Journal
of General Virology (2001), 82, 3099–3106. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Evidence for RNA-mediated defence effects on the
accumulation of Potato leafroll virus
Hugh Barker,1 Kara D. McGeachy,1 Eugene V. Ryabov,1† Uli Commandeur,2 Mike A. Mayo1
and Michael Taliansky1
1
Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK
Aachen University of Technology (RWTH), Institute for Biology VII, Molecular Biotechnology, Worringerweg 1, D-52074 Aachen,
Germany
2
In plants infected with Potato leafroll virus (PLRV), or other luteoviruses, infection is very largely
confined to cells in the vascular system. Even in tobacco plants transformed with PLRV full-length
cDNA, in which all mesophyll cells should synthesize infectious PLRV RNA transcripts, only a
minority of the mesophyll cells accumulate detectable amounts of virus. We have explored this
phenomenon further by transforming a better PLRV host, Nicotiana benthamiana, with the same
transgene, by superinfecting transformed plants with Potato virus Y and by producing tobacco
plants in which cells contained both PLRV cDNA and DNA encoding the P1/HC-Pro genes of the
potyvirus Tobacco etch virus. A greater proportion of cells in superinfected plants or in doubly
transgenic plants accumulated PLRV than did in singly transgenic tobacco plants. However, most
cells in these plants did not accumulate virus. To investigate restriction of the multiplication of
viruses containing PLRV sequences, transgenic plants were infected with a chimeric virus that
consisted of Tobacco mosaic virus (TMV) containing genes for either the coat protein (CP) of PLRV
or jellyfish green fluorescent protein (GFP) in place of the TMV coat protein. The virus that encoded
PLRV CP spread more slowly and accumulated less extensively than did the virus that expressed
GFP. The results support the suggestion that an RNA-mediated form of resistance that resembles
post-transcriptional gene silencing operates in non-vascular cells and may be part of the
mechanism that restricts PLRV to vascular tissue in conventionally infected plants.
Introduction
Like other luteoviruses, Potato leafroll virus (PLRV) cannot
be transmitted to virus-free plants by mechanical inoculation.
In the natural situation, PLRV is transmitted by aphid vectors
that introduce particles into the vascular tissue of plants where
PLRV multiplies and remains largely restricted within phloem
tissue. Barker (1987) and van den Heuvel et al. (1995) have
shown that a very small proportion of non-phloem cells of
PLRV-infected plants of Nicotiana clevelandii and potato can
contain virus particles. This spread into non-phloem tissue can
be enhanced if plants are co-infected with certain other viruses
(Atabekov et al., 1984 ; Barker, 1987, 1989). These findings
Author for correspondence : Hugh Barker.
Fax j44 1382 562 426. e-mail H.Barker!scri.sari.ac.uk
† Present address : Horticulture Research International-East Malling,
West Malling, Maidstone, Kent ME19 6BJ, UK
0001-7910 # 2001 SGM
suggest that the PLRV is normally restricted to phloem tissue
because the virus lacks movement functions that can operate in
epidermal and mesophyll cells (see for review, Taliansky &
Barker, 1999), and\or because PLRV cannot suppress putative
host defence responses in non-vascular tissues (Voinnet et al.,
1999 ; Waterhouse et al., 1999). Complementation and enhancement of PLRV movement by co-infecting viruses is
thought to result from the supply of either of these functions.
PLRV does multiply in tobacco and potato mesophyll
protoplasts that have been inoculated in vitro (Barker &
Harrison, 1982 ; Miller & Mayo, 1991), and it has been
proposed (Harrison & Mayo, 1983) that isolated protoplasts
lack host defence responses that operate in intact tissues to
prevent PLRV movement and multiplication.
Tobacco and potato plants have been transformed with a
full-length (biologically active) cDNA copy of the PLRV
genome by Franco-Lara et al. (1999). Although all cells of these
transformed plants should have produced infective RNA by
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:07:21
DAJJ
H. Barker and others
transcription, only a very small proportion accumulated
detectable amounts of the virus. Transgenic tobacco and
potato differed in that much more PLRV accumulated in
transgenic potato than in equivalent infected non-transgenic
plants, whereas in transgenic and infected non-transgenic
tobacco plants the amounts of PLRV were similar. It was
suggested that the majority of cells in transgenic plants did not
accumulate PLRV because they were expressing some form of
resistance to the establishment of infection (Franco-Lara et al.,
1999).
Recently, it was shown that resistance to PLRV multiplication in non-vascular tissues can be overcome when
plants are also infected with umbraviruses. Thus, PLRV was
mechanically transmissible when plants were inoculated with
PLRV particles mixed with extracts of plants infected with Pea
enation mosaic virus-2 (PEMV-2) or another umbravirus,
Groundnut rosette virus (GRV) (Mayo et al., 2000). This effect
involves limited movement in mesophyll tissues and loading
into phloem in inoculated leaves, followed by unloading from
phloem to infect mesophyll tissues in systemically infected
leaves (Ryabov et al., 2001). The same effect was obtained
when PLRV particles were mixed with extracts of plants
infected with a recombinant Cucumber mosaic virus (CMV) that
expressed the ORF4-encoded movement protein (MP) of
GRV, but not if the CMV 2b gene, which functions as a
suppressor of gene silencing (Brigneti et al., 1998), had been
made non-translatable. It was suggested by Ryabov et al.
