Oene, 93 (1990) 41-47
Elsevier
41
G E N E 03592
An improved p-galaetosidase et-eomplementation system for molecular cloning in B a c i l l u s subtilis
(Recombinant DNA; translation efficiency; chromosomal integration; lacZ gene; structural plasmid stability)
Peter Haima', Uouwe van Sinderen % Sierd Bronb and Gerard Venemab
° Department ofMicrobiology,and b Department of Genetics,Center ofBiologicalSciences,gedclaan 30. NL-9751 NNHaven (The Net&edands)
Received by R,E, Yasbin: 5 December 1989
Revised: 26 January 1990
Accepted: 12 February 1990
SUMMARY
The recently described/~-galactosidase ~-complementation system for molecular cloning in Bacillus subtilis [Haima et al.,
Gene 86 (1990) 63-69] was optimized in several ways. First, the efficiencyof translation ofthe lacZAM ! 5 gene was improved.
Second, the plasmid-borne lacZdM 15 gene was segregationally stabilized by integration into the B. subtilis chromosome.
Third, a new lacZ~ complementing cloning vector was constructed, containing more unique target sites. It was shown that
large heterologous DNA fragments (up to at least 29 kb) could be cloned with lacZ~-complementing vectors carrying the
replication functions of the cryptic B. subtilis plasmid pTAI060, and that these inserts were structurally stably maintained
for at least 100 generations of growth.
INTRODUCTION
Since natural plasmids in Bacillus subtilis are usually
cryptic, molecular cloning in this organism has mainly been
carried out with high-copy-number plasmids from Staphylococcus aureus, such as pC194 (Cma), pE194 (Er a) and
pUB 110 (KmR). Although vectors based on such plasmids
have successfully been used in some cases, frequently obCorrespondence to: Dr. S. Bron, Department of Genetics, Center of
Biological Sciences, Kerklaan 30, NL-9751 NN Haren (The Netherlands)
Tel. (050) 632105; Fax (050) 632348.
Abbreviations: aa, amino acid(s); Ap, ampicillin; B., Bacillus; pGd,
,B-gdactosidase; bp, base pair(s); CAT, Cm acetyitransferase; cat, gene
encoding CAT; Cut, chloramphenicoi; A, deletion; ds, double strand(ed);
DTr, dithiothreitoi; Er, erythromycin; Kin, kanamycin; kb, kilobase(s)
or 1000 bp; lacZ, gene encoding pGal; MCS, multiple cloning site; nt,
nudeotide(s); oligo, oligodeoxyribonudeotide; or/, origin of DNA replication; P, promoter; Polik, Klenow (large) fragment of E. coil DNA polymerase I; a resistant/resistance; rep, primary replication functions; ss,
single strand(ed); TY, see Table I, footnote a; u, units; XGal, 5-bromo-4chloro-3-indolyl-p-D-galactopyranoside; ::, novel joint (fusion); [],
denotes plasmid-carrier state.
0378-11191901503.50 © 1990Elsevier Science Publishers B.V.(Biomedical Division)
served problems are structural and segregational instability
(Ehrlich et al., 1986; Bron et al., 1985; 1988), and low
efficiencies obtained in random cloning of foreign DNA.
The latter is manifested in low numbers of clones and
limited sizes of the DNA inserts (Michel et al., 1980;
Gryczan et al., 1982; Janni~re et al., 1990). Recently, it was
postulated that the inferior cloning properties of the
staphylococcal plasmids might be a consequence of their
mode of replication (Janni~re et al., 1990); all these plasraids appear to replicate via ssDNA intermediates, probably by rolling-circle replication (for a review, see Gruss and
Ehrlich, 1989). Plasmids based on the ssDNA-generating
replicon pC194 appeared to be structurally unstable and
showed inferior cloning properties as compared to plasmids
which replicate without generating ssDNA, like pAM/~t
(Janni~re et al., 1990).
We recently described cloning vectors based on the
B. subtilis low-copy-number plasmid pTAI060 (Uozumi
et al., 1980), which showed important advantages in comparison to the commonly used staphylococcal plasmids
(Bron et al., 1987; Haima et al., 1987). First, it was shown
that the segregational stability of pTAl060-derived repli-
42
pTAl060-derived vectors by developing a/~Gal =-complementation cloning system for B. subtilis (Haima etal.,
1990). This system was based on two unrelated compatible
plasmids. The host contained the pWVOl-based (Kok
etal., 1984) plasmid pGHSI, which carries the constitutively expressed lacZAMl5 gone. The cloning vector was
the pTAl060-based plasmid pHPS9, which carries a constitutively expressed translational fusion of the Bacillus
cons was hardly affected by plasmid size (Bron et at., 1987).
