nogo-A can self-limit axon outgrowth in a cell autonomous manner in primary cortical
neurons (Dickson et al., 2010).
However, Nogo-A is also present in the axonal growth cones where the relation of the
protein to the growth machinery needs to be further investigated. Several recent studies
have suggested that in contrast to myelin Nogo-A, neuronal Nogo-A might be beneficial for
regeneration in injured conditions. Firstly, Nogo-A expression was found to be increased in
retinal ganglion cells (RGCs) after optic nerve crush injury, and the up-regulation of Nogo-A
was not involved in injury-induced cell death (Pernet et al., 2011). Secondly, silencing NogoA selectively in RGCs resulted in marked reduction of regenerative sprouting and decreased
the expression growth-associated molecules. Thirdly, axonal regeneration was not notably
enhanced in conventional Nogo-A knock-out animals, in which both glial and neuronal
Nogo-A is deleted.
The expression pattern of Nogo-A in the retina and optic nerve also suggests cell-type
specific, segregated functions for this protein. In the optic nerve, Nogo-A is present in
oligodendrocytes and activates Nogo-A signaling leading to the Rho-A pathway activation in
injured neurons eventually leading to growth cone collapse and the blockade of axonal
regeneration (Figure 5A). In intact retinae of adult mice, the bulk of Nogo-A is expressed by
Müller glial cells, localized to the end-feet surrounding retinal ganglion cell bodies (Figure
5B). Even though the function of Nogo-A in Müller cells is not yet understood, this close
proximity of the Nogo receptor expressing RGCs suggests close interaction between the two
cell types. Nogo-A is up-regulated in about 50% of RGCs following optic nerve crush. Both
Nogo-A receptors, NgR1 and S1PR2 receptors are also expressed (Wang et al., 2002c) in
injured, Nogo-A overexpressing RGCs (Figure 5B) that showed increased regeneration in the
optic nerve. These findings led us to the hypothesis that the Nogo-A ligand may bind to its
receptors in cis position (intracellularly or on the neuronal cell surface) and thereby prevent
inhibitory signaling originating from the extracellular, myelin Nogo-A presented in trans.
This phenomenon has previously been described for axonal guidance molecules such as
Ephrins and Semaphorins.
Similarly to Nogo-A and its receptors, members of the ephrin and Eph ligand-receptor
family fulfil repulsive cell surface functions (Klein, 2004) via forward signaling through
Ephs or reverse signaling through ephrins (Egea and Klein, 2007). Expression mapping of
these molecules in several nervous system regions revealed that ephrins and Ephs are
coexpressed in the same neurons during the period of axon outgrowth. This finding has
further complicated the bidirectional signaling system, raising the possibility of cis-
- 40 -
Chapter 1: Introduction
Figure 5. Nogo-A expression and function in the retina and optic nerve. (A) In the optic nerve,
Nogo-A is present in oligodendrocytes and activates Nogo-A signaling (Rho-A pathway) on neurons
that eventually lead to growth cone collapse and the blockade of axonal regeneration. (B) In intact
retinae of adult mice, the bulk of Nogo-A is expressed by Müller glial cells, localized to the end-feet
surrounding RGC cell bodies. Even though the function of Nogo-A in Müller cells is not yet
understood, this close proximity of the Nogo receptor expressing RGCs suggest close interaction.
Nogo-A is up-regulated in about 50% of RGCs following optic nerve crush and these RGCs express
both Nogo-A-∆20 and Nogo-66 receptors, S1PR2 and NgR1.
- 41 -
Chapter 1: Introduction
interaction between the receptor and ligand, namely that the ephrin molecule presented in
cis position could block the signaling of the trans ligand through Eph receptors. The cisligand may sequester the receptor and block the binding of the exogenous ligand, or inhibit
downstream signaling elements activated by the trans-ligand, prevent the receptors cell
surface expression or alternatively act as a competitor of the trans ephrin molecule. This
hypothesis has been confirmed to help the axonal pathfinding of the lateral motor column
neurites in the peripheral targets (Kao and Kania, 2011) and to function as an axon guidance
mechanism for the retinotectal projections in the CNS (Hornberger et al., 1999).
Additionally, multiple EphA receptors and ephrin-A ligands are expressed in gradients in the
developing visual system (Huberman et al., 2005), both in the retina and in different brain
targets, raising the possibility that correct patterning of not only retinocollicular but also
retinogeniculate projections could depend on cis-interaction. A similar mechanism of ligandreceptor cis-interaction leading to blockade of signal transduction was recently shown for
the semaphorins, another family of developmental axonal guidance molecules (HaklaiTopper et al., 2010). The simultaneous presence of Nogo-A and its receptors in RGCs
therefore raised the possibility that through cis-interaction Nogo-A could limit signaling via
NgR1 and S1PR2 and thereby counteract growth inhibition by myelin inhibitory cues.
In addition to the plausible pro-regenerative function of Nogo-A in neurons, several
studies suggested that neuronal Nogo-A might play a cell-autonomous role in improving
neuronal survival. One proposed mechanism is the protection by Nogo-A against oxidative
insult through interaction with Prdx2 and by scavenging ROS (Mi et al., 2012), by inhibiting
NADPH oxidase-mediated oxidative damage (Guo et al., 2013) or by functioning as an antistress platform through its central domain NiG, recruiting cytoprotective proteins including
Apg-1 and Prdx2 (Kern et al., 2013). Additionally, it has recently been described that the
Nogo-A protein levels are increased in cortical and thalamic neurons after stroke
(Cheatwood et al., 2008), and that Nogo-A could promote neuronal survival by controlling
the Rac1/Rho-A balance (Kilic et al., 2010). Along this line, blocking Rho-A activation after
spinal cord injury protected cells from p75NTR-dependent apoptosis (Dubreuil et al., 2003).
Additionally, recently a study showed that the loss of RTN4 alter ER morphology and RTN4
depleted cells fail to sustain elevated cytoplasmic Ca2+ levels, therefore are less susceptible
to Ca2+ overload induced apoptosis (Jozsef et al., 2014).
4 Conclusions
In the injured CNS, Nogo-A derived from oligodendrocytes appears to be a major inhibitor
for axonal regeneration. Many studies have reported that neutralization of Nogo-A or Nogo
- 42 -
Chapter 1: Introduction
receptor complex members improved axonal growth and plasticity and enhanced functional
recovery after injury. Clinical studies are currently ongoing with function blocking antiNogo-A antibodies in multiple CNS disease areas such as spinal cord injury, stroke, ALS and
MS. However, the expression of Nogo-A in physiological conditions and in a large population
of neurons during development and even in the adulthood suggests further functions for
Nogo-A, such as its influence in cell migration and myelination during development,
synaptic plasticity and cell survival. Our recent studies also suggested that not only glial, but
also neuronal Nogo-A could influence axonal growth and that this neuronal counterpart
might be beneficial for axonal regeneration. The research presented in this thesis therefore
aimed to provide, at least in part, answers for the glial versus neuronal cell type-specific
functions of Nogo-A, on how they regulate axonal growth and neuronal survival.
References
Abel R, Baron HC, Casha S, Harms J, Hurlbert J, Kucher K, Maier D, Thietje R, Weidner N, A C
(2011) Therapeutic anti-Nogo-A antibodies in acute spinal cord injury: safety and
pharmacokinetic data from an ongoing first-in-human trial. In: ISCOS Meeting
Washington D.C.
Aguayo AJ, Vidal-Sanz M, Villegas-Perez MP, Bray GM (1987) Growth and connectivity of
axotomized retinal neurons in adult rats with optic nerves substituted by PNS grafts
linking the eye and the midbrain. Ann N Y Acad Sci 495:1-9.
Akbik FV, Bhagat SM, Patel PR, Cafferty WB, Strittmatter SM (2013) Anatomical plasticity of
adult brain is titrated by Nogo Receptor 1. Neuron 77:859-866.
Akhavan D, Cloughesy TF, Mischel PS (2010) mTOR signaling in glioblastoma: lessons
learned from bench to bedside. Neuro Oncol 12:882-889.
Alabed YZ, Grados-Munro E, Ferraro GB, Hsieh SH, Fournier AE (2006) Neuronal responses
to myelin are mediated by rho kinase. J Neurochem 96:1616-1625.
Aloy EM, Weinmann O, Pot C, Kasper H, Dodd DA, Rulicke T, Rossi F, Schwab ME (2006)
Synaptic destabilization by neuronal Nogo-A. Brain Cell Biol 35:137-156.
Atwal JK, Pinkston-Gosse J, Syken J, Stawicki S, Wu Y, Shatz C, Tessier-Lavigne M (2008) PirB
is a functional receptor for myelin inhibitors of axonal regeneration. Science
322:967-970.
Baldwin K, Raiker S, Giger R (2011) Nogo-A negatively regulates mTor signaling to inhibit
synaptic function. Society for Neuroscience, Neuroscience 2011 poster 216.204.
Bandtlow CE, Schmidt MF, Hassinger TD, Schwab ME, Kater SB (1993) Role of intracellular
calcium in NI-35-evoked collapse of neuronal growth cones. Science 259:80-83.
Bareyre FM, Kerschensteiner M, Raineteau O, Mettenleiter TC, Weinmann O, Schwab ME
(2004) The injured spinal cord spontaneously forms a new intraspinal circuit in
adult rats. Nat Neurosci 7:269-277.
Basso DM, Beattie MS, Bresnahan JC (1995) A sensitive and reliable locomotor rating scale
for open field testing in rats. J Neurotrauma 12:1-21.
Baumer BE, Kurz A, Borrie SC, Sickinger S, Dours-Zimmermann MT, Zimmermann DR,
Bandtlow CE (2014) Nogo receptor homolog NgR2 expressed in sensory DRG
neurons controls epidermal innervation by interaction with Versican. J Neurosci
34:1633-1646.
- 43 -
Chapter 1: Introduction
Benson MD, Romero MI, Lush ME, Lu QR, Henkemeyer M, Parada LF (2005) Ephrin-B3 is a
myelin-based inhibitor of neurite outgrowth. Proc Natl Acad Sci U S A 102:1069410699.
Berkelaar M, Clarke DB, Wang YC, Bray GM, Aguayo AJ (1994) Axotomy results in delayed
death and apoptosis of retinal ganglion cells in adult rats. J Neurosci 14:4368-4374.
Blesch A, Fischer I, Tuszynski MH (2012) Gene therapy, neurotrophic factors and spinal cord
regeneration. Handb Clin Neurol 109:563-574.
Bonilla IE, Tanabe K, Strittmatter SM (2002) Small proline-rich repeat protein 1A is
expressed by axotomized neurons and promotes axonal outgrowth. J Neurosci
22:1303-1315.
Bray GM, Villegas-Perez MP, Vidal-Sanz M, Carter DA, Aguayo AJ (1991) Neuronal and
nonneuronal influences on retinal ganglion cell survival, axonal regrowth, and
connectivity after axotomy. Ann N Y Acad Sci 633:214-228.
Bregman BS, Kunkel-Bagden E, Schnell L, Dai HN, Gao D, Schwab ME (1995) Recovery from
spinal cord injury mediated by antibodies to neurite growth inhibitors. Nature
378:498-501.
Brosamle C, Huber AB, Fiedler M, Skerra A, Schwab ME (2000) Regeneration of lesioned
corticospinal tract fibers in the adult rat induced by a recombinant, humanized IN-1
antibody fragment. The Journal of neuroscience : the official journal of the Society
for Neuroscience 20:8061-8068.
Bunge MB (2001) Bridging areas of injury in the spinal cord. Neuroscientist 7:325-339.
Cafferty WB, Duffy P, Huebner E, Strittmatter SM (2010) MAG and OMgp synergize with
Nogo-A to restrict axonal growth and neurological recovery after spinal cord trauma.
J Neurosci 30:6825-6837.
Cafferty WB, Kim JE, Lee JK, Strittmatter SM (2007) Response to correspondence: Kim et al.,
"axon regeneration in young adult mice lacking Nogo-A/B." Neuron 38, 187-199.
Neuron 54:195-199.
Cafferty WB, Strittmatter SM (2006) The Nogo-Nogo receptor pathway limits a spectrum of
adult CNS axonal growth. J Neurosci 26:12242-12250.
Cai D, Deng K, Mellado W, Lee J, Ratan RR, Filbin MT (2002) Arginase I and polyamines act
downstream from cyclic AMP in overcoming inhibition of axonal growth MAG and
myelin in vitro. Neuron 35:711-719.
Caroni P, Schwab ME (1988) Two membrane protein fractions from rat central myelin with
inhibitory properties for neurite growth and fibroblast spreading. The Journal of cell
biology 106:1281-1288.
Cheatwood JL, Emerick AJ, Schwab ME, Kartje GL (2008) Nogo-A expression after focal
ischemic stroke in the adult rat. Stroke 39:2091-2098.
Chen MS, Huber AB, van der Haar ME, Frank M, Schnell L, Spillmann AA, Christ F, Schwab ME
(2000) Nogo-A is a myelin-associated neurite outgrowth inhibitor and an antigen for
monoclonal antibody IN-1. Nature 403:434-439.
Cheng L, Sapieha P, Kittlerova P, Hauswirth WW, Di Polo A (2002) TrkB gene transfer
protects retinal ganglion cells from axotomy-induced death in vivo. J Neurosci
22:3977-3986.
Chong SY, Rosenberg SS, Fancy SP, Zhao C, Shen YA, Hahn AT, McGee AW, Xu X, Zheng B,
Zhang LI, Rowitch DH, Franklin RJ, Lu QR, Chan JR (2012) Neurite outgrowth
inhibitor Nogo-A establishes spatial segregation and extent of oligodendrocyte
myelination. Proc Natl Acad Sci U S A 109:1299-1304.
Courtine G, Bunge MB, Fawcett JW, Grossman RG, Kaas JH, Lemon R, Maier I, Martin J, Nudo
RJ, Ramon-Cueto A, Rouiller EM, Schnell L, Wannier T, Schwab ME, Edgerton VR
(2007) Can experiments in nonhuman primates expedite the translation of
treatments for spinal cord injury in humans? Nature medicine 13:561-566.
Cui Q, Cho KS, So KF, Yip HK (2004) Synergistic effect of Nogo-neutralizing antibody IN-1
and ciliary neurotrophic factor on axonal regeneration in adult rodent visual
systems. J Neurotrauma 21:617-625.
- 44 -
Chapter 1: Introduction
Cui Q, Yip HK, Zhao RC, So KF, Harvey AR (2003) Intraocular elevation of cyclic AMP
potentiates ciliary neurotrophic factor-induced regeneration of adult rat retinal
ganglion cell axons. Mol Cell Neurosci 22:49-61.
Curt A, Schwab ME, Dietz V (2004) Providing the clinical basis for new interventional
therapies: refined diagnosis and assessment of recovery after spinal cord injury.
Spinal Cord 42:1-6.
David S, Aguayo AJ (1981) Axonal elongation into peripheral nervous system "bridges" after
central nervous system injury in adult rats. Science 214:931-933.
de Lima S, Koriyama Y, Kurimoto T, Oliveira JT, Yin Y, Li Y, Gilbert HY, Fagiolini M, Martinez
AM, Benowitz L (2012a) Full-length axon regeneration in the adult mouse optic
nerve and partial recovery of simple visual behaviors. Proc Natl Acad Sci U S A
109:9149-9154.
de Lima S, Koriyama Y, Kurimoto T, Oliveira JT, Yin Y, Li Y, Gilbert HY, Fagiolini M, Martinez
AM, Benowitz L (2012b) Full-length axon regeneration in the adult mouse optic
nerve and partial recovery of simple visual behaviors. Proc Natl Acad Sci U S A
109:9149-9154.
Delekate A, Zagrebelsky M, Kramer S, Schwab ME, Korte M (2011) NogoA restricts synaptic
plasticity in the adult hippocampus on a fast time scale. Proc Natl Acad Sci U S A
108:2569-2574.
Dergham P, Ellezam B, Essagian C, Avedissian H, Lubell WD, McKerracher L (2002) Rho
signaling pathway targeted to promote spinal cord repair. J Neurosci 22:6570-6577.
Dickendesher TL, Baldwin KT, Mironova YA, Koriyama Y, Raiker SJ, Askew KL, Wood A,
Geoffroy CG, Zheng B, Liepmann CD, Katagiri Y, Benowitz LI, Geller HM, Giger RJ
(2012) NgR1 and NgR3 are receptors for chondroitin sulfate proteoglycans. Nat
Neurosci 15:703-712.
Dickson HM, Zurawski J, Zhang H, Turner DL, Vojtek AB (2010) POSH is an intracellular
signal transducer for the axon outgrowth inhibitor Nogo66. J Neurosci 30:1331913325.
Diekmann H, Leibinger M, Fischer D (2013) Do growth-stimulated retinal ganglion cell
axons find their central targets after optic nerve injury? New insights by threedimensional imaging of the visual pathway. Exp Neurol 248C:254-257.
Dimou L, Schnell L, Montani L, Duncan C, Simonen M, Schneider R, Liebscher T, Gullo M,
Schwab ME (2006) Nogo-A-deficient mice reveal strain-dependent differences in
axonal regeneration. J Neurosci 26:5591-5603.
Dodd DA, Niederoest B, Bloechlinger S, Dupuis L, Loeffler JP, Schwab ME (2005) Nogo-A, -B,
and -C are found on the cell surface and interact together in many different cell
types. J Biol Chem 280:12494-12502.
Domeniconi M, Cao Z, Spencer T, Sivasankaran R, Wang K, Nikulina E, Kimura N, Cai H, Deng
K, Gao Y, He Z, Filbin M (2002) Myelin-associated glycoprotein interacts with the
Nogo66 receptor to inhibit neurite outgrowth. Neuron 35:283-290.
Dubreuil CI, Winton MJ, McKerracher L (2003) Rho activation patterns after spinal cord
injury and the role of activated Rho in apoptosis in the central nervous system. J Cell
Biol 162:233-243.
Dupuis L, Gonzalez de Aguilar JL, di Scala F, Rene F, de Tapia M, Pradat PF, Lacomblez L,
Seihlan D, Prinjha R, Walsh FS, Meininger V, Loeffler JP (2002) Nogo provides a
molecular marker for diagnosis of amyotrophic lateral sclerosis. Neurobiol Dis
10:358-365.
Egea J, Klein R (2007) Bidirectional Eph-ephrin signaling during axon guidance. Trends Cell
Biol 17:230-238.
Filli L, Schwab ME (2012) The rocky road to translation in spinal cord repair. Ann Neurol
72:491-501.
Fischer D, He Z, Benowitz LI (2004a) Counteracting the Nogo receptor enhances optic nerve
regeneration if retinal ganglion cells are in an active growth state. J Neurosci
24:1646-1651.
- 45 -
Chapter 1: Introduction
Fischer D, Pavlidis M, Thanos S (2000) Cataractogenic lens injury prevents traumatic
ganglion cell death and promotes axonal regeneration both in vivo and in culture.
Invest Ophthalmol Vis Sci 41:3943-3954.
Fischer D, Petkova V, Thanos S, Benowitz LI (2004b) Switching mature retinal ganglion cells
to a robust growth state in vivo: gene expression and synergy with RhoA
inactivation. J Neurosci 24:8726-8740.
Fouad K, Klusman I, Schwab ME (2004) Regenerating corticospinal fibers in the Marmoset
(Callitrix jacchus) after spinal cord lesion and treatment with the anti-Nogo-A
antibody IN-1. Eur J Neurosci 20:2479-2482.
Fournier AE, GrandPre T, Strittmatter SM (2001) Identification of a receptor mediating
Nogo-66 inhibition of axonal regeneration. Nature 409:341-346.
Freund P, Schmidlin E, Wannier T, Bloch J, Mir A, Schwab ME, Rouiller EM (2006) Nogo-Aspecific antibody treatment enhances sprouting and functional recovery after
cervical lesion in adult primates. Nat Med 12:790-792.
Freund P, Schmidlin E, Wannier T, Bloch J, Mir A, Schwab ME, Rouiller EM (2009) Anti-NogoA antibody treatment promotes recovery of manual dexterity after unilateral
cervical lesion in adult primates--re-examination and extension of behavioral data.
The European journal of neuroscience 29:983-996.
Freund P, Wannier T, Schmidlin E, Bloch J, Mir A, Schwab ME, Rouiller EM (2007) Anti-NogoA antibody treatment enhances sprouting of corticospinal axons rostral to a
unilateral cervical spinal cord lesion in adult macaque monkey. The Journal of
comparative neurology 502:644-659.
Gao Y, Deng K, Hou J, Bryson JB, Barco A, Nikulina E, Spencer T, Mellado W, Kandel ER, Filbin
MT (2004) Activated CREB is sufficient to overcome inhibitors in myelin and
promote spinal axon regeneration in vivo. Neuron 44:609-621.
Giger RJ, Hollis ER, 2nd, Tuszynski MH (2010) Guidance molecules in axon regeneration.
Cold Spring Harb Perspect Biol 2:a001867.
Goldberg JL, Barres BA (2000) The relationship between neuronal survival and
regeneration. Annu Rev Neurosci 23:579-612.
Goldberg JL, Espinosa JS, Xu Y, Davidson N, Kovacs GT, Barres BA (2002) Retinal ganglion
cells do not extend axons by default: promotion by neurotrophic signaling and
electrical activity. Neuron 33:689-702.
Goldshmit Y, Galea MP, Wise G, Bartlett PF, Turnley AM (2004) Axonal regeneration and lack
of astrocytic gliosis in EphA4-deficient mice. J Neurosci 24:10064-10073.
Goldshmit Y, Spanevello MD, Tajouri S, Li L, Rogers F, Pearse M, Galea M, Bartlett PF, Boyd
AW, Turnley AM (2011) EphA4 blockers promote axonal regeneration and
functional recovery following spinal cord injury in mice. PLoS One 6:e24636.
Gonzenbach RR, Gasser P, Zorner B, Hochreutener E, Dietz V, Schwab ME (2010) Nogo-A
antibodies and training reduce muscle spasms in spinal cord-injured rats. Ann
Neurol 68:48-57.
Gonzenbach RR, Schwab ME (2008) Disinhibition of neurite growth to repair the injured
adult CNS: focusing on Nogo. Cell Mol Life Sci 65:161-176.
Gonzenbach RR, Zoerner B, Schnell L, Weinmann O, Mir AK, Schwab ME (2012) Delayed
anti-nogo-a antibody application after spinal cord injury shows progressive loss of
responsiveness. J Neurotrauma 29:567-578.
GrandPre T, Li S, Strittmatter SM (2002) Nogo-66 receptor antagonist peptide promotes
axonal regeneration. Nature 417:547-551.
GrandPre T, Nakamura F, Vartanian T, Strittmatter SM (2000) Identification of the Nogo
inhibitor of axon regeneration as a Reticulon protein. Nature 403:439-444.
Grunewald E, Kinnell HL, Porteous DJ, Thomson PA (2009) GPR50 interacts with neuronal
NOGO-A and affects neurite outgrowth. Mol Cell Neurosci 42:363-371.
Guo F, Jin WL, Li LY, Song WY, Wang HW, Gou XC, Mi YJ, Wang Q, Xiong L (2013) M9, a novel
region of amino-Nogo-A, attenuates cerebral ischemic injury by inhibiting NADPH
oxidase-derived superoxide production in mice. CNS Neurosci Ther 19:319-328.
- 46 -
Chapter 1: Introduction
Haklai-Topper L, Mlechkovich G, Savariego D, Gokhman I, Yaron A (2010) Cis interaction
between Semaphorin6A and Plexin-A4 modulates the repulsive response to Sema6A.
EMBO J 29:2635-2645.
Hauk TG, Leibinger M, Muller A, Andreadaki A, Knippschild U, Fischer D (2010) Stimulation
of axon regeneration in the mature optic nerve by intravitreal application of the tolllike receptor 2 agonist Pam3Cys. Invest Ophthalmol Vis Sci 51:459-464.
Hauk TG, Muller A, Lee J, Schwendener R, Fischer D (2008) Neuroprotective and axon
growth promoting effects of intraocular inflammation do not depend on
oncomodulin or the presence of large numbers of activated macrophages. Exp
Neurol 209:469-482.
Hornberger MR, Dutting D, Ciossek T, Yamada T, Handwerker C, Lang S, Weth F, Huf J,
Wessel R, Logan C, Tanaka H, Drescher U (1999) Modulation of EphA receptor
function by coexpressed ephrinA ligands on retinal ganglion cell axons. Neuron
22:731-742.
Hu F, Strittmatter SM (2008) The N-terminal domain of Nogo-A inhibits cell adhesion and
axonal outgrowth by an integrin-specific mechanism. J Neurosci 28:1262-1269.
Huber AB, Weinmann O, Brosamle C, Oertle T, Schwab ME (2002) Patterns of Nogo mRNA
and protein expression in the developing and adult rat and after CNS lesions. J
Neurosci 22:3553-3567.
Huberman AD, Murray KD, Warland DK, Feldheim DA, Chapman B (2005) Ephrin-As
mediate targeting of eye-specific projections to the lateral geniculate nucleus. Nat
Neurosci 8:1013-1021.
Hug A, Weidner N (2012) From bench to beside to cure spinal cord injury: lost in
translation? Int Rev Neurobiol 106:173-196.
Huntwork-Rodriguez S, Wang B, Watkins T, Ghosh AS, Pozniak CD, Bustos D, Newton K,
Kirkpatrick DS, Lewcock JW (2013) JNK-mediated phosphorylation of DLK
suppresses its ubiquitination to promote neuronal apoptosis. J Cell Biol 202:747763.
Ji B, Li M, Wu WT, Yick LW, Lee X, Shao Z, Wang J, So KF, McCoy JM, Pepinsky RB, Mi S, Relton
JK (2006) LINGO-1 antagonist promotes functional recovery and axonal sprouting
after spinal cord injury. Mol Cell Neurosci 33:311-320.
Jokic N, Gonzalez de Aguilar JL, Dimou L, Lin S, Fergani A, Ruegg MA, Schwab ME, Dupuis L,
Loeffler JP (2006) The neurite outgrowth inhibitor Nogo-A promotes denervation in
an amyotrophic lateral sclerosis model. EMBO Rep 7:1162-1167.
Joly S, Jordi N, Schwab ME, Pernet V (2014) The Ephrin receptor EphA4 restricts axonal
sprouting and enhances branching in the injured mouse optic nerve. Eur J Neurosci.
Jones TB, McDaniel EE, Popovich PG (2005) Inflammatory-mediated injury and repair in the
traumatically injured spinal cord. Curr Pharm Des 11:1223-1236.
Joset A, Dodd DA, Halegoua S, Schwab ME (2010) Pincher-generated Nogo-A endosomes
mediate growth cone collapse and retrograde signaling. J Cell Biol 188:271-285.
Jozsef L, Tashiro K, Kuo A, Park EJ, Skoura A, Albinsson S, Rivera-Molina F, Harrison KD,
Iwakiri Y, Toomre D, Sessa WC (2014) Reticulon 4 is necessary for endoplasmic
reticulum tubulation, STIM1-Orai1 coupling, and store-operated calcium entry. J Biol
Chem 289:9380-9395.
Jurewicz A, Matysiak M, Raine CS, Selmaj K (2007) Soluble Nogo-A, an inhibitor of axonal
regeneration, as a biomarker for multiple sclerosis. Neurology 68:283-287.
Kao TJ, Kania A (2011) Ephrin-mediated cis-attenuation of Eph receptor signaling is
essential for spinal motor axon guidance. Neuron 71:76-91.
Kapfhammer JP, Schwab ME (1994) Inverse patterns of myelination and GAP-43 expression
in the adult CNS: neurite growth inhibitors as regulators of neuronal plasticity? J
Comp Neurol 340:194-206.
Karlen A, Karlsson TE, Mattsson A, Lundstromer K, Codeluppi S, Pham TM, Backman CM,
Ogren SO, Aberg E, Hoffman AF, Sherling MA, Lupica CR, Hoffer BJ, Spenger C,
- 47 -
Chapter 1: Introduction
Josephson A, Brene S, Olson L (2009) Nogo receptor 1 regulates formation of lasting
memories. Proc Natl Acad Sci U S A 106:20476-20481.
Kempf A, Montani L, Petrinovic MM, Schroeter A, Weinmann O, Patrignani A, Schwab ME
(2013) Upregulation of axon guidance molecules in the adult central nervous system
of Nogo-A knockout mice restricts neuronal growth and regeneration. Eur J Neurosci
38:3567-3579.
Kempf A, Tews B, Arzt ME, Weinmann O, Obermair FJ, Pernet V, Zagrebelsky M, Delekate A,
Iobbi C, Zemmar A, Ristic Z, Gullo M, Spies P, Dodd D, Gygax D, Korte M, Schwab ME
(2014) The sphingolipid receptor S1PR2 is a receptor for Nogo-a repressing
synaptic plasticity. PLoS Biol 12:e1001763.
Kern F, Stanika RI, Sarg B, Offterdinger M, Hess D, Obermair GJ, Lindner H, Bandtlow CE,
Hengst L, Schweigreiter R (2013) Nogo-A couples with Apg-1 through interaction
and co-ordinate expression under hypoxic and oxidative stress. Biochem J 455:217227.
Kilic E, ElAli A, Kilic U, Guo Z, Ugur M, Uslu U, Bassetti CL, Schwab ME, Hermann DM (2010)
Role of Nogo-A in neuronal survival in the reperfused ischemic brain. J Cereb Blood
Flow Metab 30:969-984.
Kim JE, Li S, GrandPre T, Qiu D, Strittmatter SM (2003) Axon regeneration in young adult
mice lacking Nogo-A/B. Neuron 38:187-199.
Kim JE, Liu BP, Park JH, Strittmatter SM (2004) Nogo-66 receptor prevents raphespinal and
rubrospinal axon regeneration and limits functional recovery from spinal cord
injury. Neuron 44:439-451.
Kiseleva E, Morozova KN, Voeltz GK, Allen TD, Goldberg MW (2007) Reticulon 4a/NogoA
locates to regions of high membrane curvature and may have a role in nuclear
envelope growth. J Struct Biol 160:224-235.
Klein R (2004) Eph/ephrin signaling in morphogenesis, neural development and plasticity.
Curr Opin Cell Biol 16:580-589.
Klimczak RR, Koerber JT, Dalkara D, Flannery JG, Schaffer DV (2009) A novel adenoassociated viral variant for efficient and selective intravitreal transduction of rat
Muller cells. PLoS One 4:e7467.
Koprivica V, Cho KS, Park JB, Yiu G, Atwal J, Gore B, Kim JA, Lin E, Tessier-Lavigne M, Chen
DF, He Z (2005) EGFR activation mediates inhibition of axon regeneration by myelin
and chondroitin sulfate proteoglycans. Science 310:106-110.
Kurimoto T, Yin Y, Habboub G, Gilbert HY, Li Y, Nakao S, Hafezi-Moghadam A, Benowitz LI
(2013) Neutrophils express oncomodulin and promote optic nerve regeneration. J
Neurosci 33:14816-14824.
Kurimoto T, Yin Y, Omura K, Gilbert HY, Kim D, Cen LP, Moko L, Kugler S, Benowitz LI (2010)
Long-distance axon regeneration in the mature optic nerve: contributions of
oncomodulin, cAMP, and pten gene deletion. J Neurosci 30:15654-15663.
Leaver SG, Cui Q, Plant GW, Arulpragasam A, Hisheh S, Verhaagen J, Harvey AR (2006) AAVmediated expression of CNTF promotes long-term survival and regeneration of adult
rat retinal ganglion cells. Gene Ther 13:1328-1341.
Lee H, Raiker SJ, Venkatesh K, Geary R, Robak LA, Zhang Y, Yeh HH, Shrager P, Giger RJ
(2008) Synaptic function for the Nogo-66 receptor NgR1: regulation of dendritic
spine morphology and activity-dependent synaptic strength. J Neurosci 28:27532765.
Lee JK, Geoffroy CG, Chan AF, Tolentino KE, Crawford MJ, Leal MA, Kang B, Zheng B (2010)
Assessing spinal axon regeneration and sprouting in Nogo-, MAG-, and OMgpdeficient mice. Neuron 66:663-670.
Lee JK, Kim JE, Sivula M, Strittmatter SM (2004) Nogo receptor antagonism promotes stroke
recovery by enhancing axonal plasticity. J Neurosci 24:6209-6217.