(2001) that PLRV can accumulate and spread in mesophyll
tissues when (i) some form of RNA-mediated defence (RMD),
possibly involving post-transcriptional gene silencing (PTGS),
is blocked and (ii) cell-to-cell movement function is complemented. This suggestion is supported by results reported
recently by Savenkov & Valkonen (2001). They showed that
another gene silencing suppressor, helper-component proteinase (HC-Pro) of the potyvirus Potato virus A, can enhance
accumulation of PLRV in phloem tissues, although it cannot
mediate unloading of PLRV from the phloem.
In this paper we report results of experiments to examine in
more detail the restriction on virus accumulation in transgenic
plants that express a full-length cDNA copy of the PLRV
genome. We show that expression of HC-Pro can dramatically
enhance the accumulation of PLRV, a result that reinforces the
suggestion that PTGS-like RMD is involved in limiting the
accumulation of PLRV in both phloem and mesophyll tissues.
Methods
Transgenic tobacco plants and hybridization. Transgenic
tobacco plants were as follows : line AW3 contained the full-length
genome of PLRV as described by Franco-Lara et al. (1999) ; lines U6B and
X-27-8 contained Tobacco etch virus (TEV) P1\HC-Pro in cvs Havana 425
and Xanthi, respectively, as described by Carrington et al. (1990) and
Mallory et al. (2001), respectively. Crosses were made in Dundee,
Scotland, UK, using AW3 plants as female parents and pollen samples
from plants of U6B and X-27--8 grown in South Carolina, USA ; pollen
DBAA
was used within a week of arrival. Hybridizations were made using
standard procedures after emasculation of the AW3 flowers. Control
crosses were made by using pollen from plants not containing TEV
P1\HC-Pro, namely Havana 425 plants transformed with ‘ empty ’ vector
for U-6B or non-transformed cv. Xanthi plants for line X-27-8.
Transformation of Nicotiana benthamiana. Pieces of N.
benthamiana stem tissue were transformed as described by Benvenuto et
al. (1991) using Agrobacterium tumefaciens containing plasmid pBNUP110
as described by Franco-Lara et al. (1999). Plasmid pBNUP110 contains a
full-length cDNA copy of the genome of PLRV under the transcriptional
regulation of the 35S promoter from Cauliflower mosaic virus. Seven
rooted plantlets (T generation) were transferred to an aphid-proof
!
glasshouse kept at about 20 mC, their flowers were allowed to selffertilize, and seed was collected. T seedlings from four of the T plantlets
"
!
were grown and tested to determine if they were transgenic by PCR or
by ELISA (see below). For PCR, total leaf DNA was prepared essentially
as described by Reavy et al. (1997), and tested for the presence of PLRV
cDNA by PCR amplification using oligonucleotide primers designed to
amplify sequences within the PLRV coat protein (CP) gene (Franco-Lara
et al., 1999).
Inoculation of plants with viruses. A culture of PVYO (an isolate
kindly provided by the Scottish Agricultural Science Agency, East Craigs,
Edinburgh, Scotland, UK) was maintained in Nicotiana tabacum by manual
transmission. Test plants of N. tabacum and N. benthamiana were infected
by manual inoculation. Non-transgenic WT plants were inoculated with
PLRV by exposure for 3 days to five viruliferous Myzus persicae that had
been reared on PLRV-infected potato, cv. Maris Piper, as described by
Franco-Lara et al. (1999).
Plasmids, generation of chimeric cDNA constructs and in
vitro transcription. The plasmid pTMV(∆CP)-GFP, in which the CP
gene of Tobacco mosaic virus (TMV) was deleted and replaced by the
DNA encoding jellyfish green fluorescent protein (GFP), was generated
from a full-length cDNA clone of TMV [TMV(30B)] and has been
described earlier (Ryabov et al., 1999).
Plasmid TMV(∆CP)PLRV-CP was designed to produce infectious
RNA transcripts of TMV with the TMV CP gene replaced by the CP
gene from PLRV. A fragment containing the PLRV CP gene was
amplified by PCR by using the PLRV cDNA clone pBNUC110 as a
template (Franco-Lara et al., 1999) and oligonucleotides 5h GGCCTTAATTAAATGAGTACGGGTCGTGG 3h and 5h GCATCTCGAGTTACTATTTGGGGTTTTGCAAAG 3h as primers. It was cloned in the
TMV-based vector, TMV(∆CP), described by Ryabov et al. (1999),
between the PacI and XhoI sites such that PLRV CP expression was driven
by the CP gene subgenomic promoter.
TMV-based plasmids were linearized by digestion with the restriction
enzyme KpnI and in vitro transcripts were synthesized with T7 RNA
polymerase using the mMESSAGE mMACHINE T7 Kit (Ambion).