In contrast, the $. aureus plasmid p U B 110 showed sizedependent effects on copy numbers (Bron et at., 1985;
1988) resulting in dramatic levels of segregational instability. Second, pTAl060-derived vectors showed superior
cloning efficiencies as compared to the staphylococcal plasmids (Haima etal., 1987).
In a follow-up study we extended the applicability of the
PSP02
E~~ p23 (pKuue)
•
:TTATA UmA ACTT II ATa ACt
',
UamUATTCT II
ACC
NheI
'
I(mR
ATo OATTeACTo
An AOG TCA
t
" t
P23
toeZAII15
~x
GTCtool
GTCmG'.
(l~usu)
(V¢,us)
Hind~ (pKBU5)
/
"/.2 29.1 16.8
AAA
Rababab
~x
pKBU4
11.0kb
wl
. pSCt0t
(Fig, i)
~
" PstI
Fig. 1. Structure of plasmids pKBU4, pKBU$, pKBUSM, pKBU6 and pKBUT. Large scale and mini preparations of plasmid DNA were obtained
essentially as described by lsh-Horowicz and Burke (1981). DNA techniques were as described by Maniatis et at, (1982). The dideoxy-¢haln termination
method was used for DNA sequencing (Sanger et at,, 1977~ Plasmid pKBU$ was constructed by insertion of the Nhel.Hindlll fragment from pGHSl
(both sides were filled in with Pollk), containing the KmR Bane and the lacZdMlS gene, into the filled.in Bglll site of pKBU4 (Table i), The £. colt
MCI000[pUC9] transformants carrying pKBU5 were selected on Km+ Ap + XGal plates. To construct pKBU6 and pKBU7, the small EcoRI.Bgll
fragment from pKBU$, containing the -20 to + 33 region of the lacZAMlS Bane and promoter P2J, was replaced by a synthetic ds oligo fragment of
110 bp, The two complementary strands of this fragment were initially synthesized as four separate oligos of 54, 56° 60 and 43 nt long, in such a way
that alter annealing the overlaps on the opposite strands were at least 10 nt long. The oligos of the coding strand were: 5'-dAATTCGTTAACAGATCTTATAAAGGAGGATTCACTTATGACTATGATAACAGAT and 5'-dTCACTAGCAGTC~3TAGCCC(3CACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAA, and those of the complementary strand: 5'-dCTGCTAGTGAATCTGTTATCATAGTCATAAGTG.
AATCCTCCTITATAAGATCTGTTAACG and 5'-dAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGC'~3GGCTACGA. The oligos
were phosphorylated (360 pmol of each) for 1.5 h at 20°C using ! u of T4 polynucleotide kinase in 60 mM Tris. HC! (pH 7.5)/10 mM MgCl2/10mM
DTr/I mM ATP in vols. of 20 pl, For annealing, the phosphorylated oligos were combined in 44.4 ttl of 150 mM KCI, heated for S rain at 98=C and
slowly allowed to cool to room temperature. One/~! of the annealing mixture was iigated to EcoRl + Bg/l-cleaved MI3mpl9 DNA (0.1 pmol) and the
ligation mixture was used to transform £, coltJM 101 competent cells with selection on XGal plates. The EcoRI.Bgll fragment from the double-stranded
replicative form DNA of a recombinant phage carrying the correct fragment (as confirmed by sequence analysis) was used to replace the corresponding
fragment of pKBUS, containing promoter P23 and the first 73 bp of the lacZdMl5 sane. Since the synthetic oligo fragment lacked a promoter, the
lacZdM 15 gene was not expressed in the resulting plasmid, denoted as pKBUSM. Plasmid pKBU6 was constructed by reinserting the strong lactococcal
promoter 1'23, as a Sau3A fragment from pGKV223, in the Bglll site of pKBUSM, Plasmid pKBU7 was constructed by inserting the 280-bp EcoR!
fragment from pGKVl 1, containing the B. subtOb phage SPO2 promoter, into the EcoRI site of pKBUSM, The E. colt MCI000[pUC9] transformants
containing pKBU6 or pKBU7 were selected on Km + Ap + XGal plates. The sequences ofthe -20 to + 33 regions ofpKBU5 and pKBUSM are shown
in capital letters. Modifications in the coding region of the lacZdMI5 are indicated in lower-case letters; and Shine-Dalgarno sequences in boldface.
The shaded bar in pKBU4 represents the 7.$-kb B. subttlis chromosomal DNA fragment.