Leibinger M, Muller A, Andreadaki A, Hauk TG, Kirsch M, Fischer D (2009) Neuroprotective
and axon growth-promoting effects following inflammatory stimulation on mature
- 48 -
Chapter 1: Introduction
retinal ganglion cells in mice depend on ciliary neurotrophic factor and leukemia
inhibitory factor. J Neurosci 29:14334-14341.
Leon S, Yin Y, Nguyen J, Irwin N, Benowitz LI (2000) Lens injury stimulates axon
regeneration in the mature rat optic nerve. J Neurosci 20:4615-4626.
Li S, Kim JE, Budel S, Hampton TG, Strittmatter SM (2005) Transgenic inhibition of Nogo-66
receptor function allows axonal sprouting and improved locomotion after spinal
injury. Mol Cell Neurosci 29:26-39.
Li S, Liu BP, Budel S, Li M, Ji B, Walus L, Li W, Jirik A, Rabacchi S, Choi E, Worley D, Sah DW,
Pepinsky B, Lee D, Relton J, Strittmatter SM (2004) Blockade of Nogo-66, myelinassociated glycoprotein, and oligodendrocyte myelin glycoprotein by soluble Nogo66 receptor promotes axonal sprouting and recovery after spinal injury. J Neurosci
24:10511-10520.
Li S, Strittmatter SM (2003) Delayed systemic Nogo-66 receptor antagonist promotes
recovery from spinal cord injury. J Neurosci 23:4219-4227.
Liebscher T, Schnell L, Schnell D, Scholl J, Schneider R, Gullo M, Fouad K, Mir A, Rausch M,
Kindler D, Hamers FP, Schwab ME (2005) Nogo-A antibody improves regeneration
and locomotion of spinal cord-injured rats. Ann Neurol 58:706-719.
Liu BP, Fournier A, GrandPre T, Strittmatter SM (2002) Myelin-associated glycoprotein as a
functional ligand for the Nogo-66 receptor. Science 297:1190-1193.
Liu K, Lu Y, Lee JK, Samara R, Willenberg R, Sears-Kraxberger I, Tedeschi A, Park KK, Jin D,
Cai B, Xu B, Connolly L, Steward O, Zheng B, He Z (2010) PTEN deletion enhances the
regenerative ability of adult corticospinal neurons. Nat Neurosci 13:1075-1081.
Liu K, Tedeschi A, Park KK, He Z (2011) Neuronal intrinsic mechanisms of axon
regeneration. Annu Rev Neurosci 34:131-152.
London A, Benhar I, Schwartz M (2013) The retina as a window to the brain-from eye
research to CNS disorders. Nat Rev Neurol 9:44-53.
Lord-Fontaine S, Yang F, Diep Q, Dergham P, Munzer S, Tremblay P, McKerracher L (2008)
Local inhibition of Rho signaling by cell-permeable recombinant protein BA-210
prevents secondary damage and promotes functional recovery following acute
spinal cord injury. J Neurotrauma 25:1309-1322.
Luo X, Salgueiro Y, Beckerman SR, Lemmon VP, Tsoulfas P, Park KK (2013) Threedimensional evaluation of retinal ganglion cell axon regeneration and pathfinding in
whole mouse tissue after injury. Exp Neurol 247:653-662.
Maier IC, Ichiyama RM, Courtine G, Schnell L, Lavrov I, Edgerton VR, Schwab ME (2009)
Differential effects of anti-Nogo-A antibody treatment and treadmill training in rats
with incomplete spinal cord injury. Brain : a journal of neurology 132:1426-1440.
Manns R, Schmandke A, Jareonsettasin P, Cook G, Schwab ME, Holt C, Keynes R (2014)
Protein synthesis dependence of growth cone collapse induced by different Nogo-Adomains. PLoS ONE 9:e86820.
Mansour-Robaey S, Clarke DB, Wang YC, Bray GM, Aguayo AJ (1994) Effects of ocular injury
and administration of brain-derived neurotrophic factor on survival and regrowth of
axotomized retinal ganglion cells. Proc Natl Acad Sci U S A 91:1632-1636.
Mathis C, Schroter A, Thallmair M, Schwab ME (2010) Nogo-a regulates neural precursor
migration in the embryonic mouse cortex. Cereb Cortex 20:2380-2390.
McGee AW, Yang Y, Fischer QS, Daw NW, Strittmatter SM (2005) Experience-driven
plasticity of visual cortex limited by myelin and Nogo receptor. Science 309:22222226.
McKerracher L, David S, Jackson DL, Kottis V, Dunn RJ, Braun PE (1994) Identification of
myelin-associated glycoprotein as a major myelin-derived inhibitor of neurite
growth. Neuron 13:805-811.
McKerracher L, Guertin P (2013) Rho as a target to promote repair: translation to clinical
studies with cethrin. Curr Pharm Des 19:4400-4410.
Merkler D, Metz GA, Raineteau O, Dietz V, Schwab ME, Fouad K (2001) Locomotor recovery
in spinal cord-injured rats treated with an antibody neutralizing the myelin- 49 -
Chapter 1: Introduction
associated neurite growth inhibitor Nogo-A. The Journal of neuroscience : the official
journal of the Society for Neuroscience 21:3665-3673.
Mi S, Lee X, Shao Z, Thill G, Ji B, Relton J, Levesque M, Allaire N, Perrin S, Sands B, Crowell T,
Cate RL, McCoy JM, Pepinsky RB (2004) LINGO-1 is a component of the Nogo-66
receptor/p75 signaling complex. Nat Neurosci 7:221-228.
Mi YJ, Hou B, Liao QM, Ma Y, Luo Q, Dai YK, Ju G, Jin WL (2012) Amino-Nogo-A antagonizes
reactive oxygen species generation and protects immature primary cortical neurons
from oxidative toxicity. Cell Death Differ 19:1175-1186.
Mimura F, Yamagishi S, Arimura N, Fujitani M, Kubo T, Kaibuchi K, Yamashita T (2006)
Myelin-associated glycoprotein inhibits microtubule assembly by a Rho-kinasedependent mechanism. J Biol Chem 281:15970-15979.
Mingorance A, Fontana X, Sole M, Burgaya F, Urena JM, Teng FY, Tang BL, Hunt D, Anderson
PN, Bethea JR, Schwab ME, Soriano E, del Rio JA (2004) Regulation of Nogo and Nogo
receptor during the development of the entorhino-hippocampal pathway and after
adult hippocampal lesions. Mol Cell Neurosci 26:34-49.
Mironova YA, Giger RJ (2013) Where no synapses go: gatekeepers of circuit remodeling and
synaptic strength. Trends Neurosci 36:363-373.
Moore DL, Apara A, Goldberg JL (2011) Kruppel-like transcription factors in the nervous
system: novel players in neurite outgrowth and axon regeneration. Mol Cell Neurosci
47:233-243.
Moore DL, Blackmore MG, Hu Y, Kaestner KH, Bixby JL, Lemmon VP, Goldberg JL (2009) KLF
family members regulate intrinsic axon regeneration ability. Science 326:298-301.
Moreau-Fauvarque C, Kumanogoh A, Camand E, Jaillard C, Barbin G, Boquet I, Love C, Jones
EY, Kikutani H, Lubetzki C, Dusart I, Chedotal A (2003) The transmembrane
semaphorin Sema4D/CD100, an inhibitor of axonal growth, is expressed on
oligodendrocytes and upregulated after CNS lesion. J Neurosci 23:9229-9239.
Morgenstern DA, Asher RA, Fawcett JW (2002) Chondroitin sulphate proteoglycans in the
CNS injury response. Prog Brain Res 137:313-332.
Mukhopadhyay G, Doherty P, Walsh FS, Crocker PR, Filbin MT (1994) A novel role for
myelin-associated glycoprotein as an inhibitor of axonal regeneration. Neuron
13:757-767.
Muller A, Hauk TG, Fischer D (2007) Astrocyte-derived CNTF switches mature RGCs to a
regenerative state following inflammatory stimulation. Brain 130:3308-3320.
Muller A, Hauk TG, Leibinger M, Marienfeld R, Fischer D (2009) Exogenous CNTF stimulates
axon regeneration of retinal ganglion cells partially via endogenous CNTF. Mol Cell
Neurosci 41:233-246.
Mullner A, Gonzenbach RR, Weinmann O, Schnell L, Liebscher T, Schwab ME (2008) Laminaspecific restoration of serotonergic projections after Nogo-A antibody treatment of
spinal cord injury in rats. Eur J Neurosci 27:326-333.
Nakaya N, Sultana A, Lee HS, Tomarev SI (2012) Olfactomedin 1 interacts with the Nogo A
receptor complex to regulate axon growth. J Biol Chem 287:37171-37184.
Nash M, Pribiag H, Fournier AE, Jacobson C (2009) Central nervous system regeneration
inhibitors and their intracellular substrates. Mol Neurobiol 40:224-235.
Niederost B, Oertle T, Fritsche J, McKinney RA, Bandtlow CE (2002) Nogo-A and myelinassociated glycoprotein mediate neurite growth inhibition by antagonistic
regulation of RhoA and Rac1. J Neurosci 22:10368-10376.
Niederost BP, Zimmermann DR, Schwab ME, Bandtlow CE (1999) Bovine CNS myelin
contains neurite growth-inhibitory activity associated with chondroitin sulfate
proteoglycans. J Neurosci 19:8979-8989.
Oertle T, van der Haar ME, Bandtlow CE, Robeva A, Burfeind P, Buss A, Huber AB, Simonen
M, Schnell L, Brosamle C, Kaupmann K, Vallon R, Schwab ME (2003) Nogo-A inhibits
neurite outgrowth and cell spreading with three discrete regions. J Neurosci
23:5393-5406.
- 50 -
Chapter 1: Introduction
Ono K, Yasui Y, Rutishauser U, Miller RH (1997) Focal ventricular origin and migration of
oligodendrocyte precursors into the chick optic nerve. Neuron 19:283-292.
Pardridge WM (2002) Drug and gene delivery to the brain: the vascular route. Neuron
36:555-558.
Park JB, Yiu G, Kaneko S, Wang J, Chang J, He XL, Garcia KC, He Z (2005) A TNF receptor
family member, TROY, is a coreceptor with Nogo receptor in mediating the
inhibitory activity of myelin inhibitors. Neuron 45:345-351.
Park JH, Gimbel DA, GrandPre T, Lee JK, Kim JE, Li W, Lee DH, Strittmatter SM (2006)
Alzheimer precursor protein interaction with the Nogo-66 receptor reduces
amyloid-beta plaque deposition. J Neurosci 26:1386-1395.
Park KK, Liu K, Hu Y, Smith PD, Wang C, Cai B, Xu B, Connolly L, Kramvis I, Sahin M, He Z
(2008) Promoting axon regeneration in the adult CNS by modulation of the
PTEN/mTOR pathway. Science 322:963-966.
Peng X, Kim J, Zhou Z, Fink DJ, Mata M (2011) Neuronal Nogo-A regulates glutamate
receptor subunit expression in hippocampal neurons. J Neurochem 119:1183-1193.
Pernet V, Di Polo A (2006) Synergistic action of brain-derived neurotrophic factor and lens
injury promotes retinal ganglion cell survival, but leads to optic nerve dystrophy in
vivo. Brain 129:1014-1026.
Pernet V, Hauswirth WW, Di Polo A (2005) Extracellular signal-regulated kinase 1/2
mediates survival, but not axon regeneration, of adult injured central nervous
system neurons in vivo. J Neurochem 93:72-83.
Pernet V, Joly S, Christ F, Dimou L, Schwab ME (2008) Nogo-A and myelin-associated
glycoprotein differently regulate oligodendrocyte maturation and myelin formation.
J Neurosci 28:7435-7444.
Pernet V, Joly S, Dalkara D, Jordi N, Schwarz O, Christ F, Schaffer DV, Flannery JG, Schwab ME
(2013a) Long-distance axonal regeneration induced by CNTF gene transfer is
impaired by axonal misguidance in the injured adult optic nerve. Neurobiol Dis
51:202-213.
Pernet V, Joly S, Dalkara D, Schwarz O, Christ F, Schaffer D, Flannery JG, Schwab ME (2011)
Neuronal Nogo-A upregulation does not contribute to ER stress-associated
apoptosis but participates in the regenerative response in the axotomized adult
retina. Cell Death Differ.
Pernet V, Joly S, Jordi N, Dalkara D, Guzik-Kornacka A, Flannery JG, Schwab ME (2013b)
Misguidance and modulation of axonal regeneration by Stat3 and Rho/ROCK
signaling in the transparent optic nerve. Cell Death Dis 4:e734.
Pernet V, Schwab ME (2012) The role of Nogo-A in axonal plasticity, regrowth and repair.
Cell Tissue Res 349:97-104.
Pernet V, Schwab ME (2014) Lost in the jungle: new hurdles for optic nerve axon
regeneration. Trends Neurosci 37:381-387.
Petrinovic MM, Duncan CS, Bourikas D, Weinman O, Montani L, Schroeter A, Maerki D,
Sommer L, Stoeckli ET, Schwab ME (2010) Neuronal Nogo-A regulates neurite
fasciculation, branching and extension in the developing nervous system.
Development 137:2539-2550.
Petrinovic MM, Hourez R, Aloy EM, Dewarrat G, Gall D, Weinmann O, Gaudias J, Bachmann
LC, Schiffmann SN, Vogt KE, Schwab ME (2013) Neuronal Nogo-A negatively
regulates dendritic morphology and synaptic transmission in the cerebellum. Proc
Natl Acad Sci U S A 110:1083-1088.
Pradat PF, Bruneteau G, Gonzalez de Aguilar JL, Dupuis L, Jokic N, Salachas F, Le Forestier N,
Echaniz-Laguna A, Dubourg O, Hauw JJ, Tranchant C, Loeffler JP, Meininger V (2007)
Muscle Nogo-A expression is a prognostic marker in lower motor neuron
syndromes. Ann Neurol 62:15-20.
Prinjha R, Moore SE, Vinson M, Blake S, Morrow R, Christie G, Michalovich D, Simmons DL,
Walsh FS (2000) Inhibitor of neurite outgrowth in humans. Nature 403:383-384.
- 51 -
Chapter 1: Introduction
Pun RY, Rolle IJ, Lasarge CL, Hosford BE, Rosen JM, Uhl JD, Schmeltzer SN, Faulkner C,
Bronson SL, Murphy BL, Richards DA, Holland KD, Danzer SC (2012) Excessive
activation of mTOR in postnatally generated granule cells is sufficient to cause
epilepsy. Neuron 75:1022-1034.
Pyne NJ, Pyne S (2010) Sphingosine 1-phosphate and cancer. Nat Rev Cancer 10:489-503.
Raiker SJ, Lee H, Baldwin KT, Duan Y, Shrager P, Giger RJ (2010) Oligodendrocyte-myelin
glycoprotein and Nogo negatively regulate activity-dependent synaptic plasticity. J
Neurosci 30:12432-12445.
Raineteau O, Fouad K, Bareyre FM, Schwab ME (2002) Reorganization of descending motor
tracts in the rat spinal cord. Eur J Neurosci 16:1761-1771.
Raineteau O, Fouad K, Noth P, Thallmair M, Schwab ME (2001) Functional switch between
motor tracts in the presence of the mAb IN-1 in the adult rat. Proc Natl Acad Sci U S
A 98:6929-6934.
Raineteau O, Schwab ME (2001) Plasticity of motor systems after incomplete spinal cord
injury. Nat Rev Neurosci 2:263-273.
Ramón y Cajal S, DeFelipe J, Jones EG (1991) Cajal's degeneration and regeneration of the
nervous system. New York: Oxford University Press.
Reindl M, Khantane S, Ehling R, Schanda K, Lutterotti A, Brinkhoff C, Oertle T, Schwab ME,
Deisenhammer F, Berger T, Bandtlow CE (2003) Serum and cerebrospinal fluid
antibodies to Nogo-A in patients with multiple sclerosis and acute neurological
disorders. J Neuroimmunol 145:139-147.
Schmalfeldt M, Bandtlow CE, Dours-Zimmermann MT, Winterhalter KH, Zimmermann DR
(2000) Brain derived versican V2 is a potent inhibitor of axonal growth. J Cell Sci
113 ( Pt 5):807-816.
Schnell L, Hunanyan AS, Bowers WJ, Horner PJ, Federoff HJ, Gullo M, Schwab ME, Mendell
LM, Arvanian VL (2011) Combined delivery of Nogo-A antibody, neurotrophin-3 and
the NMDA-NR2d subunit establishes a functional 'detour' in the hemisected spinal
cord. Eur J Neurosci 34:1256-1267.
Schnell L, Schneider R, Kolbeck R, Barde YA, Schwab ME (1994) Neurotrophin-3 enhances
sprouting of corticospinal tract during development and after adult spinal cord
lesion. Nature 367:170-173.
Schnell L, Schwab ME (1990) Axonal regeneration in the rat spinal cord produced by an
antibody against myelin-associated neurite growth inhibitors. Nature 343:269-272.
Schwab ME (2004) Nogo and axon regeneration. Curr Opin Neurobiol 14:118-124.
Schwab ME (2010) Functions of Nogo proteins and their receptors in the nervous system.
Nat Rev Neurosci 11:799-811.
Schwab ME, Bartholdi D (1996) Degeneration and regeneration of axons in the lesioned
spinal cord. Physiol Rev 76:319-370.
Schwab ME, Strittmatter SM (2014) Nogo limits neural plasticity and recovery from injury.
Curr Opin Neurobiol 27C:53-60.
Shao Y, Akmentin W, Toledo-Aral JJ, Rosenbaum J, Valdez G, Cabot JB, Hilbush BS, Halegoua S
(2002) Pincher, a pinocytic chaperone for nerve growth factor/TrkA signaling
endosomes. J Cell Biol 157:679-691.
Shao Z, Browning JL, Lee X, Scott ML, Shulga-Morskaya S, Allaire N, Thill G, Levesque M, Sah
D, McCoy JM, Murray B, Jung V, Pepinsky RB, Mi S (2005) TAJ/TROY, an orphan TNF
receptor family member, binds Nogo-66 receptor 1 and regulates axonal
regeneration. Neuron 45:353-359.
Shen K, Cowan CW (2010) Guidance molecules in synapse formation and plasticity. Cold
Spring Harb Perspect Biol 2:a001842.
Simonen M, Pedersen V, Weinmann O, Schnell L, Buss A, Ledermann B, Christ F, Sansig G,
van der Putten H, Schwab ME (2003) Systemic deletion of the myelin-associated
outgrowth inhibitor Nogo-A improves regenerative and plastic responses after
spinal cord injury. Neuron 38:201-211.
- 52 -
Chapter 1: Introduction
Sivasankaran R, Pei J, Wang KC, Zhang YP, Shields CB, Xu XM, He Z (2004) PKC mediates
inhibitory effects of myelin and chondroitin sulfate proteoglycans on axonal
regeneration. Nat Neurosci 7:261-268.
Smith PD, Sun F, Park KK, Cai B, Wang C, Kuwako K, Martinez-Carrasco I, Connolly L, He Z
(2009) SOCS3 deletion promotes optic nerve regeneration in vivo. Neuron 64:617623.
Spillmann AA, Bandtlow CE, Lottspeich F, Keller F, Schwab ME (1998) Identification and
characterization of a bovine neurite growth inhibitor (bNI-220). J Biol Chem
273:19283-19293.
Starkey ML, Schwab ME (2014) How Plastic Is the Brain after a Stroke? Neuroscientist
20:359-371.
Steketee MB, Oboudiyat C, Daneman R, Trakhtenberg E, Lamoureux P, Weinstein JE,
Heidemann S, Barres BA, Goldberg JL (2014) Regulation of intrinsic axon growth
ability at retinal ganglion cell growth cones. Invest Ophthalmol Vis Sci 55:43694377.
Steward O, Sharp K, Yee KM, Hofstadter M (2008) A re-assessment of the effects of a Nogo66 receptor antagonist on regenerative growth of axons and locomotor recovery
after spinal cord injury in mice. Exp Neurol 209:446-468.
Steward O, Zheng B, Banos K, Yee KM (2007) Response to: Kim et al., "axon regeneration in
young adult mice lacking Nogo-A/B." Neuron 38, 187-199. Neuron 54:191-195.
Sun F, Park KK, Belin S, Wang D, Lu T, Chen G, Zhang K, Yeung C, Feng G, Yankner BA, He Z
(2011) Sustained axon regeneration induced by co-deletion of PTEN and SOCS3.
Nature 480:372-375.
Sung JK, Miao L, Calvert JW, Huang L, Louis Harkey H, Zhang JH (2003) A possible role of
RhoA/Rho-kinase in experimental spinal cord injury in rat. Brain Res 959:29-38.
Syken J, Grandpre T, Kanold PO, Shatz CJ (2006) PirB restricts ocular-dominance plasticity
in visual cortex. Science 313:1795-1800.
Tetzlaff W, Okon EB, Karimi-Abdolrezaee S, Hill CE, Sparling JS, Plemel JR, Plunet WT, Tsai
EC, Baptiste D, Smithson LJ, Kawaja MD, Fehlings MG, Kwon BK (2011) A systematic
review of cellular transplantation therapies for spinal cord injury. J Neurotrauma
28:1611-1682.
Tews B, Schonig K, Arzt ME, Clementi S, Rioult-Pedotti MS, Zemmar A, Berger SM, Schneider
M, Enkel T, Weinmann O, Kasper H, Schwab ME, Bartsch D (2013) Synthetic
microRNA-mediated downregulation of Nogo-A in transgenic rats reveals its role as
regulator of synaptic plasticity and cognitive function. Proc Natl Acad Sci U S A
110:6583-6588.
Thallmair M, Metz GA, Z'Graggen WJ, Raineteau O, Kartje GL, Schwab ME (1998) Neurite
growth inhibitors restrict plasticity and functional recovery following corticospinal
tract lesions. Nat Neurosci 1:124-131.
Thomas R, Favell K, Morante-Redolat J, Pool M, Kent C, Wright M, Daignault K, Ferraro GB,
Montcalm S, Durocher Y, Fournier A, Perez-Tur J, Barker PA (2010) LGI1 is a Nogo
receptor 1 ligand that antagonizes myelin-based growth inhibition. J Neurosci
30:6607-6612.
Tsai SY, Papadopoulos CM, Schwab ME, Kartje GL (2011) Delayed anti-nogo-a therapy
improves function after chronic stroke in adult rats. Stroke 42:186-190.
Tuszynski MH, Gage FH (1995) Maintaining the neuronal phenotype after injury in the adult
CNS. Neurotrophic factors, axonal growth substrates, and gene therapy. Mol
Neurobiol 10:151-167.
Venkatesh K, Chivatakarn O, Lee H, Joshi PS, Kantor DB, Newman BA, Mage R, Rader C, Giger
RJ (2005) The Nogo-66 receptor homolog NgR2 is a sialic acid-dependent receptor
selective for myelin-associated glycoprotein. J Neurosci 25:808-822.
Voeltz GK, Prinz WA, Shibata Y, Rist JM, Rapoport TA (2006) A class of membrane proteins
shaping the tubular endoplasmic reticulum. Cell 124:573-586.
- 53 -
Chapter 1: Introduction
Wahl AS, Omlor W, Rubio JC, Chen JL, Zheng H, Schroter A, Gullo M, Weinmann O, Kobayashi
K, Helmchen F, Ommer B, Schwab ME (2014) NEURONAL REPAIR Asynchronous
therapy restores motor control by rewiring of the rat corticospinal tract after stroke.
Science 344:1250-1255.
Wang KC, Kim JA, Sivasankaran R, Segal R, He Z (2002a) P75 interacts with the Nogo
receptor as a co-receptor for Nogo, MAG and OMgp. Nature 420:74-78.
Wang KC, Koprivica V, Kim JA, Sivasankaran R, Guo Y, Neve RL, He Z (2002b)
Oligodendrocyte-myelin glycoprotein is a Nogo receptor ligand that inhibits neurite
outgrowth. Nature 417:941-944.
Wang X, Chun SJ, Treloar H, Vartanian T, Greer CA, Strittmatter SM (2002c) Localization of
Nogo-A and Nogo-66 receptor proteins at sites of axon-myelin and synaptic contact.
J Neurosci 22:5505-5515.
Wang X, Duffy P, McGee AW, Hasan O, Gould G, Tu N, Harel NY, Huang Y, Carson RE,
Weinzimmer D, Ropchan J, Benowitz LI, Cafferty WB, Strittmatter SM (2011)
Recovery from chronic spinal cord contusion after Nogo receptor intervention. Ann
Neurol 70:805-821.
Wang X, Hasan O, Arzeno A, Benowitz LI, Cafferty WB, Strittmatter SM (2012a) Axonal
regeneration induced by blockade of glial inhibitors coupled with activation of
intrinsic neuronal growth pathways. Exp Neurol 237:55-69.
Wang X, Hasan O, Arzeno A, Benowitz LI, Cafferty WB, Strittmatter SM (2012b) Axonal
regeneration induced by blockade of glial inhibitors coupled with activation of
intrinsic neuronal growth pathways. Exp Neurol 237:55-69.
Wang X, Yigitalani K, Kim CY, Sekine T, Wirak D, Frieden E, Bhargava A, Maynard G, Cafferty
W, Strittmatter SM (2014) Human NgR-Fc Decoy Protein via Lumbar Intrathecal
Bolus Administration Enhances Recovery from Rat Spinal Cord Contusion. J
Neurotrauma.
Watkins TA, Wang B, Huntwork-Rodriguez S, Yang J, Jiang Z, Eastham-Anderson J, Modrusan
Z, Kaminker JS, Tessier-Lavigne M, Lewcock JW (2013) DLK initiates a
transcriptional program that couples apoptotic and regenerative responses to
axonal injury. Proc Natl Acad Sci U S A 110:4039-4044.
Weinmann O, Schnell L, Ghosh A, Montani L, Wiessner C, Wannier T, Rouiller E, Mir A,
Schwab ME (2006) Intrathecally infused antibodies against Nogo-A penetrate the
CNS and downregulate the endogenous neurite growth inhibitor Nogo-A. Mol Cell
Neurosci 32:161-173.
Wills ZP, Mandel-Brehm C, Mardinly AR, McCord AE, Giger RJ, Greenberg ME (2012) The
nogo receptor family restricts synapse number in the developing hippocampus.
Neuron 73:466-481.
Winzeler AM, Mandemakers WJ, Sun MZ, Stafford M, Phillips CT, Barres BA (2011) The lipid
sulfatide is a novel myelin-associated inhibitor of CNS axon outgrowth. J Neurosci
31:6481-6492.
Wong ST, Henley JR, Kanning KC, Huang KH, Bothwell M, Poo MM (2002) A p75(NTR) and
Nogo receptor complex mediates repulsive signaling by myelin-associated
glycoprotein. Nat Neurosci 5:1302-1308.
Woolf CJ (2003) No Nogo: now where to go? Neuron 38:153-156.
Yin Y, Cui Q, Gilbert HY, Yang Y, Yang Z, Berlinicke C, Li Z, Zaverucha-do-Valle C, He H,
Petkova V, Zack DJ, Benowitz LI (2009) Oncomodulin links inflammation to optic
nerve regeneration. Proc Natl Acad Sci U S A 106:19587-19592.
Yin Y, Cui Q, Li Y, Irwin N, Fischer D, Harvey AR, Benowitz LI (2003) Macrophage-derived
factors stimulate optic nerve regeneration. J Neurosci 23:2284-2293.
Yin Y, Henzl MT, Lorber B, Nakazawa T, Thomas TT, Jiang F, Langer R, Benowitz LI (2006)
Oncomodulin is a macrophage-derived signal for axon regeneration in retinal
ganglion cells. Nat Neurosci 9:843-852.
Zagrebelsky M, Schweigreiter R, Bandtlow CE, Schwab ME, Korte M (2010) Nogo-A stabilizes
the architecture of hippocampal neurons. J Neurosci 30:13220-13234.
- 54 -
Chapter 1: Introduction
Zemmar A, Weinmann O, Kellner Y, Yu X, Vicente R, Gullo M, Kasper H, Lussi K, Ristic Z, Luft
AR, Rioult-Pedotti M, Zuo Y, Zagrebelsky M, Schwab ME (2014) Neutralization of
Nogo-A enhances synaptic plasticity in the rodent motor cortex and improves motor
learning in vivo. J Neurosci 34:8685-8698.
Zhao RR, Andrews MR, Wang D, Warren P, Gullo M, Schnell L, Schwab ME, Fawcett JW
(2013) Combination treatment with anti-Nogo-A and chondroitinase ABC is more
effective than single treatments at enhancing functional recovery after spinal cord
injury. Eur J Neurosci.
Zheng B, Atwal J, Ho C, Case L, He XL, Garcia KC, Steward O, Tessier-Lavigne M (2005)
Genetic deletion of the Nogo receptor does not reduce neurite inhibition in vitro or
promote corticospinal tract regeneration in vivo. Proc Natl Acad Sci U S A 102:12051210.
Zheng B, Ho C, Li S, Keirstead H, Steward O, Tessier-Lavigne M (2003) Lack of enhanced
spinal regeneration in Nogo-deficient mice. Neuron 38:213-224.
Zhou X, Hu X, He W, Tang X, Shi Q, Zhang Z, Yan R (2011) Interaction between amyloid
precursor protein and Nogo receptors regulates amyloid deposition. FASEB journal :
official publication of the Federation of American Societies for Experimental Biology
25:3146-3156.
Zorner B, Filli L, Starkey ML, Gonzenbach R, Kasper H, Rothlisberger M, Bolliger M, Schwab
ME (2010) Profiling locomotor recovery: comprehensive quantification of
impairments after CNS damage in rodents. Nat Methods 7:701-708.
- 55 -
- 56 -
Chapter 2
Cell type-specific Nogo-A gene ablation promotes axonal
regeneration in the injured adult optic nerve
by Flóra Vajda
Further contributions by:
Noémie Jordi, Deniz Dalkara, Sandrine Joly, Franziska Christ, Björn Tews, Martin E. Schwab
and Vincent Pernet
Contributions:
F.V., V.P. and M.E.S.: designed the study. F.V. characterized the glial and neuronal conditional
Nogo-A knock-out lines (with the help of S.J and F.C.), performed the optic nerve crush
surgeries and anatomical tracings (with the help of V.P.), harvested and processed tissues
for qRT-PCRs, for Western blotting and immunohistochemical stainings, acquired
microscopic images, analyzed axonal regeneration and neuronal survival. N.J. created and
analyzed 3D optic nerve reconstructions. D.D prepared the AAV2.Cre virus. B.T designed the
Rtn4flox/flox line. V.P. performed AAV2.Cre virus injections. F.V. prepared all the figures and
wrote the manuscript (revised by V.P. and M.E.S.).
(in press, Cell Death and Differentiation)
- 57 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
1 Abstract
Nogo-A is a well-known myelin-enriched inhibitory protein for axonal growth and
regeneration in the central nervous system (CNS). Besides oligodendrocytes, our previous
data revealed that Nogo-A is also expressed in subpopulations of neurons including retinal
ganglion cells in which it can play a positive role in the neuronal growth response after
injury, through an unclear mechanism. In the present study, we analyzed the opposite roles
of glial versus neuronal Nogo-A in the injured visual system. To this aim, we created
oligodendrocyte
(Cnp-Cre+/-xRtn4/Nogo-Aflox/flox)
and
neuron-specific
(Thy1-
Cretg+xRtn4flox/flox) conditional Nogo-A knock-out (KO) mouse lines. Following complete
intraorbital optic nerve crush, both spontaneous and inflammation-mediated axonal
outgrowth was increased in the optic nerves of the glia-specific Nogo-A KO mice. In contrast,
neuron-specific deletion of Nogo-A in a KO mouse line or acute gene recombination in
retinal ganglion cells mediated by adeno-associated virus serotype 2 (AAV2).Cre virus
injection in Rtn4flox/flox animals decreased axon sprouting in the injured optic nerve. These
results therefore show that selective ablation of Nogo-A in oligodendrocytes and myelin in
the optic nerve is more effective at enhancing regrowth of injured axons than what has
previously been observed in conventional, complete Nogo-A KO mice. Our data also suggest
that neuronal Nogo-A in retinal ganglion cells could participate in enhancing axonal
sprouting, possibly by cis-interaction with Nogo receptors at the cell membrane that may
counteract trans Nogo-A signaling. We propose that inactivating Nogo-A in glia while
preserving neuronal Nogo-A expression may be a successful strategy to promote axonal
regeneration in the CNS.