Transcripts were inoculated directly to leaves of N. benthamiana plants by
rubbing carborundum-dusted leaves with the transcription products
derived from 0n2 µg of plasmid template.
Assay of PLRV by ELISA and tissue printing. The accumulation
of PLRV antigen was assessed and quantified by ELISA as described by
Franco-Lara & Barker (1999). Immunoprints of leaf lamina, from which the
lower epidermis had been removed by peeling with forceps, were made
as described by Franco-Lara et al. (1999). In developed prints, the
presence of PLRV was apparent as discrete spots (stained cells) of purple
indoxyl precipitate. These were counted and photographed at low
magnification in a Leica MZ FLIII microscope. The number of cells per
unit area of leaf was estimated by counting the number of green spots of
cell contents imprinted on the membrane.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:07:21
RNA-mediated defence effects on PLRV accumulation
Detection of GFP. Plants were illuminated with long-wavelength
UV light and photographed as described previously (Baulcombe et al.,
1995 ; Oparka et al., 1995).
Results
N. benthamiana expressing PLRV-FL cDNA
Previous work with plants transformed with full-length
PLRV cDNA used tobacco and potato plants (Franco-Lara et
al., 1999). In current work, N. benthamiana was transformed in
order to investigate a Nicotiana species known to support
greater accumulation of PLRV than tobacco and, unlike
tobacco, to be susceptible to a chimeric virus used in our
experiments.
PLRV (detected by ELISA using anti-CP antibodies)
accumulated in leaf tissue of T seedlings from the four lines of
"
N. benthamiana tested ; line CW1 was selected for all further
tests. Although leaf extracts from the majority of individual
CW1 T seedlings gave a strong signal in ELISA for PLRV CP,
"
some seedlings gave signals that did not differ from those
given by non-transgenic N. benthamiana. In one experiment, 48
of 67 CW1 T seedlings were found to be PLRV-infected and
"
PCR tests on DNA extracts showed that these PLRV-infected
seedlings contained DNA encoding the CP gene of PLRV,
whereas PLRV-free seedlings did not. In this and other tests the
ratio between PLRV-infected and PLRV-free (transgenic : nontransgenic) plants was always close to this ratio of 3 : 1, and we
conclude that line CW1 contains a single locus of integrated
T-DNA in which the PLRV-FL transgene is active.
PLRV accumulation in transgenic and PLRV-infected
WT N. benthamiana
The PLRV-infected T plants of line CW1 grew more
"
slowly and were smaller than uninfected WT plants, but there
were no other symptoms of infection. Similar stunting effects
were observed in WT N. benthamiana plants that had been
inoculated by viruliferous aphids, but there were no other
symptoms of infection.
In all subsequent experiments, ELISA of CW1 seedlings
was done prior to further experimentation and non-infected
plants (assumed to be non-transgenic segregants) were discarded. PLRV accumulation in leaf tissues of CW1 plants was
assessed by ELISA and immunoprinting and, in some experiments, was compared with that in infected WT N. benthamiana
plants. In contrast to earlier results with potato plants (FrancoLara et al., 1999), there were no distinguishing trends among
samples taken from different leaf positions or from plants of
different ages. ELISA values were little different between CW1
and infected WT plants [mean A of 0n71 (n l 33) and 0n68
%!&
(n l 28) respectively at a dilution of 1 g in 10 ml extraction
buffer]. However, ELISA values for samples from transgenic
N. benthamiana CW1 plants (n l 12) were about 5-fold
greater than those for samples from transgenic tobacco AW3
plants (n l 6).
Comparison of PLRV accumulation in mesophyll cells
of N. benthamiana and tobacco
Immunoprinting of leaf tissue from CW1 and PLRVinfected WT N. benthamiana plants detected antigen in many
cells of tissue that appeared to be mesophyll. There were
means of 2n46, 12n7 and 10n8 cells that contained detectable
PLRV per cm# in prints of leaf tissue from AW3 (tobacco),
CW1 (N. benthamiana) and PLRV-infected WT N. benthamiana
respectively (approx. 70 cm# of leaf immunoprints were
examined from each plant type). Such cells were not obviously
associated with a vein. Some tracks left by veins could be seen
and stained cells were associated with some of these [for
example, see Fig. 2 (f ) in Franco-Lara et al. (1999)]. In CW1 and
PLRV-infected WT N. benthamiana, about 25 % of the stained
cells occurred singly and were irregularly distributed but most
were in clusters of between two and six adjacent cells (Fig. 1 a,
b, c) and a few clusters contained up to 20 cells (Fig. 1 d ). In
AW3 leaves, there were fewer infected cells and clusters of
infected cells were less numerous and smaller, but in a few areas
there were many. In one area of an AW3 leaf approximately
15 mm across, about 1 in 20 of the cells were infected. In other
areas only about 1 in 5000 of the cells were infected.