Fig. 2. Structural stability ofrecombinant pHPS9 plasmids. Cultures started from single colonies of B. subfl//s6GMI5 containing recombinant pHPS9
plasmids (phage Jt DNA inserts of 7.2, 16.8 and 29 kb), were grown overnight at 37°C in 10 mi of Cm-contalning TY medium. The cultures were diluted
l0s- to 10S-foldin the same medium after everycycleof about approximately 20 generations until approximately 100generations ofgrowth, Plasmid DNAs
extracted from the overnil0tt cultures at the start (a) and after 100 generations of growth (b) were analyzed by BamHl digestion and 0.8% agarose/EtdBr
gel electrophoresis. Numbers "/.2,29.1 and 16.8 correspond to the total size of the DNA inserts (kb). Note that the 29.l-kb insert consists of two Ban=HI
fragments of 16.8 and IZ3 kb, Ban=HI-cleaved ~. DNA served as reference markers (lane R; fragment sizes are indicated in kb on the leR margin).
43
pumilus cat-86 gene and the lacZ~ gene from plasmid pUC9.
This cloning system offered: (1)the direct selection of recombinants; (2) the cloning of large heterologous DNA
fragments with high efficiency; and (3) the availability ofsix
unique target sites: Sphl, Ndel, Nhel, BamHl, Sinai and
EcoRl.
The aim of the present studies was to improve the/~Gal
~-complementation cloning system in two ways: to stably
integrate the lacZAMl5 gene into the B. subtilb chromosome and to improve the efficiency of translation of this
gene.
RESULTS AND DISCUSSION
(a) Integration of the l a c Z A M I 5 gene into the Bacilhts
subtilis c h r o m o s o m e
A drawback of the previously described pGal ~-complementation system (Haima et al., 1989) was the segregational instability of the l a c Z d M l S - c a r r y i n g plasmid
p G H S 1, which is based on the lactococcal plasmid pWVOI
(Kok etal., 1984). Piasmid p G H S I appeared to be extremely unstable during competence development of B. subtilis, resulting in about 97 % plasmid-free cells at the state
TABLE I
Strains and plasmids used in this study a
Relevant properties
Source or reference
Strains
B. subtilb
6GM
6GMI5
trpC2 tyr met hb ura rib r~ m~
IvpC2 tyr met hb ura rib r;a m~ IocZAMI5 Km R
Haima et ai. (1987)
This work
£. coli
MCI000
JMI01
F- araD 139A(araABC-leu)7679 galU galK lacX74 rpsL tM
supE tki ~l(lac-proAB) [F' traD36 proA +B + IoclqZAMIS]
Weinstock et al. (1983)
Laboratory collection
Bacteriophages
Ml3mpl9
lacZoe
Norrander et al. (1983)
Plasmids
pHSG$7$
pKBU4
Cm a, lacZa, derivative of pSCl01
Cma, derivative of pHSG575 carrying a 7.$-kb B. subtilb chromosomal fragment
Takeshita et al. (1987)
J.A.K.W. Kiel, H, Boels and
G.V. (unpublished)
This work
This work
This work
pKBU$
pKBUSM
pKBU6
pKBU7
pGHSI
pLGSI
pHPl3-2
pHPS9
pHPS 10
pGKHI
pGKH2
pGKV259
pGKV259-2
pGKV223
pGKVI I
pPCT2
pUC9
Cmn, Kmn, lacZdM 15, derivative of pKBU4
CmR, Kma, derivative of pKBU$ carrying a modified -20 to + 33 lacZAMI$ region
Cma, Kma, derivative of pKBUSM carrying the modified lacZ~lMl$ gene preceded by the
lactococcal promoter P2.~
Cma, Kma, derivative of pKBUSM carrying the modified iacgdMI5 8ene preceded by the
B. subtilb phage SPO2 promoter
Kmn,/ooZ~IMI$, derivative of pWVOI
Kma,/acZAMI$, pSCI01 derivative
Cma, ErR, pTAI060-pUC9 derivative
Cma, Era, cat-86: :iacZa¢, pTAI060-pUC9 derivative
Era, cat.86: :lacZo~, derivative of pHPl 3-2
Era, cat.86::lacZo~, pWVOI derivative
Era, cat-86 :: lacZ~, derivative of pGK~-I1
Era, cat-86, pWVOI derivative
Era, cat-86, derivative of pGKV259 lacking the Pstl and Sail sites
Era, cat-86, pWVOI derivative
Era, cat.86, pWVOi derivative
Era, cat-86, pUBII0 derivative eo,',~ining the E. coli ::::BTtT2 terminators on an £coR!