- 58 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Keywords:
glial Nogo-A; neuronal Nogo-A; optic nerve crush injury; retinal ganglion cells; axonal
regeneration; cis-interaction
Abbreviations:
AAV, adeno-associated virus; AKT, Protein Kinase B; APC, adenomatous polyposis coli;
CNPase, 2′,3′-cyclic nucleotide 3′-phosphodiesterase; CNS, central nervous system; CNTF,
ciliary neurotrophic factor; CRALBP, cellular retinaldehyde binding protein; CREB, cAMP
response element-binding protein; CTB-A594, cholera toxin B-Alexa594; DRG, dorsal root
ganglion; ERK1/2, extracellular signal-regulated kinases 1/2; Gap-43, growth-associated
protein 43; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GCL, ganglion cell layer;
GFAP, glial fibrillary acidic protein; GFP, green fluorescent protein; GS, glutamine
synthetase; INL, inner nuclear layer; Jak3, janus kinase 3; KO, knock-out; LIF, leukemia
inhibitory factor; LTP, long-term potentiation; MAG, myelin-associated glycoprotein; NgR1,
Nogo66 receptor 1; OFL, optic fiber layer; OMgp, oligodendrocyte myelin glycoprotein;
ONC, optic nerve crush injury; ONL, outer nuclear layer; Pam3Cys, (S)-(2,3bis(palmitoyloxy)-(2RS)-propyl)-Npalmitoyl-(R)-Cys-(S)-Ser(S)-Lys(4)OH.trihydrochloride; PBS; phosphate-buffered saline, PNS, peripheral nervous system;
PTEN, phosphatase and tensin homolog; qRT-PCR, quantitative real-time polymerase chain
reaction; RGCs, retinal ganglion cells; ROCK, Rho-associated protein kinase; RTN, reticulon;
SEM, standard error of the mean; SOCS3, suppressor of cytokine signaling 3; S1PR2,
sphingosine 1-phosphate receptor 2; Sprr1A, small proline-rich protein 1A; STAT3, signal
transducer and activator of transcription 3; TBS, tris-buffered saline.
- 59 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
2 Introduction
In the adult mammalian central nervous system (CNS), axons have a very limited capacity to
regenerate after traumatic injury. This lack of axonal regeneration is thought to be mainly
due to the presence of growth-inhibiting molecules in the injured CNS environment (Yiu and
He, 2006, Schwab, 2010) and to the low intrinsic growth capacity of mature neurons
(Goldberg et al., 2002).
Nogo-A is a well-studied inhibitory protein for axonal growth, plasticity and
regeneration after CNS injury (Schwab, 2004, Pernet and Schwab, 2012). Nogo-A is
predominantly expressed in oligodendrocytes in the adult CNS, where it is thought to
stabilize neuronal circuits in healthy conditions and to inhibit neurite growth and plasticity
after lesion (Schwab, 2010). Neutralizing Nogo-A by function blocking antibodies or genetic
knock-out has been shown to improve axonal sprouting and regeneration in the injured
spinal cord and brain (Thallmair et al., 1998, Bareyre et al., 2002, Kim et al., 2003, Simonen
et al., 2003, Dimou et al., 2006, Schwab and Strittmatter, 2014).
In addition to oligodendrocytes and myelin, Nogo-A is expressed in growing and
immature neurons as well as in some adult neurons (Huber et al., 2002, Wang et al., 2002).
Neurons express Nogo-A receptors such as the Nogo-66 receptor 1 (NgR1) (Fournier et al.,
2001) and the Nogo-A-∆20 specific sphingosine 1-phosphate receptor 2 (S1PR2) (Kempf et
al., 2014). They can co-express them along with Nogo-A (Wang et al., 2002), an observation
that raises the possibility of cis-interactions between the ligand and its receptors within or
at the cell surface of the same cell. This mechanism has previously been described for axonal
guidance molecules such as Ephrins and Semaphorins and could play a major role in the
neuronal response to extracellular growth inhibitors during development (Egea and Klein,
2007, Haklai-Topper et al., 2010).
In the adult CNS, the expression of neuronal Nogo-A remains elevated mainly in
plastic regions such as in the hippocampus, the olfactory bulb or the neocortex and in dorsal
root ganglia (Huber et al., 2002). Nogo-A and NgR1 were shown to regulate synaptic
plasticity, e.g. long-term potentiation (LTP) in the hippocampus and in the sensory-motor
cortex (Raiker et al., 2010, Delekate et al., 2011, Wills et al., 2012, Akbik et al., 2013, Tews et
al., 2013), while after injury, the effects of neuronal Nogo-A are not yet well understood.
During development, neuronal Nogo-A influences neuronal migration (Mingorance-Le Meur
et al., 2007, Mathis et al., 2010), survival (Mi et al., 2012, Guo et al., 2013), cell spreading and
neurite growth (Oertle et al., 2003, Petrinovic et al., 2010). In injured adult retinal ganglion
cells (RGCs), silencing neuronal Nogo-A resulted in marked reduction of regenerative
sprouting and decreased the expression of growth-associated molecules (Pernet et al.,
- 60 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
2011). Furthermore, in the optic nerve, axonal regeneration was not improved in
conventional Nogo-A KO animals, in which both glial and neuronal Nogo-A was deleted
(Pernet et al., 2011). The present study therefore aimed to investigate whether glial and
neuronal Nogo-A differently influence axonal growth in vivo using cell type-specific Nogo-A
KO mouse lines and adeno-associated virus-mediated recombination of the Nogo-A gene in
neurons. The results show that significantly more axons grew through the lesion site in the
oligodendrocyte-specific Nogo-A KO mice. In contrast, neuron-specific ablation of Nogo-A in
RGCs reduced the number of regenerating axons after optic nerve crush injury (ONC). In
summary, we show that inactivating Nogo-A specifically in oligodendrocytes appears to be
the most successful strategy to promote axonal regeneration in the adult optic nerve.
3 Results
3.1 Targeted deletion of Nogo-A in oligodendrocytes
To obtain an oligodendrocyte-specific Nogo-A KO mouse line, mice expressing Crerecombinase under the control of the 2′,3′-cyclic nucleotide 3′-phosphodiesterase (CnpCre+/-) (Lappe-Siefke et al., 2003) were crossed with mice in which exon 3 of the Rtn4 gene
was flanked by loxP sites (Rtn4flox/flox) (Figure 1A). CNPase is a well characterized
component and marker for myelin and oligodendrocytes (Sprinkle, 1989). In the optic nerve
Olig2-positive oligodendrocytes specifically express CNP (Supplementary Figure S1A). By
Western blotting in the highly myelinated optic nerve, the level of Nogo-A protein decreased
by ~80% in Cnp-Cre+/-xRtn4flox/flox mice compared to WT, Cnp-Cre+/- and Rtn4flox/flox
genotypes (Figure 1B). In the spinal cord, where Nogo-A is expressed in oligodendrocytes
and in neurons, the level of Nogo-A was decreased by ~70% (Figure 1C). In the neocortex of
Cnp-Cre+/-xRtn4flox/flox mice, Nogo-A levels were decreased by ~50%, reflecting the higher
proportion of neuronal Nogo-A (Figure 1D) (Huber et al., 2002). In the Cnp-Cre+/-xRtn4flox/flox
hippocampus, we observed a ~30% decrease of Nogo-A (Figure 1E). The level of the Nogo-A
splice variant Nogo-B was elevated in the optic nerve, spinal cord, cortex, and hippocampus,
suggesting a compensatory up-regulation of this protein in oligodendrocytes (Simonen et al.,
2003) (Figures 1B-E). By immunohistochemistry in the optic nerve (Figure 1F) and corpus
callosum (Figure 1G), adenomatous polyposis coli (APC)-positive oligodendrocytes
contained Nogo-A in control Cnp-Cre+/- animals, but lacked Nogo-A in Cnp-Cre+/-xRtn4flox/flox
mice.
- 61 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Supplementary figure 1. CNP is expressed in oligodendrocytes and in retinal Müller cells. (A)
In the optic nerve, Olig2-positive myelin forming oligodendrocytes expressed CNP. (B)
Developmental expression pattern of Cnp mRNA in the retina shows a peak at birth (P0). Scale bar: A
= 10μm.
- 62 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Figure 1. Generation and characterization of Cnp-Cre+/-xRtn4flox/flox Nogo-A knock-out animals.
(A) To obtain an oligodendrocyte-specific Nogo-A KO mouse line, mice expressing Cre-recombinase
under the control of the 2’,3’-Cnp (Lappe-Siefke et al., 2003) were crossed with mice in which exon 3
of the Rtn4 gene was flanked by loxP sequences (Rtn4flox/flox). (B-E) Western blot analysis revealed
that Nogo-A protein was down-regulated in the optic nerve (~80%), spinal cord (~70%), cortex
(~50%) and hippocampus (~30%) to different extents. In all these four examined CNS regions NogoB protein showed compensatory up-regulation. (F-G) By double immunohistochemistry for Nogo-A
and adenomatous polyposis coli (APC) on optic nerve and corpus callosum sections, Nogo-A was
specifically excised from oligodendrocytes in myelinated regions. APC-positive oligodendrocytes
contained Nogo-A only in control animals, and lacked Nogo-A in the Cnp-Cre+/-xRtn4flox/flox KO mice.
Fluorescent pictures were from merged confocal microscopy stacks. Statistics: one-way ANOVA,
Bonferroni‘s Multiple Comparison Test, *p<0.05, **p<0.01, ***p<0.001. Scale bars: F, G = 25μm; insets
= 5μm.
- 63 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
3.2 Cnp-Cre-driven ablation of Nogo-A increases regenerative axonal sprouting after
optic nerve crush injury
The effects of myelin Nogo-A on regenerative growth of CNS axons were assessed in the
optic nerve crush model. The retinal ganglion cell axon growth was analysed after
anterograde tracing with Alexa594-conjugated cholera toxin B on histological sections two
weeks after injury. We observed more axonal sprouting after the lesion site in Cnp-Cre+/xRtn4flox/flox mice than in control groups (Figure 2A). Quantitatively, compared to control
genotypes the Cnp-Cre+/-xRtn4flox/flox optic nerves showed more regenerating axons at 50,
100, 150 and 200μm past the injury site (Figure 2B). The injury-induced growth response of
RGCs was further analysed by following gene expression changes for Sprr1A and Gap-43,
two known indicators of neuronal growth in the CNS and the PNS (Aigner et al., 1995,
Bonilla et al., 2002, Pernet et al., 2011, Pernet et al., 2013). The mRNA levels of the two
growth markers were increased five days after optic nerve crush and were more elevated in
the Cnp-Cre+/-xRtn4flox/flox KO retinae than in control samples (Supplementary Figure S2A
and B). These data show that the targeted deletion of Nogo-A in myelinating cells of the
optic nerve enhances the neuronal growth response after axonal injury, in marked contrast
with our previous analysis in conventional, systemic Nogo-A KO animals (Pernet et al.,
2011).
3.3 Nogo-A deletion in Cnp-Cre+/-xRtn4flox/flox mice enhances inflammation-induced
axonal regeneration after optic nerve injury
The growth state of RGCs can be enhanced by intraocular injection of inflammatory agents
such as the Toll-like receptor 2 agonist Zymosan (Yin et al., 2006, Yin et al., 2009). In our
study, we observed that the injection of Zymosan at the time of the injury increased the
number of regenerating axons by ~3-fold in all the groups compared to untreated mice. The
enhancement of growing axons was higher in the optic nerves of Cnp-Cre+/-xRtn4flox/flox mice
than in WT, Cnp-Cre+/- or Rtn4flox/flox animals (Figure 2C and D). Statistically more axonal
fibers grew across the lesion site in the Cnp-Cre+/-xRtn4flox/flox KO mice at 50, 100, 150, 200
and 300μm past the injury site than in control genotypes (Figure 2D). These results show
that the combined growth program stimulation with a pro-inflammatory molecule along
with the deletion of Nogo-A myelin potentiates axonal regeneration.
- 64 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Figure 2. Axonal growth is increased after optic nerve crush injury in Cnp-Cre+/-xRtn4flox/flox
mice. (A) In comparison to WT, Cnp-Cre+/- and Rtn4flox/flox control mice, Cnp-Cre+/-xRtn4flox/flox mice
showed significantly more growing CTB-594-labelled fibers across the optic nerve lesion site (black
stars). (B) The number of growing axonal fibers was statistically higher in Cnp-Cre+/-xRtn4flox/flox, gliaspecific Nogo-A KOs (mean±S.E.M., two-way ANOVA, Bonferroni posttest, *p<0.05, **p<0.01,
***p<0.001) at 50, 100, 150 and 200μm past the injury site. (C) The intraocular delivery of proinflammatory reagent Zymosan at the time of the lesion placed RGCs in an active growth state
resulting in robust axonal growth in the injured optic nerve. (D) In the optic nerves of mice injected
with Zymosan, CTB-594-labelled regenerating fibers were dramatically increased in all genotypes,
but were the most abundant in Cnp-Cre+/-xRtn4flox/flox animals. Statistically more axons grew across
the lesion site in the Cnp-Cre+/-xRtn4flox/flox, glial Nogo-A KO mice (mean±S.E.M., two-way ANOVA,
- 65 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Bonferroni posttest, *p<0.05, **p<0.01, ***p<0.001) at 50, 100, 150, 200 and 300μm past the injury
site than in control genotypes. (E) Tissue clearing allowed to visualize traced axons in three
dimensions in transparent whole-mounted optic nerves 2 weeks after injury (lesion site: stars). An
example of a 3D optic nerve segment is presented for a control Rtn4flox/flox mouse after reconstruction
of confocal microscopy image stacks with the Imaris software. Axons were analysed at high
magnification in the region where Cnp-Cre+/-xRtn4flox/flox mice had more sprouting axons, i.e. between
100 and 300μm past the injury site (two dashed lines). (F) In this range, branched (arrows), unbranched (arrowheads) and U-turn-forming (stars) axons could be identified. (G) The proportion of
branching axons did not significantly vary between Rtn4flox/flox and Cnp-Cre+/-xRtn4flox/flox mice. (H)
The percentage of U-turn-forming axons was not different between the two genotypes. Scale bars: A
and C insets = 25μm; E = 100μm, F = 50μm.
3.4 Three-dimensional analysis of the growth pattern of regenerating axons in the
transparent optic nerve
The higher numbers of retinal fibers in Cnp-Cre+/-xRtn4flox/flox optic nerves elongating after
the injury site could either be due to a higher number of individually growing axons or to
enhanced branching. In order to assess the pattern of growing axons, a three-dimensional
analysis of the regenerating fibers was carried out in whole-mounted optic nerves after
tissue clearing using a modified protocol previously described (Dodt et al., 2007, Luo et al.,
2013). In optic nerve segments situated between 100 and 300μm past the lesion site,
branched and unbranched axons could be distinguished, as well as axons that formed Uturns within this region (Figure 2E and F). We found that the proportion of branching axons
did not significantly vary between Cnp-Cre+/-xRtn4flox/flox and Rtn4flox/flox control mice (Figure
2G). The percentage of U-turn-forming axons was not different between the two genotypes
(Figure 2H).
3.5 Compensatory up-regulation of EphrinA3 and EphA4 in Cnp-Cre+/-xRtn4flox/flox mice
We then wondered if compensatory mechanisms impede axonal regeneration in Cnp-Cre+/xRtn4flox/flox mice after crush lesion. Our laboratory has previously found that Nogo-A gene
deletion induced the up-regulation of inhibitory molecules such as EphA4 and one of its
ligands EphrinA3 in the spinal cord (Kempf et al., 2013). In EphA4 KO mice, axonal growth
was increased in the injured spinal cord and optic nerve compared with WT animals (Kempf
et al., 2013, Joly et al., 2014). In the present study, the analysis of EphrinA3 and EphA4
expressions by Western blotting revealed a strong up-regulation of EphrinA3 in the optic
nerve and an increase of EphA4 in the retina of Cnp-Cre+/-xRtn4flox/flox compared with CnpCre+/- mice (Supplementary Figure S3A and E). In contrast, myelin-associated glycoprotein
(MAG), a molecule that can block axonal regeneration by activating the same receptor
(NgR1) as Nogo-A (Cafferty et al., 2010), did not change in optic nerves (Supplementary
- 66 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Supplementary figure 2. Optic nerve crush injury induces gene expression changes. (A-B) After
injury, the mRNA levels of growth-associated molecular markers Sprr1A and Gap-43 were increased
in the Cnp-Cre+/-xRtn4flox/flox mice compared to control animals (two-way ANOVA, *P<0.05, **P<0.01).
- 67 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Supplementary figure 3. Compensatory up-regulation of inhibitory guidance molecules
following deletion of Nogo-A from glial cells. The expression of EphrinA3, EphA4, L-MAG and
used as internal control. (A) In the optic nerve of Cnp-Cre+/-xRtn4flox/flox mice, the expression of
EphrinA3 was up-regulated by ~75% compared to control animals. (B) The L-MAG isoform was not
significantly (ns.) elevated in Cnp-Cre+/-xRtn4flox/flox optic nerves relative to controls. (C) The level of
S1PR2 protein was not altered in the optic nerve. (D) Retinal EphrinA3 did not change between
groups. (E) EphA4 was significantly increased in the retinae of Cnp-Cre+/-xRtn4flox/flox mice. (F)
Similarly to the optic nerve, S1PR2 was not modified in Cnp-Cre+/-xRtn4flox/flox retina when compared
to Rtn4flox/flox controls (mean±S.E.M., student’s T-test, *p<0.05).
- 68 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Figure S3B). The retinal expressions of NgR1 and S1PR2, a newly identified receptor for
Nogo-A (Kempf et al., 2014), were not modified (Supplementary Figure S5A, Supplementary
Figure S3C and F). These data suggest that EphA4 and EphrinA3 up-regulation may restrict
the distance of axonal regrowth in Cnp-Cre+/-xRtn4flox/flox optic nerves following injury.
3.6 Nogo-A distribution and neuronal survival in the retinae of Cnp-Cre+/-xRtn4flox/flox
mice
Western blot analysis revealed a down-regulation of Nogo-A by ~85% in glial Nogo-A KO
retinae (Figure 3A), although no oligodendrocytes are present in this tissue. As in the intact
retina of adult mice the bulk of Nogo-A is expressed by Müller glial cells (Pernet et al., 2011),
we hypothesized that Nogo-A down-regulation may derive from expression changes
occurring in these cells. In fact, qRT-PCR measurements showed a transitory expression of
Cnp mRNA in the postnatal retina (Supplementary Figure S1B). By immunohistochemistry,
the CNP protein was localized in Müller cell processes labelled with the specific marker
cellular retinaldehyde binding protein (CRALBP) at P8 (Figure 3E). Nogo-B levels were not
changed in Cnp-Cre+/-xRtn4flox/flox retinae (Figure 3A). Compared to intact, control mouse
retinal flat-mounts, in which Nogo-A appeared mostly in the end-feet of Müller cells around
βIII-Tubulin-labelled retinal ganglion cell bodies, Nogo-A expression was abolished in the
Müller cells of Cnp-Cre+/-xRtn4flox/flox KO retinae (Figure 3B). Strikingly, in the same retinae,
Nogo-A was clearly up-regulated in RGCs. Quantitatively, in intact control retinae ~7% of
RGCs expressed Nogo-A, whereas in the intact Cnp-Cre+/-xRtn4flox/flox KOs ~55% of RGCs
showed a bright signal for the Nogo-A protein (Figure 3C). Two weeks after optic nerve
crush injury, the proportion of cells expressing Nogo-A rose to ~50% in the surviving retinal
ganglion cell bodies of Rtn4flox/flox control mice, but remained at ~55% in Cnp-Cre+/xRtn4flox/flox animals, a percentage that did not differ from the intact condition (Figure 3D).
The density of surviving βIII-Tubulin-positive RGCs was examined two weeks after optic
nerve crush injury on retinal flat-mounts (Figure 3F). The retinal ganglion cell survival was
slightly, but significantly increased in Cnp-Cre+/-xRtn4flox/flox KO animals compared to the
control genotypes, from ~25% in Rtn4flox/flox control to ~33% in Cnp-Cre+/-xRtn4flox/flox KO
retinae (Figure 3G).
3.7 Nogo-A expression is required in retinal ganglion cells for optic axon regeneration
We selectively ablated Nogo-A in RGCs of Rtn4flox/flox mice by infection with an adenoassociated virus serotype 2 containing the Cre cDNA (AAV2.Cre). After four weeks of
- 69 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Figure 3. Retinal ganglion cell body analysis reveals Nogo-A up-regulation and higher cell
survival in Cnp-Cre+/-xRtn4flox/flox knock-outs. (A) In the retina, Nogo-A expression was downregulated by ~85% while Nogo-B was unchanged in the Cnp-Cre+/-xRtn4flox/flox KOs. (B) In intact, CnpCre+/- control retinae, Nogo-A was mostly located in Müller cell end-feet surrounding βIII-Tubulinlabelled retinal ganglion cell bodies. In contrast, in Cnp-Cre+/-xRtn4flox/flox KOs, Nogo-A expression was
abolished in Müller cells and was strongly up-regulated in RGCs. (C) Quantitatively, ~7% of RGCs
expressed Nogo-A in intact control retinae, whereas ~55% of RGCs expressed the Nogo-A protein in
the glial Nogo-A KOs (n=4 per group). (D) Two weeks after ONC injury the density of RGCs expressing
Nogo-A was not significantly different between Rtn4flox/flox and Cnp-Cre+/-xRtn4flox/flox mice (n=3 per
group). (E) In the retina, the CNP protein was expressed in Müller cells identified by using the celltype specific marker cellular retinaldehyde binding protein (CRALBP). (F) Two weeks after injury, the
density of surviving RGCs was evaluated by immunostaining for βIII-Tubulin on retinal flat-mounts.
(G) Retinal ganglion cell survival was slightly, but significantly increased in Cnp-Cre+/-xRtn4flox/flox KO
animals compared to the control genotypes (n=3-7). Statistics: one-way ANOVA, Bonferroni‘s
Multiple Comparison Test, *p<0.05, **p<0.01, ***p<0.001. Scale bars: B, E, F = 50μm; B insets = 10μm.
- 70 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Figure 4. Neuronal Nogo-A ablation in retinal ganglion neurons reduces axonal sprouting in
the injured optic nerve. (A-B) WT and Rtn4flox/flox mice were intraocularly injected with AAV2.Cre
virus 4 weeks prior to optic nerve crush injury. Five days after crush operation (5dpo), Nogo-A was
detected in ~50% of RGCs in WT animals. In contrast, the proportion of injured RGCs expressing
Nogo-A was reduced to ~15% after transduction with AAV2.Cre virus in Rtn4flox/flox animals. (C) Two
weeks after injury ~52% of RGCs expressed Nogo-A in WT control mice, whereas only ~15% of
surviving RGCs contained Nogo-A in AAV2.Cre-injected Rtn4flox/flox mice, and ~25% of RGCs were
positive for Nogo-A in AAV2.Cre-injected Cnp-Cre+/-xRtn4flox/flox KOs. (D) For the axonal regeneration
study, the AAV2.Cre virus was injected 4 weeks before the optic nerve crush injury and the number of
CTB-A594 positive fibers was counted two weeks after injury. Quantitatively, compared to WT mice
injected with AAV2.Cre, the number of axons growing after the lesion was statistically lower in the
AAV2.Cre-injected Rtn4flox/flox animals. AAV2.Cre injection in the Cnp-Cre+/-xRtn4flox/flox prevented
axonal regeneration improvement in glial-Nogo-A KOs (mean±S.E.M., two-way ANOVA, Bonferroni
posttest, *p<0.05). Scale bar: A = 50μm.
- 71 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Supplementary figure 4. AAV2.Cre mediated deletion of Nogo-A from the retinal ganglion cells
of glial Nogo-A KO mice. (A-B) By double immunostaining for Nogo-A and βIII-Tubulin, we observed
that ~55% of retinal ganglion cells expressed Nogo-A in intact Cnp-Cre+/-xRtn4flox/flox mice, while 4
weeks after infection with AAV2.Cre, the number of Nogo-A expressing retinal ganglion cells reduced
to ~30%. Scale bar: A = 50μm.
- 72 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
incubation, AAV2.Cre infection reduced the number of Nogo-A-expressing RGCs in intact
Cnp-Cre+/-xRtn4flox/flox mice from ~55% to ~30% (Supplementary Figure S4A and B). The
injury-induced up-regulation of Nogo-A at days 5 and 14 was markedly reduced in retinal
ganglion cells transduced with AAV2.Cre in Rtn4flox/flox animals, from 50% Nogo-A-positive,
surviving cells in WT mice to ~15% in the knock-down retinae at the two time points
(Figures 4A-C). In Cnp-Cre+/-xRtn4flox/flox mice, the percentage of Nogo-A-expressing RGCs
decreased from ~55% in intact retinae to ~25% at 2 weeks after nerve crush (Figure 4C).
The knock-down of Nogo-A in the RGCs resulted in a statistically lower number of sprouting
fibers at two weeks post-injury compared with WT mice injected with AAV2.Cre. Moreover,
AAV2.Cre injection in Cnp-Cre+/-xRtn4flox/flox mice completely prevented the enhancement of
regenerative sprouting that we observed in these animals without the AAV2.Cre injection
(Figure 4D).
To genetically ablate Nogo-A in RGCs, a neuron-specific Nogo-A KO mouse line was
generated by crossing mice expressing Cre recombinase under the control of the Thy1
promoter (Moore et al., 2009) with Rtn4flox/flox mice (Figure 5A). By Western blotting in the
optic nerve, neuronal KOs showed a Nogo-A reduction by ~40% compared to ~80% downregulation in glial KOs (Figure 5B). In the primary motor cortex, Nogo-A was reduced by
~40% in glial and by ~70% in neuronal KOs (Figure 5C). As shown before, compared with
the glial Nogo-A KO retinae where Nogo-A expression was reduced by ~90%, we found
~40% reduction of Nogo-A in the neuron-specific KO retinae (Figure 5D). Importantly,
regenerative axonal sprouting was decreased in neuronal Nogo-A KO mice after optic nerve
injury with respect to Rtn4flox/flox mice. Quantitatively, the number of axons growing through
the lesion was statistically diminished in Thy1-Cretg+xRtn4flox/flox animals at 50 and 100μm
past the injury site compared with the control Rtn4flox/flox group (Figure 5E). Thy1-Cretg+
control mice showed the same protein expression levels for Nogo-A and Nogo-B in all
examined CNS regions and similar axon regeneration (data not shown) as Rtn4flox/flox
animals.
3.8 The immunohistochemical signal for the Nogo receptor NgR1 is increased in CnpCre+/-xRtn4flox/flox retinae
NgR1 is a well characterized GPI-linked Nogo-A receptor expressed by intact RGCs in
Rtn4flox/flox control and Cnp-Cre+/-xRtn4flox/flox KO mice (Figure 6A). By immunohistochemistry
in intact retinal flat-mounts, the level of the NgR1 protein detected in the retinal ganglion
cell bodies was found to be higher in the neurons that expressed a higher level of Nogo-A
compared with cells that showed weak Nogo-A signal in the Cnp-Cre+/-xRtn4flox/flox KO
- 73 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Figure 5. Axonal regeneration is reduced in neuron-specific Nogo-A knock-out animals. (A) To
obtain a neuron-specific Nogo-A KO mouse line, mice expressing Cre-recombinase under the control
of Thy1 promoter (Moore et al., 2009) were crossed with Rtn4flox/flox mouse line. (B-D) Nogo-A and
Nogo-B protein expression levels were studied by Western blotting in control (Rtn4flox/flox), glia- (CnpCre+/-xRtn4flox/flox) and neuron-specific Nogo-A KO (Thy1-Cretg+xRtn4flox/flox) mice. (B) In the optic
nerve, the down-regulation of Nogo-A was more pronounced in glial (~80%) than in neuronal
(~40%) KOs, while Nogo-B was similarly up-regulated in the two KO mouse lines. (C) In the primary
motor cortex, the down-regulation of Nogo-A was less pronounced in glial (~40%) than in neuronal
(~70%) KOs. Nogo-B was up-regulated in the two KO mouse lines. (D) In the retina, Nogo-A
expression was reduced by ~90% in glial and by ~40% in the neuron-specific KOs. Contrary to other
tissues, the level of Nogo-B was not changed in the retina of the two conditional KO mouse lines.
Statistics: one-way ANOVA, Bonferroni‘s Multiple Comparison Test, *p<0.05, **p<0.01, ***p<0.001.
(E) The number of axonal fibers growing spontaneously through the lesion was statistically
diminished in neuronal Nogo-A KO, Thy1-Cretg+xRtn4flox/flox animals at 50, 100 and 200μm past the
injury site when compared with Rtn4flox/flox control groups (mean±S.E.M., student’s T-test, *p<0.05).
- 74 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Figure 6. The correlation of Nogo-A and NgR1 expression levels in retinal ganglion cells
suggests possible cis-interaction. (A) NgR1, Nogo-A and βIII-Tubulin were examined by
immunohistochemistry on retinal flat-mounts in Rtn4flox/flox and Cnp-Cre+/-xRtn4flox/flox KO mice. (B)
Nogo-A-positive RGCs in the Cnp-Cre+/-xRtn4flox/flox mice were divided into high (above the mean level of
the control mice) and low expressing cells. (C) The levels of NgR1 correlated with the Nogo-A levels
in these two populations of intact RGCs. (D-E) Rho-A pull-down experiments revealed lower activated
Rho-A-GTP levels in the injured retinae of the Cnp-Cre+/-xRtn4flox/flox KO mice. (F) Cartoon showing
trans-activation of the NgR1-S1PR2/Rho-A signaling pathway by oligodendroglial Nogo-A. (G)
Hypothetical cis-interaction between Nogo-A and its receptors in neurons, on the intracellular side, in
the endoplasmic reticulum or at the cell membrane, leading to the downstream signaling blockade of
Rho-A. Scale bar: A = 20μm.
- 75 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Supplementary figure 5. NgR1 and Nogo-A mRNA expression analysis in intact and injured
retinae. (A) qRT-PCR analysis of NgR1 mRNA levels in intact and injured retinae did not reveal
expression differences between the Rtn4flox/flox and Cnp-Cre+/-xRtn4flox/flox genotypes. (B) Rtn4/Nogo-A
transcript levels were strongly decreased in Cnp-Cre+/-xRtn4flox/flox KO mice compared with Rtn4flox/flox
control retinal lysates with and without optic nerve injury.
Supplementary figure 6. Analysis of axonal regeneration and survival related signaling
cascades. (A-B) By western blotting, the phospho-Cofilin levels were not different between intact
and injured, control and Cnp-Cre+/-xRtn4flox/flox KO mice. (C) On intact retinal cross-sections, phosphoCofilin appeared in the inner nuclear layer (INL) and ganglion cell layer (GCL) by
immunohistochemistry. After injury phospho-Cofilin was also detected in the optic fiber layer (OFL).
(D-E) The phospho-CREB levels did not differ between intact and injured, control and Cnp-Cre+/xRtn4flox/flox KO mice. (F) Phospho-CREB was weakly expressed in the INL of the retina. However, 3
days after optic nerve crush injury, a strong expression was detected in the retina ganglion cell layer.
(G-H) The phospho-ERK1/2 levels were similar between intact and injured, control and Cnp-Cre+/xRtn4flox/flox mice. (I) Phospho-ERK1/2 expression was induced in some Müller cells 3 days after optic
nerve injury. (J-K) The phospho-STAT3 level was almost undetectable in intact retinae, but was upregulated by ~6-fold after ONC injury. The Cnp-Cre+/-xRtn4flox/flox KOs tended to display lower
phospho-STAT3 activation levels than in control conditions. (L-M) The phospho-Akt levels did not
vary between intact and injured, control and Cnp-Cre+/-xRtn4flox/flox KO mice. No significant differences
were found between the analysed phosphorylated protein levels of Cnp-Cre+/-xRtn4flox/flox and
Rtn4flox/flox animals by one-way ANOVA, Bonferroni‘s Multiple Comparison Test. Scale bars: C, F and I
= 50μm.