Effects of inoculation with PVY on PLRV accumulation
CW1 plants were inoculated with PVY and, 12 days after
inoculation, systemically infected leaves were tested by ELISA
and immunoprinting. The PLRV titre in these leaves was about
5-fold greater and the number of infected mesophyll cells was
about 4-fold greater than in uninoculated control CW1 plants
(approximately 1 in 24 mesophyll cells were infected in PVYinfected CW1 plants, and in some areas of the tissue up to 1 in
10 mesophyll cells were stained). However, infected cells in
these areas were interspersed with unstained cells, and the
appearance was different from that of clusters in immunoprints
of leaves inoculated with TMV(∆CP)PLRV-CP in which there
were few unstained cells in infected areas (see below).
After inoculation of AW3 plants with PVY, the amounts of
PLRV in leaf tissue samples were compared with those in
leaves of non-inoculated plants. PLRV titre changed little
between 13 and 38 days post-inoculation (p.i.) (Fig. 2) ; the
mean titres were 240 ng\g leaf in non-inoculated plants, and
1600 ng\g leaf in PVY-infected plants. From immunoprints of
the non-inoculated AW3 plants, 1 in 3000 mesophyll cells
were found to be stained, whereas in PVY-infected AW3
plants, 1 in 625 mesophyll cells contained PLRV and clusters of
up to four infected cells were found. Thus potyvirus infection
resulted in a 5- to 6-fold enhancement in the accumulation of
PLRV in the transgenic plants. This raised the possibility that
PLRV in the transgenic line was limited by PTGS.
Effects of TEV P1/HC-Pro on PLRV accumulation
The experiment above used virus infection to elicit the
production in transgenic cells of HC-Pro. In more direct tests,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:07:21
DBAB
H. Barker and others
Fig. 1. Immunoprints of leaf mesophyll tissue developed for PLRV after removing the lower epidermis. Magnification bar in
(a) is for (a)–(g) and represents 0n5 mm. Prints of half leaves (approx. 40i20 mm) are shown in (h)–(k). (a) PLRV-infected
WT N. benthamiana showing infected cells, some dispersed and some in pairs ; (b) PLRV-infected WT N. benthamiana showing
a typical cluster of six cells ; (c) CW1 N. benthamiana leaf showing a typical cluster of five cells ; (d ) CW1 N. benthamiana leaf
showing a typical cluster of approx. 20 cells ; (e) WT non-inoculated N. benthamiana ; (f ) PLRV-infected WT N. benthamiana 4
days p.i. with TMV(∆CP)PLRV-CP ; (g) WT N. benthamiana 8 days p i. with TMV(∆CP)PLRV-CP ; (h) WT non-inoculated N.
benthamiana ; (i) WT N. benthamiana 8 days p.i. with TMV(∆CP)PLRV-CP ; ( j) PLRV-infected WT N. benthamiana 8 days p.i.
with TMV(∆CP)PLRV-CP ; (k) CW1 N. benthamiana 8 days p.i. with TMV(∆CP)PLRV-CP.
DBAC
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:07:21
RNA-mediated defence effects on PLRV accumulation
Table 1. PLRV titre in leaf samples from progeny plants
from crosses between AW3 and P1/HC-Pro lines U-6B
and X-27-8
Cross between AW3
plants as female
parents and pollen
from other
sources
AW3iWT Havana 425
AW3iU6B
AW3iWT Xanthi
AW3iX-27-8
Fig. 2. PLRV titre (ng/g leaf) in leaf tissue samples from AW3 plants either
inoculated with PVY (open bars) or non-inoculated (hatched bars) ;
standard errors shown. Titre was measured by ELISA at 13, 20 and 38
days p.i. on samples from 9 AW3 plants inoculated with PVY and 11 noninoculated AW3 plants.
PLRV titre* (ng/g leaf)
SE
168
1467
292
4129
p12
p333
p49
p830
* PLRV titre in leaf samples was measured in six plants from each
progeny at the 6\7 leaf stage.
that expression of HC-Pro diminishes, at least in part, the
resistance to PLRV accumulation in the mesophyll.
we used plants transformed so as to produce high levels of the
P1\HC-Pro of the potyvirus TEV. Seedling progenies from
crosses between AW3 (PLRV-FL) and either U6B or X-27-8
(TEV P1\HC-Pro) or between AW3 and pollen from control
non-transgenic tobacco cvs. Havana 425 or Xanthi were grown
and tested by ELISA for PLRV. From each cross, approximately
50 % of the plants gave positive ELISA signals. This ratio of
PLRV-infected to virus-free plants is consistent with line AW3
containing a single active copy of the PLRV-FL transgene. Our
previous studies (Franco-Lara et al., 1999) showed that the
AW3 plants contained the PLRV-FL transgene at two
independent loci, but one of these loci seems to be inactive for
the expression of PLRV.