fragment
Apa, pBR322 derivative
This work
Haima et al. (1990)
Haima et al. 0990)
Haima et al. (1990)
Haima et al. (1990)
This work
Haima et el. (1990)
This work
Van der Vossen et al. (1987)
This work
Van der Vossen et ai. (1987)
Van der Vossen et ai. (1987)
P. Cegiowski
Vieira and Messing (1982)
" TY medium was as described b~ Biswal et al. (1967). For E. coli, Ap pius Km and Km plus Er were used at 50 pg/ml each. For B. subtilis, Km was
used at 10 pg/ml, Cm at 5 pg/ml and Er at 1 gg/ml. XGai was used at 40 gg/ml for £. coil and at 80 pg/ml for B. subtilis. The B. subtilis cells were grown
to competence as described by Bron and Venema (1972) and, unless stated otherwise, transformed as described before (Haima et al., 1987).The E. co//
cells were made competent and transformed as described before (Haima et ai., 1987). When ~Gal a-complementation in B. subtilis was assayed,
transformants were selected at 30°C for 40 h.
44
ofmaximal competence. We tried to stabilize the lacZAM 15
gene by integrating it, together with a Km R marker gene, via
a double cross-over event into the B. subtilis chromosome.
The plasmid used for the integration, pKBU4 (Fig. 1,
Table I), which is nonreplicative in B. subtilis, contains a
7.5-kb PstI fragment derived from the B. subtilis chromosome. Sequence analysis of this fragment (J.A.K.W. Kiel,
J.M. Boels, G. Beldman, G. and G.V., unpublished)
revealed that the Bglll site in this fragment starts approximately 2 kb downstream from the rrnB gene cluster (Green
et al., 1985), approximately at position 275 ° on the genetic
linkage map ofB. subtilis (Piggot and Hoch, 1985). Since it
appeared that integration of DNA fragments in this region
did not affect essential functions, we decided to target the
lacZAM15 gene to this part of the B. subtilis chromosome.
Plasmid pKBU5 (Fig. 1) was constructed by inserting
the Nhel-Hindlll fragment from pGHS1, containing the
lacZAMl5 and Km R genes, into the BgllI site of the
pSCl01-based plasmid pKBU4. The pGHS1 moiety of
pKBU5 was flanked with large nonessential regions of
homology with the B. subtilischromosome (2.5 kb to the left
and 5 kb to the right ofthe Bgill site), thus allowing homologous recombination to occur. To obtain the desired double
crossover integration event, B. subtilis 6GM competent
cells containing the lacZu-complementing plasmid pHPS9
(Haima et ai., 1990), were transformed with Pstl-cleaved
pKBU5 DNA. This can only result in single-copy integration of the fragment of interest. All transformants
selected on TY plates containing Km, Cm and XGal,
showed pGai activity, suggesting that the lacZ4Ml5 gene
had been integrated into the chromosome. As expected,
Southern hybridization of restriction digests of chromosomal DNA from the transformants with appropriate probes,
revealed that all integration events had taken place by
double crossover recombination (results not shown), resulting in a stable copy number of one lacZLIM15 gene per
chromosome equivalent.
(b) Optimizing the expression of the integrated lacZdMIS
gene
B. subtills cells containing the integrated lacZdM 15 gene
and the lacZcc-complementing plasmid pHPS9, produced
faint-blue colonies on media containing XGal. Since deepblue colonies were obtained in controls when the lacZ•M 15
gene was present on plasmid pGHS 1, this indicates that the
level of expression of the integrated gene was reduced compared to the plasmid-borne gene. Most likely this was due
to a gene dose effect: pGHS 1 was present at approximately
five copies per chromosome equivalent. To quantitate the
level of reduction of expression of the lacZAM 15 gene due
to integration, we measured the/~Gal activity in exponentially growing cultures. The results (Table II) show that
integration resulted in about a fourfold reduction of the
pGal activity (pKBU5-derived integrants).
TABLE II
/~Gal activities in B. subtY/sstrains carrying various lacZo~and lacZAMI5
combinations
Strain
~Gal
activity (u/ml) b
6GM[pGHSI + pHPS9]
6GM(pKBU5)[pHPS9] ~'
6GM(pKBU6)[pHPS9] a
6GM(pKBU7)[pHPS9] a
I I.I
2.7
9.9
5.4
a In these strains the lacZAMl5 gene was integrated into the chromosome.
b /~Gal activity was assayed as described by Miller (1982) and expressed
as u/ml culture (normalized for cell density).