- 76 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
- 77 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
animals (Figure 6B and C). The overall mRNA expression level of NgR1, however, was not
different between the two genotypes in intact and injured conditions (Supplementary
Figure 5A). The Nogo-A mRNA level reduction was also confirmed with qRT-PCR
experiments (Supplementary Figure 5B). We hypothesized that the stronger NgR1 signal
observed by immunohistochemistry could reflect the increased association of Nogo-A with
NgR1 in Nogo-A-positive RGCs. This close proximity could lead to a cis-interaction between
the ligand and its receptor intracellularly or on the cell membrane and potentially lead to
the attenuation of trans Nogo-A signaling (Figure 6F and G). To test this hypothesis, the
activation of the downstream Nogo-A/NgR1 signaling mediator Rho-A was studied in RhoA-GTP pull-down experiments. In the intact conditions where the Rho-A signaling pathway
is not activated, no differences could be detected in Rho-A-GTP levels between Rtn4flox/flox
control and Cnp-Cre+/-xRtn4flox/flox KO retinae. However, after optic nerve crush injury,
significantly less Rho-A-GTP was detected in the retinae of the Cnp-Cre+/-xRtn4flox/flox mice
than in samples collected from control animals (Figure 6D and E). Downstream of Rho-A,
the level of the inactive, phosphorylated form of the actin filament severing enzyme Cofilin
was however not changed in Cnp-Cre+/-xRtn4flox/flox retinae (Supplementary Figure S6A-C).
None of the regeneration and survival related signaling pathways such as the cAMP
response element-binding protein (CREB), extracellular-signal-regulated kinase 1/2
(ERK1/2), signal transducer and activator of transcription 3 (STAT3) and protein kinase B
(AKT)
analyzed
by
Western
blotting
(Supplementary
Figure
S6D-M)
and
immunohistochemistry (Supplementary Figure S6C, F, I) showed significant difference
between control and Cnp-Cre+/-xRtn4flox/flox retinae.
In vitro, the role of neuronal Nogo-A was tested by plating DRG-derived F11 cells on
substrates coated with increasing concentrations of the Nogo-A inhibitory fragment Nogo-Adelta20 (∆20); Nogo-A inhibited neurite outgrowth in a concentration dependent way
(Supplementary Figure S7B). Overexpression of Nogo-A in the F11 cells by AAV2.Nogo-A
attenuated the inhibition of neurite outgrowth
on the Nogo-A-∆20 substrate
(Supplementary Figure S7A and B). This result suggests a cell-autonomous effect of
neuronal Nogo-A on neurite outgrowth and supports the possibility that cis-interaction
between Nogo-A and its receptors may counteract the inhibitory effect of Nogo-A present in
the environment.
- 78 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Supplementary figure 7. AAV2-mediated over-expression of Nogo-A in F11 cells partially
reduces neurite outgrowth inhibition by extracellular Nogo-A. (A) After transduction with
AAV2.GFP or AAV2.Nogo-A viruses and 48h after forskolin-induced differentiation, the neurites of
F11 cells were labelled with an anti-βIII-Tubulin antibody. (B) The inhibitory effect of coated Nogo-A∆20 on F11 cell neurite outgrowth is attenuated at 2.5μg/cm2 by AAV2.Nogo-A infection (t-test;
**p<0.01). Scale bar: A = 100μm.
- 79 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
4 Discussion
In the present study we aimed to investigate whether glial and neuronal Nogo-A differently
influence axonal growth in vivo. We created cell type-specific Nogo-A KO mouse lines and
applied adeno-associated virus-mediated recombination of the Nogo-A gene in neurons. Our
results show that axonal sprouting is significantly increased in the optic nerves of
oligodendrocyte-specific Nogo-A KO mice and accompanied by a decrease in Rho-A
activation in the retina.
4.1 Axonal regeneration in conventional versus cell type-specific Nogo-A KO lines
The characterization of Cnp-Cre+/-xRtn4flox/flox mice (glial Nogo-A KO mice) revealed
oligodendrocyte-specific ablation in myelinated CNS regions and deletion of Nogo-A from
Müller glial cells in the retina. In these mice, axonal regeneration was increased compared
with control animals, in line with the effects obtained by acute pharmacological treatments
such as the anti-Nogo-A antibody infusion, the application of the soluble NgR1 decoy
receptor, or Rho-A/ROCK blocking agents (Dergham et al., 2002, Li et al., 2004, Liebscher et
al., 2005). The improved regeneration that we reported here for the optic nerve is in
contrast with what has previously been observed in systemic, conventional KO mice (Pernet
et al., 2011). We speculate that the lack of axonal regeneration improvement observed after
optic nerve crush in the conventional, full KO mouse line may be due, at least in part, to the
lack of neuronal Nogo-A expression (Pernet et al., 2011). Nogo-A levels are up-regulated
after injury in many RGCs, and the excision of Nogo-A gene by two different experimental
approaches, the AAV2.Cre-mediated recombination and generation of a neuron-specific
Nogo-A KO mouse line, decreased the retinal ganglion cell growth potential and prevented
regeneration improvement in Cnp-Cre+/-xRtn4flox/flox KOs. Taken together, our data show that
targeted glial Nogo-A deletion appears to be the most effective way to stimulate axonal
growth in the injured optic nerve.
4.2 The limitations of axonal regeneration by Nogo-A and guidance molecules in the
injured optic nerve
Glial Nogo-A neutralization potentiated inflammation-induced axonal regeneration after
optic nerve crush injury. The combined treatment effect emphasizes the importance of
making the environment more permissive to boost regeneration upon intrinsic growth
mechanism activation. The poor intrinsic neuronal growth can be improved by the deletion
- 80 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
of phosphatase and tensin homolog (PTEN) and suppressor of cytokine signaling 3 (SOCS3),
two key players for cell growth inhibition (Sun et al., 2011). Moreover, inflammationinducing agents such as Zymosan or Pam3Cys have been shown to increase the intrinsic
growth potential of adult neurons, thereby leading to enhanced regeneration (Yin et al.,
2003, Hauk et al., 2010). Acting at two levels, the neuronal growth program activation with
Zymosan and the blockade of Nogo-A signaling potentiated regenerative growth (Fischer et
al., 2004, Dickendesher et al., 2012, Wang et al., 2012). However, our data suggested that the
range of axonal regeneration may be restricted by compensatory up-regulation of EphA4
and EphrinA3 in glial cells. Further investigation are required to determine 1) how Nogo-A
gene ablation causes Ephrin expression increase, 2) if additional Ephrins and Semaphorins
are up-regulated as well and 3) if this mechanism can be neutralized to potentiate axonal
regeneration in the damaged CNS.
Our previous three-dimensional analyses revealed axonal guidance and patterning
defects reflected by increased axonal U-turns and branching after growth induction in the
injured optic nerve (Luo et al., 2013, Pernet et al., 2013). In the present study, we
hypothesized that the myelin Nogo-A could play a role in axon guidance after optic nerve
lesion. However, by examining individual growing axons in 3D, we found no significant
difference in the proportion of branching or U-turn-forming axons between mouse
genotypes. The compensatory enhancement of EphrinA3 in the optic nerve and EphA4 in
the retina that we detected in Cnp-Cre+/-xRtn4flox/flox KOs could influence the guidance of
regenerating axons in a complex manner. For example, we reported that EphA4 KO mice
were less prone to form branches in the injured optic nerve than WT animals (Joly et al.,
2014). In Cnp-Cre+/-xRtn4flox/flox KOs, the lack of guidance and branching changes could result
from the increase of EphA4 or EphrinA3 signaling in regenerating neurons. In future studies,
the impact of compensatory myelin protein elevations and possibly of that of other
repulsive molecules should be further addressed on axonal guidance in Cnp-Cre+/xRtn4flox/flox KO mice (Giger et al., 2010, Pernet and Schwab, 2014).
4.3 The role of Nogo-A in neuronal survival
We found that retinal ganglion cell survival was slightly, but significantly increased in the
glial Nogo-A KO animals compared to control genotypes. Recently, several studies have
suggested that neuronal Nogo-A might play a cell-autonomous role in improving neuronal
survival under conditions of oxidative stress by scavenging reactive oxygen species (Mi et
al., 2012), inhibiting oxidative damage (Guo et al., 2013) or by recruiting cytoprotective
proteins (Kern et al., 2013). The moderate retinal ganglion cell survival observed in our
- 81 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
study could be related to the neuronal Nogo-A up-regulation in the glial Nogo-A KOs.
Moreover, the activation of Rho-A by myelin Nogo-A could be damaging for neurons after
injury; blocking Rho-A activation after spinal cord injury protected cells from p75NTRdependent apoptosis (Dubreuil et al., 2003). Similarly, the increase of retinal ganglion cell
survival in Cnp-Cre+/-xRtn4flox/flox mice could be due to the reduction of Rho-A activation that
we observed in axotomized retinae.
4.4 Nogo-A and Nogo receptors in retinal ganglion cells: trans and cis-interaction?
In our study, the increase of the NgR1 immunohistochemical signal in the highly Nogo-Apositive RGCs of Cnp-Cre+/-xRtn4flox/flox KOs could reflect cis-interactions between the ligand
and receptor. At the cell membrane, the sequestration and inactivation of ligands by cisbinding to adjacent receptors has previously been described to prevent trans-activation in
the case of guidance molecules such as Ephrins (Egea and Klein, 2007), Semaphorins
(Haklai-Topper et al., 2010) or Slit-Robo (Jaworski and Tessier-Lavigne, 2012), but also for
the Notch signaling pathway (Sprinzak et al., 2010). The co-expression of Nogo-A and NgR1
in RGCs of Cnp-Cre+/-xRtn4flox/flox KO mice could prevent downstream activation of Rho-A
after optic nerve crush injury and Nogo-A over-expression in F11 cells could partially
counteract neurite outgrowth inhibition induced by Nogo-A-∆20. These results suggest a
cell-autonomous effect of neuronal Nogo-A on neurite outgrowth, potentially through cisinteraction with the Nogo receptors NgR1 or S1PR2.
In summary, the generation of cell type-specific KO mice allowed to observe that
targeted deletion of Nogo-A from glial cells promotes more neuronal growth in the injured
optic nerve than what has previously been reported in conventional KO animals. The
inactivation of Nogo-A in glia appears as an optimized strategy to promote axonal
regeneration in the CNS.
Conflict of Interest
The authors declare no conflict of interest.
Acknowledgements
This work was supported by the Swiss National Science Foundation (SNF grant #31003A149315-1 for M.E.S), the European Research Council (ERC, ‘Nogorise’ #294115 for M.E.S)
- 82 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
and by the International Foundation for Research in Paraplegia (IRP, P115 for B.T). We
thank Professor Klaus-Armin Nave for kindly providing the Cnp-Cre mouse line, Professor
Ronald van Kesteren for sending us the F11 cells and Professor Schaeren-Wiemers for
sharing the L-MAG antiserum with us. We thank A. Guzik-Kornacka for the help with tissue
dissections and protein/mRNA extractions.
5 Materials and Methods
Animals
Rtn4flox/flox mice were generated by TaconicArtemis. Briefly, the conditional Rtn4 exon 3
allele was generated by homologous recombination in C57BL/6N ES cells. Exon 3 was
flanked by LoxP sites using a targeting vector with 7.2 kb (long arm) and 3.2 kb (short arm)
homologous sequences, respectively. Correct targeting was verified in ES cells using
Southern Blotting before performing blastocyst injections. Highly chimeric male offsprings
were bred to C57BL/6 females, transgenic for the presence of a recombinase gene (FlpDeleter line). Germline transmission was identified by the presence of black coat color,
strain C57BL/6. Flp mediated removal of the FRT site flanked positive selection marker
gene (PuroR) was verified in the next generation. Cre mediated excision of exon 3 resulted
in specific loss of function of the Rtn4 isoform A (Nogo-A), whereas the Rtn4 isoforms B and
C (Nogo-B and Nogo-C) were still expressed. Glia and neuron-specific Nogo-A knock-out
mice were generated to study the role of glial versus neuronal Nogo-A on axonal
regeneration. Rtn4flox/flox mice were crossed with mice expressing Cre-recombinase under
the control of the 2’,3’-cyclic nucleotide phosphodiesterase (Cnp) or Thy1 promoter,
respectively. The Cnp-Cre line was generated in the laboratory of Klaus-Armin Nave (LappeSiefke et al., 2003). The Thy1-Cre line was obtained from the Jackson Laboratory (FVB/NTg(Thy1-cre)1Vln/J) and back-crossed to C57BL/6 background more than eight times
before the breeding was started with Rtn4flox/flox animals. All procedures and surgeries were
performed on 2–4 month old mice of mixed genders and different genotypes. Animal
experiments were performed in accordance with the guidelines of the Veterinary Office of
the Canton of Zurich.
AAV vector production and application
An AAV2.Cre-mCherry expressing virus was generated to selectively infect RGCs. Adenoassociated viral vectors were produced by standard methods. To selectively excise Nogo-A
from retinal ganglion cell neurons in the retina, the AAV2.Cre-mCherry virus was injected to
- 83 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
mice with Rtn4flox/flox genotype. 1.5μl of AAV2.Cre-mCherry virus (1014 vg/ml) was
administered intraocularly using a 10μl Hamilton syringe adapted with a pulled-glass tip. To
allow the diffusion of the virus, the needle was kept in place for 3–4 min and then carefully
removed. Attention was paid not to damage the lens during the injections. To allow time for
optimal transgene expression in vivo, the injections were performed 4 weeks before the
optic nerve crush (ONC) injury.
Axonal regeneration analysis on longitudinal optic nerve sections
We performed ONC injuries to study axonal regeneration in the optic nerve and neuronal
survival in the retina. The optic nerve was exposed intra-orbitally and then crushed by tying
a knot with a 9-0 suture at ~0.5mm from the back of the eye. The suture was carefully
removed and the integrity of the ophthalmic artery was examined by fundus examination.
To induce intraocular inflammation, 2μl of 1% Zymosan dissolved in PBS was injected
intraocularly at the time of the injury. Thirteen days after ONC, the optic axons were
anterogradely traced by intraocularly injecting 1.5μl of 0.5% cholera toxin B conjugated to
Alexa594 (CTB-A594, Molecular Probes). On the following day, the animals were perfused
with 4% paraformaldehyde (PFA) and the optic nerves were processed as described below.
CTB-A594-positive axons were observed on longitudinal optic nerve sections (14μm) with a
Zeiss Axioskop 2 Plus microscope and images were taken with a CCD video camera at 20X
magnification. The number of growing axons was estimated at different distances (50, 100,
150, 200, 300, 400, and 500 to 1’000μm) after the lesion site. Five-six optic nerve sections
were analysed per animal. An estimation of the number of axons per optic nerve () was
calculated with the following formula: d =  x R2 x (average number of axons/mm)/T. The
sum () of axons at a given distance (d) was obtained using the average optic nerve radius
(R) of all optic nerves at 500μm past the lesion site, and a thickness (T) of the tissue slices of
14μm. For statistical analysis with multiple comparisons, ANOVA test was applied followed
by a Bonferroni’s post hoc test. Animals with retinal haemorrhages or ischemia were
excluded from the analysis.
Optic nerve preparation and clearing for 3D analysis of regenerating axons
To visualize CTB-A594-labeled axons in the whole injured optic nerve, the tissue was
cleared following the adapted protocol from (Luo et al., 2013). After intracardial perfusion
with PBS and 4% PFA, optic nerves were further fixed overnight, then rinsed with PBS and
stored at 4°C. The samples were dehydrated in baths of increasing concentrations of
tetrahydrofuran (THF, Sigma-Aldrich) (50, 80, and 100%) for 30min each and for additional
30min in 100% THF at room temperature under constant agitation. To remove traces of
- 84 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
water, optic nerves were placed in dichloromethane for 3-4 hours at room temperature. In
the BABB clearing solution (mixture of benzyl alcohol and benzylbenzoate (1:2, SigmaAldrich)) the white optic nerve turned transparent within 30s. The whole optic nerves were
mounted in the clearing medium before imaging. Image stacks were taken using an inverted
confocal Leica SP5 microscope equipped with a 63X glycerin immersion objective (NA: 1.3).
This setup was used to scan axons throughout the whole thickness of the optic nerve. To
obtain 3D reconstruction of the optic nerves, image stacks were stitched using the
XuvTools42 software (Emmenlauer et al., 2009) and the resulting macro-stack was exported
to the Imaris Software (Bitplane) to create 3D projections. Individual axons were analysed
semi-automatically with the Filament Tracers’ advanced manual tracing mode
(‘AutoDepth’). The percentage of U-turns and branching was calculated between 100 and
300μm past the lesion site. The best traced 30-60 fibers were selected for growth pattern
analysis.
Neuronal survival analysis
Retinal ganglion cell survival was examined two weeks after ONC injury. The animals were
intracardially perfused with 4% PFA and the injured and intact retinae were flat-mounted.
RGCs were visualized by immunostaining for βIII-Tubulin (1:1’000, Promega), a specific and
reliable marker labelling all RGCs. The antibodies were diluted in blocking solution (0.3%
Triton-X-100, 5% of normal serum and 0.05% sodium azide in PBS), and the retinae were
incubated at 4°C with primary and secondary antibodies, for 5 and 3 days, respectively. The
βIII-Tubulin-positive RGCs were imaged in the four quadrants of the retina using a Leica
SPE-II confocal microscope equipped with a 40X oil immersion objective (NA 1.25). Image
stacks were acquired in the ganglion cell layer with a step size of 0.5μm and a resolution of
1’024×1’024 pixels (0.275μm/pixel). The number of retinal ganglion cell bodies was
quantified in grids of 62’500μm2 at 1 and 1.5mm distances from the optic disc. The density
of surviving RGCs was calculated per mm2.
Retina and optic nerve processing and immunostaining
Mice were sacrificed by injecting an overdose of anaesthetics intraperitoneally and perfused
intracardially with PBS and 4% PFA. Optic nerves and eyes were dissected, the latter by
removing the cornea and the lens from the eyecup. For retinal cross sections and
longitudinal optic nerve sections, the eye cups and optic nerves were post-fixed in 4% PFA
overnight at 4oC. The tissues were then cryoprotected in 30% sucrose and frozen in OCT
compound (Tissue-TEK, Sakura) with a 2-methylbutane bath cooled with liquid nitrogen.
Optic nerves and retinal sections were cut (14μm) with a cryostat. Immuno-histochemical
- 85 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
stainings were performed in a blocking solution (5% of normal goat serum or 5% BSA, 0.3%
Triton-X-100, and 0.05% sodium azide in PBS). Primary antibodies were applied overnight
at 4°C and after PBS washes, sections were incubated with the appropriate secondary
antibody for 1h at room temperature. The slides were mounted in Mowiol solution (10%
Mowiol 4–88 (Calbiochem) in 100mM Tris, pH 8.5, 25% glycerol and 0.1% DABCO). Primary
antibodies were: rabbit anti-Nogo-A (Laura, Rb173A40) serum (1:200), mouse anti-GS
(1:300, Chemicon), rabbit anti-CRALBP (1:1’000, kindly provided by Prof. JC Saari,
Washington), mouse anti-APC (1:300, Chemicon), mouse anti-CNP (1:300, Chemicon), goat
anti-NgR1 (1:50, R&D Systems), rabbit anti-phospho-ERK1/2 (1:100, Cell Signaling), rabbit
anti-phospho-CREB (1:100, Cell Signaling), rabbit anti-phospho-Cofilin (1:200, Abcam) and
mouse anti-βIII-Tubulin (1:1’000, Promega). Immunofluorescent labelling was analysed
with a Zeiss Axioskop 2 Plus microscope or with Leica SPE-II confocal microscope.
Western blot analysis
After cervical dislocation, retinae and optic nerves were quickly dissected out and flash
frozen in liquid nitrogen. Tissues were kept at -80oC until extraction in lysis buffer (RIPA
buffer: 150mM NaCl, 1% NP40, 0,5% deoxycholate, 0.1% SDS in 50mM Tris buffer at pH8)
containing protease inhibitors (Complete mini, Roche Diagnostics). Samples were fully
homogenized and let on ice for 60 min. After centrifugation for 15 min at 15’000xg, 4°C,
supernatants were collected and processed for protein concentration analysis (Bio-Rad
Laboratories, RC DC Protein Assay). Retinal and optic nerve proteins (20μg/lane) were
separated by electrophoresis on a 4–12% polyacrylamide gel and transferred to
nitrocellulose membranes. Blots were incubated in a blocking solution of either 2% Top
Block (Lubio Science) or 5% BSA (bovine serum albumin) in 0.2% TBST (0.2% Tween-20 in
Tris-base 0.1 M, pH7.4) for 1 hour at room temperature, then incubated with primary
antibodies overnight at 4°C. Following the washing steps, membranes were incubated with
horseradish peroxidase-conjugated anti-mouse or anti-rabbit secondary antibodies
(1:10’000-1:25’000; Pierce Biotechnology). Primary antibodies were rabbit anti-Nogo-A/B
(Bianca, Rb140) serum (1:20’000), mouse anti-L-MAG serum (1:1’000, polyclonal) (Erb et
al., 2003), mouse anti-EphA4 (1:200, Invitrogen), rabbit anti-EphrinA3 (1:200, Invitrogen),
mouse anti-S1PR2 (1:500, Santa Cruz Biotechnology), rabbit anti-phospho-STAT3 (1:500,
Cell Signaling), rabbit anti-STAT3 (1:500, Cell Signaling), rabbit anti-phospho-ERK1/2
(1:1’000, Cell Signaling), rabbit anti-ERK1/2 (1:1’000, Cell Signaling), rabbit anti-phosphoAKT (1:500, Cell Signaling), rabbit anti-AKT (1:500, Cell Signaling), rabbit anti-phosphoCREB (1:500, Cell Signaling), rabbit anti-CREB (1:500, Cell Signaling), rabbit anti-phosphoCofilin (1:500, Abcam), rabbit anti-Cofilin (1:500, Cell Signaling), and mouse anti-GAPDH
- 86 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
(1:20’000; Abcam). Protein bands were detected with SuperSignal West Pico
Chemiluminescent Substrate (Pierce Biotechnology) in a Stella detector (Raytest). Band
intensities were measured with the Image J software (NIH).
Rho-A pull-down
After rapid dissection of intact and injured (3 days post operation) retinae in TBS, the
samples were flash frozen in liquid nitrogen and stored at -80oC until performing the Rho-A
pull-down. The pull-down of activated RhoA-GTP was subsequently performed using the
RhoA Activation Assay Biochem Kit according to the manufacturer's instructions
(Cytoskeleton, Inc.) combined with a previously described protocol (Pellegrin and Mellor,
2008). The Rho-A-GTP pull-down and total lysate samples were then subjected to
electrophoresis on a 4–12% polyacrylamide gel and transferred to nitrocellulose
membranes. After blocking with 5% BSA in 0.2% TBST for 1 hour, the membranes were
incubated overnight at 4°C with a rabbit anti-Rho-A (1:400, Cell Signaling) primary
antibody. The secondary antibody incubation and signal detection was performed as
described before for the Western blots.
Semi-quantitative RT-PCR (qRT-PCR)
After cervical dislocation, intact and injured whole retinae were rapidly dissected in PBS.
The samples were flash frozen in liquid nitrogen and stored at -80oC until RNA extraction.
Retinal RNA was prepared using the RNeasy RNA isolation kit (Qiagen), including a DNase
treatment to digest the residual genomic DNA. For reverse transcription, equal amounts of
total RNA were transformed to cDNA by using oligo(dT) primers and M-MLV reverse
transcriptase (Promega). 10ng of cDNA was amplified in the Light Cycler 480 thermocycler
(Roche Diagnostics AG) with the polymerase ready mix (SYBR Green I Master; Roche
Diagnostics). The following specific primers were designed to span intronic sequences or
cover exon–intron boundaries: Gapdh (forward, 5’-CAGCAATGCATCCTGCACC-3’; reverse, 5’TGGACTGTGGTCATGAGCCC-3’), Cnp (forward, 5’-AGGAGAAGCTTGAGCTGGTC-3’; reverse,
5’-CGATCTCTTCACCACCTCCT-3’), Nogo-A/Rtn4 (forward, 5’-CAGTGGATGAGACCCTTTTTG3’;
reverse,
5’-GCTGCTCCTTCAAATCCATAA-3’),
CTCGACCCCGAAGATGAAG-3’;
reverse:
NgR1/Rtn4R
(forward,
5’-TGTAGCACACACAAGCACCAG-3’),
5’-
Gap-43
(forward, 5’-TGCTGTCACTGATGCTGCT-3’; reverse, 5’-GGCTTCGTCTACAGCGTCTT-3’), small
proline-rich protein 1A (Sprr1A, forward, 5’-GAACCTGCTCTTCTCTGAGT-3’; reverse, 5’AGCTGAGGAGGTACAGTG-3’). For relative quantification of gene expression, mRNA levels
were normalized to GAPDH using the comparative threshold cycle (∆∆CT) method and a
- 87 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
control sample was used to calculate the relative values. Each reaction was done in triplicate
and 3-4 mice per condition were analysed.
Cell cultures
The effects of AAV2.GFP and AAV2.Nogo-A on neurite outgrowth were evaluated in vitro by
infecting F11 cells. The F11 cell line, kindly provided by Prof. RE van Kesteren (Amsterdam,
The Netherlands), was maintained as described before (MacGillavry et al., 2009). F11 cells
were plated at a density of 100’000 cells per well in 6-well plates and were treated with
AAV2.GFP or AAV2.Nogo-A viruses 24 h later. Four days after infection, F11 cells were
transferred to 4-well dishes at a density of 2’000 cells per well. The 4-well dishes were
coated by different concentrations of Nogo-A-∆20 substrate (0, 0.5, 1 and 2.5μg/cm2)
diluted in PBS at 4°C for 12 hours. Twenty four hours after plating the cells on Nogo-A-∆20
substrate, F11 cells were differentiated by adding 10μM of Forskolin (Sigma-Aldrich) for 48
h. To visualize neurite extension, F11 cells were stained with βIII-Tubulin antibody.
Measurement of neurite length was carried out using the Neuron J plugin in the Image J
software (NIH). The mean of the total neurite length was calculated for the AAV2.GFP and
AAV2.Nogo-A treatments on all four Nogo-A-∆20 substrate concentrations measuring
between 80 and 110 cells.
References
Aigner L, Arber S, Kapfhammer JP, Laux T, Schneider C, Botteri F, Brenner HR, Caroni P
(1995) Overexpression of the neural growth-associated protein GAP-43 induces
nerve sprouting in the adult nervous system of transgenic mice. Cell 83:269-278.
Akbik FV, Bhagat SM, Patel PR, Cafferty WB, Strittmatter SM (2013) Anatomical plasticity of
adult brain is titrated by Nogo Receptor 1. Neuron 77:859-866.
Bareyre FM, Haudenschild B, Schwab ME (2002) Long-lasting sprouting and gene
expression changes induced by the monoclonal antibody IN-1 in the adult spinal
cord. J Neurosci 22:7097-7110.
Bonilla IE, Tanabe K, Strittmatter SM (2002) Small proline-rich repeat protein 1A is
expressed by axotomized neurons and promotes axonal outgrowth. J Neurosci
22:1303-1315.
Cafferty WB, Duffy P, Huebner E, Strittmatter SM (2010) MAG and OMgp synergize with
Nogo-A to restrict axonal growth and neurological recovery after spinal cord trauma.
J Neurosci 30:6825-6837.
Delekate A, Zagrebelsky M, Kramer S, Schwab ME, Korte M (2011) NogoA restricts synaptic
plasticity in the adult hippocampus on a fast time scale. Proc Natl Acad Sci U S A
108:2569-2574.
Dergham P, Ellezam B, Essagian C, Avedissian H, Lubell WD, McKerracher L (2002) Rho
signaling pathway targeted to promote spinal cord repair. J Neurosci 22:6570-6577.
Dickendesher TL, Baldwin KT, Mironova YA, Koriyama Y, Raiker SJ, Askew KL, Wood A,
Geoffroy CG, Zheng B, Liepmann CD, Katagiri Y, Benowitz LI, Geller HM, Giger RJ
- 88 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
(2012) NgR1 and NgR3 are receptors for chondroitin sulfate proteoglycans. Nat
Neurosci 15:703-712.
Dimou L, Schnell L, Montani L, Duncan C, Simonen M, Schneider R, Liebscher T, Gullo M,
Schwab ME (2006) Nogo-A-deficient mice reveal strain-dependent differences in
axonal regeneration. J Neurosci 26:5591-5603.
Dodt HU, Leischner U, Schierloh A, Jahrling N, Mauch CP, Deininger K, Deussing JM, Eder M,
Zieglgansberger W, Becker K (2007) Ultramicroscopy: three-dimensional
visualization of neuronal networks in the whole mouse brain. Nat Methods 4:331336.
Dubreuil CI, Winton MJ, McKerracher L (2003) Rho activation patterns after spinal cord
injury and the role of activated Rho in apoptosis in the central nervous system. J Cell
Biol 162:233-243.
Egea J, Klein R (2007) Bidirectional Eph-ephrin signaling during axon guidance. Trends Cell
Biol 17:230-238.
Emmenlauer M, Ronneberger O, Ponti A, Schwarb P, Griffa A, Filippi A, Nitschke R, Driever
W, Burkhardt H (2009) XuvTools: free, fast and reliable stitching of large 3D
datasets. J Microsc 233:42-60.
Erb M, Steck AJ, Nave KA, Schaeren-Wiemers N (2003) Differential expression of L- and SMAG upon cAMP stimulated differentiation in oligodendroglial cells. J Neurosci Res
71:326-337.
Fischer D, He Z, Benowitz LI (2004) Counteracting the Nogo receptor enhances optic nerve
regeneration if retinal ganglion cells are in an active growth state. J Neurosci
24:1646-1651.
Fournier AE, GrandPre T, Strittmatter SM (2001) Identification of a receptor mediating
Nogo-66 inhibition of axonal regeneration. Nature 409:341-346.
Giger RJ, Hollis ER, 2nd, Tuszynski MH (2010) Guidance molecules in axon regeneration.
Cold Spring Harb Perspect Biol 2:a001867.
Goldberg JL, Espinosa JS, Xu Y, Davidson N, Kovacs GT, Barres BA (2002) Retinal ganglion
cells do not extend axons by default: promotion by neurotrophic signaling and
electrical activity. Neuron 33:689-702.
Guo F, Jin WL, Li LY, Song WY, Wang HW, Gou XC, Mi YJ, Wang Q, Xiong L (2013) M9, a novel
region of amino-Nogo-A, attenuates cerebral ischemic injury by inhibiting NADPH
oxidase-derived superoxide production in mice. CNS Neurosci Ther 19:319-328.
Haklai-Topper L, Mlechkovich G, Savariego D, Gokhman I, Yaron A (2010) Cis interaction
between Semaphorin6A and Plexin-A4 modulates the repulsive response to Sema6A.
EMBO J 29:2635-2645.
Hauk TG, Leibinger M, Muller A, Andreadaki A, Knippschild U, Fischer D (2010) Stimulation
of axon regeneration in the mature optic nerve by intravitreal application of the tolllike receptor 2 agonist Pam3Cys. Invest Ophthalmol Vis Sci 51:459-464.
Huber AB, Weinmann O, Brosamle C, Oertle T, Schwab ME (2002) Patterns of Nogo mRNA
and protein expression in the developing and adult rat and after CNS lesions. J
Neurosci 22:3553-3567.
Jaworski A, Tessier-Lavigne M (2012) Autocrine/juxtaparacrine regulation of axon
fasciculation by Slit-Robo signaling. Nat Neurosci 15:367-369.
Joly S, Jordi N, Schwab ME, Pernet V (2014) The Ephrin receptor EphA4 restricts axonal
sprouting and enhances branching in the injured mouse optic nerve. Eur J Neurosci.
Kempf A, Montani L, Petrinovic MM, Schroeter A, Weinmann O, Patrignani A, Schwab ME
(2013) Upregulation of axon guidance molecules in the adult central nervous system
of Nogo-A knockout mice restricts neuronal growth and regeneration. Eur J Neurosci
38:3567-3579.
Kempf A, Tews B, Arzt ME, Weinmann O, Obermair FJ, Pernet V, Zagrebelsky M, Delekate A,
Iobbi C, Zemmar A, Ristic Z, Gullo M, Spies P, Dodd D, Gygax D, Korte M, Schwab ME
(2014) The sphingolipid receptor S1PR2 is a receptor for Nogo-a repressing
synaptic plasticity. PLoS Biol 12:e1001763.