ELISA-positive plants were selected and the PLRV contents
of plants from the different crosses were compared. The mean
PLRV titres in progeny containing the PLRV-FL and TEV
P1\HC-Pro transgenes were about 10-fold greater than in
plants from control crosses (Table 1). Immunoprints were made
from leaves (mesophyll and sections of mid-vein) of plants
from the progeny AW3iU6B. These showed that there were
many more PLRV-infected cells in the mesophyll and phloem
tissue of the progeny of AW3iU6B than in the progeny of
AW3iHavana 425. Thus, in the progeny plants of
AW3iHavana 425, only 1 in 25 000 mesophyll cells were
infected, whereas 1 in 55 mesophyll cells from progeny plants
of AW3 x U6B were infected. Many stained cells were in small
clusters of up to six. The numbers of PLRV-infected phloem
cells per mid-vein section were 1n5 for AW3iHavana 425
plants and 13n2 for AW3iU6B plants. Thus expression of
TEV P1\HC-Pro resulted in an increase in the amounts of
PLRV produced in both mesophyll and phloem tissues. This
result is consistent with previous experiments in which HC-Pro
was produced as a result of potyvirus infection and suggests
Inoculation of N. benthamiana with TMV(∆CP)PLRV-CP
As an alternative system for examining PTGS-like effects
on the accumulation of PLRV RNA sequences, we used the
chimeric virus TMV(∆CP)PLRV-CP in which the CP gene of
TMV RNA had been replaced by the CP gene of PLRV. This
virus accumulates in N. benthamiana but not in N. clevelandii or
N. tabacum. It did not move systemically, probably because
the CP is essential for long-distance movement of TMV
(Carrington et al., 1996) and because PLRV CP is unable to
provide this function.
When TMV(∆CP)PLRV-CP was inoculated to WT N.
benthamiana plants, large areas (up to 15 mm across) containing
many stained cells were visible by eye at 4 days p.i., and at 8
days p.i. approximately 80 % of the leaf area (approx. 70 cm# of
immunoprints examined) was strongly stained (Fig. 1 i). By
microscopy, it was possible to see that the majority of
individual cells in these visibly stained areas were strongly
stained with indoxyl precipitate (Fig. 1 g). These results
suggested that virus had moved from cell to cell in these
leaves. The result was different when TMV(∆CP)PLRV-CP
was inoculated to PLRV-infected WT N. benthamiana or CW1
plants. In these plants, by 4 days p.i. antigen-containing cells
were in clusters of up to approximately 200 cells (Fig. 1 f ). At
8 days p.i. the areas of staining were much larger and clusters
of up to several hundred cells could be seen in the microscope,
and by eye approximately 35 % of the leaf area was stained
(Fig. 1 j, k ; 160 cm# of immunoprints examined). As a control,
we inoculated plants with the chimera TMV(∆CP)-GFP in
which the TMV CP gene was replaced by sequences encoding
GFP. In these plants, and in contrast to results with
TMV(∆CP)PLRV-CP, there was no difference in virus dis-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:07:21
DBAD
H. Barker and others
tribution (measured as that of GFP fluorescence) between WT
N. benthamiana and CW1 N. benthamiana. These results suggest
that the delay in spread of TMV(∆CP)PLRV-CP in inoculated
leaves of PLRV-infected WT N. benthamiana and CW1 plants
occurred because of specific resistance against the virus
containing PLRV sequences.
Discussion
A small proportion of mesophyll cells (about 2 %) in
transgenic CW1 N. benthamiana contained detectable amounts
of PLRV. Surprisingly, we also found that approximately 2 %
of mesophyll cells in PLRV-infected WT N. benthamiana that
had been inoculated by aphids also contained virus. The titres
of PLRV, estimated by ELISA, and the extent of mesophyll cell
infection were about the same in CW1 plants and in PLRVinfected WT N. benthamiana. Franco-Lara et al. (1999) found
very few stained mesophyll cells (less than 1 in 40 000) in
tobacco plants transformed with the same PLRV-FL transgene,
but no stained mesophyll cells were found in PLRV-infected
WT tobacco plants. Because stained mesophyll cells occurred
in WT N. benthamiana plants inoculated with PLRV, we assume
that such cells were infected following cell-to-cell movement
of PLRV from cells within vascular tissue, as was shown by
Barker (1987) and van den Heuvel et al. (1995) in N. clevelandii
and potato respectively. In CW1 plants, mesophyll cells could
be infected via a similar route, or as a result of transcript of the
full-length PLRV transgene initiating infection in particular
cells, as was found in tobacco by Franco-Lara et al. (1999).
However, because similar numbers of infected mesophyll cells
were detected in transgenic and WT plants, it seems likely that
the majority of stained mesophyll cells in CW1 plants became
infected via the same route, as do the cells in WT plants
inoculated with PLRV.
Immunoprints of leaves from CW1 and PLRV-infected WT
N. benthamiana showed that a large proportion of stained
mesophyll cells were located in clusters (groups of between 2
and 20 cells). This finding prompted a re-examination of AW3
tobacco plants because such clusters were not detected by
Franco-Lara et al. (1999). In immunoprints of leaves from AW3
plants, we found that a proportion of stained mesophyll cells
were also located in small clusters, although such clusters were
generally not as large as those in N. benthamiana leaves.