Since the iacZ,4M 15 gone was under control of the strong
lactococcal promoter P23, which is also highly active in
B. subtilis (Van der Vossen et al., 1987), we reasoned that
transcription would not be a limiting factor for expression
of the gone. Therefore, we tried to increase the level of
expression by improving the efficiency of translation. This
was done by modifying the -20 to + 33 region of the gone
(Fig. 1), using synthetic oligos. Throe kinds of modifications were introduced. First, the region upstream of the
lacZAM 15 gone, which as a consequence of the construction is not the regular upstream sequence of the gone
(Haima et al., 1989), was replaced by the -20 to -1 region
of the B. subtgis spoOF gone, which was shown to be
efficiently translated in B. subtgis (Shimotsu et al., 1983;
Hager and Rabinowitz, 1985). Second, we adapted several
third nt of the codons in the 0 to + 32 region of the
lacZ4M 15 gone, such that those corresponded to the average nt distribution in this region of Gram* genes, as
deduced from the work of Hager and Rabinowitz (1985).
Third, the 2nd (ACC), 7th (CTG) and 8th (GCC) codon of
the lacZ,4Ml5 gone, which are rare in highly expressed
B. subtilis genes (Sharp et al., 1988), were substituted with
frequently used codons. None of these changes resulted in
aa substitutions in the protein.
The modified lacZAMl5 gone was placed under control
of either the lactococzal promoter P23 (Van der Vossen
et al., 1987), resulting in plasmid pKBU6 (Fig. 1), or the
B. subtYis phage SPO2 promoter (Williams et ai., 1981),
resulting in plasmid pKBU7 (Fig. 1), and stably integrated
into the B. subtilis chromosome in one copy by a double
cross-over event (as described for pKBU5). These modifications of the gone rzsult~ in about a fourfold increase of
the/1Gal activity (Table II; pKBU5 vs. pKBU6). Furthermore, promoter P23 appeared to result in about twofold
higher levels of/IGal activity than the SPO2 promoter
(pKBU6 vs. pKBU7). One of the pKBU6-derived intogrants, denoted B. subtilis strain 6GM 15, was selected for
further use.
45
(c) Molecular cloning with the host-vector system 6GMIS-
talned a recombinant plasmid), and enabled the cloning of
large heterologous inserts (up to at least 29 kb) with high
efficiency.
plies9
To test the cloning properties of the novel host-vector
system 6GMI5-pHPS9, BamHl-cleaved bacteriophage ~.
DNA was ligated to BamHl-cleaved pHPS9 DNA at a
mass ratio of 25:1 and a final DNA concentration of
500 pg/ml. The ligation mixture was used to transform
6GM15 competent cells and transformants were selected
on Cm- and XGal-containing plates.
Approximately 104 transformants per ml competent cells
were obtained, among which 75~o were potential clones
since these produced white colonies. Restriction analysis of
plasmid DNA extracted from 24 randomly chosen potential
clones revealed that all contained a recombinant pHPS9
plasmid, carrying inserts ranging from 5.6 to 29 kb (the
average insert size amounted to 13.5 kb). From these results
it can be conchlded that the host-vector system 6GM15pHPS9 was reliable (white colony producing cells con-
(d) Structural stabBity of recombinant plasmids
Plasmids from Staphylococcus aureus are rather inefficient
cloning vehicles (Gryczan et al., 1982; Janni~re et al., 1989;
1990; Michel et al., 1980), and inserts carried on these
plasmids often suffer deletions (Ehrlich et al., 1986). Moreover, cloning in such vectors has been shown to result in
high levels of size-dependent segregational instability (Bron
et al., 1985; 1988). It has been postulated that the inferior
cloning properties of staphylococcal plasmids are a consequence of their mode of replication (Janni~re et al., 1990);
all these plasmids appear to replicate via ssDNA intermediates (termed ss + plasmids), probably by roiling-circle
replication (for a review, see Gruss and Ehrlich, 1989). One
observation supporting this hypothesis was that plasmids
Sa,~
Sm
pGKH2
-. Pv
,~tM,t~Zoc
Sp
Bell
pGKH1
S0uNI~
S
¢
0
I
x
t~0t r
~z
smo!