- 89 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
Kern F, Stanika RI, Sarg B, Offterdinger M, Hess D, Obermair GJ, Lindner H, Bandtlow CE,
Hengst L, Schweigreiter R (2013) Nogo-A couples with Apg-1 through interaction
and co-ordinate expression under hypoxic and oxidative stress. Biochem J 455:217227.
Kim JE, Li S, GrandPre T, Qiu D, Strittmatter SM (2003) Axon regeneration in young adult
mice lacking Nogo-A/B. Neuron 38:187-199.
Lappe-Siefke C, Goebbels S, Gravel M, Nicksch E, Lee J, Braun PE, Griffiths IR, Nave KA
(2003) Disruption of Cnp1 uncouples oligodendroglial functions in axonal support
and myelination. Nat Genet 33:366-374.
Li S, Liu BP, Budel S, Li M, Ji B, Walus L, Li W, Jirik A, Rabacchi S, Choi E, Worley D, Sah DW,
Pepinsky B, Lee D, Relton J, Strittmatter SM (2004) Blockade of Nogo-66, myelinassociated glycoprotein, and oligodendrocyte myelin glycoprotein by soluble Nogo66 receptor promotes axonal sprouting and recovery after spinal injury. J Neurosci
24:10511-10520.
Liebscher T, Schnell L, Schnell D, Scholl J, Schneider R, Gullo M, Fouad K, Mir A, Rausch M,
Kindler D, Hamers FP, Schwab ME (2005) Nogo-A antibody improves regeneration
and locomotion of spinal cord-injured rats. Ann Neurol 58:706-719.
Luo X, Salgueiro Y, Beckerman SR, Lemmon VP, Tsoulfas P, Park KK (2013) Threedimensional evaluation of retinal ganglion cell axon regeneration and pathfinding in
whole mouse tissue after injury. Exp Neurol 247:653-662.
MacGillavry HD, Stam FJ, Sassen MM, Kegel L, Hendriks WT, Verhaagen J, Smit AB, van
Kesteren RE (2009) NFIL3 and cAMP response element-binding protein form a
transcriptional feedforward loop that controls neuronal regeneration-associated
gene expression. J Neurosci 29:15542-15550.
Mathis C, Schroter A, Thallmair M, Schwab ME (2010) Nogo-a regulates neural precursor
migration in the embryonic mouse cortex. Cereb Cortex 20:2380-2390.
Mi YJ, Hou B, Liao QM, Ma Y, Luo Q, Dai YK, Ju G, Jin WL (2012) Amino-Nogo-A antagonizes
reactive oxygen species generation and protects immature primary cortical neurons
from oxidative toxicity. Cell Death Differ 19:1175-1186.
Mingorance-Le Meur A, Zheng B, Soriano E, del Rio JA (2007) Involvement of the myelinassociated inhibitor Nogo-A in early cortical development and neuronal maturation.
Cereb Cortex 17:2375-2386.
Moore DL, Blackmore MG, Hu Y, Kaestner KH, Bixby JL, Lemmon VP, Goldberg JL (2009) KLF
family members regulate intrinsic axon regeneration ability. Science 326:298-301.
Oertle T, van der Haar ME, Bandtlow CE, Robeva A, Burfeind P, Buss A, Huber AB, Simonen
M, Schnell L, Brosamle C, Kaupmann K, Vallon R, Schwab ME (2003) Nogo-A inhibits
neurite outgrowth and cell spreading with three discrete regions. J Neurosci
23:5393-5406.
Pellegrin S, Mellor H (2008) Rho GTPase activation assays. Curr Protoc Cell Biol Chapter
14:Unit 14 18.
Pernet V, Joly S, Dalkara D, Schwarz O, Christ F, Schaffer D, Flannery JG, Schwab ME (2011)
Neuronal Nogo-A upregulation does not contribute to ER stress-associated
apoptosis but participates in the regenerative response in the axotomized adult
retina. Cell Death Differ.
Pernet V, Joly S, Jordi N, Dalkara D, Guzik-Kornacka A, Flannery JG, Schwab ME (2013)
Misguidance and modulation of axonal regeneration by Stat3 and Rho/ROCK
signaling in the transparent optic nerve. Cell Death Dis 4:e734.
Pernet V, Schwab ME (2012) The role of Nogo-A in axonal plasticity, regrowth and repair.
Cell Tissue Res 349:97-104.
Pernet V, Schwab ME (2014) Lost in the jungle: new hurdles for optic nerve axon
regeneration. Trends Neurosci.
Petrinovic MM, Duncan CS, Bourikas D, Weinman O, Montani L, Schroeter A, Maerki D,
Sommer L, Stoeckli ET, Schwab ME (2010) Neuronal Nogo-A regulates neurite
- 90 -
Chapter 2: Targeted Nogo-A ablation promotes axonal growth
fasciculation, branching and extension in the developing nervous system.
Development 137:2539-2550.
Raiker SJ, Lee H, Baldwin KT, Duan Y, Shrager P, Giger RJ (2010) Oligodendrocyte-myelin
glycoprotein and Nogo negatively regulate activity-dependent synaptic plasticity. J
Neurosci 30:12432-12445.
Schwab ME (2004) Nogo and axon regeneration. Curr Opin Neurobiol 14:118-124.
Schwab ME (2010) Functions of Nogo proteins and their receptors in the nervous system.
Nat Rev Neurosci 11:799-811.
Schwab ME, Strittmatter SM (2014) Nogo limits neural plasticity and recovery from injury.
Curr Opin Neurobiol 27C:53-60.
Simonen M, Pedersen V, Weinmann O, Schnell L, Buss A, Ledermann B, Christ F, Sansig G,
van der Putten H, Schwab ME (2003) Systemic deletion of the myelin-associated
outgrowth inhibitor Nogo-A improves regenerative and plastic responses after
spinal cord injury. Neuron 38:201-211.
Sprinkle TJ (1989) 2',3'-cyclic nucleotide 3'-phosphodiesterase, an oligodendrocyteSchwann cell and myelin-associated enzyme of the nervous system. Crit Rev
Neurobiol 4:235-301.
Sprinzak D, Lakhanpal A, Lebon L, Santat LA, Fontes ME, Anderson GA, Garcia-Ojalvo J,
Elowitz MB (2010) Cis-interactions between Notch and Delta generate mutually
exclusive signalling states. Nature 465:86-90.
Sun F, Park KK, Belin S, Wang D, Lu T, Chen G, Zhang K, Yeung C, Feng G, Yankner BA, He Z
(2011) Sustained axon regeneration induced by co-deletion of PTEN and SOCS3.
Nature 480:372-375.
Tews B, Schonig K, Arzt ME, Clementi S, Rioult-Pedotti MS, Zemmar A, Berger SM, Schneider
M, Enkel T, Weinmann O, Kasper H, Schwab ME, Bartsch D (2013) Synthetic
microRNA-mediated downregulation of Nogo-A in transgenic rats reveals its role as
regulator of synaptic plasticity and cognitive function. Proc Natl Acad Sci U S A
110:6583-6588.
Thallmair M, Metz GA, Z'Graggen WJ, Raineteau O, Kartje GL, Schwab ME (1998) Neurite
growth inhibitors restrict plasticity and functional recovery following corticospinal
tract lesions. Nat Neurosci 1:124-131.
Wang X, Chun SJ, Treloar H, Vartanian T, Greer CA, Strittmatter SM (2002) Localization of
Nogo-A and Nogo-66 receptor proteins at sites of axon-myelin and synaptic contact.
J Neurosci 22:5505-5515.
Wang X, Hasan O, Arzeno A, Benowitz LI, Cafferty WB, Strittmatter SM (2012) Axonal
regeneration induced by blockade of glial inhibitors coupled with activation of
intrinsic neuronal growth pathways. Exp Neurol 237:55-69.
Wills ZP, Mandel-Brehm C, Mardinly AR, McCord AE, Giger RJ, Greenberg ME (2012) The
nogo receptor family restricts synapse number in the developing hippocampus.
Neuron 73:466-481.
Yin Y, Cui Q, Gilbert HY, Yang Y, Yang Z, Berlinicke C, Li Z, Zaverucha-do-Valle C, He H,
Petkova V, Zack DJ, Benowitz LI (2009) Oncomodulin links inflammation to optic
nerve regeneration. Proc Natl Acad Sci U S A 106:19587-19592.
Yin Y, Cui Q, Li Y, Irwin N, Fischer D, Harvey AR, Benowitz LI (2003) Macrophage-derived
factors stimulate optic nerve regeneration. J Neurosci 23:2284-2293.
Yin Y, Henzl MT, Lorber B, Nakazawa T, Thomas TT, Jiang F, Langer R, Benowitz LI (2006)
Oncomodulin is a macrophage-derived signal for axon regeneration in retinal
ganglion cells. Nat Neurosci 9:843-852.
Yiu G, He Z (2006) Glial inhibition of CNS axon regeneration. Nat Rev Neurosci 7:617-627.
- 91 -
- 92 -
Chapter 3
Contribution of glial Nogo-A to molecular mechanisms underlying
axonal regeneration and cell survival in the visual system
by Flóra Vajda
Further contributions by:
Sandrine Joly, Martin E. Schwab and Vincent Pernet
Contributions:
F.V., V.P. and M.E.S.: designed the study. F.V. performed the optic nerve crush surgeries,
harvested and processed tissues for qRT-PCRs (with the help of S.J.), for Western blotting
and immunohistochemical stainings, acquired microscopic images, analyzed mRNA and
protein expression levels. F.V. analyzed the data, prepared all the figures and wrote the
manuscript (revised by V.P. and M.E.S.).
(manuscript in preparation)
- 93 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
1 Abstract
We previously found that both spontaneous and inflammation-mediated axonal
regeneration and neuronal survival was increased in the glia-specific Nogo-A knock-out
(KO), Cnp-Cre+/-xRtn4flox/flox mice. In the visual system, Nogo-A is highly expressed in
oligodendrocytes of the optic nerve and in Müller cells of the retina. Additionally, Nogo-A is
up-regulated in retinal ganglion cells (RGC) after optic nerve injury, where we described its
positive influence on axon growth and potentially on cell survival. Based on these previous
findings, here we further investigated the role of Nogo-A in gliosis and its possible
involvement in the molecular mechanisms of cell death. We found that the deletion of NogoA from Müller cells in the glial Nogo-A KOs did not influence the expression regulation of the
Müller cell marker glutamine sythetase (GS/GLUL) or the Müller glial activation marker glial
fibrillary acidic protein (GFAP). However, in injured conditions, the glial Nogo-A KO retinae
contained slightly increased level of vimentin mRNA. As Nogo-A is highly expressed in the
endoplasmic reticulum (ER) and is up-regulated in the RGCs of the glial Nogo-A KO animals,
we investigated the expression of ER-stress markers that could contribute to the higher RGC
survival observed in these mice. Although the expression of C/EBP homologous protein
(CHOP)
and
binding
immunoglobulin
protein/78kDa
glucose-regulated
protein
(BiP/GRP78) were increased in the retinae of optic nerve injured mice, the mRNA levels
were not significantly different between the observed genotypes. As the role of autophagy
was reported in both neuroprotection and in programmed cell death of RGCs, we examined
the levels of several autophagy-related genes (Atg) and proteins, but the glial Nogo-A KOs
displayed no obvious differences compared to control genotypes. In addition, we screened
the mRNA expression of all Nogo-66 receptor complex members and of related receptors,
and found an up-regulation of NgR2 and TROY that could render RGC growth cones more
sensitive to extrinsic inhibitory myelin cues. To confirm our regenerative and survival
results obtained with the Cnp-Cre+/-xRtn4flox/flox mice, we generated and characterized a
second oligodendrocyte specific conditional Nogo-A knock-out mouse line by crossing our
Rtn4flox/flox mice to the Mog-Cre+/- deleter line. To our surprise, we only detected modest
Nogo-A down-regulation in the optic nerves of Mog-Cre+/-xRtn4flox/flox animals, but as the
expression of Nogo-A in Müller cells was not altered, we propose this model to be suitable
for certain questions addressing the role of oligodendroglial Nogo-A separately.
In summary, here we tested possible molecular processes that may contribute to the
increased axonal regeneration and neuronal survival in the glial Nogo-A KO mice. Despite
the potential role that has been attributed to Nogo-A in ER-stress and autophagy in neuronal
survival, our results show that Nogo-A up-regulation in neurons does not take part in ER
- 94 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
stress or autophagy-associated apoptosis. However, the changes we detected in NgR2 or
TROY receptor expression might influence the growth responses after axonal injury.
Keywords:
glial Nogo-A; neuronal Nogo-A; retinal ganglion cells; Müller cells; optic nerve crush injury;
gliosis; ER stress; autophagy
Abbreviations:
Atf6, activating transcription factor-6; Atg, autophagy-related genes; BiP/Grp78, binding
immunoglobulin protein/78 kDa glucose-regulated protein; CHOP/Gadd153, C/EBP
homologous
protein;
adeno-associated
virus;
CNPase,
2′,3′-cyclic
nucleotide
3′-
phosphodiesterase; CNS, central nervous system; CNTF, ciliary neurotrophic factor; CSPG,
chondroitin sulphate proteoglycans; eIF2α, eukaryotic initiation factor 2; ER, endoplasmatic
reticulum; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GCL, ganglion cell layer;
GFAP, glial fibrillary acidic protein; GS/Glul, glutamine synthetase; INL, inner nuclear layer;
KO, knock-out; LC3, microtubule-associated protein 1 light chain 3 LIF, leukemia inhibitory
factor; LINGO-1, leucine rich repeat - LRR - and IgG domain containing Nogo receptor
interacting protein 1; MAG, myelin-associated glycoprotein; MOG, myelin oligodendrocyte
glycoprotein; NgR, Nogo66 receptor; OFL, optic fiber layer; OMgp, oligodendrocyte myelin
glycoprotein; ONC, optic nerve crush injury; ONL, outer nuclear layer; p75NTR, low affinity
neurotrophin receptor; PBS; phosphate-buffered saline, PirB, paired immunoglobulin-like
receptor B; PNS, peripheral nervous system; qRT-PCR, quantitative real-time polymerase
chain reaction; RGCs, retinal ganglion cells; RTN, reticulon; SEM, standard error of the
mean; STAT3, signal transducer and activator of transcription 3; TBS, tris-buffered saline;
TROY, tumor necrosis factor - TNFα - receptor superfamily member 19; UPR, unfolded
protein response.
- 95 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
2 Introduction
Nogo-A is mostly known as an extracellular inhibitor of axonal regeneration, expressed in
the myelin (Schwab, 2010). However, in the visual system in particular, its localization and
expression regulation suggests further distinct functions in different cell types.
Firstly, in the intact retina, Nogo-A is expressed in the end-feet of retinal Müller glia
surrounding RGC cell bodies. In response to axonal injury and the subsequent inflammation,
radial processes of the Müller cells start expressing the gliosis marker GFAP (Chen and
Weber, 2002, Lewis and Fisher, 2003, Pernet et al., 2011), a marker that has been widely
used to quantify the extent of Müller cell activation. This gliosis of Müller cells following an
optic nerve lesion leads to the secretion of cytokines and inflammatory molecules that
influence the regenerative state of neurons. For instance, in response to optic nerve crush
(ONC), Müller cells express CNTF (ciliary neurotrophic factor) and LIF (leukemia inhibitor
factor), two cytokines that had been shown to be pro-regenerative (Leibinger et al., 2009,
Pernet et al., 2013) and neuroprotective for RGCs and photoreceptors (Ju et al., 2000, Joly et
al., 2008).
The expression of Nogo-A in RGCs in injured WT or in intact and injured glial Nogo-A
KO mice suggests that Nogo-A acts as intrinsic growth and survival regulator in neurons
(Pernet et al., 2011, Mi et al., 2012). In our previous study presented in Chapter 2, we have
shown that possibly by cis-interaction with its receptors, expression of Nogo-A in neurons
leads to decreased activation of Rho-A, serving an explanation how glial deletion of Nogo-A
could lead to increased regeneration and survival. Additionally, intracellular Nogo-A located
in the ER has been proposed to play a neuroprotective function by attenuating ER-stress
(Yang et al., 2009). Disturbances such as axonal damage leading to increased Ca2+ levels or
altered cellular redox regulation cause accumulation of unfolded proteins in the ER. This
triggers an unfolded protein response (UPR) that facilitates either the adaptation to stress
or leads to apoptosis, depending on the severity of the injury (Rutkowski and Kaufman,
2004). The expression of the ER-stress marker C/EBP homologous protein (CHOP) has been
correlated to Nogo-A expression in neurons, and although the expression of both CHOP and
Nogo-A was increased in injured RGCs, no causal link was found in their expression (Pernet
et al., 2011). About 95% of Nogo-A in neurons is expressed intracellularly in membranebound state mostly associated to the ER, and this pattern could suggest that Nogo-A could
also be expressed in other organelles such as in autophagosome isolation membranes. A
recent study suggested that RTN3, a reticulon family member related to Nogo-A (RTN4) may
regulate autophagy under ER stress conditions (Chen et al., 2011), and Nogo-A itself has
been implicated in the protection against autophagic cell death (Teng and Tang, 2013).
- 96 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
Autophagy is a highly conserved catabolic intracellular degradation pathway that has been
implicated in either pro-survival or pro-death mechanisms in RGCs (Russo et al., 2013).
Autophagy is activated in RGCs 3-5 days after optic nerve axotomy and the up-regulation of
Atg5, an autophagy regulator, has been described to play a cytoprotective role (RodriguezMuela et al., 2012).
In this study we aimed to investigate the possible role of Nogo-A in Müller cells in
axonal regeneration and of neuronal Nogo-A in cell survival, possibly through its
involvement in ER-stress or autophagic processes. Additionally, to gain further insights into
the increased regeneration phenotype we previously observed in glial Nogo-A KO animals,
we followed the expression changes of members of the Nogo-A receptor complex.
Furthermore we generated and tested an alternative glial conditional Nogo-A KO mouse line
(Mog-Cre+/-xRtn4flox/flox) that might allow us to study the separate contribution of
oligodendroglial Nogo-A in the blockade of axonal regeneration, independently of the
deletion of Nogo-A in Müller cells that occurred in the mouse line we have previously used
(Cnp-Cre+/-xRtn4flox/flox).
3 Results
3.1 Müller cells injury response in glial Nogo-A KOs
The effect glial Nogo-A deletion on gliosis in intact and injured retina samples was first
evaluated by qRT-PCR. The overall mRNA level of the gliosis marker glial fibrillary acidic
protein (Gfap) increased, whereas glutamine sythetase (Glul) decreased 5 days after ONC
injury, however no significant difference was found between Cnp-Cre+/- control and CnpCre+/-xRtn4flox/flox glial Nogo-A KO mice in either conditions (Figure 1A and B). In injured
conditions, the glial Nogo-A KO retinae showed slightly increased levels of vimentin mRNA
(Figure 1C), however this increase was modest and not consistent with the Gfap mRNA
levels that were not different between the different genotypes. GFAP protein levels and
localization was followed by Western blot analysis and immunohistochemistry in intact
conditions and 3 days post injury. On the bulk of the protein content, we could not detect a
difference between control and glial Nogo-A KO, or intact and injured retina lysates (Figure
1D and E). On retinal cross-sections, compared to intact retinae, where only astrocytes are
stained for GFAP in the optic fiber layer (Figure 1F), we found high expression of GFAP in
radial processes in injured conditions, reflecting strong Müller cells gliosis (Figure 1G). In
our study, GFAP expression levels were not different between injured control and glial
Nogo-A KO mice, where Nogo-A is excised from Müller cells. In summary, based on our
- 97 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
- 98 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
Figure 1. Müller cells injury response in Cnp-Cre+/-xRtn4flox/flox mice. (A-B) Five days after ONC
injury, the mRNA levels of the gliosis marker glial fibrillary acidic protein (Gfap) increased, whereas
the Müller cell marker glutamine sythetase (Glul) decreased, but neither of the mRNA levels differ
significantly between control and glial Nogo-A KO mice. (C) A slight, but significant increase of the
vimentin mRNA was measured in injured glial Nogo-A KO retinae (mean±S.E.M., student’s T-test,
*p<0.05). (D-E) On the protein level GFAP levels were not different between the Rtn4flox/flox and CnpCre+/-xRtn4flox/flox groups. (F) In intact retinae, GFAP is expressed in astrocytes localized in the optic
fiber layer. (G) Three day after ONC, Müller cells respond to the injury by strong up-regulation of
GFAP in glutamine sythetase (GS) positive radial processes, but the activation pattern and intensity
was not different between the examined genotypes. Scale bar: F and G = 100μm.
findings glial Nogo-A does not seem to contribute to the injury-triggered activation of Müller
cells.
3.2 Regulation of ER stress-related genes in the retina of Cnp-Cre+/-xRtn4flox/flox mice
Optic nerve injury provoked strong mRNA up-regulation of two important ER stress-related
molecules: Chop/Gadd153 (C/EBP homologous protein), a pro-apoptotic transcription factor
suppressing the transcription of Bcl-2 (Figure 2A), and Bip/Grp78, an important protein
chaperon abundant in the ER lumen possessing anti-apoptotic functions (Figure 2B). The
level of eIF2α (eukaryotic initiation factor 2) upstream of CHOP was also induced 3 days
after ONC (Figure 2C). No changes were detected in the level of Atf6 (activating
transcription factor-6), another mediator of the ER-stress cascade (Figure 2D). We have not
found different regulation for any of the ER-stress related genes in intact or inured glial
Nogo-A KO retinae. The anti-apoptotic marker Bcl-2 also showed increased mRNA
expression after injury (Figure 2E), but its expression was comparable between different
genotypes. On the protein level, CHOP was strongly increased in the nucleus of injured RGCs,
but not in other retinal layers, showing the specificity of the signal detection. The deletion of
Nogo-A from Müller cells and the initial up-regulation of Nogo-A in RGCs did not influence
this CHOP activation pattern in Cnp-Cre+/-xRtn4flox/flox mice (Figure 3A).
3.3 The expression of autophagy related genes is not modified by glial deletion of
Nogo-A
To study whether autophagy serves as an anti-apoptotic strategy in the glial Nogo-A knockout mice, we measured the mRNA levels of several autophagy-related genes (Atg) (Figure 4).
The microtubule-associated protein 1 light chain 3 (LC3, in mammals three homologous LC3
proteins: α, β and γ), a homolog of yeast Atg8, is either a cytosolic protein (LC3I) or localizes
to autophagosomal membranes after post-translational modifications (LC3II). The
- 99 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
Figure 2. Regulation of the ER stress related genes and in the glial Nogo-A KO mice. The effect of
Nogo-A deletion from glia on ER stress mechanisms in intact and injured retina samples was
measured by qRT-PCR 3 days after ONC injury. (A) Chop/Gadd153 and (B) Bip/Grp78 were strongly
up-regulated in response to the injury, but the magnitude if increase was comparable between the
different genotypes. The mRNA levels of two upstream regulators (C) eIF2α and (D) Atf6, were
slightly increased after injury to similar extent in all groups. (E) Bcl-2 also showed a small increase in
mRNA expression after injury.
Figure 3. Protein expression and localization of CHOP after ONC injury. The elevation of CHOP
was confirmed on protein levels. (A) CHOP was strongly increased in the nucleus of only injured
RGCs, but not in other retinal layers. The activation pattern was not altered in Cnp-Cre+/-xRtn4flox/flox
mice. Scale bar: A = 50μm.
- 100 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
Figure 4. Regulation of the autophagy related genes and in the glial Nogo-A KO mice. The levels
of (A) Atg3, (B) Atg5, (D) Atg12, (E) LC3α and (F) LC3β mRNA were increased in whole retinal lysates
3 days after optic nerve crush injury and no difference was detected between the glial Nogo-A KO and
control groups. (C) The Atg7 mRNA level was unchanged after injury.
- 101 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
proteolytic cleavage and lipidation that turns LC3 into its active form that translocates to the
autophagosomal membrane involves a cascade of events requiring the action of Atg3 and 7.
In the macroautophagic process, the elongation and closure of the isolation membrane
requires the covalent attachment of the protein Atg5 to Atg12 through an ubiquitin-like
conjugation system and this association then also promotes the activation of LC3. Except
Atg7, all analyzed autophagy mRNA products such as Atg3, Atg5, Atg12, LC3α and LC3β were
increased to different extents in whole retinal lysates 3 days after optic nerve crush injury
(Figure 4A-F), consistently with previous studies (Russo et al., 2013). However the levels of
these mRNAs were not significantly different in the Cnp-Cre+/-xRtn4flox/flox mice compared to
control genotypes. The LC3 (I and II) protein was localized in the ganglion cell layer, but the
ONC injury did not change the distribution of LC3 in the retina in either genotypes (Figure
5A). By Western blotting, the level of the Atg5/Atg12 protein complex was not changed in
the glial Nogo-A KOs in intact or injured retinae (Figure 5B and C).
3.4 Regulation of Nogo-A receptors in the retina of Cnp-Cre+/-xRtn4flox/flox mice
We observed interesting mRNA level alterations of the Nogo-66 receptor complex 5 days
after ONC injury. As reported before, NgR1 mRNA decreased by ~40% in response to the
injury (Pernet et al., 2011), but the overall level was not changed between the genotypes
(Figure 6A). We also analyzed the expression level of a related NgR family member, NgR2, a
receptor for MAG but not for Nogo-A (Venkatesh et al., 2005). As we previously found that
MAG increased in conventional Nogo-A KO mice (Pernet et al., 2008), the interplay between
the regulation of Nogo-A, MAG and NgR2 was especially interesting. Indeed, the NgR2 mRNA
expression level was increased in the Cnp-Cre+/-xRtn4flox/flox mice in both intact and injured
retinae (Figure 6B). The amount of NgR3, one of the receptors for CSPGs, was not changed
between conditions and genotypes (Figure 6C). We found a significant up-regulation of Troy
in injured glial Nogo-A KO retinae (Figure 6D), but the levels of a further NgR1 receptor
complex partner, Lingo-1 were not altered between the genotypes (Figure 6F). The
expression level of PirB, an additional Nogo-66 receptor, was not statistically different in the
glial Nogo-A KOs (Figure 6E). In the retina, p75 is mostly expressed in Müller cells (Hu et al.,
1998), but its expression levels were not changed in the glial Nogo-A KOs where Nogo-A is
ablated in this cell type in neither intact or injured conditions (Figure 6G).
- 102 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
Figure 5. Protein expression and localization of LC3 and Atg5/12 after ONC injury. (A) LC3 was
localized in the ganglion cell layer, but the ONC injury have not changed the distribution of LC3 in the
retina in neither of the genotypes. (B-C) The level of the Atg5/Atg12 protein complex was not
changed in the glial Nogo-A KOs in intact or injured retinae. Scale bar: A = 50μm.
- 103 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
Figure 6. Nogo-A receptor expression changes in the retina of Cnp-Cre+/-xRtn4flox/flox mice. (A)
The NgR1 mRNA decreased by ~40% in response to the injury, but the overall level was not changed
between the genotypes. (B) The NgR2 receptor mRNA expression was significantly increased in both
intact and injured Cnp-Cre+/-xRtn4flox/flox retinae. (C) NgR3 was not changed between conditions and
genotypes. (D) The NgR1-Lingo-1 co-receptor Troy was significant up-regulation in injured glial
Nogo-A KO retinae. (E) PirB increased after injury, but not to a different extent in the glial Nogo-A
KOs. (F) Lingo-1 was not altered between genotypes. (G) p75 expression levels were not changed in
any conditions. All receptor mRNA levels were measured in intact retinae and 5 days after ONC injury
(two-way ANOVA, *P<0.05, **P<0.01. ***p<0.001).
- 104 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
3.5 Model systems: Mog-Cre+/-xRtn4flox/flox vs. Cnp-Cre+/-xRtn4flox/flox
In the Cnp-Cre+/-xRtn4flox/flox mice we found complete excision of Nogo-A from Müller cells
that might have influenced regeneration in these glial Nogo-A KO animals, indirectly
through influencing gliosis or by possible changes in the direct interaction with retinal
ganglion cell bodies. To create a more specific oligodendroglial Nogo-A KO mouse line
where Nogo-A is solely excised from oligodendrocytes but not from other glial cells, we
crossed Rtn4flox/flox mice with the Mog-Cre+/- deleter mouse line. Surprisingly, in this different
system where Cre expression is driven by the Mog gene expressed in oligodendrocytes, we
only found ~25% Nogo-A down-regulation in the optic nerve at age P60 compared to ~80%
down-regulation in the Cnp-Cre+/-xRtn4flox/flox mice (Figure 7A). The double immunostaining
for Olig2 and Cre-recombinase confirmed that compared to the Cnp-Cre+/-xRtn4flox/flox optic
nerves, where all Olig2 positive oligodendrocytes expressed Cre recombinase, Cre
expression was very sparse and almost undetectable in the Mog-Cre+/-xRtn4flox/flox mice
(Figure 7B). In the retina, we found no Nogo-A expression changes in Mog-Cre+/-xRtn4flox/flox
animals (Figure 8A) and no alterations in Nogo-A localization in RGCs or Müller cells (Figure
8B).
- 105 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
Figure 7. Nogo-A expression in the optic nerves of Mog-Cre+/-xRtn4flox/flox mice. (A) Western blot
analysis revealed that Nogo-A protein was only down-regulated by ~25% in P60 optic nerves of MogCre+/-xRtn4flox/flox in contrast to the previously observed ~80% decrease in Cnp-Cre+/-xRtn4flox/flox mice
(one-way ANOVA, **P<0.01. ***p<0.001). Nogo-B protein showed compensatory up-regulation in
both glial Nogo-A KO lines. (B) Olig2 and Cre-recombinase immunostainings on sagittal optic nerve
sections revelead very weak Cre expression in Mog-Cre+/-xRtn4flox/flox oligodendrocytes compared to
highly Cre-expressing Olig2-positive cells in the Cnp-Cre+/-xRtn4flox/flox animals. Scale bar: B = 100μm.
- 106 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
Figure 8. Nogo-A expression in the optic nerves of Mog-Cre+/-xRtn4flox/flox mice. (A) In the retina,
we found no Nogo-A or -B expression changes in Mog-Cre+/-xRtn4flox/flox animals. (B) Nogo-A was
mostly located in Müller cell end-feet surrounding βIII-Tubulin-labelled retinal ganglion cell bodies in
both Mog-Cre+/- and Mog-Cre+/-xRtn4flox/+ intact retinae. Scale bar: B = 50μm.
- 107 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
4 Discussion
In Chapter 2 of the present thesis, we found that of deletion of Nogo-A from glial cells leads
to significantly increased axonal regeneration in the optic nerve and elevated retinal
ganglion cell survival in the retina. In the present study, we aimed to further investigate the
possible underlying molecular mechanisms that drive cell survival and axonal regeneration
in the glial Nogo-A knock-out animals. Our results showed no obvious alterations in gliosis,
ER stress or autophagy that may contribute to RGC survival. Some expression changes were
detected in NgR related receptors upon deletion of Nogo-A from glial cells. Additionally in
this study we introduced an alternative mouse model to study further functions of glial
Nogo-A in the CNS, however this new line displayed only modest Nogo-A down-regulation
from oligodendrocytes.
4.1 Nogo-A and Müller cell reaction
In the retina, Nogo-A is expressed in Müller cells and after ONC injury about 50% of RGCs
respond with Nogo-A up-regulation. The polarized distribution of Nogo-A in the end-feet of
Müller cells resembles the localization of RTN3 and MAG (Stefansson et al., 1984,
Kumamaru et al., 2004), but the physiological role of these proteins in this cell type is not
yet understood. In response to the optic nerve or retinal injury and inflammation, radial
processes of the Müller cells start expressing increased amount of GFAP, a widely used
gliosis marker. In our study, we tested the possible contribution of Nogo-A to Müller cell
activation in the glial Nogo-A KO mice. Our results showed no significant alteration in the
up-regulation of GFAP, and only a slight increase in retinal vimentin levels following ONC
injury. These findings are consistent with previous data showing that in conventional NogoA KO mice the loss of Nogo-A in Müller cells did not alter axotomy-induced gliosis or that
following injury Nogo-A levels remain unchanged in Müller glia (Pernet et al., 2011).
Interestingly, the glial Nogo-A KO mice showed a tendency towards lower STAT3 activation
that could be attributed to the deletion of Nogo-A from Müller glia, but this alteration was
not significant and did not lead to changes in the downstream signaling pathways.