Furthermore, after examining a large area of immunoprints
from AW3 leaves (250 cm#), it was apparent that stained cells
were not evenly distributed, and that in some areas of some
leaves stained cells were much more numerous than in other
areas. For example, in a small area (approx. 5 mm across) in one
leaf print, about 1 in 20 of the cells contained detectable PLRV.
However, stained cells were interspersed with apparently noninfected cells. Similar clusters may have been present in the
tobacco plants assessed by Franco-Lara et al. (1999) but not
identified because the sampled tissues contained few cell
DBAE
clusters. In contrast, in N. benthamiana leaves stained cells were
distributed relatively evenly.
A similar effect has been demonstrated by Angell &
Baulcombe (1997), who transformed plants with amplicons of
the non-phloem-limited virus Potato virus X (PVX). The
amplicons comprised the intact PVX genome modified to carry
the β-glucuronidase (GUS) reporter gene. Angell & Baulcombe
(1997) suggested that the transgenic plants carrying these
constructs displayed several phenotypes attributable to PTGS,
one of which was that expression of GUS activity (and
apparently of PVX) was restricted to single cells, or small
groups of cells. These plants thus resemble those of CW1 or
AW3 that, although presumably synthesizing full-length PLRV
transcript RNA in all cells, accumulated virus in only a few. As
discussed by Franco-Lara et al. (1999), this may indicate that a
resistance mechanism is induced in these transgenic plants that
restricts the establishment of infection. Our findings indicate
some characteristics of this resistance and suggest that it
results, at least in part, from PTGS.
This idea was further supported by experiments with the
chimeric virus TMV(∆CP)PLRV-CP. When this virus was
inoculated to WT plants, virus multiplication was extensive in
inoculated leaves ; infected areas were visible by 4 days p.i., and
about 80 % of the leaf area was infected by 8 days p.i. By
contrast, when CW1 and PLRV-infected WT N. benthamiana
plants were inoculated with TMV(∆CP)PLRV-CP, virus spread
and accumulation was slower, and, although by 8 days p.i.
many cells were infected, only 35 % of the leaf area was
infected. This delay (partial resistance) seems to be PLRV
sequence-specific, because TMV(∆CP)-GFP (which lacked
PLRV CP sequences) replicated and spread rapidly in infected
and PLRV-free tissues.
Although in many instances transgenes are designed to
maximize expression, transgene expression can be downregulated by PTGS. PTGS is manifested as the reduction in
steady-state levels of specific RNAs after expression of
exogenously introduced homologous nucleotide sequences
(Marathe et al., 2000 ; Ding, 2000 ; Vance & Vaucheret, 2001).
PTGS involves the systemic spread of a silencing signal that
directs sequence-specific RNA degradation. Recently, it has
been shown that PTGS and virus resistance are related
phenomena. Plant viruses can both induce and be the targets of
PTGS (Ratcliff et al., 1997 ; Covey et al., 1997). Indeed, Angell
& Baulcombe (1997) have shown that replicating viral RNA
can induce PTGS. Several aspects of our observations suggest
that the phenomena we report here resemble those of PTGS.
Thus, in plants transformed with the PLRV-FL transgene, only
a few cells accumulated detectable amounts of PLRV, even
though infectious PLRV transcript was presumably produced
in all cells. Possibly the PLRV transgene was transcribed and
PLRV replicated first in a few cells and after that a silencing
signal induced in these cells spread to other cells in the plant,
where it prevented further accumulation of PLRV. It is also
possible that such a process could contribute to the restriction
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:07:21
RNA-mediated defence effects on PLRV accumulation
of PLRV accumulation to very few cells after movement out of
phloem tissue in infected WT plants.
In either WT N. benthamiana infected by aphids or CW1 N.
benthamiana, most of the cells that contained PLRV were in
small groups. Co-infection of CW1 and AW3 plants with PVY,
or crossing AW3 plants with TEV P1\HC-Pro transgenic
plants, increased the number of PLRV-infected cells. Although
in these circumstances the clusters of infected cells remained
fairly small, these clusters were more numerous than those in
plants not infected with PVY or not containing TEV P1\HCPro. These clusters of cells may represent areas of tissue in
which the putative silencing effect has been downregulated by
a signal emanating from some of the first cells to support virus
replication. Such clusters of cells were present in AW3 tobacco,
but with the rare exception of a couple of relatively large areas
of staining, clusters were smaller than those in N. benthamiana.
It is possible that a small increase in anti-PTGS activity has a
greater effect in N. benthamiana than in tobacco plants.
It has been generally accepted that some plant viruses, such
as potyviruses, can suppress PTGS (Anandalakshmi et al.,
1998 ; Brigneti et al., 1998 ; Kasschau & Carrington, 1998), and
potyviral HC-Pro protein has been identified as a specific
suppressor of PTGS (Anandalakshmi et al., 1998 ; Brigneti et al.,
1998). Recently Savenkov & Valkonen (2001) showed that
HC-Pro protein expressed in PLRV-infected transgenic plants
enhanced titres of PLRV in the phloem. Similarly, the levels of
PLRV accumulation and the numbers of cells that contained
PLRV in AW3 and CW1 plants were significantly increased
when plants were co-infected with the potyvirus PVY.