F.¢~I
Fig. 3, Construction ofplasmid pHPS 10. The Pstl and Sail sites on the pWVOl-based plasmid pGKV259 were removed with T4 DNA polymeraseand
Pollk, respectively, resulting in plasmid pGKV259-2 (filling.in of the Sail site resulted in the generation of a Pvul site). The Scal-$phl fragment of
pGKV259-2, containing promoter P59 and part ofthe cat-86gene, was used to replace the corresponding Scal-$phl fragmentofplasmid pGKH l, resulting
jn plasmid pGKH2. Plasmid pHPS 10 was constructed by ligating the 1200-bp Smal-BamHI fragment from pGKH2 to plasmid pHPI3-2 digested with
Hindlll (filled-in) and BamHl. The E. coilMC 1000[pLGSI] transformants carryingpHPS 10were selected on Km+ Er + XGal plates. Open bars, lacZot
sequences; closed bars, cat.86 sequences; thin arrows in the plasmid, direction of transcription; bold arrows, promoter P59; or~pUC, or/of replication
derived from plasmid pUCg; rep, primary replication functions of pTA1060. The followingrestriction sites (only those relevant for the construction) are
indicated: B, BamHl; E, EcoRl; H, HindllI; P, Pstl; Pv, Pvul; S, Sail; Sa, Sau96I; Sc, Scal; Sm, Sinai; Sp, Sphl. Emtz, gene encoding Er resistance.
46
like pAM/~,, which replicate without generating ssDNA
(termed ss- plasmids), appeared to be structurally more
stable than plasmids based on the ssDNA generating replicon pC194, at least for certain types of deletions. Further
support came from the observation that large DNA segments could be cloned on ss- plasmids, while only small
fragments could be cloned on the ss ÷ plasmid (Janni~re
eta]., 1990).
Several observations in our laboratory indicate that the
a. subtilis plasmid pTAI060 also replicates via a rolfingcircle mechanism (S.B. and S. Holsappel, unpublished). A
region of pTAI060 was identified which is required for
optimal segregationai stability (Bron etal., 1987), and
which appeared to contain the origin of minus strand synthesis (or/- ; S.B. and S. Holsappel, unpublished). Because
plasmid pHPS9 lacks the functional or/- and therefore
accumulates ss DNA, it might be structurally unstable. To
examine this possibility, we analyzed the structural stability
of four recombinant pHPS9 plasmids, carrying bacteriophage ~ DNA fragments of 7.2, 16.8, 24 and 29.1 kb, respectively. All transformed colonies (12 of each type were
examined) appeared to contain only the original plasmid,
indicating that the inserts carried by pHPS9 were stable
during transformation of competent cells. To examine the
long-term stability of the inserts, transformants containing
the four recombinant pHPS9 plasmids were grown in batch
culture under Cm selective pressure for 100 generations. All
cultures appeared to contain the original plasmid (results
are shown for the 7.2-, 16.8- and 29-kb inserts in Fig. 2),
indicating that the inserts carried by pHPS9 were also
stable during long-term vegetative growth. It is therefore
concluded that, although pTAl060-based plasmids replicate via a ssDNA-generating rolling-circle mechanism, they
are far superior to the commonly used 5. aureus vectors
with regard to cloning efficiencies and structural stability.
At present we can only speculate about the reasons why
in B. subtilis pTA 1060-derived plasmids are superior to the
commonly used $. aureus plasmids. Since both groups of
plasmids replicate in a similar way (via a rolling-circle mechanism), it is unlikely that the observed differences with
respect to cloning efficiencies and stability are a direct
consequence of their mode of replication. One possible
explanation is that the types of structural instabifity shown
to be stimulated by ssDNA (Janni~re and Ehrlich, 1987;
Janni~re et al., 1990), do not occur frequently enough to
interfere seriously with molecular cloning of foreign DNA
in pTA1060-based plasmids. A significant difference
between the two groups of plasmids is their copy number:
five per chromosome equivalent for pTAI060, and from 20
to 50 for most ofthe S. aureus plasmids. It has been shown
that the $. aureus plasmids generate, in addition to ssDNA
repli~ttion in~ermechates, aberrant replication inter-
mediates of high-molecular-weight (HMW) DNA (Gruss
and Ehrlich, 1988), if they carry foreign DNA inserts.
HMW DNA was also observed in certain derivatives of
pUBll0 (Viret and Alonso, 1987). Both ss and HMW
DNA have been conceived to cause plasmid instability
(Alonso et al., 1987; Gruss and Ehrfich, 1988; Viret and
Alonso, 1987), possibly in an indirect way by interfering
with cell growth. It is attractive to speculate that pTA1060based plasmids generate only small amounts of ss and
HMW plasmid DNA. Preliminary experiments suggest that
this is indeed the case (S.B. and S. Holsappel, unpubfished). The production of ss DNA can even be further
reduced by the introduction of the or/- in plasmids like
pHPS9, which we expect to result in an even further
improvement of the stability properties, also segregationaily,
of these plasmids.
(e) Construction of improved cloning vectors
To extend the number of unique target sites in the MCS
of the lacZ~-complementing plasmid pHPS9, one of each
of the duplicate Sail and Pstl sites was removed, resulting
in plasmid pHPSI0. The details ofpHPSl0, along with an
outline of its construction, are shown in Fig. 3.