Nogo-B is expressed solely in Müller cells of the retina, but in contrast to myelinated
CNS regions, its expression was not altered in Cnp-Cre+/-xRtn4flox/flox animals, where Nogo-A
is deleted from glial cells. However, as the amount of Nogo-B exceed Nogo-A expression
levels in retina, it is not unlikely that Nogo-B would replace functions of Nogo-A in Müller
cells and possibly participate in the gliotic reaction.
Additionally, in our previous study we observed EphA4 up-regulation in the retinae of
glial Nogo-A KO mice. EphA4 is mostly expressed in Müller cells in the retina, and genetic
- 108 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
deletion of EphA4 led to increase regeneration that was associated with significantly higher
Lif and Bdnf mRNA expression in the retina (Joly et al., 2014). These expression changes
were probably not triggered by altered gliosis, as the levels of the two gliosis markers Gfap
and vimentin were similar between control and EphA4 KO genotypes. The compensatory upregulation of EphA4 in Müller glia of the Cnp-Cre+/-xRtn4flox/flox mice, however, could still be
of functional importance by acting as a break on the regenerative response, a possibility that
should be further investigated.
4.2 Possible neuro-protective mechanisms of Nogo-A in the retina
Nogo-A belongs to the reticulon protein family composed of four members (RTN1, RTN2,
RTN3 and RTN4), the functions of which have been closely related to the maintenance of ER
structure (Voeltz et al., 2006, Jozsef et al., 2014). RTN proteins have been also implicated in
cell death regulation by Bcl-2 and Bcl-XL, two intracellular anti-apoptotic proteins (Tagami
et al., 2000, Oertle et al., 2003, Wan et al., 2007).
In contrast to cell surface Nogo-A’s role as a myelin-associated inhibitor of axon
outgrowth, the function of the high levels of intracellular Nogo-A is largely unknown.
Neuronal Nogo-A has been indicated to act as a neuroprotective molecule after oxidative
stress: Nogo-A-∆20 has been shown to scavenge reactive oxygen species (Mi et al., 2012),
whereas M9, a region of amino-Nogo-A, attenuated cerebral ischemic injury by inhibiting
NADPH oxidase derived superoxide production (Guo et al., 2013). Additionally, NiG/Nogo-A
recruited cytoprotective proteins such as Apg-1, a member of the stress-induced Hsp110
(heat-shock protein of 110 kDa) family (Kern et al., 2013).
Injured neurons up-regulate Nogo-A (Cheatwood et al., 2008, Pernet et al., 2011)
suggesting that neuronal Nogo-A might play a cell-autonomous role in neuronal survival and
growth related mechanisms. Due to its localization, RTN members were proposed to
influence ER stress activation (Munoz and Zorzano, 2011, Sutendra et al., 2011). Nogo-A
contributed to the proper function of the ER resident chaperone PDI, and was found to be
protective against ALS-like neurodegeneration (Yang et al., 2009). Optic nerve injury
provokes sustained CHOP up-regulation, and deletion of CHOP promotes RGC survival (Hu
et al., 2012), however, no expression changes of CHOP were detected in Nogo-A depleted
neurons (Pernet et al., 2011). Additionally, overexpression of Nogo-A did not alter the level
of CHOP or that of the chaperon protein Bip (Yang et al., 2009). In our study, where we
deleted Nogo-A in Müller glia, we could not detect any differences in the regulation of ER
stress related genes such as Chop/Gadd153, Bip/Grp78, eIF2α, Atf6 and Bcl-2, or the
localization of the CHOP protein, neither in Müller cells nor in RGCs. A recent study
- 109 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
suggested that although Nogo-A/B deletion altered ER morphology and compromised the
Ca2+ homeostasis, no indication of ER stress was detected in the Nogo-A/B KO cells,
suggesting proper functioning of the protein folding machinery (Jozsef et al., 2014). Our
results are therefore consistent with the previously discussed data on ER stress regulation,
showing that Nogo-A is not involved in the injury-induced ER stress processes.
Interestingly, the role of autophagy has been controversial in the retina; several
studies reported either positive (Kim et al., 2008, Shen et al., 2011, Rodriguez-Muela et al.,
2012) or negative (Piras et al., 2011, Park et al., 2012) contribution of autophagy to retinal
ganglion cell survival. In the glial Nogo-A KOs, where Nogo-A was up-regulated in about
50% of RGCs before and after injury, we found increased RGC survival after ONC injury. In
one study, Nogo-A overexpression suppressed autophagy induction after H2O2 treatment as
assessed by the LC3-II/LC3-I ratio, suggesting that Nogo-A would protect against
autophagic cell death (Teng and Tang, 2013). In the retinae of the glial Nogo-A KOs,
however, we found no changes in the regulation of autophagy related genes (Atg3, Atg5,
Atg7, Atg12, LC3α and LC3β) or proteins (LC3 and Atg5/12).
In light of these data, an influence of Nogo-A on the oxidative stress-induced necrotic
neuronal cell death or apoptosis could be an explanation for the increased neuroprotection
in glial Nogo-A KOs. However, physiological, in vivo experiments are necessary to confirm
this hypothesis.
4.3 NgR receptor complex changes upon glial deletion of Nogo-A
In our previous study with the glial Nogo-A KO mice we proposed that neuronal Nogo-A
might interact with its receptor NgR1 in cis, thereby blocking the downstream Rho-A
signaling pathway and leading to increased axonal regeneration after ONC injury. The
overall level of NgR1 was not changed in the retina, but the mRNA of a related receptor
NgR2 was significantly up-regulated in both intact and injured glial Nogo-A KO retinae.
NgR1 is a common receptor for the myelin associated inhibitors (Nogo-A, MAG, OMgp)
(Fournier et al., 2001, Domeniconi et al., 2002, Wang et al., 2002), however, NgR2, a receptor
for MAG, acts selectively to mediate MAG derived inhibitory responses (Venkatesh et al.,
2005). The increase in NgR2 expression might render RGC axons in the glial conditional KOs
more sensitive to MAG and block axonal regrowth. On the ligand level, we have previously
shown that MAG was not significantly up-regulated in the optic nerves of glial Nogo-A KOs.
Additionally, a recent study demonstrated Versican as a novel interaction partner of NgR2
(Baumer et al., 2014), therefore up-regulation of NgR2 might further sensitize growing
axons to this subclass of CSPGs.
- 110 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
Another NgR receptor complex member that showed significant mRNA up-regulation
in injured glial Nogo-A KOs is TROY, a co-receptor that can replace p75 in the
p75/NgR1/LINGO-1 complex (Shao et al., 2005). This up-regulation, however, was not
associated with an NgR1/LINGO-1 increase, its two partners in the receptor complex;
therefore, the expression increase might derive from distinct cell types from RGCs, such as
reactive astrocytes, macrophages, microglia or immune cells (Satoh et al., 2007). A possible
contribution of glial and neuronal Nogo-A to the regulation of the retinal immune responses
triggered by optic nerve injury needs to be further investigated.
4.4 Lack of significant Nogo-A down-regulation in Mog-Cre+/-xRtn4flox/flox mice
Contrary to our expectations, only a fraction of Nogo-A was excised from oligodendrocytes
of Mog-Cre+/-xRtn4flox/flox optic nerves, a finding that was also supported by the low
expression of Cre recombinase in these cells. Relative to other, well-characterized myelin
proteins such as MBP and CNP, the expression of MOG appeared relatively late during CNS
development (Scolding et al., 1989, Matthieu and Amiguet, 1990). Cre expression therefore
might only rise at the moment of oligodendrocyte development, when Nogo-A is already
strongly expressed. Although the Cre staining we performed on optic nerve sections did not
label well defined oligodendrocyte nuclei in Mog-Cre+/-xRtn4flox/flox mice, it remains possible
that only a subpopulation of oligodendrocytes express Cre in the Mog-Cre+/-xRtn4flox/flox
animals, thereby driving only a localized effect on Nogo-A expression. This could be due to
insufficient amount of Cre present in the genome, as the Mog-Cre mice were kept in a
heterozygous (+/-) state to avoid complete deletion of the Mog gene from these Cre knock-in
mice. The difference in Nogo-A down-regulation levels in Mog-Cre+/-xRtn4flox/flox vs. CnpCre+/-xRtn4flox/flox mice could therefore be due to different amount of Cre recombinase
expressed in oligodendrocytes of the two lines.
Due to the modest Nogo-A down-regulation in the Mog-Cre+/-xRtn4flox/flox animals,
these mice would not serve as an ideal model to study axonal regeneration in the optic
nerve. However, this lower efficiency of Nogo-A deletion from oligodendrocytes might allow
us to study local, cell specific processes, such as the myelination pattern around
subpopulations of oligodendrocytes that express or lack Cre recombinase. The newly
generated Mog-Cre driven glial Nogo-A KO line therefore holds the potential to serve as a
model to study localized Nogo-A functions in the optic nerve, however the suitability and
Nogo-A down-regulation efficiency in other CNS regions need to be investigated.
- 111 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
In summary, in this study we aimed to identify further molecular regulators that drive
the increased axonal regeneration and neuronal survival in the glial Nogo-A KO mice. No
obvious changes were found in the Müller glial activation, ER-stress or autophagy
responses. Small alterations were detected in the expression of some Nogo-A receptor
complex members such as TROY and NgR2 that could influence the regenerative response of
our glial Nogo-A KOs. Additionally, although we observed some Nogo-A deletion in our
newly generated Mog-Cre+/-xRtn4flox/flox, due to the relatively low down-regulation efficiency
we propose that our Cnp-Cre+/-xRtn4flox/flox is more suitable to study the role of
oligodendroglial Nogo-A in axonal regeneration.
Conflict of Interest
The authors declare no conflict of interest.
Acknowledgements
This work was supported by the Swiss National Science Foundation (SNF grant #31003A149315-1 for M.E.S) and the European Research Council (ERC, ‘Nogorise’ #294115 for
M.E.S). We thank Professor Klaus-Armin Nave for kindly providing the Cnp-Cre mouse line
and Professor Ari Waisman for sharing the Mog-Cre mice with us.
5 Materials and methods
Animals
The previously described Rtn4flox/flox, in which the exon 3 of the Rtn4 allele was flanked by
LoxP sites were crossed with mice expressing Cre-recombinase under the control of the
2’,3’-cyclic nucleotide phosphodiesterase (Cnp) or myelin oligodendrocyte glycoprotein
(Mog), respectively. The Cnp-Cre line was generated in the laboratory of Prof. Klaus-Armin
Nave (Lappe-Siefke et al., 2003). The Mog-Cre line was obtained from Prof. Ari Waisman
(Buch et al., 2005, Hovelmeyer et al., 2005). All procedures and surgeries were performed
on 2–4 month old mice of mixed genders and different genotypes. Animal experiments were
performed in accordance with the guidelines of the Veterinary Office of the Canton of Zurich.
Optic nerve crush (ONC) injury
The left optic nerve was exposed intra-orbitally and then crushed by tying a knot with a 9-0
suture at ~0.5mm from the back of the eye. The suture was carefully removed and the
- 112 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
integrity of the ophthalmic artery was examined by fundus examination. Three to five days
after ONC, intact and injured retinae were collected for Western blot and qRT-PCR analysis.
Retina and optic nerve processing and immunostaining
Mice were sacrificed by injecting an overdose of anaesthetics intraperitoneally and perfused
intracardially with PBS and 4% PFA. Optic nerves and eyes were dissected, the latter by
removing the cornea and the lens from the eyecup. For retinal cross sections and
longitudinal optic nerve sections, the eye cups and optic nerves were post-fixed in 4% PFA
overnight at 4oC. The tissues were then cryoprotected in 30% sucrose and frozen in OCT
compound (Tissue-TEK, Sakura) with a 2-methylbutane bath cooled with liquid nitrogen.
Optic nerves and retinal sections were cut (14μm) with a cryostat. Immuno-histochemical
stainings were performed in a blocking solution (5% of normal goat serum or 5% BSA, 0.3%
Triton-X-100, and 0.05% sodium azide in PBS). Primary antibodies were applied overnight
at 4°C and after PBS washes, sections were incubated with the appropriate secondary
antibody for 1h at room temperature. The slides were mounted in Mowiol solution (10%
Mowiol 4–88 (Calbiochem) in 100mM Tris, pH 8.5, 25% glycerol and 0.1% DABCO). Primary
antibodies were: rabbit anti-Nogo-A (Laura, Rb173A40) serum (1:200), rabbit anti-GFAP
(1:500, Dako), mouse anti-GS (1:300, Chemicon), rabbit anti-CHOP/GADD153 (1:50, Santa
Cruz), rabbit anti-LC3 (1:250, MBL), mouse anti-APC (1:300, Chemicon), rabbit anti-Olig2
(1:300, Millipore), mouse anti-Cre recombinase (1:400, Millipore) and mouse anti-βIIITubulin (1:1’000, Promega). Immunofluorescent labelling was analysed with a Zeiss
Axioskop 2 Plus microscope or with Leica SPE-II confocal microscope.
Western blot analysis
After cervical dislocation, retinae and optic nerves were quickly dissected out and flash
frozen in liquid nitrogen. Tissues were kept at -80oC until extraction in lysis buffer (RIPA
buffer: 150mM NaCl, 1% NP40, 0,5% deoxycholate, 0.1% SDS in 50mM Tris buffer at pH8)
containing protease inhibitors (Complete mini, Roche Diagnostics). Samples were fully
homogenized and let on ice for 60 min. After centrifugation for 15 min at 15’000xg, 4°C,
supernatants were collected and processed for protein concentration analysis (Bio-Rad
Laboratories, RC DC Protein Assay). Retinal and optic nerve proteins (20μg/lane) were
separated by electrophoresis on a 4–12% polyacrylamide gel and transferred to
nitrocellulose membranes. Blots were incubated in a blocking solution of either 2% Top
Block (Lubio Science) or 5% BSA (bovine serum albumin) in 0.2% TBST (0.2% Tween-20 in
Tris-base 0.1 M, pH7.4) for 1 hour at room temperature, then incubated with primary
antibodies overnight at 4°C. Following the washing steps, membranes were incubated with
- 113 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
horseradish peroxidase-conjugated anti-mouse or anti-rabbit secondary antibodies
(1:10’000-1:25’000; Pierce Biotechnology). Primary antibodies were rabbit anti-Nogo-A/B
(Bianca, Rb140) serum (1:20’000), rabbit anti-GFAP (1:500, Dako), mouse anti-Atg5/Atg512 (1:400, NanoTools), and mouse anti-GAPDH (1:20’000; Abcam). Protein bands were
detected with SuperSignal West Pico Chemiluminescent Substrate (Pierce Biotechnology) in
a Stella detector (Raytest). Band intensities were measured with the Image J software (NIH).
Semi-quantitative RT-PCR (qRT-PCR)
After cervical dislocation, intact and injured whole retinae were rapidly dissected in PBS.
The samples were flash frozen in liquid nitrogen and stored at -80oC until RNA extraction.
Retinal RNA was prepared using the RNeasy RNA isolation kit (Qiagen), including a DNase
treatment to digest the residual genomic DNA. For reverse transcription, equal amounts of
total RNA were transformed to cDNA by using oligo(dT) primers and M-MLV reverse
transcriptase (Promega). 10ng of cDNA was amplified in the Light Cycler 480 thermocycler
(Roche Diagnostics AG) with the polymerase ready mix (SYBR Green I Master; Roche
Diagnostics). The following specific primers were designed to span intronic sequences or
cover exon–intron boundaries: Gapdh (forward, 5’-CAGCAATGCATCCTGCACC-3’; reverse, 5’TGGACTGTGGTCATGAGCCC-3’), Nogo-A/Rtn4 (forward, 5’-CAGTGGATGAGACCCTTTTTG-3’;
reverse,
5’-GCTGCTCCTTCAAATCCATAA-3’),
NgR1/Rtn4R
(forward,
5’-
CTCGACCCCGAAGATGAAG-3’; reverse: 5’-TGTAGCACACACAAGCACCAG-3’), NgR2 (forward,
5’-GAGGCTTGGTCAGCCTACAGT-3’;
reverse:
5’-CGCGAACAAGTCATCCTGT-3’),
NgR3
(forward, 5’-ATGCTTCGCAAAGGGTGCTGTG-3’; reverse: 5’-ATGCTTCGCAAAGGGTGCTGTG3’),
Troy
(forward,
5’-ATGCTTCGCAAAGGGTGCTGTG-3’;
reverse:
5’-
GGAAGAGAATGGCAGCGAAG-3’), PirB (forward, 5’-TGTGGCCTTCATCCTGTTCCT-3’; reverse:
5’-CCTGGTTATGGGCTCTTCAGC-3’), Lingo-1 (forward, 5’-AAGTGGCCAGTTCATCAGGT-3’;
reverse: 5’-TGTAGCAGAGCCTGACAGCA-3’), p75 (forward, 5’-CTGCTGCTGCTGCTTCTAGG-3’;
reverse:
5’-ACACACGGTCTGGTTGGCTC-3’),
Gfap
(forward,
5’-
CCACCAAACTGGCTGATGTCTAC-3’; reverse: 5’- TTCTCTCCAAATCCACACGAGC -3’), Glul
(forward, 5’-CTCCATCCTGTTGCCATGT-3’; reverse: 5’-GATGTGCCTCAAGTTGGTCTC-3’),
Vimentin
(forward,
5’-TACAGGAAGCTGCTGGAAGG-3’;
reverse:
5’-
TGGGTGTCAACCAGAGGAA-3’), Chop/Gadd153 (forward, 5’-ACACCACCACACCTGAAAGCAG3’;
reverse:
5’-TGACTGGAATCTGGAGAGCGAG-3’),
Bip/Grp78
(forward,
5’-
TGCAGCAGGACATCAAGTTC-3’; reverse: 5’-CAGCAATAGTGCCAGCATCT-3’), eIF2α (forward,
5’-CCAGGAAGTGACAAGCCATT-3’; reverse: 5’-CAGGATCACCAGAAGCAGA-3’), Atf6 (forward,
5’-TGCCTTGGGAGTCAGACCTA-3’;
reverse:
5’-AGGAAGCCGGAGAAAGAGG-3’),
Bcl-2
(forward, 5’-TGCACCTGACGCCCTTCAC-3’; reverse: 5’-AGACAGCCAGGAGAAATCAAACAG-3’),
- 114 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
Atg3
(forward,
5’-CAGCACTGTGTGATGAAGAAGACG-3’;
reverse:
5’-
CATAGCCAAACAACCATAGCCG-3’), Atg5 (forward, 5’-GACAGATTTGACCAGTTTTGGGC-3’;
reverse:
5’-GGGTTTCCAGCATTGGCTCTATC-3’),
Atg7
(forward,
5’-
CGATGACGACACTGTTCTGGTCTC-3’; reverse: 5’-GACTTCAACGGACTGGAAACTGC-3’), Atg12
(forward, 5’-AATCAGTCCTTTGCCCCTTCC-3’; reverse: 5’-TCCCACAGCACCGAAATGTCTC-3’),
Lc3α
(forward,
5’-CGACCAGCACCCCAGTAAGA-3’;
reverse:
5’-
TGACCAACTCGCTCATGTTAACA-3’), Lc3β (forward, 5’-AGTGGAAGATGTCCGGCTCAT-3’;
reverse: 5’-TCAGGCACCAGGAACTTGGT-3’). For relative quantification of gene expression,
mRNA levels were normalized to GAPDH using the comparative threshold cycle (∆∆CT)
method and a control sample was used to calculate the relative values. Each reaction was
done in triplicate and 3-4 mice per condition were analysed.
References
Baumer BE, Kurz A, Borrie SC, Sickinger S, Dours-Zimmermann MT, Zimmermann DR,
Bandtlow CE (2014) Nogo receptor homolog NgR2 expressed in sensory DRG
neurons controls epidermal innervation by interaction with Versican. J Neurosci
34:1633-1646.
Buch T, Heppner FL, Tertilt C, Heinen TJ, Kremer M, Wunderlich FT, Jung S, Waisman A
(2005) A Cre-inducible diphtheria toxin receptor mediates cell lineage ablation after
toxin administration. Nat Methods 2:419-426.
Cheatwood JL, Emerick AJ, Schwab ME, Kartje GL (2008) Nogo-A expression after focal
ischemic stroke in the adult rat. Stroke 39:2091-2098.
Chen H, Weber AJ (2002) Expression of glial fibrillary acidic protein and glutamine
synthetase by Muller cells after optic nerve damage and intravitreal application of
brain-derived neurotrophic factor. Glia 38:115-125.
Chen R, Jin R, Wu L, Ye X, Yang Y, Luo K, Wang W, Wu D, Huang L, Huang T, Xiao G (2011)
Reticulon 3 attenuates the clearance of cytosolic prion aggregates via inhibiting
autophagy. Autophagy 7:205-216.
Domeniconi M, Cao Z, Spencer T, Sivasankaran R, Wang K, Nikulina E, Kimura N, Cai H, Deng
K, Gao Y, He Z, Filbin M (2002) Myelin-associated glycoprotein interacts with the
Nogo66 receptor to inhibit neurite outgrowth. Neuron 35:283-290.
Fournier AE, GrandPre T, Strittmatter SM (2001) Identification of a receptor mediating
Nogo-66 inhibition of axonal regeneration. Nature 409:341-346.
Guo F, Jin WL, Li LY, Song WY, Wang HW, Gou XC, Mi YJ, Wang Q, Xiong L (2013) M9, a novel
region of amino-Nogo-A, attenuates cerebral ischemic injury by inhibiting NADPH
oxidase-derived superoxide production in mice. CNS Neurosci Ther 19:319-328.
Hovelmeyer N, Hao Z, Kranidioti K, Kassiotis G, Buch T, Frommer F, von Hoch L, Kramer D,
Minichiello L, Kollias G, Lassmann H, Waisman A (2005) Apoptosis of
oligodendrocytes via Fas and TNF-R1 is a key event in the induction of experimental
autoimmune encephalomyelitis. Journal of immunology 175:5875-5884.
Hu B, Yip HK, So KF (1998) Localization of p75 neurotrophin receptor in the retina of the
adult SD rat: an immunocytochemical study at light and electron microscopic levels.
Glia 24:187-197.
- 115 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
Hu Y, Park KK, Yang L, Wei X, Yang Q, Cho KS, Thielen P, Lee AH, Cartoni R, Glimcher LH,
Chen DF, He Z (2012) Differential effects of unfolded protein response pathways on
axon injury-induced death of retinal ganglion cells. Neuron 73:445-452.
Joly S, Jordi N, Schwab ME, Pernet V (2014) The Ephrin receptor EphA4 restricts axonal
sprouting and enhances branching in the injured mouse optic nerve. Eur J Neurosci.
Joly S, Lange C, Thiersch M, Samardzija M, Grimm C (2008) Leukemia inhibitory factor
extends the lifespan of injured photoreceptors in vivo. J Neurosci 28:13765-13774.
Jozsef L, Tashiro K, Kuo A, Park EJ, Skoura A, Albinsson S, Rivera-Molina F, Harrison KD,
Iwakiri Y, Toomre D, Sessa WC (2014) Reticulon 4 is necessary for endoplasmic
reticulum tubulation, STIM1-Orai1 coupling, and store-operated calcium entry. J Biol
Chem 289:9380-9395.
Ju WK, Kim KY, Lee MY, Hofmann HD, Kirsch M, Cha JH, Oh SJ, Chun MH (2000) Up-regulated
CNTF plays a protective role for retrograde degeneration in the axotomized rat
retina. Neuroreport 11:3893-3896.
Kern F, Stanika RI, Sarg B, Offterdinger M, Hess D, Obermair GJ, Lindner H, Bandtlow CE,
Hengst L, Schweigreiter R (2013) Nogo-A couples with Apg-1 through interaction
and co-ordinate expression under hypoxic and oxidative stress. Biochem J 455:217227.
Kim SH, Munemasa Y, Kwong JM, Ahn JH, Mareninov S, Gordon LK, Caprioli J, Piri N (2008)
Activation of autophagy in retinal ganglion cells. J Neurosci Res 86:2943-2951.
Kumamaru E, Kuo CH, Fujimoto T, Kohama K, Zeng LH, Taira E, Tanaka H, Toyoda T, Miki N
(2004) Reticulon3 expression in rat optic and olfactory systems. Neurosci Lett
356:17-20.
Lappe-Siefke C, Goebbels S, Gravel M, Nicksch E, Lee J, Braun PE, Griffiths IR, Nave KA
(2003) Disruption of Cnp1 uncouples oligodendroglial functions in axonal support
and myelination. Nat Genet 33:366-374.
Leibinger M, Muller A, Andreadaki A, Hauk TG, Kirsch M, Fischer D (2009) Neuroprotective
and axon growth-promoting effects following inflammatory stimulation on mature
retinal ganglion cells in mice depend on ciliary neurotrophic factor and leukemia
inhibitory factor. J Neurosci 29:14334-14341.
Lewis GP, Fisher SK (2003) Up-regulation of glial fibrillary acidic protein in response to
retinal injury: its potential role in glial remodeling and a comparison to vimentin
expression. Int Rev Cytol 230:263-290.
Matthieu JM, Amiguet P (1990) Myelin/oligodendrocyte glycoprotein expression during
development in normal and myelin-deficient mice. Dev Neurosci 12:293-302.
Mi YJ, Hou B, Liao QM, Ma Y, Luo Q, Dai YK, Ju G, Jin WL (2012) Amino-Nogo-A antagonizes
reactive oxygen species generation and protects immature primary cortical neurons
from oxidative toxicity. Cell Death Differ 19:1175-1186.
Munoz JP, Zorzano A (2011) Endoplasmic reticulum stress enters a Nogo zone. Sci Transl
Med 3:88ps26.
Oertle T, Merkler D, Schwab ME (2003) Do cancer cells die because of Nogo-B? Oncogene
22:1390-1399.
Park HY, Kim JH, Park CK (2012) Activation of autophagy induces retinal ganglion cell death
in a chronic hypertensive glaucoma model. Cell Death Dis 3:e290.
Pernet V, Joly S, Christ F, Dimou L, Schwab ME (2008) Nogo-A and myelin-associated
glycoprotein differently regulate oligodendrocyte maturation and myelin formation.
J Neurosci 28:7435-7444.
Pernet V, Joly S, Dalkara D, Jordi N, Schwarz O, Christ F, Schaffer DV, Flannery JG, Schwab ME
(2013) Long-distance axonal regeneration induced by CNTF gene transfer is
impaired by axonal misguidance in the injured adult optic nerve. Neurobiol Dis
51:202-213.
Pernet V, Joly S, Dalkara D, Schwarz O, Christ F, Schaffer D, Flannery JG, Schwab ME (2011)
Neuronal Nogo-A upregulation does not contribute to ER stress-associated
- 116 -
Chapter 3: Nogo-A in molecular processes contributing to regeneration and survival
apoptosis but participates in the regenerative response in the axotomized adult
retina. Cell Death Differ.
Piras A, Gianetto D, Conte D, Bosone A, Vercelli A (2011) Activation of autophagy in a rat
model of retinal ischemia following high intraocular pressure. PLoS One 6:e22514.
Rodriguez-Muela N, Germain F, Marino G, Fitze PS, Boya P (2012) Autophagy promotes
survival of retinal ganglion cells after optic nerve axotomy in mice. Cell Death Differ
19:162-169.
Russo R, Berliocchi L, Adornetto A, Amantea D, Nucci C, Tassorelli C, Morrone LA, Bagetta G,
Corasaniti MT (2013) In search of new targets for retinal neuroprotection: is there a
role for autophagy? Curr Opin Pharmacol 13:72-77.
Rutkowski DT, Kaufman RJ (2004) A trip to the ER: coping with stress. Trends Cell Biol
14:20-28.
Satoh J, Tabunoki H, Yamamura T, Arima K, Konno H (2007) TROY and LINGO-1 expression
in astrocytes and macrophages/microglia in multiple sclerosis lesions. Neuropathol
Appl Neurobiol 33:99-107.
Schwab ME (2010) Functions of Nogo proteins and their receptors in the nervous system.
Nat Rev Neurosci 11:799-811.
Scolding NJ, Frith S, Linington C, Morgan BP, Campbell AK, Compston DA (1989) Myelinoligodendrocyte glycoprotein (MOG) is a surface marker of oligodendrocyte
maturation. J Neuroimmunol 22:169-176.
Shao Z, Browning JL, Lee X, Scott ML, Shulga-Morskaya S, Allaire N, Thill G, Levesque M, Sah
D, McCoy JM, Murray B, Jung V, Pepinsky RB, Mi S (2005) TAJ/TROY, an orphan TNF
receptor family member, binds Nogo-66 receptor 1 and regulates axonal
regeneration. Neuron 45:353-359.
Shen X, Ying H, Qiu Y, Park JS, Shyam R, Chi ZL, Iwata T, Yue BY (2011) Processing of
optineurin in neuronal cells. J Biol Chem 286:3618-3629.
Stefansson K, Molnar ML, Marton LS, Molnar GK, Mihovilovic M, Tripathi RC, Richman DP
(1984) Myelin-associated glycoprotein in human retina. Nature 307:548-550.
Sutendra G, Dromparis P, Wright P, Bonnet S, Haromy A, Hao Z, McMurtry MS, Michalak M,
Vance JE, Sessa WC, Michelakis ED (2011) The role of Nogo and the mitochondriaendoplasmic reticulum unit in pulmonary hypertension. Sci Transl Med 3:88ra55.
Tagami S, Eguchi Y, Kinoshita M, Takeda M, Tsujimoto Y (2000) A novel protein, RTN-XS,
interacts with both Bcl-XL and Bcl-2 on endoplasmic reticulum and reduces their
anti-apoptotic activity. Oncogene 19:5736-5746.
Teng FY, Tang BL (2013) Nogo/RTN4 isoforms and RTN3 expression protect SH-SY5Y cells
against multiple death insults. Mol Cell Biochem 384:7-19.
Venkatesh K, Chivatakarn O, Lee H, Joshi PS, Kantor DB, Newman BA, Mage R, Rader C, Giger
RJ (2005) The Nogo-66 receptor homolog NgR2 is a sialic acid-dependent receptor
selective for myelin-associated glycoprotein. J Neurosci 25:808-822.
Voeltz GK, Prinz WA, Shibata Y, Rist JM, Rapoport TA (2006) A class of membrane proteins
shaping the tubular endoplasmic reticulum. Cell 124:573-586.
Wan Q, Kuang E, Dong W, Zhou S, Xu H, Qi Y, Liu Y (2007) Reticulon 3 mediates Bcl-2
accumulation in mitochondria in response to endoplasmic reticulum stress.
Apoptosis 12:319-328.
Wang KC, Koprivica V, Kim JA, Sivasankaran R, Guo Y, Neve RL, He Z (2002)
Oligodendrocyte-myelin glycoprotein is a Nogo receptor ligand that inhibits neurite
outgrowth. Nature 417:941-944.
Yang YS, Harel NY, Strittmatter SM (2009) Reticulon-4A (Nogo-A) redistributes protein
disulfide isomerase to protect mice from SOD1-dependent amyotrophic lateral
sclerosis. Journal of Neuroscience 29:13850-13859.
- 117 -
- 118 -
Chapter 4
In vitro investigation of the potential hindrance of Nogo-A receptor
signaling by Nogo-A expressed in cis position
by Flóra Vajda
Further contributions by:
Jody L. Martin, Martin E. Schwab and Vincent Pernet
Contributions:
F.V., V.P. and M.E.S.: designed the study. F.V. performed all the in vitro studies: handled and
transduced
the
cells,
harvested
the
cell
cultures
for
Western
blotting
and
immunocytochemical stainings, acquired microscopic images, analyzed cell spreading and
neurite outgrowth. J.L.M produced the Adenovirus (sh.Nogo-A and sh.Control) constructs.
F.V. prepared the figures and wrote the manuscript (revised by V.P. and M.E.S.).