Furthermore, in the progeny of crosses between AW3 plants
and tobacco plants that contained sequence encoding TEV
P1\HC-Pro, the accumulation of PLRV and the number of
infected cells were increased between 10- and 20-fold. These
results show that in AW3 and CW1 plants there is resistance
to PLRV replication that is also partially alleviated in mesophyll
tissues by the presence of potyviral P1\HC-Pro. Recently we
have demonstrated that another silencing suppressor, 2b
protein encoded by CMV, is able to facilitate multiplication of
PLRV in mesophyll tissues (Ryabov et al., 2001). Taken
together, these results (Savenkov & Valkonen, 2001 ; Ryabov
et al., 2001 ; and the present work) strongly suggest that the
observed increases in accumulation of PLRV in certain
mesophyll cells are the result of suppression of PTGS.
However, even though the PTGS-like silencing was
suppressed in mesophyll cells, most remained apparently virusfree. The CMV silencing suppressor protein 2b can only assist
PLRV to spread in mesophyll tissue when supplemented by an
umbravirus movement protein (Ryabov et al., 2001), indicating
that cell-to-cell movement of PLRV is also defective in these
tissues. Thus, either suppression of silencing was incomplete
because of the absence of an HC-Pro effect on systemic
silencing, as suggested by Mallory et al. (2001), or an additional
resistance mechanism also operated, or both. It seems unlikely
that PLRV moves extensively from cell to cell in mesophyll\
epidermis tissues forming areas (groups) of infected cells
because PLRV, like other luteoviruses, lacks a cell-to-cell
movement function in mesophyll\epidermis. Our results are
consistent with PLRV being principally confined to the phloem
of conventionally infected plants because of a combination of
a failure to suppress gene silencing (Voinnet et al., 1999 ;
Waterhouse et al., 1999) and a lack of a cell-to-cell movement
function protein, as suggested by Atabekov et al. (1984) and
Barker (1989).
We are grateful to Vicki Bowman Vance of the University of South
Carolina, Columbia, USA, for pollen from transgenic plants expressing
TEV P1\HC-Pro, and for helpful suggestions and comments during the
work and preparation of the manuscript. H. B., K. D. McG., M. A. M. and
M. T. are supported by the Scottish Executive Environment and Rural
Affairs Department (SEERAD). E. V. R. gratefully acknowledges receipt of
an EMBO Fellowship. This work was performed with permission from
SEERAD under Plant Health Licences GM\127\2001 and GM\137\
2001.
References
Anandalakshmi, R., Pruss, G. J., Ge, X., Marathe, R., Mallory, A. C.,
Smith, T. H. & Vance, V. B. (1998). A viral suppressor of gene silencing
in plants. Proceedings of the National Academy of Sciences, USA 95,
13079–13084.
Angell, S. M. & Baulcombe, D. C. (1997). Consistent gene silencing in
transgenic plants expressing a replicating potato virus X RNA. EMBO
Journal 16, 3675–3684.
Atabekov, J. G., Taliansky, M. E., Drampyan, A. H., Kaplan, I. B. &
Turka, I. E. (1984). Systemic infection by a phloem-restricted virus in
parenchyma cells in mixed infection. Biologicheskie nauki 10, 28–31 (in
Russian).
Barker, H. (1987). Invasion of non-phloem tissue in Nicotiana clevelandii
by potato leafroll luteovirus is enhanced in plants also infected with
potato Y potyvirus. Journal of General Virology 68, 1223–1227.
Barker, H. (1989). Specificity of the effect of sap-transmissible viruses in
increasing the accumulation of luteoviruses in co-infected plants. Annals
of Applied Biology 115, 71–78.
Barker, H. & Harrison, B. D. (1982). Infection of potato mesophyll
protoplasts with five plant viruses. Plant Cell Reports 1, 247–249.
Baulcombe, D. C., Chapman, S. & Cruz, S. S. (1995). Jellyfish green
fluorescent protein as a reporter for virus-infections. Plant Journal 7,
1045–1053.
Benvenuto, E., Ordas, R. J., Tavazza, R., Ancora, G., Biocca, S.,
Cattaneo, A. & Galeffi, P. (1991). Phytoantibodies – a general vector
for the expression of immunoglobulin domains in transgenic plants. Plant
Molecular Biology 17, 865–874.
Brigneti, G., Voinnet, O., Li, W. X., Ji, L. H., Ding, S. W. & Baulcombe,
D. C. (1998). Viral pathogenicity determinants are suppressors of
transgene silencing in Nicotiana benthamiana. EMBO Journal 17,
6739–6746.
Carrington, J. C., Freed, D. D. & Oh, C. S. (1990). Expression of
potyviral polyproteins in transgenic plants reveals 3 proteolytic activities
required for complete processing. EMBO Journal 9, 1347–1353.
Carrington, J. C., Kasschau, K. D., Mahajan, S. K. & Schaad, M. C.