Unexpectedly, plasmid pHPSI0 failed to express Cm
resistance in B. subtilis. Furthermore, the/~Gal activity in
6GMI5[pHPSI0] was considerably higher (60.6 u/ml)
than in 6GMI5[pHPS9] (9.9 u/mi). Since the copy numbers of pHPS9 and pHPS 10 were similar (five copies per
chromosome equivalent, results not shown), the most likely
explanation for the decreased expression of the CmR gene
is strong read-through transcription from promoter P59 in
pHPS 10 into the divergently transcribed Cm gene. This was
concluded from the fact that the insertion of the F,. coil rrnB
Tj T2 terminators (Brosius et al., 1981) into the Eco RI site
of the cat-86 : : lacZo~ fusion on pHPS 10 restored the Cm R
phenotype.
Although plasmid pHPSI0 does not express Cm R in
B. subtilis, the vector is very useful for molecular cloning in
this organism. It confers ErR to B. subtilis and contains
eight unique restriction sites suitable for the direct selection
of cloned heterologous DNA fragments. Furthermore, the
plasmid might be useful for isolating transcription terminators. We have shown that by screening for Cm R transformants, recombinant pHPS 10 plasmids carrying the Ts T~
terminator fragment were selected.
ACKNOWLEDGEMENTS
We thank Henk Mulder for preparing the figures and
Gist-Brocades N.V., Delft, for providing synthetic oligos
and for funding of this project.
47
REFERENCES
Alonso, J.C., Viret, J.-F. and Tailor, R.H.: Plasr~id maintenance in Bacil.
ius subtilis recombination-deficient mutants. Mol. Gen. Genet. 208
(1987) 349-352.
Biswal, N., Kleinschmidt, A.K., Spatz, H.C. and Trantner, T.A.: Physical
properties ofthe DNA ofbacteriophage SPS0. Mol. Gen. Genet. 100
(1967) 39-55.
Bron, S. and Venema, G.: Ultraviolet inactivation and excision repair in
Bacillus subtilis, I. Construction and characterization of a transformable eightfold auxotrophic strain and two ultraviolet-sensitive derivatives. Mutat. Res, 15 (1972) 1-10.
Bron, S. and Luxen, E.: Segregational instability of pUBll0-derived
recombinant plasmids in Bacillus subtilis. Plasmid 14 (1985) 235-244.
Bron, S., Bosma, P., Van Belkum, M. and Luxen, E.: Stability fun~:tion
in the Bacillus subtilis plasmid pTAI060. Plasmid 18 (1987) 8-15.
Bron, S., Luxen, E. and Swart, P.: Instability of recombinant pUB110
plasmids in Bacillus sublilis: plasmid-encoded stability function and
effects of DNA inserts. Plasmid 19 (1988) 231-241.
Brosius, J., Dull, T.J., Sleeter, D.D. and Noller, H.F.: Gene organization
and primary structure of a ribosomal RNA operon from £scherichia
coil J. Mol. Biol. 148 (1981) 107-127.
Ehrlich, S.D., Noirot, Ph., Petit, M.A., Janni~re, L., Michel, B. and te
Riele, H.: Structural instebility ofBacillus sublilis plasmids, la Setlow,
J.K. and Hoilaender, A. (Eds.), Genetic Engineering Vol. 8. Plenum
Press, New York, 1986, pp. 71-83.
Green, C.J., Stewart, G.C., Hollis, M.A., Void, B.S. and Bolt, K.F.:
Nucleotide sequence of the Bacillus subtilis ribosomal RNA operon
rrnB. Gene 37 (1985) 261-266.
Gruss, A. and Ehrlich, S.D.: Insertion of foreign DNA into plasmids from
Gram-positive bacteria induces formation of high-molecular-weight
plasmid multimers. J. Bacteriol. 170 (1988) 1183-1190.
Gruss, A. and Ehrlich, S,D.: The family of highly interrelated singlestranded deoxyribonucleic acid plasmids. Microb. Rev, 53 (1989),
231-241.
Gryczan, T.J.: Molecular cloning in Bacilh, s subtilis, in Dubnau, D. (Ed.),
The Molecular Biology of the Bacilli. Academic Press, New York,
1982, pp. 307-327.
Haima, P,, Bron, S, and Venema, O.: The effect ofrestriction on shotgun
cloning and plasmid arability in Bacillus subillis Marburg, Mol. Oen.
Genet. 209 (1987) 335-342.