(manuscript in preparation)
- 119 -
Chapter 4: In vitro investigation of cis-interaction
1 Abstract
Besides being known as a myelin inhibitory protein for axonal growth, Nogo-A can also be
expressed in neurons, where it can exert distinct and beneficial functions in axonal repair
and neuronal survival. In Chapter 2 of the present thesis, we reported that overexpression
of Nogo-A in F11 cells by AAV2.Nogo-A attenuated the inhibition of neurite outgrowth on
Nogo-A-∆20 substrate and proposed that in Nogo-A expressing neurons, cis interaction
between Nogo-A and its receptors may counteract trans Nogo-A signaling. To further test
this hypothesis we performed a series of in vitro studies with Nogo-A manipulations in
neuronal and fibroblast cell lines and tested their neurite outgrowth and cell spreading
capacity, respectively. We characterized the expression of Nogo-A and its receptors in a
neuronal cell line, in F11 cells, and found stable expression of the ligand and receptors both
in basal conditions and after differentiation, in whole cell lysates and in membrane
preparations. F11 cells responded to the inhibitory Nogo-A-∆20, however silencing Nogo-A
with a short hairpin construct (sh.Nogo) did not change the neurite outgrowth extent in
these cells. Similarly, sh.Nogo-A mediated down-regulation did not alter spreading capacity
of NIH 3T3 fibroblasts, however, full genetic deletion of Nogo-A decreased cell spreading of
mouse embryonic fibroblast cells plated on Nogo-A-∆20. On the molecular level, the upregulation of Nogo-A in F11 cells increased phospho-ERK1/2 expression, which may
contribute to the increased neurite growth or neuronal survival in neurons.
In summary, in this study we further tested whether cell autonomous expression of
Nogo-A is beneficial for axonal growth and cell spreading. Our in vitro results support the
hypothesis of a positive role of Nogo-A expressed in cis position.
- 120 -
Chapter 4: In vitro investigation of cis-interaction
Keywords:
cis Nogo-A; trans Nogo-A; F11 cell neurite outgrowth; fibroblast cell spreading;
adenoviruses; Nogo-A up and down-regulation
Abbreviations:
ATF3, activating transcription factor-3; CNS, central nervous system; DRG, dorsal root
ganglia; ERK1/2, extracellular signal-regulated kinases 1/2; EtOH, ethanol; Fsk, Forskolin;
GAP-43,
growth
associated
protein-43;
GAPDH,
glyceraldehyde
3-phosphate
dehydrogenase; GFP, green fluorescent protein; KO, knock-out; LTP, long-term
potentiation; MOI, multiple of infection; NgR1, Nogo66 receptor-1; PBS, phosphate-buffered
saline; qRT-PCR, quantitative real-time polymerase chain reaction; RTN, reticulon; S1PR2,
sphingosine-1-phosphate receptor 2; SEM, standard error of the mean; shRNA, short
hairpin RNA; TBS, tris-buffered saline.
- 121 -
Chapter 4: In vitro investigation of cis-interaction
2 Introduction
During development Nogo-A is highly expressed in growing and immature neurons and is
down-regulated in many types of mature neurons. In adulthood, the expression of neuronal
Nogo-A remains elevated in plastic regions of the nervous system, such as in the
hippocampus, cortex and dorsal root ganglia (DRGs) (Huber et al., 2002). Nogo-A was
shown to control long-term potentiation (LTP) in the hippocampus and in the cortex
(Delekate et al., 2011, Tews et al., 2013), to influence cell migration (Mathis et al., 2010),
survival (Mi et al., 2012, Guo et al., 2013), cell spreading and growth (Oertle et al., 2003) of
multiple cell types. In this context the possible effects of cell autonomous, neuronal Nogo-A
are less well understood. We have previously shown that in contrast to myelin/glial Nogo-A,
neuronal Nogo-A appeared beneficial for regeneration in the injured optic nerve, and that
Nogo-A expression was increased in retinal ganglion cells (RGC) after optic nerve crush
injury (Pernet et al., 2011). In Chapter 2 of the present thesis, we demonstrated that
neuronal expression of Nogo-A is necessary for improved regeneration in a more permissive
environment, where Nogo-A is deleted from glial cells.
Interestingly, Nogo-A receptors such as Nogo-66 receptor 1 (NgR1) (Fournier et al.,
2001) and sphingosine-1-phosphate receptor 2 (S1PR2) (Kempf et al., 2014) can be coexpressed with Nogo-A in retinal ganglion neurons. The proximity of the ligand and its
receptors raised the possibility of cis-interaction within the same cell, a phenomenon that
has previously been described for several guidance molecules (Yaron and Sprinzak, 2012),
such as Ephrins, Semaphorins and Slit2 (Egea and Klein, 2007, Haklai-Topper et al., 2010,
Jaworski and Tessier-Lavigne, 2012), but also for the Notch/Delta signaling pathway
(Sprinzak et al., 2010) (Figure 1). A possible cis-interaction between Nogo-A and PirB, an
additional receptor member, has been raised before, however, in this case Nogo-A on the
neuron was proposed to self-limit axon outgrowth in a cell autonomous manner, by
activating downstream receptor components (Dickson et al., 2010). Additionally,
Olfactomedin 1 (Olfm1), a highly conserved secreted glycoprotein, has been shown to
promote axon growth through interaction with the Nogo A receptor (NgR1) complex. This
interaction reduced binding of NgR1 to its co-receptors p75NTR and LINGO-1 and therefore
attenuated the activation of underlying signaling mechanisms (Nakaya et al., 2012). In vitro,
we found that overexpression of Nogo-A in F11 cells by AAV2.Nogo-A attenuated the
inhibition of neurite outgrowth on Nogo-A-∆20-coated substrate, suggesting a cellautonomous effect of neuronal Nogo-A on neurite outgrowth and supporting the possibility
that cis-interaction between Nogo-A and its receptors may counteract the inhibitory effect of
Nogo-A present in the environment (Figure 1).
- 122 -
Chapter 4: In vitro investigation of cis-interaction
Figure 1. Illustration of trans-signaling and cis-interaction. In different classes of ligand/receptor
pairs, such as Ephrins/Ephs (Egea and Klein, 2007), Semaphorins/Plexins (Haklai-Topper et al.,
2010), Delta/Notch (Sprinzak et al., 2010), trans binding of the ligand to the receptor leads to
repulsive signaling activation. However, ligand binding in cis position, referred to as cis-interaction, in
some cases blocked inhibitory signaling in various cell types, including neurons. We propose similar
action mechanism for Nogo-A, whereby trans Nogo-A would activate Nogo-66 and Nogo-∆20
mediated growth inhibition, but Nogo-A expressed in cis position would lead to the blockade of Rho-A
activation down-stream NgR1 and S1PR2.
- 123 -
Chapter 4: In vitro investigation of cis-interaction
In the present study, due to technical reasons our experiments with a Nogo-A knockdown technique could not confirm a cell-autonomous role of Nogo-A in neurite outgrowth
or cells spreading. However, genetic deletion of Nogo-A led to decreased spreading of mouse
embryonic fibroblast cells at the highest concentration of the tested Nogo-A-∆20 substrates,
supporting the hypothesis that cell autonomous Nogo-A expression is able to counteract the
inhibitory Nogo-A-∆20 presented in trans.
3 Results
3.1 Expression of Nogo-A and Nogo-A receptors in the F11 neuronal cell-type
First, we characterized the expression of Nogo-A and its receptors NgR1 and S1PR2 in F11
cells by Western blotting with whole cell lysates or membrane preparations. The
endogenous levels of both Nogo-A and Nogo-B were high in undifferentiated F11 cells
(EtOH), and neither of protein’s expression was altered upon Forskolin (Fsk)-induced
differentiation (Figure 2A). We also tested the expression of the receptors for the two
identified inhibitory regions of Nogo-A, the Nogo-A-∆20 receptor S1PR2 and the Nogo-66
receptor NgR1. Both receptors were present in whole protein lysates of F11 cells and their
expression did not change after neurite outgrowth stimulation (Figure 2B-C). Next, we
compared the amount of these proteins in total cell lysates and membrane preparations
(Figure 2D). The purity of these proteins samples was controlled by GAPDH and Na +/K+
ATPase detections, which revealed that the membrane preparations almost lacked the
cytoplasmic protein GAPDH, but were highly enriched in Na+/K+ ATPase, a transmembrane
ion-pump. Nogo-A, Nogo-B and S1PR2 were all expressed in both the total cell and
membrane fractions (Figure 2D), allowing us to formulate the hypothesis of cis-interactions
with the membrane-bound/cell surface pool of these molecules. Plating F11 cells on
increasing concentrations of Nogo-A-∆20 did not alter Nogo-A or Nogo-B protein expression
(Figure 2E). We have not observed any changes in the expression of the growth-associated
protein-43 (GAP-43) after plating on inhibitory Nogo-A-∆20 substrate and following Fsk
treatment (Figure 2E). Compared to the EtOH-treated F11 cells, cells differentiated with Fsk
grew fairly long neurites as early as 24 hours after treatment that were visualized by
staining with the βIII-Tubulin antibody labelling neuronal processes (Figure 2F).
Characterization of the F11 cells confirmed that this cell line is suitable for testing the cisinteraction hypothesis in vitro.
- 124 -
Chapter 4: In vitro investigation of cis-interaction
Figure 2. Nogo-A and its receptors are expressed in F11 cells. (A) In total cell lysates of F11 cells,
Nogo-A and Nogo-B were both expressed and their protein level did not vary between EtOH (control)
treated and Forskolin-induced, differentiated conditions. The Nogo-A receptors (B) S1PR2 and (C)
NgR1 were both expressed in F11 cells and their expression did not change upon differentiation. (D)
Nogo-A, Nogo-B and S1PR2 were present in the cell membrane preparations from F11 cell cultures.
The membrane bound faction of these proteins was not altered upon Forskolin treatment. (E) Plating
F11 cells on increasing amounts of Nogo-A-∆20 did not alter Nogo-A or Nogo-B protein expression
levels, and did not lead to the decrease of GAP-43 protein. (F) Treatment with Forskolin leading to
intracellular cAMP up-regulation induced neurite outgrowth of F11 cells, as demonstrated on the
pictures taken 24 hours after the differentiation induction. Neurites were labelled with βIII-Tubulin
antibody. Scale bar: F = 50μm.
- 125 -
Chapter 4: In vitro investigation of cis-interaction
3.2 Down-regulation or deletion of Nogo-A: effect on neurite outgrowth and cell
spreading
With the aid of Adenoviruses containing short hairpin RNA (shRNA) specific to Nogo-A
(Adeno.sh.Nogo-A), we aimed to investigate the contribution of cell autonomous Nogo-A to
neurite outgrowth and cell spreading on an inhibitory Nogo-A-∆20 substrate. The neurite
outgrowth experiments with F11 cells (MacGillavry et al., 2009) showed a Nogo-A-∆20
dose-dependent outgrowth inhibition, with and EC50 of ~12.5pM (Figure 3A). The Nogo-A
down-regulation efficiency was controlled after each experiments; transduction with the
Adeno.sh.Nogo-A virus led to ~75% decrease of Nogo-A from F11 cells 4 days after viral
transduction (Figure 3B). However, silencing Nogo-A did not alter the length of neurites in
any conditions (Figure 3A). Cell spreading experiments with NIH 3T3 fibroblasts also failed
to show different spreading phenotypes between control and Adeno.sh.Nogo-A transduced
cells (Figure 3C) in which Nogo-A was also down-regulated by ~75% (Figure 3D). However,
when mouse embryonic fibroblast cells (MEFC) from WT and conventional Nogo-A knockout (KO) mice were compared for their spreading efficiency on Nogo-A-∆20, the Nogo-A KO
MEFC cells showed modest, but significantly decreased cell spreading at the highest (9pM)
substrate concentration (Figure 3E).
3.3 Protein expression changes following Nogo-A up and down-regulation
We followed the expression of Nogo-A, its receptor and growth related protein and signaling
cascade molecules by Western blotting after Nogo-A overexpression by Adeno.Nogo-A-GFP
(Figure 4A) and Nogo-A down-regulation by Adeno.sh.Nogo-A (Figure 4B), respectively.
Nogo-A up-regulation was confirmed after transduction of F11 cells with Adeno.Nogo-A-GFP
viruses by detection of Nogo-A or GFP proteins. The increased Nogo-A expression lead to
strong up-regulation of phospho-ERK1/2, while the total-ERK level remained constant
(Figure 4A). The expression level of ATF3, the growth associated activating transcription
factor 3, did not increase upon adeno-mediated Nogo-A up-regulation. Additionally, no
changes were observed in the protein expression of S1PR2, Nogo-B and βIII-Tubulin (Figure
4A). No protein changes were observed in the control virus (Adeno.LacZ) treated cells
(Figure 4A). Inversely, the strong, almost complete down-regulation of Nogo-A in F11 cells
(50-100MOI Adeno.sh.Nogo-A) led to the decrease in phospho-ERK1/2 protein levels,
although higher MOIs of the Adeno.sh.Control viruses also resulted in the same phosphoERK1/2 expression changes (Figure 4B). We did not detect a decrease in the growth marker
GAP-43 and ATF3 protein levels. The level of Nogo-B also remained constant (Figure 4B).
- 126 -
Chapter 4: In vitro investigation of cis-interaction
Figure 3. Effect of Nogo-A ablation on neurite outgrowth and cell spreading. (A) Silencing NogoA by Adeno.sh.Nogo-A viruses in F11 cell did not alter Nogo-A-∆20 mediated outgrowth inhibition.
(B) The Adeno.sh.Nogo-A virus transduction led to ~75% deletion of Nogo-A in F11 cells (4 days
sh.Nogo-A expression). (C) NIH 3T3 fibroblast spreading was also not effected by Nogo-A silencing.
(D) ~75% of Nogo-A was deleted 4 days after the transduction of NIH 3T3 fibroblasts with
Adeno.sh.Nogo-A virus. (E) Mouse embryonic fibroblast cells (MEFC) were isolated from WT and
Nogo-A KO embryos. Nogo-A KO MEFC cells showed significantly decreased cell spreading on the
highest (9pM) Nogo-A-∆20 concentration (t-test; ***p<0.001).
- 127 -
Chapter 4: In vitro investigation of cis-interaction
Figure 4. Protein expression changes after Nogo-A up and down-regulation in F11 cells. (A)
Nogo-A up-reguation by Adeno.Nogo-A-GFP led to the strong increase of phospho-ERK1/2, while the
total-ERK level remained constant, and the level of ATF3 did not increase. Furthermore, no changes
were observed in the protein expression level of the Nogo-A-∆20 receptor S1PR2, or Nogo-B and βIIITubulin. (B) Nogo-A downregulation by Adeno.sh.Nogo-A viruses led to the decrease in phosphoERK1/2 protein levels. However, high MOI infection rates (50-100MOI) with Adeno.sh.Control
viruses similarly led to a decrease in phospho-ERK1/2. No changes were detected for the growth
marker GAP-43 and ATF3 protein levels. The level of Nogo-B also remained constant.
- 128 -
Chapter 4: In vitro investigation of cis-interaction
4 Discussion
At the cell membrane, the sequestration of the receptor by adjacent ligand binding, the socalled cis-interaction, has previously been described to prevent trans receptor activation in
the case of guidance molecules such as Ephrins (Egea and Klein, 2007), Semaphorins
(Haklai-Topper et al., 2010) or Slit-Robo (Jaworski and Tessier-Lavigne, 2012), but also for
the Notch signaling pathway (Sprinzak et al., 2010) (Figure 1). In the visual system, the
Ephrin-Eph cis and trans signaling is of particular importance, as these ligand-receptor
interactions have been shown to be major determinants of the topographic retino-tectal
projection during development (Hornberger et al., 1999).
It is intriguing that in retinal ganglion neurons both Nogo-A and its receptors NgR1
and S1PR2 are present, and this co-expression raised the possibility of cis-interaction
between the ligand and receptor (Figure 1). The Nogo-A expressed in neurons could
potentially bind to NgR1 and prevent downstream signaling to Rho-A through the NgR1
receptor complex. In our previously described in vitro experiments, Nogo-A overexpressing
F11 cells could counteract the outgrowth-blocking effect of Nogo-A-∆20. However, Nogo-A
knock-down experiments have not confirmed a crucial cell-autonomous role of Nogo-A in
neurite outgrowth or cells spreading. It is possible that these experiments employing RNA
interference have led to insufficient down-regulation levels. As confirmed by Western
blotting, ~25% of Nogo-A was still expressed in these cells at the time of the functional
experiments, and this could mask the real effect of Nogo-A deletion.
Cell spreading studies with embryonic fibroblast cells derived from Nogo-A KO mice
indicated that these cells lacking 100% of Nogo-A spread less on the substrate containing
high concentration of Nogo-A-∆20. These results are in line with our previous observation,
where Nogo-A overexpression increased neurite outgrowth of F11 cells only on the highest
inhibitory Nogo-A-∆20 conditions. Cell spreading with the MEFC cells therefore confirmed
that full deletion of Nogo-A indeed leads to impaired spreading capacity. However, as these
Nogo-A KO cells up-regulate Nogo-B, the contribution of compensatory expression changes
remains to be investigated.
Interestingly, in F11 cells, the overexpression of Nogo-A led to the up-regulation of
phosphorylated extracellular signal-regulated protein kinase1/2 (phospho-ERK1/2).
Activation of ERK, a member of the mitogen-activated protein kinase family, has been shown
to mediate neurite outgrowth-promoting effects (Agthong et al., 2009). However, although
in the visual system ERK1/2 activation promoted robust neuroprotection, it did not induce
increased regeneration (Pernet et al., 2005). It would be therefore tempting to hypothesize
that cell autonomous Nogo-A leads to the activation of pro-regenerative and pro-survival
- 129 -
Chapter 4: In vitro investigation of cis-interaction
processes. However, as we introduced Nogo-A or sh.Nogo-A to the cells by Adenoviruses, it
cannot be excluded that the virus transduction by itself led to the phospho-ERK1/2 increase
(Tibbles et al., 2002). Phospho-ERK1/2 levels decreased not only in Adeno.sh.Nogo-A
treated, but also after higher MOI application of Adeno.sh.Control viruses. This might serve
as a confirmation for the viral transduction induced phospho-ERK1/2 expression changes.
On the other hand, Nogo-A up and down-regulation lead to phospho-ERK1/2 up and downregulation respectively, which is a contradictory result considering that both cell
populations were transduced with Adenoviruses. An additional concern for the results with
Nogo-A up-regulation is that the GFP levels controlling MOIs of the control LacZ and Nogo-A
overexpressing viruses were unequal, and the higher MOI of the Adeno.Nogo-A-GFP viruses
could have induced changes in the ERK1/2 signaling.
In summary, the experiments in this study partially confirmed the beneficial role of
Nogo-A in cis position for cell spreading on Nogo-A-∆20. However, further experiments such
as an encounter assay analyzing effects of Nogo-A-∆20 on the single cell level are required
to address this hypothesis in details.
Conflict of Interest
The authors declare no conflict of interest.
Acknowledgements
This work was supported by the Swiss National Science Foundation (SNF Grant
3100A0_122527/1 and 31-138676). We thank Professor Ronald E. van Kesteren for kindly
providing the F11 cell line. We thank Olivia Schwarz and Michael Arzt for their help in
culturing F11 and MEFC cells.
5 Materials and methods
Cell Cultures
F11 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Invitrogen GIBCO,
#21885) containing 10% fetal bovine serum (FBS) and 1% Penicillin-Streptomycin
(PenStrep) (Invitrogen, #15140) in tissue culture dishes (Techno Plastic Products). For
passaging and before outgrowth experiments 0.05% Trypsin (Invitrogen) was used to
dissociate the F11 cells from the culture dish. NIH 3T3 cells were maintained in DMEM
(Invitrogen GIBCO, #61965) containing 10% neonatal bovine calf serum (NBCS, Invitrogen).
- 130 -
Chapter 4: In vitro investigation of cis-interaction
For passaging and before spreading experiments 0.25% Trypsin was used to dissociate the
NIH 3T3 cells from the culture dish. Primary mouse embryonic fibroblast cells (MEFC) were
isolated and immortalized as described previously (Todaro and Green, 1963). Each primary
fibroblast culture was isolated from the embryos (E15) from a single pregnant C57BL/6
Nogo-A heterozygous knock-out mouse.
To identify the genotype of each embryo,
genotyping protocol was carried out on tail samples as described before (Simonen et al.,
2003). MEFC cultures of each genotypes (WT, heterozygous and Nogo-A KO) were
maintained separately in DMEM (Invitrogen GIBCO, #61965) containing 10% FBS and 1%
PenStrep. For passaging, 0.25% Trypsin was used to dissociate the MEFCs and before
spreading experiments MEFCs were detached with 2mM EDTA-PBS from the culture dish.
All cells were grown in the incubator at 37°C with 5% CO2 concentration.
AAV and Adenovirus vector production and application
Adeno-associated viral vectors were produced by standard methods. An AAV2.Nogo-A
(5.1x1011vp/ml) and AAV2.GFP (2.1x1011vp/ml) (adeno-associated virus serotype 2)
expressing virus was generated to selectively infect neuronal cell populations and were
used in 230 and 200 MOIs (multiple of infection), respectively. The Adeno.Nogo-A-GFP
(2.1x1010vp/ml) and Adeno.LacZ-GFP (6.5x1010vp/ml) viruses were produced by Dr. Dana A
Dodd and were applied in 10 and 20 MOIs, respectively. The Adeno.sh.Nogo-A
(3.25x1010vp/ml) and Adeno.sh.Control (3.25x1010vp/ml) adenoviruses were generously
provided by Dr. Jody L Martin and used in 1-100 MOIs for Western blotting and in 25 and 50
MOIs for F11 outgrowth and 3T3 NIH cell spreading assays.
F11 neurite outgrowth assay
The effects of AAV2.GFP, AAV2.Nogo-A, Adeno.sh.Control or Adeno.sh.Nogo-A on neurite
outgrowth were evaluated in vitro by infecting F11 cells. The F11 cell line, kindly provided
by Prof. RE van Kesteren (Amsterdam, The Netherlands), was maintained as described
before (MacGillavry et al., 2009). F11 cells were plated at a density of 100 000 cells per well
in 6-well plates and were treated with the viruses 24 h later. Four days or 24 hours after
infection with AAVs or adenoviruses respectively, F11 cells were transferred to 4-well
dishes at a density of 2000cells per well. The 4-well dishes were coated by different
concentrations of Nogo-A-∆20 substrate (0, 0.5, 1 and 2.5μg/cm2) diluted in PBS at 4
degrees for 12 hours. Twenty four hours after plating the cells on Nogo-A-∆20 substrate,
F11 cells were differentiated by adding 10μM of Forskolin (Sigma-Aldrich) for 48 h. To
visualize neurite extension, F11 cells were stained with βIII-Tubulin antibody. Measurement
of neurite length was carried out using the Neuron J plugin in the Image J software (NIH).
- 131 -
Chapter 4: In vitro investigation of cis-interaction
The mean of the total neurite length was calculated for each treatment on all Nogo-A-∆20
substrate concentrations measuring between 80 and 110 cells.
NIH 3T3 and MEFC spreading assay
The NIH 3T3 and MEFC fibroblast spreading assays neurons were performed as described
previously (Oertle et al., 2003). Briefly, four-well plates (Greiner) were coated with different
concentrations of Nogo-A-∆20 at 4°C overnight. NIH 3T3 and MEFC cells were plated at
7,000 cells per cm2 for 1 h at 37°C and 5% CO2, fixed with 4% paraformaldehyde (PFA) and
stained with Phalloidin-Alexa-488. Each experiment was performed at least three times in
four replicate wells. Spreading was quantified manually in a blinded manner. NIH 3T3 and
MEFC cells were classified as spread cells if they bear at least two lammelipodial processes
longer than one cell body diameter. Round cells were classified as non-spread. Data were
normalized to baseline and plotted as average with error of the mean (SEM).
Western-blot analysis
F11 cells were plated in DMEM containing 10% FBS and 1% PenStrep in 6-well plates by at.
200’000 cells/well density. 48 hours later, the cells were treated with either 10μM forskolin
(Sigma-Aldrich, diluted in ethanol) or ethanol diluted in DMEM containing 0.5% FBS and 1%
PenStrep. 24 or 48 hours after treatment the cells were scraped and lysed in 100μl CHAPS
lysis buffer (20mM Tris-HCl pH8, 0.5% CHAPS) containing protease inhibitors (Complete
mini, Roche diagnostics). The samples were fully homogenized and let on ice for 60 min.
After centrifugation for 15min at 15,000xg, 4°C, supernatants were collected and processed
for protein concentration analysis (Bio-Rad Laboratories, RC DC Protein Assay). 20 μg of
proteins from each cell lysates were mixed with 4x SDS-loading buffer (Invitrogen, NuPAGE
LDS sample buffer), were boiled at 95°C for 10 min and were separated by electrophoresis
on a 4–12% polyacrylamide gel and transferred to nitrocellulose membranes (Whatman,
reinforced NC). Blots were incubated in a blocking solution of either 2% Top Block (Lubio
Science) or 5% BSA (bovine serum albumin) in 0.2% TBST (0.2% Tween-20 in Tris-base 0.1
M, pH7.4) for 1 hour at room temperature, then incubated with primary antibodies
overnight at 4°C. Following the washing steps, the membranes were incubated with
horseradish peroxidase-conjugated anti-mouse or anti-rabbit secondary antibodies
(1:10’000-1:25’000, Pierce Biotechnology). Primary antibodies were rabbit anti-Nogo-A/B
(Bianca, Rb140) serum (1:20’000), rabbit anti-phosphoERK1/2 (1:1’000, Cell Signaling),
rabbit anti-ERK1/2 (1:1’000, Cell Signaling), rabbit anti-ATF3 (1:200, Santa Cruz
Biotechnology), rabbit anti-GAP43 (1:500, Millipore), goat anti-NgR1 (1:300, R&D), human
anti-S1PR2 (1:500, AbD Serotec custom made HuCAL antibody AbD14533.1), chicken anti-
- 132 -
Chapter 4: In vitro investigation of cis-interaction
GFP (1:5’000, Abcam), mouse anti-βIII-Tubulin (1:500, Promega), mouse anti-Na+/K+
ATPase (1:5’000; Abcam) and mouse anti-GAPDH (1:20’000, Abcam). Protein bands were
detected with SuperSignal West Pico Chemiluminescent Substrate (Pierce Biotechnology) in
a Stella detector (Raytest). Band intensities were measured with the Image J software (NIH).
Membrane preparation
F11 cells were plated in DMEM containing 10% FBS and 1% PenStrep in 10cm tissue culture
dishes. When the plates were 75% confluent, the cells were treated with either 10μM
forskolin (Sigma-Aldrich, diluted in ethanol) or ethanol diluted in DMEM containing 0.5%
FBS and 1% PenStrep. 24 hours after treatment the cells were collected in 6ml PBS
containing protease inhibitors (Complete mini, Roche diagnostics) and centrifuged for 10
min at 2,500xg at 4°C. Pellets from eight dishes per conditions (EtOH and forskolin) were
pooled together and were homogenized in 5ml of H buffer (50mM mannitol, 5mM HEPES,
pH 8) with Ultra Turrax T25 for 10 min on ice. After addition of CaCl2 (end concentration of
10mM), the samples were homogenized for additional 10min. The cell lysates were
centrifuged at 3,000xg for 15min at 4°C. The supernatants were further ultra-centrifuged at
48,000xg for 30min at 4°C (27,000rpm for Type 80 Ti rotor) in special 10 ml thick-wall
tubes (Beckmann). The pellet was carefully re-suspended in 200 μl PBS and the membrane
preparations were processed for Western blotting as described before.
References
Agthong S, Koonam J, Kaewsema A, Chentanez V (2009) Inhibition of MAPK ERK impairs
axonal regeneration without an effect on neuronal loss after nerve injury. Neurol Res
31:1068-1074.
Delekate A, Zagrebelsky M, Kramer S, Schwab ME, Korte M (2011) NogoA restricts synaptic
plasticity in the adult hippocampus on a fast time scale. Proc Natl Acad Sci U S A
108:2569-2574.
Dickson HM, Zurawski J, Zhang H, Turner DL, Vojtek AB (2010) POSH is an intracellular
signal transducer for the axon outgrowth inhibitor Nogo66. J Neurosci 30:1331913325.
Egea J, Klein R (2007) Bidirectional Eph-ephrin signaling during axon guidance. Trends Cell
Biol 17:230-238.
Fournier AE, GrandPre T, Strittmatter SM (2001) Identification of a receptor mediating
Nogo-66 inhibition of axonal regeneration. Nature 409:341-346.
Guo F, Jin WL, Li LY, Song WY, Wang HW, Gou XC, Mi YJ, Wang Q, Xiong L (2013) M9, a novel
region of amino-Nogo-A, attenuates cerebral ischemic injury by inhibiting NADPH
oxidase-derived superoxide production in mice. CNS Neurosci Ther 19:319-328.
Haklai-Topper L, Mlechkovich G, Savariego D, Gokhman I, Yaron A (2010) Cis interaction
between Semaphorin6A and Plexin-A4 modulates the repulsive response to Sema6A.
EMBO J 29:2635-2645.
Hornberger MR, Dutting D, Ciossek T, Yamada T, Handwerker C, Lang S, Weth F, Huf J,
Wessel R, Logan C, Tanaka H, Drescher U (1999) Modulation of EphA receptor
- 133 -
Chapter 4: In vitro investigation of cis-interaction
function by coexpressed ephrinA ligands on retinal ganglion cell axons. Neuron
22:731-742.
Huber AB, Weinmann O, Brosamle C, Oertle T, Schwab ME (2002) Patterns of Nogo mRNA
and protein expression in the developing and adult rat and after CNS lesions. J
Neurosci 22:3553-3567.
Jaworski A, Tessier-Lavigne M (2012) Autocrine/juxtaparacrine regulation of axon
fasciculation by Slit-Robo signaling. Nat Neurosci 15:367-369.
Kempf A, Tews B, Arzt ME, Weinmann O, Obermair FJ, Pernet V, Zagrebelsky M, Delekate A,
Iobbi C, Zemmar A, Ristic Z, Gullo M, Spies P, Dodd D, Gygax D, Korte M, Schwab ME
(2014) The sphingolipid receptor S1PR2 is a receptor for Nogo-a repressing
synaptic plasticity. PLoS Biol 12:e1001763.
MacGillavry HD, Stam FJ, Sassen MM, Kegel L, Hendriks WT, Verhaagen J, Smit AB, van
Kesteren RE (2009) NFIL3 and cAMP response element-binding protein form a
transcriptional feedforward loop that controls neuronal regeneration-associated
gene expression. J Neurosci 29:15542-15550.
Mathis C, Schroter A, Thallmair M, Schwab ME (2010) Nogo-a regulates neural precursor
migration in the embryonic mouse cortex. Cereb Cortex 20:2380-2390.
Mi YJ, Hou B, Liao QM, Ma Y, Luo Q, Dai YK, Ju G, Jin WL (2012) Amino-Nogo-A antagonizes
reactive oxygen species generation and protects immature primary cortical neurons
from oxidative toxicity. Cell Death Differ 19:1175-1186.
Nakaya N, Sultana A, Lee HS, Tomarev SI (2012) Olfactomedin 1 interacts with the Nogo A
receptor complex to regulate axon growth. J Biol Chem 287:37171-37184.
Oertle T, van der Haar ME, Bandtlow CE, Robeva A, Burfeind P, Buss A, Huber AB, Simonen
M, Schnell L, Brosamle C, Kaupmann K, Vallon R, Schwab ME (2003) Nogo-A inhibits
neurite outgrowth and cell spreading with three discrete regions. J Neurosci
23:5393-5406.
Pernet V, Hauswirth WW, Di Polo A (2005) Extracellular signal-regulated kinase 1/2
mediates survival, but not axon regeneration, of adult injured central nervous
system neurons in vivo. J Neurochem 93:72-83.
Pernet V, Joly S, Dalkara D, Schwarz O, Christ F, Schaffer D, Flannery JG, Schwab ME (2011)
Neuronal Nogo-A upregulation does not contribute to ER stress-associated
apoptosis but participates in the regenerative response in the axotomized adult
retina. Cell Death Differ.
Simonen M, Pedersen V, Weinmann O, Schnell L, Buss A, Ledermann B, Christ F, Sansig G,
van der Putten H, Schwab ME (2003) Systemic deletion of the myelin-associated
outgrowth inhibitor Nogo-A improves regenerative and plastic responses after
spinal cord injury. Neuron 38:201-211.
Sprinzak D, Lakhanpal A, Lebon L, Santat LA, Fontes ME, Anderson GA, Garcia-Ojalvo J,
Elowitz MB (2010) Cis-interactions between Notch and Delta generate mutually
exclusive signalling states. Nature 465:86-90.