(1996). Cell-to-cell and long-distance transport of viruses in plants. Plant
Cell 8, 1669–1681.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:07:21
DBAF
H. Barker and others
Covey, S. N., Al Kaff, N. S., Langara, A. & Turner, D. S. (1997). Plants
combat infection by gene silencing. Nature 385, 781–782.
Ding, S. W. (2000). RNA silencing. Current Opinion in Biotechnology 11,
152–156.
Franco-Lara, L. F. & Barker, H. (1999). Characterisation of resistance to
potato leafroll virus accumulation in Solanum phureja. Euphytica 108,
137–144.
Franco-Lara, L. F., McGeachy, K. D., Commandeur, U., Martin, R. R.,
Mayo, M. A. & Barker, H. (1999). Transformation of tobacco and potato
with cDNA encoding the full-length genome of Potato leafroll virus :
evidence for a novel virus distribution and host effects on virus
multiplication. Journal of General Virology 80, 2813–2822.
Harrison, B. D. & Mayo, M. A. (1983). The use of protoplasts in plant
virus research. In Use of Tissue Culture and Protoplasts in Plant Pathology,
pp. 69–137. Edited by J. P. Helgeson & B. J. Deverall. Melbourne :
Academic Press.
Kasschau, K. D. & Carrington, J. C. (1998). A counterdefensive strategy
of plant viruses : suppression of posttranscriptional gene silencing. Cell
95, 461–470.
Mallory, A. C., Ely, L., Smith, T. H., Marathe, R., Anandalakshmi, R.,
Fagard, M., Vaucheret, H., Pruss, G., Bowman, L. & Vance, V. B.
(2001). HC-Pro suppression of transgene silencing eliminates the small
RNAs but not methylation or the mobile signal. Plant Cell 13, 571–583.
Marathe, R., Anandalakshmi, R., Smith, T. H., Pruss, G. J. & Vance,
V. B. (2000). RNA viruses as inducers, suppressors and targets of post-
transcriptional gene silencing. Plant Molecular Biology 43, 295–306.
Mayo, M. A., Ryabov, E., Fraser, G. & Taliansky, M. (2000). Mechanical
transmission of Potato leafroll virus. Journal of General Virology 81,
2791–2795.
Miller, J. S. & Mayo, M. A. (1991). The location of the 5h end of the
potato leafroll luteovirus subgenomic coat protein messenger-RNA.
Journal of General Virology 72, 2633–2638.
Oparka, K. J., Roberts, A. G., Prior, D. A. M., Chapman, S., Baulcombe,
D. & Santa Cruz, S. (1995). Imaging the green fluorescent protein in
plants – viruses carry the torch. Protoplasma 189, 133–141.
DBAG
Ratcliff, F., Harrison, B. D. & Baulcombe, D. C. (1997). A similarity
between viral defense and gene silencing in plants. Science 276,
1558–1560.
Reavy, B., Sandgren, M., Barker, H., Heino, P. & Oxelfelt, P. (1997). A
coat protein transgene from a Scottish isolate of potato mop-top virus
mediates strong resistance against Scandinavian isolates which have
similar coat protein genes. European Journal of Plant Pathology 103,
829–834.
Ryabov, E. V., Robinson, D. J. & Taliansky, M. E. (1999). A plant virusencoded protein facilitates long-distance movement of heterologous viral
RNA. Proceedings of the National Academy of Sciences, USA 96, 1212–1217.
Ryabov, E. V., Fraser, G., Mayo, M. A., Barker, H. & Taliansky, M.
(2001). Umbravirus gene expression helps Potato leafroll virus to invade
mesophyll tissues and to be transmitted mechanically between plants.
Virology 286, 363–372.
Savenkov, E. I. & Valkonen, J. P. T. (2001). Potyviral helper-component
proteinase expressed in transgenic plants enhances titers of Potato leaf roll
virus but does not alleviate its phloem limitation. Virology 283, 285–293.
Taliansky, M. & Barker, H. (1999). Movement of luteoviruses in
infected plants. In The Luteoviridae, pp. 69–81. Edited by H. G. Smith &
H. Barker. Wallingford : CAB International.
Vance, V. B. & Vaucheret, H. (2001). RNA silencing in plants : defense
and counterdefense. Science (in press).
van den Heuvel, J. F. J. M., de Blank, C. M., Peters, D. & van Lent,
J. W. M. (1995). Localization of potato leafroll virus in leaves of
secondarily-infected potato plants. European Journal of Plant Pathology
101, 567–571.
Voinnet, O., Pinto, Y. M. & Baulcombe, D. C. (1999). Suppression of
gene silencing : a general strategy used by diverse DNA and RNA viruses
of plants. Proceedings of the National Academy of Sciences, USA 96,
14147–14152.
Waterhouse, P. M., Smith, N. A. & Wang, M. B. (1999). Virus resistance
and gene silencing : killing the messenger. Trends in Plant Sciences 4,
452–457.
Received 8 June 2001 ; Accepted 13 August 2001
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 02:07:21