Haima, P., Van Sinderen, D., Schotting, H.0 Bron, S. and Venema, G.:
Development of a p.galactosidase ~¢.complementation system for
molecular cloning in Bacillus subtiUs. Gene 86 (1990) 63-69.
Haget, P,W. and Rabinowitz, J.C.: Translational specificity in Bacillus
subtilis. In Dubnau, D. (Ed.), The Molecular Biology of the Bacilli.
Academic Press, New York, 1985, pp. 1-31.
Ish-Horowicz, D. and Burke, F.J.: Rapid and efficient cosmid cloring.
Nucleic Acids Res. 9 (1981) 2989-2998.
Janni~re, L. and Ehrlich, S.D.: Recombination between short repeated
sequences is more frequent in plasmids than in the chromosome of
Bacillus subtilis. Mol. Gen. Genet. 210 (1987) ! 16-121.
Janni~re, L., Brugnd, C. and Ehrlich, S.D.: Structurally stable Bacillus
subtilis cloning vectors. Gene 87 (1990) 53-61.
Kok, J., Van der Vossen, J.M.B.M. and Venema, G.: Construction of
plasmid cloning vectors for lactic streptococci which also replicate in
Bacillus sublil/s and Eschenchia co//. Appl. Environ. Microb. 48 (1984)
726-731.
Michel, B., Palla, E., Niaudet, B. and Ehrlich, S.D.: DNA cloning in
Bacillus subt~, III. Efficiency of random segment cloning and insertional inactivation vectors. Gene 12 (1980) 147-154.
Maniatis, T., Fritsch, E.F. and Samhrook, J.: Molecular Cloning. A
Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY, 1982.
Miller, J.H.: Experiments in Molecular Genetics. Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY, 1982.
Norrander, J., Kempe, T. and Messing, J.: Construction ofimproved M 13
vectors using oligodeoxynuclcotide-directed mutagenesis. Gene 26
(1983) 101-106.
Piggot, PJ. and Hoch, J.A.: Revised genetic linkage map of Bacillus
sublilis. Microb. Rev. 49 (1985) 158-179.
Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain
terminating inhibitors. Proc. Natl. #,cad. Sci. USA 74 (1977)
5463-5467.
Sharp, P.M., Cowe, E., Higgins, D.G., Shields, D.C., Wolfe, K.H. and
Wright, F.: Codon usage patterns in Esc~richia coil, Bacillus sub61is,
Saccharomyces cere~siae, Schizosaccharomyces pombe, Drosophila me.
lanogaster and Homo sapiens; a review of the considerable withinspecies diversity. Nucleic Acids Res. 16 (1988) 8207-821 !.
Shimotsu, H., Kawamura, F., Koboyashi, Y. and Saito, H.: Early sporulation gene spoOF', nucleotide sequence and analysis ofgene product.
Proc. Natl. #,cad. Sci. USA 80 (1983) 658-662.
Takeshita, S., Sato, M., Toba, M., Masahashi, W. and HashimotoGotoh, T.: High-copy-number and low-copy-number plasmid vectors
for lacZ~.complementat]on and chloramphenicol- or kanamycinresistance selection. Gene 61 (1987) 63-74.
Uozumi, T., Hoshino, T., Miwa, K., Horinouchi, S., Beppu, T. and
Arima, K.: Restriction and modification in Bacillus species. Genetic
transformation of bacteria with DNA from different species, part !,
Mol. Gen, Genet, 152 (1977) 65-69.
Van der Vossen, J.M.B.M., Van der Lelie, D. and Venema, G.: Isolation
and characterization of Streptococcus cremo~ WG2-specific promoters. Appl. Environ. Micmb. 53 (1987) 2452-2457.
Vieira, J. and Messing, J.: The pUC plasmids, an M i 3mpT-derived system
for insertion mutagenesis and sequencing with synthetic universal
primers. Gene 19 (1982) 259-268.
Viret, J.-F. and Alonso, J.C.: Generation of linear multigenome-length
plasmid molecules in Bacillus subtilis. Nucleic Acids Res. 15 (1987)
6349-6367.
Weinstock, G.M., Berman, M.L. and Silhavy, TJ.: Chimeric genes with
p.gelactosidase, in Papas, T.S., Rosenberg, M. and Chirikjian, J.G.
(Eds.), Expression of Cloned Genes in Procaryotic and Eucaryotic
Vectors. Elsevier, New York, 1983, pp. 27-64.
Williams, D.M., Schoner, R.G., Duvall, E.J., Preis, L.H. and Lovett, P.S.:
Expression of Escherichta coil trp genes and the mouse dihydrofolate
reductase gene cloned in Bacillus suMilis. Gene 16 (1981) 199-206.