Tews B, Schonig K, Arzt ME, Clementi S, Rioult-Pedotti MS, Zemmar A, Berger SM, Schneider
M, Enkel T, Weinmann O, Kasper H, Schwab ME, Bartsch D (2013) Synthetic
microRNA-mediated downregulation of Nogo-A in transgenic rats reveals its role as
regulator of synaptic plasticity and cognitive function. Proc Natl Acad Sci U S A
110:6583-6588.
Tibbles LA, Spurrell JC, Bowen GP, Liu Q, Lam M, Zaiss AK, Robbins SM, Hollenberg MD,
Wickham TJ, Muruve DA (2002) Activation of p38 and ERK signaling during
adenovirus vector cell entry lead to expression of the C-X-C chemokine IP-10.
Journal of virology 76:1559-1568.
Todaro GJ, Green H (1963) Quantitative studies of the growth of mouse embryo cells in
culture and their development into established lines. J Cell Biol 17:299-313.
Yaron A, Sprinzak D (2012) The cis side of juxtacrine signaling: a new role in the
development of the nervous system. Trends Neurosci 35:230-239.
- 134 -
Chapter 5
Concluding remarks
- 135 -
Chapter 5: Concluding remarks
1 Conclusions and Outlook
With the work presented in this thesis, we have made substantial progress towards
understanding the role of glial versus neuronal Nogo-A in axonal regeneration in the mouse
visual system. So far besides function blocking anti-Nogo-A antibodies or receptor blocking
agents, only conventional knock-out (KO) mouse lines have been used to study the the
effects of Nogo-A neutralization and gene ablation on axonal growth inhibition. Previous
studies from our laboratory have suggested that in contrast to the inhibitory myelin Nogo-A,
neuronal Nogo-A could positively influence axonal growth. Therefore, these molecular
manipulations and genetic deletions affecting both glial and neuronal cell populations might
not yield the most optimal growth conditions for promoting regeneration in the CNS.
In the present studies, we employed the Cre-lox recombination system and generated
cell-type specific conditional Nogo-A knock-out animals, or acutely excised the Nogo-A gene
by injecting adeno-associated virus serotype 2 (AAV2).Cre viruses in Nogo-A/Rtn4 floxed
mice. In Chapter 2, we showed that axonal regeneration is increased in the optic nerves of
glia-specific Nogo-A KO mice and this increase is associated with the up-regulation of
growth related genes. However, deletion of neuronal Nogo-A decreased the retinal ganglion
cell (RGC) growth potential and prevented the regeneration improvement seen in the glial
Nogo-A KOs. Therefore, we concluded that targeted glial Nogo-A deletion appears to be the
most effective way to stimulate axonal growth in the injured optic nerve. We detected
decreased Rho-A activation in the retinae of glial Nogo-A KOs, where Nogo-A is highly
expressed in RGCs. We proposed that neuronal Nogo-A in RGCs could possibly interact with
Nogo receptors at the cell membrane in cis, thereby preventing inhibitory trans Nogo-A
signaling to the neurons. In Chapter 3, we aimed to investigate the molecular mechanisms
underlying increased axonal growth and neuronal survival in the glia-specific Nogo-A
knock-outs. Chapter 4 provides further evidences on how cell autonomous, neuronal NogoA could be beneficial for cell growth and survival.
The results presented in this thesis strongly suggest that oligodendroglial and
neuronal Nogo-A play distinct roles in axonal regeneration in the retina and optic nerve, and
perhaps also in the central nervous system in general. While myelin Nogo-A presented in
trans leads to growth inhibition, Nogo-A expressed extra or intracellularly in neurons may
exert a positive function possibly by interaction with and blockade of its receptors in cis
position. Neuronal Nogo-A could influence the neuronal growth in the intracellular space,
possibly through sequestering Nogo receptors, or at the cell membrane by preventing trans
Nogo-A signaling converging to Rho-A activation. Further in vitro experiments, such as
encounter assays dissecting the contributions of the two Nogo-A pools to neuronal growth
- 136 -
Chapter 5: Concluding remarks
and migration on single cell level would be of great importance for finding the exact
underlying molecular mechanisms.
Based on these findings we propose that inactivating Nogo-A in glia while preserving
neuronal Nogo-A expression may be the most successful strategy to promote axonal
regeneration in the CNS.
1.1 Nogo-A as an extrinsic and intrinsic growth, synapse and survival regulator
Nogo-A is mostly seen as an extracellular inhibitor of axonal regeneration. Apart from
Rho-A activation leading to growth cone collapse, trans Nogo-A also suppresses the
neuronal growth program (Schwab, 2010). Several transcriptional changes have been
detected between spinal cord tissue samples from conventional Nogo-A knock-out and wildtype mice (Montani et al., 2009), pointing to regulation of the actin cytoskeleton, the
neuronal growth machinery, and in particular the Rho-GTPase/LIMK1/cofilin pathway.
Additionally, Nogo-A-∆20 containing signalosomes have been shown not only to activate
Rho-A, but also down-regulate cAMP response element binding protein (CREB)
phosphorylation and repress the neuronal growth program (Joset et al., 2010). This
pathway is a main regulatory mechanism used by neurotrophic factors to elicit growth and
neuronal plasticity (Shao et al., 2002) and strikingly, to help neurons to overcome myelinmediated growth inhibition (Cai et al., 2002, Gao et al., 2004). Interestingly, signaling from
negative and positive growth regulators converge on the same transcription factor and this
observation might be generalized to regulation of other growth controllers, such as the
mammalian target of rapamycin (mTOR), whose synaptic expression was observed to be
decreased by Nogo-A (Baldwin et al., 2011, Peng et al., 2011). Additionally, recently, NogoA-∆20 mediated growth cone collapse has been shown to be dependent on the mTOR
pathway-activated protein translation (Manns et al., 2014). All these findings illustrate how
a negative, extrinsic regulator of growth, such as Nogo-A, can interfere with intrinsic growth
mechanisms.
Similarly to previous studies, here we report that neuronal Nogo-A could also modify
intrinsic neuronal growth properties through a cell autonomous mechanism. We found
increased regeneration in the optic nerve of glial Nogo-A KOs, where expression of the
neuronal Nogo-A pool is preserved and in vitro neurons over-expressing Nogo-A grew
longer neurites on high concentrations of inhibitory Nogo-A-∆20 substrate. In injured
retinae of the glial Nogo-A KOs, increased growth associated Sprr1a and Gap43 mRNA levels
were detected confirming an elevated neuronal growth state in these animals. Importantly,
we detected lower Rho-A activation in these retinae, but the phospho-CREB levels were not
- 137 -
Chapter 5: Concluding remarks
altered. We therefore aimed to find an explanation for how neuronal Nogo-A could act as a
positive intrinsic growth regulator. We proposed cis-interaction with neuronal Nogo
receptors as a new mechanism for the cell autonomous, positive role of Nogo-A. There is a
growing body of evidence in support of this novel type of interaction, in which ligands
inhibit their receptor in the same cell. The cis-interaction we suggest within the cell
membrane between Nogo-A and Nogo receptors may be analogous to the mechanism
previously described for the Ephrin/Eph, Semaphorin/Plexin or Delta/Notch that blocked
downstream signaling (Yaron and Sprinzak, 2012). Cis-interaction has so far been shown to
control axonal guidance and cell fate specification, however other possible roles in the
central nervous system, such as in axonal growth inhibition or synaptogenesis can be
postulated. The simultaneous presence of Nogo-A and its receptors led us to the hypothesis
that through cis-interaction Nogo-A could limit signaling via NgR1 and S1PR2 and thereby
counteract growth inhibition by myelin inhibitory cues. Additionally, in view of the
importance of ephrins, some semaphorins and Nogo-A in synapse formation and
maintenance, the contribution of cis-interaction to synaptogenesis is plausible.
After CNS injury, Nogo-A has been observed to be increased in neurons (Cheatwood et
al., 2008, Pernet et al., 2011), suggesting that it may contribute to growth and cell death
related mechanisms. Our and other studies have not detected changes in the regulation of
ER-stress associated markers upon Nogo-A expression manipulation. However, in ischemia
and after oxidative stress, Nogo-A has been shown to act as a neuroprotective molecule.
Nogo-A protein levels were increased in cortical and thalamic neurons after stroke
(Cheatwood et al., 2008), and Nogo-A could promote neuronal survival (Kilic et al., 2010).
Multiple in vitro studies suggested that Nogo-A might protect neurons against oxidative
insult through scavenging ROSs or by interacting with a network of anti-stress molecules
(Mi et al., 2012, Guo et al., 2013, Kern et al., 2013). Stroke affects hundreds of thousands of
people worldwide; in light of the possible positive role of Nogo-A in neuronal survival, the
influence of immunotherapy against Nogo-A on neuronal cells should be further
investigated.
As a consequence, discovery of these newly emerging functions for Nogo-A raise
important points for designing new treatments for CNS diseases, as blocking Nogo-A may
influence regeneration, plasticity and cell survival in a complex manner.
- 138 -
Chapter 5: Concluding remarks
1.2 Contribution of guidance molecules and myelin inhibitory proteins to the
blockade of CNS axonal regeneration
In several studies from our laboratory, three-dimensional analysis of regenerating axons
revealed axonal guidance and patterning defects reflected by increased axonal U-turns and
branching after growth induction in the injured optic nerve (Pernet et al., 2013a, Pernet et
al., 2013b, Joly et al., 2014). These findings point to the complexity of molecular players
contributing to the blockade and guidance of regeneration.
After fulfilling their role in nervous system development, many axon guidance
molecules are down-regulated, while others retain their expression in the adult CNS and
this implies additional roles for guidance cues beyond developmental contribution to
outgrowth, growth cone navigation and target innervation (Giger et al., 2010). Axon
guidance molecules in the mature CNS have been proposed to play a role in synaptic
stabilization and limitation of neuronal plasticity in adulthood, and their expression is
regulated following injury. As CNS neurons continue to express guidance receptors, the
inability of severed axons to undergo spontaneous repair in the adult CNS has been
proposed to be partially attributed to the presence of the same guidance molecules that
were important during development, a hypothesis that needs further investigation.
A previous study from our laboratory revealed up-regulation of developmental axon
guidance cues such as the EphrinA3/EphA4 ligand/receptor pair following constitutive
Nogo-A deletion, and demonstrated increased axonal sprouting and regeneration after
spinal cord injury in Nogo-A/EphA4 double KO mice compared to EphA4 single KO animals
(Kempf et al., 2013). Our data in the glial Nogo-A KOs also suggested that the range of axonal
regeneration may be restricted by the compensatory up-regulation of EphA4 and EphrinA3
in glial cells. Although by examining individual growing axons in 3D we found no significant
difference in the proportion of branching or U-turn-forming axons between mouse
genotypes, it remains possible that compensatory enhancement of EphrinA3 in the optic
nerve and EphA4 in the retina could influence the guidance of regenerating axons in a
complex manner in the glial Nogo-A KOs. We also reported that EphA4 KO mice were less
prone to form branches in the injured optic nerve than WT animals (Joly et al., 2014). Due to
the EphA4 up-regulation in the glial Nogo-A KOs, we expected to find increased branching of
regenerating neurons in the injured optic nerve. However, possibly due to the simultaneous
higher expression of EphinA3 that may have led to increased signaling through other
receptors, we did not detect changes in branching or any other guidance deficits. As
additional Ephrins and Semaphorins might be up-regulated in the glial Nogo-A KOs, future
- 139 -
Chapter 5: Concluding remarks
studies should detail the complex regulation system of myelin inhibitory and guidance and
other repulsive molecules in the injured optic nerve.
Additionally, further components of the CNS myelin, such as MAG and OMgp have
been shown to have inhibitory properties on axon growth. Although we have not detected
changes in MAG levels in intact optic nerves of the glial Nogo-A KOs, expression of further
myelin components such as PLP or MBP should also be followed up to exclude alterations in
the myelin composition. As Nogo-A was proposed to be a key factor for precise myelination
in the developing CNS (Pernet et al., 2008, Chong et al., 2012), it is possible that due to the
deletion of Nogo-A in oligodendrocytes the myelin ultrastructure is slightly altered and this
could lead to altered regeneration phenotypes.
It would be of great interest to understand how and why these repulsive guidance
cues and potentially other myelin inhibitors get up-regulated upon Nogo-A deletion, and to
find out how these compensatory mechanisms could be neutralized to potentiate axonal
regeneration in the damaged CNS.
1.3 Model systems to study axonal regeneration in the CNS
The ultimate goal of the research on CNS regeneration is to improve the recovery from
diseases such as spinal cord, brain or optic nerve injuries, where regrowth and protection of
injured axons and formation of new functional neuronal connections is of uttermost
importance. Regenerating axons in the adult spinal cord have low intrinsic growth potential,
and additionally face a hostile inhibitory environment: myelin inhibitory and repulsive
guidance molecules and the CSPG expressing glial scar.
The same set of inhibitory factors represents a major hurdle for regenerating retinal
ganglion cells in the optic nerve. The visual system has been proven to be an excellent and
powerful research tool and many important milestones in understanding the mechanisms of
axonal regeneration in the CNS have been reached by using this model. The optic nerve
crush model allows researchers to investigate mechanisms of both axonal regeneration and
cell survival of retinal ganglion cells. Furthermore, as injections in the vitreous liquid are
relatively simple, retinal ganglion cells are readily accessible for pharmacological
treatments and gene therapy. Combinatorial treatments acting on both intrinsic limitations
and extrinsic hurdles affecting regeneration led to long-distance regrowth of a few RGC
axons toward the brain targets such as the hypothalamus, lateral geniculate nucleus and in
some reports even superior colliculus (de Lima et al., 2012, Luo et al., 2013). However,
correct path-finding and guidance of these re-growing axons was questioned by newly
developed 3 dimensional tracing techniques of individual axons in the transparent optic
- 140 -
Chapter 5: Concluding remarks
nerve. Several studies reported that although a number of regrowing axons can be induced,
these fibers very often follow irregular trajectories, show abnormal morphologies and
misrouting at decision points, such as the optic chiasm, possibly due to the presence of
myelin inhibitory proteins and repulsive guidance cues (Pernet and Schwab, 2014).
However, target finding and circuit formation is rather different in the optic nerve from
other parts of the CNS, therefore regenerative outcomes should also be tested in other
systems.
Once the efficiency of a treatment has been proven to lead to increased regeneration
in the optic nerve, this regenerative improvement and underlying mechanisms are likely to
be successful when transferred to the spinal cord (Liu et al., 2010). Regeneration studies
after spinal cord injury could have even stronger outcomes, as the gray matter composed
of neuronal cell bodies in immediate vicinity of regenerating axons provides a more growth
permissive environment and can be the substrate of compensatory sprouting and formation
of detour connections (Bareyre et al., 2004). In the spinal cord, studies with clinically
relevant lesion models such as compression and contusion are valuable for direct
comparison with clinical cases.
With careful selection of the injury model and species, animal experimentations in the
laboratory bring us closer to future therapies that could be applied in the clinics.
1.4 Implications for clinical therapies targeting Nogo-A signaling
Multiple ways have been developed to suppress Nogo-A/Nogo receptor interactions and the
underlying signaling pathways, such as the application of Nogo-A function blocking
antibodies, or NgR1 or RhoA/ROCK blockers. These treatments lead to enhanced
regeneration with improved functional recovery and hold high promises for promoting
axonal regeneration and plasticity after CNS injury (Schwab and Strittmatter, 2014). Clinical
trials with the anti-human Nogo-A antibodies ATI355 (Novartis) or GSK1223249
(GlaxoSmithKline) are currently being carried out with excellent safety and tolerance for
multiple CNS disease areas such as spinal cord injury, stroke, multiple sclerosis and
amyotrophic lateral sclerosis. Based on our findings, however, such treatments would
results in the blockade of both inhibitory myelin and positive neuronal Nogo-A pools,
thereby hampering the possible full extent of axonal regeneration. Indeed, the treatment
with anti-Nogo-A antibodies has been shown to down-regulate endogenously expressed
Nogo-A in both cultured oligodendrocytes and neurons in vitro, as well as in vivo in the
spinal cord (Weinmann et al., 2006). To overcome such treatment limitations, this
phenomenon should be kept in mind when designing new treatments for spinal cord injured
- 141 -
Chapter 5: Concluding remarks
patients. The ideal therapy targeting Nogo-A signaling should aim to block glial Nogo-A (in
trans), but at the same time preserve neuronal Nogo-A functions (in cis). However, reaching
this treatment regimen is challenging, as targeted blockers for Nogo-A in oligodendrocytes
are not yet available and reinforcing neuronal Nogo-A expression would only be possible by
gene therapy applications.
Furthermore, as we gain more knowledge on the factors limiting axonal regeneration
in the central nervous systems, new generations of pharmacological treatments may be
developed. One potential way is targeting Nogo-A signaling pathways with small molecules
instead of antibodies, such as the S1PR2-blocker JTE-013 and the Rho-A/ROCK blocker
Cethrin. Our recent data also suggest that targeting the cAMP/CREB pathway might be
beneficial to overcome Nogo-A and MAG-mediated growth inhibition. Various degrees of
growth and sprouting of injured CNS neurons have been achieved by blocking extrinsic
inhibitory cues (myelin, ECM, glial scar), increasing extrinsic growth promoting cues
(neurotrophic factors), or by activation of intrinsic growth programs (PTEN deletion, Stat3,
mTOR up-regulation). Recently, combinations of these different treatment regimens have
yielded even more success in promoting neural growth, sprouting and improving behavioral
outcomes (Schnell et al., 2011, Wang et al., 2012). Whether the most promising treatment
strategies in animal models are also beneficial for human patients suffering from spinal
cord, brain or optic nerve injury is a challenge ahead for testing in clinical settings.
- 142 -
Chapter 5: Concluding remarks
1.5 Final conclusions
The research presented in this thesis provides, at least in part, answers for the glial versus
neuronal cell type-specific functions of Nogo-A after optic nerve lesion, in particular for
axonal regeneration, retinal ganglion cell survival and Müller cell reactivity. Conditional
deletion of Nogo-A from glial cells shed light on the specific growth inhibitory function of
Nogo-A in oligodendrocytes and provided further evidence for the growth supporting,
positive role of neuronal Nogo-A. We proposed that while Nogo-A leads to the activation of
Nogo-A receptors in trans and subsequent neuronal growth inhibition, Nogo-A expressed in
cis in neurons could counteract this receptor activation by sequestering, binding, blocking or
internalizing NgR1 and/or S1PR2. This possible mode of action for Nogo-A raises many new
questions, regarding the exact mechanisms and whether promoting cis-interaction between
Nogo-A and its receptors could be exploited for a future potential therapy promoting axonal
regeneration. Taken together, our results suggest that in order to promote strong
regeneration and plasticity after CNS injury, the next generation of Nogo-A signaling
blockers should selectively target Nogo-A in oligodendrocytes, and simultaneously prevent
loss or even promote Nogo-A expression and functions in neurons.
- 143 -
Chapter 5: Concluding remarks
References
Baldwin K, Raiker S, Giger R (2011) Nogo-A negatively regulates mTor signaling to inhibit
synaptic function. Society for Neuroscience, Neuroscience 2011 poster 216.204.
Bareyre FM, Kerschensteiner M, Raineteau O, Mettenleiter TC, Weinmann O, Schwab ME
(2004) The injured spinal cord spontaneously forms a new intraspinal circuit in
adult rats. Nat Neurosci 7:269-277.
Cai D, Deng K, Mellado W, Lee J, Ratan RR, Filbin MT (2002) Arginase I and polyamines act
downstream from cyclic AMP in overcoming inhibition of axonal growth MAG and
myelin in vitro. Neuron 35:711-719.
Cheatwood JL, Emerick AJ, Schwab ME, Kartje GL (2008) Nogo-A expression after focal
ischemic stroke in the adult rat. Stroke 39:2091-2098.
Chong SY, Rosenberg SS, Fancy SP, Zhao C, Shen YA, Hahn AT, McGee AW, Xu X, Zheng B,
Zhang LI, Rowitch DH, Franklin RJ, Lu QR, Chan JR (2012) Neurite outgrowth
inhibitor Nogo-A establishes spatial segregation and extent of oligodendrocyte
myelination. Proc Natl Acad Sci U S A 109:1299-1304.
de Lima S, Koriyama Y, Kurimoto T, Oliveira JT, Yin Y, Li Y, Gilbert HY, Fagiolini M, Martinez
AM, Benowitz L (2012) Full-length axon regeneration in the adult mouse optic nerve
and partial recovery of simple visual behaviors. Proc Natl Acad Sci U S A 109:91499154.
Gao Y, Deng K, Hou J, Bryson JB, Barco A, Nikulina E, Spencer T, Mellado W, Kandel ER, Filbin
MT (2004) Activated CREB is sufficient to overcome inhibitors in myelin and
promote spinal axon regeneration in vivo. Neuron 44:609-621.
Giger RJ, Hollis ER, 2nd, Tuszynski MH (2010) Guidance molecules in axon regeneration.
Cold Spring Harb Perspect Biol 2:a001867.
Guo F, Jin WL, Li LY, Song WY, Wang HW, Gou XC, Mi YJ, Wang Q, Xiong L (2013) M9, a novel
region of amino-Nogo-A, attenuates cerebral ischemic injury by inhibiting NADPH
oxidase-derived superoxide production in mice. CNS Neurosci Ther 19:319-328.
Joly S, Jordi N, Schwab ME, Pernet V (2014) The Ephrin receptor EphA4 restricts axonal
sprouting and enhances branching in the injured mouse optic nerve. Eur J Neurosci.
Joset A, Dodd DA, Halegoua S, Schwab ME (2010) Pincher-generated Nogo-A endosomes
mediate growth cone collapse and retrograde signaling. J Cell Biol 188:271-285.
Kempf A, Montani L, Petrinovic MM, Schroeter A, Weinmann O, Patrignani A, Schwab ME
(2013) Upregulation of axon guidance molecules in the adult central nervous system
of Nogo-A knockout mice restricts neuronal growth and regeneration. Eur J Neurosci
38:3567-3579.
Kern F, Stanika RI, Sarg B, Offterdinger M, Hess D, Obermair GJ, Lindner H, Bandtlow CE,
Hengst L, Schweigreiter R (2013) Nogo-A couples with Apg-1 through interaction
and co-ordinate expression under hypoxic and oxidative stress. Biochem J 455:217227.
Kilic E, ElAli A, Kilic U, Guo Z, Ugur M, Uslu U, Bassetti CL, Schwab ME, Hermann DM (2010)
Role of Nogo-A in neuronal survival in the reperfused ischemic brain. J Cereb Blood
Flow Metab 30:969-984.
Liu K, Lu Y, Lee JK, Samara R, Willenberg R, Sears-Kraxberger I, Tedeschi A, Park KK, Jin D,
Cai B, Xu B, Connolly L, Steward O, Zheng B, He Z (2010) PTEN deletion enhances the
regenerative ability of adult corticospinal neurons. Nat Neurosci 13:1075-1081.
Luo X, Salgueiro Y, Beckerman SR, Lemmon VP, Tsoulfas P, Park KK (2013) Threedimensional evaluation of retinal ganglion cell axon regeneration and pathfinding in
whole mouse tissue after injury. Exp Neurol 247:653-662.
Manns R, Schmandke A, Jareonsettasin P, Cook G, Schwab ME, Holt C, Keynes R (2014)
Protein synthesis dependence of growth cone collapse induced by different Nogo-Adomains. PLoS ONE 9:e86820.
- 144 -
Chapter 5: Concluding remarks
Mi YJ, Hou B, Liao QM, Ma Y, Luo Q, Dai YK, Ju G, Jin WL (2012) Amino-Nogo-A antagonizes
reactive oxygen species generation and protects immature primary cortical neurons
from oxidative toxicity. Cell Death Differ 19:1175-1186.
Montani L, Gerrits B, Gehrig P, Kempf A, Dimou L, Wollscheid B, Schwab ME (2009)
Neuronal Nogo-A modulates growth cone motility via Rho-GTP/LIMK1/cofilin in the
unlesioned adult nervous system. J Biol Chem 284:10793-10807.
Peng X, Kim J, Zhou Z, Fink DJ, Mata M (2011) Neuronal Nogo-A regulates glutamate
receptor subunit expression in hippocampal neurons. J Neurochem 119:1183-1193.
Pernet V, Joly S, Christ F, Dimou L, Schwab ME (2008) Nogo-A and myelin-associated
glycoprotein differently regulate oligodendrocyte maturation and myelin formation.
J Neurosci 28:7435-7444.
Pernet V, Joly S, Dalkara D, Jordi N, Schwarz O, Christ F, Schaffer DV, Flannery JG, Schwab ME
(2013a) Long-distance axonal regeneration induced by CNTF gene transfer is
impaired by axonal misguidance in the injured adult optic nerve. Neurobiol Dis
51:202-213.
Pernet V, Joly S, Dalkara D, Schwarz O, Christ F, Schaffer D, Flannery JG, Schwab ME (2011)
Neuronal Nogo-A upregulation does not contribute to ER stress-associated
apoptosis but participates in the regenerative response in the axotomized adult
retina. Cell Death Differ.
Pernet V, Joly S, Jordi N, Dalkara D, Guzik-Kornacka A, Flannery JG, Schwab ME (2013b)
Misguidance and modulation of axonal regeneration by Stat3 and Rho/ROCK
signaling in the transparent optic nerve. Cell Death Dis 4:e734.
Pernet V, Schwab ME (2014) Lost in the jungle: new hurdles for optic nerve axon
regeneration. Trends Neurosci 37:381-387.
Schnell L, Hunanyan AS, Bowers WJ, Horner PJ, Federoff HJ, Gullo M, Schwab ME, Mendell
LM, Arvanian VL (2011) Combined delivery of Nogo-A antibody, neurotrophin-3 and
the NMDA-NR2d subunit establishes a functional 'detour' in the hemisected spinal
cord. Eur J Neurosci 34:1256-1267.
Schwab ME (2010) Functions of Nogo proteins and their receptors in the nervous system.
Nat Rev Neurosci 11:799-811.
Schwab ME, Strittmatter SM (2014) Nogo limits neural plasticity and recovery from injury.
Curr Opin Neurobiol 27C:53-60.
Shao Y, Akmentin W, Toledo-Aral JJ, Rosenbaum J, Valdez G, Cabot JB, Hilbush BS, Halegoua S
(2002) Pincher, a pinocytic chaperone for nerve growth factor/TrkA signaling
endosomes. J Cell Biol 157:679-691.
Wang X, Hasan O, Arzeno A, Benowitz LI, Cafferty WB, Strittmatter SM (2012) Axonal
regeneration induced by blockade of glial inhibitors coupled with activation of
intrinsic neuronal growth pathways. Exp Neurol 237:55-69.
Weinmann O, Schnell L, Ghosh A, Montani L, Wiessner C, Wannier T, Rouiller E, Mir A,
Schwab ME (2006) Intrathecally infused antibodies against Nogo-A penetrate the
CNS and downregulate the endogenous neurite growth inhibitor Nogo-A. Mol Cell
Neurosci 32:161-173.
Yaron A, Sprinzak D (2012) The cis side of juxtacrine signaling: a new role in the
development of the nervous system. Trends Neurosci 35:230-239.
- 145 -
- 146 -
Acknowledgements
Acknowledgements
I would like to express my gratitude to all the people who supported and assisted me both
before and during my doctoral thesis.
First, I wish to thank my supervisor Professor Martin E. Schwab for offering me this
interesting research project, for his continuous support during my work and for his infinite
enthusiasm finding the mechanisms underlying axonal growth inhibition. I am very grateful
to Dr Vincent Pernet for being a passionate scientist and a great mentor. I learned a lot from
him, both technically and scientifically, and without his help carrying out the work
presented in this thesis would not have been possible. I would also like to thank the
members of my PhD committee, Professor Ueli Suter and Professor Stephan Neuhauss for
their valuable comments and suggestions for my research projects.
Furthermore, I am very grateful to Anna Guzik-Kornacka and Sandrine Joly for their
great support both technically in the lab and morally, helping to keep my projects running.
Very special thanks goes to Franziska Christ for her help in genotyping myriads of samples
for my experiments and for her advice in various lab related questions or suggestions for
beautiful hikes in Switzerland. I also thank the whole animal facility staff for their great
effort in taking care of our animals. I would like to thank all my friends and colleagues from
the lab and institute, especially from the “chicks’ office” and the “pilates team”, for sharing
so many good memories with me during the last 4 years in and outside of Zürich. I would
also like to acknowledge the administrative and technical staff of the institute for providing
welcoming and technically well-equipped working conditions in the HIFO.
I wish to express my sincere thanks to my family and my close friends in Zürich and
all over the world for all their support during my doctoral thesis. I am very grateful for the
warm welcome, friendship and support of Alice in both personal and scientific questions. I
am delighted to acknowledge my friends with whom I spent many happy moments learning
German, enjoying the ASVZ, hiking and skiing in the mountains and swimming in rivers and
lakes of Switzerland. My deep gratitude goes to my family for their constant encouragement
and acceptance for my decisions. Finally, it is my pleasure to thank Edu for his patience, love
and endless support during the last four years that brought me so much happiness and
helped me enormously in carrying out my various projects.
- 147 -
Curriculum vitae
Curriculum vitae
Personal data
Name:
Flóra Vajda
Date of birth:
December 26th, 1986
Place of birth:
Budapest, Hungary
Nationality:
Hungarian
Education
September 2010 - present
PhD candidate in Neuroscience
ETH (Swiss Federal Institute of Technology Zurich)
and UZH (University of Zürich), Brain Research
Institute
November 2008 - May 2010
Master thesis and Research internship
University of Stuttgart, Institute of Cell Biology and
Immunology
September 2005 - June 2010
Master’s Degree in Neuroscience, Bachelor’s
Degree in Biology
Eötvös Loránd University (Budapest), Faculty of
Science, Institute of Biology
Scholarships and awards
March 2013
First Prize for Poster presentation
Cambridge Brain Repair Spring School, Cambridge, UK
November 2009
First Prize for Presentation
Undergraduate Researchers Conference in Animal
Physiology and Neurobiology section, Eötvös Loránd
University, Budapest
June 2008 - August 2008
Summer Research Program Scholar
École Polytechnique Fédérale de Lausanne (EPFL),
Brain Mind Institute
- 148 -
Curriculum vitae
Publications
•
Vajda F, Jordi N, Dalkara D, Joly S, Christ F, Tews E, Schwab ME, Pernet V (2014). Cell
type-specific Nogo-A gene ablation promotes axonal regeneration in the injured adult optic
nerve. Cell Death and Differentiation (in press).
•
Guzik-Kornacka A, van der Bourg A, Vajda F, Joly S, Christ F, Schwab ME, Pernet V
(2014). Nogo-A deletion increases the plasticity of the optokinetic response and changes
retinal projection organization in the adult mouse visual system. Brain Structure and
Function (in press).
•
Guzik-Kornacka A*, Vajda F*, Schwab ME (2014). Blocking the Nogo-A signalling
pathway to promote regeneration and plasticity after spinal cord injury and stroke. Chapter
25, Translational Neuroscience (in press). (*these authors contributed equally)
Poster presentations
•
Vajda F, Pernet V, Guzik A, Joly S, Jordi N, Christ F, Tews E, Schwab ME (2013).
Targeted Nogo-A gene ablation in glia reveals improved axonal regeneration in the injured
adult optic nerve. Poster Presentation at SfN Neuroscience meeting, 2013, San Diego.
•
Vajda F, Pernet V, Guzik A, Christ F, Tews E, Schwab ME (2012). Characterization of
glia-specific Nogo-A knock-out mice. Poster Presentation at SfN Neuroscience meeting,
2012, New Orleans.
•
Vajda F, Petrinovic M, Duncan C, Schwab ME (2011). Functions of Neuronal Nogo-A
for Neurite Growth in the Developing Nervous System. Poster Presentation at EMBO
Workshop in Crete, Cell Biology of the Neuron: Polarity, Plasticity and Regeneration.
•
Vajda F, Hausser A and Schlett K (2010). Intracellular localization and functional
effects of mutant Protein kinase D expression in hippocampal neurons. Frontiers of
Neuroscience Conference Abstract: IBRO International Workshop.
Professional memberships
2012-present
Society for Neuroscience (SfN) member
2011-present
Life Science Zürich Young Scientist Network member
- 149 -