Articles in PresS. Am J Physiol Cell Physiol (May 11, 2005). doi:10.1152/ajpcell.00093.2005
1
Wnt/ -catenin signaling activates growth-control genes
during overload-induced skeletal muscle hypertrophy
Dustin D. Armstrong*#, Karyn A. Esser*#
*
#
University of Illinois Chicago, School of Kinesiology, Chicago IL 60608 USA
University of Kentucky, Dept. Physiology, Lexington KY 40536 USA
Running Head: Wnt/ -catenin signaling in skeletal muscle hypertrophy
Contact: Karyn Esser
Department of Physiology
MS508 Medical Center
800 Rose St.
Lexington, KY 40536-0298
Tel # (859) 323-8107
Fax # (859) 323-1070
Email: [email protected]
Copyright © 2005 by the American Physiological Society.
2
Abstract
-catenin is a transcriptional activator shown to regulate the embryonic, postnatal, and
oncogenic growth of many tissues. In most research to date, -catenin activation has
been the unique downstream function of the Wnt signaling pathway. However, in the
heart, a Wnt-independent mechanism involving Akt-mediated phosphorylation of GSK3 was recently shown to activate -catenin and regulate cardiomyocyte growth. In this
study, results have identified the activation of the Wnt/ -catenin pathway during
hypertrophy of mechanically overloaded skeletal muscle. Significant increases in catenin were determined during skeletal muscle hypertrophy. In addition, the Wntreceptor, mFrizzled-1, the signaling mediator Dishevelled-1, and the transcriptional coactivator, Lef-1, are all increased during hypertrophy of the overloaded mouse plantaris
muscle. Experiments also determined an increased association between GSK-3 and the
inhibitory Frat1 protein with no increase in GSK-3 phosphorylation (ser9). Finally,
skeletal muscle overload resulted in increased nuclear -catenin/Lef-1 expression and
induction of the transcriptional targets c-Myc, Cyclin D1 and Pitx2. Thus, this study
provides the first evidence that the Wnt signaling pathway induces -catenin/Lef-1
activation of growth-control genes during overload induced skeletal muscle hypertrophy.
Key Words: Lef-1, GSK-3 , Pitx2, c-Myc
3
Introduction
The Wnt pathway has been shown to be critical for skeletal muscle development (12,
51, 52). Wnt1 and Wnt3 ligands, secreted by the dorsal neural tube, induce myogenesis
during embryonic growth and Wnt activation is both necessary and sufficient to induce
myogenesis in P19 embryonic carcinoma cells (12, 21, 35). In addition to its role in
skeletal muscle development, Wnt signaling is associated with neuromuscular junction
formation, the activation of stem cells during regeneration, the regulation of muscle fiber
type, and the prevention of lipid accumulation with aging (3, 29, 47, 53). However, a
role for Wnt signaling in the regulation of adult skeletal muscle size has not been tested.
The classic identifier of Wnt signaling is the accumulation and thus, activation of catenin function (32, 59).
-catenin is a multifunctional protein that can act in the
cytoplasm to link cadherins to the actin cytoskeleton or enter the nucleus and function as
a transcription factor (7, 33, 48). In the absence of Wnt signaling, free -catenin is
phosphorylated by glycogen synthase kinase-3 (GSK-3 ) and rapidly targeted for
proteosomal degradation (2, 14, 20, 26, 27). Upon Wnt activation, Wnt ligands bind
Frizzled and low-density lipoprotein receptor-related protein-5 or -6 (LRP5 or 6) coreceptors, stimulate phosphorylation of the protein Dishevelled (Dvl), and thereby inhibit
-catenin degradation (23, 25, 34). While the exact mechanism is unknown, Dvl
phosphorylation/activation is thought to block GSK-3 activity by sequestering GSK-3
via the inhibitory protein Frat (frequently rearranged in advanced T-cell lymphomas) (6,
26, 54, 59).
4
Alternatively, GSK-3 inhibition via phosphorylation at the Ser9 site can increase catenin accumulation independent of Wnt signaling (13, 16, 49). Several signaling
pathways have been shown to induce GSK-3 phosphorylation in other cell types (22, 60,
61). However, studies of GSK-3 phosphorylation in skeletal muscle have focused on
the activation of the PI3-kinase/Akt pathway via insulin and/or insulin-like growth factor1 (IGF-1) (42, 44, 57). Interestingly, both IGF-1 signaling and Akt activation have been
linked to skeletal muscle hypertrophy while GSK-3 activity has been shown to be a
negative regulator of this process (9, 16, 42). In support of this model, Akt-mediated
GSK-3 phosporylation was shown to activate -catenin during cardiomyocyte
hypertrophy (15).
Activated -catenin is associated with cellular growth through its well-characterized
function as a transcription factor (32, 33). In the nucleus, -catenin can form a
transcriptional complex with T-cell factor/Lymphocyte-enhancement factor-1 (Tcf/Lef-1)
family members and subsequently promote expression of target genes (33, 40). Two
important transcriptional targets of active -catenin in developmental and oncogenic
growth are c-Myc and Cyclin D1 (17, 50). Besides direct transcriptional activation, catenin can induce c-Myc and Cyclin D1 indirectly through paired-like homeodomain
transcription factor2 (Pitx2) activation. Pitx2 has been shown to directly activate c-Myc
and Cyclin D1 in skeletal muscle cells exposed to Wnt/ -catenin stimulation in vitro (5).
Both c-Myc and Cyclin D1 are thought to function as cell-cycle regulators but recent
evidence suggests these proteins can regulate cell-size (18, 31, 36, 41). For example,
5
overexpression of c-Myc has been shown to be sufficient to induce hypertrophy in both
postmitotic cardiac myocytes and hepatocytes in vivo (24, 62).
The overall goal of this study was to examine the regulation of -catenin during
overload-induced skeletal muscle hypertrophy. The hypotheses tested were 1) -catenin
will be activated during overload-induced skeletal muscle hypertrophy; 2) increased catenin levels will result from phosphorylation-induced GSK-3 inhibition and not via
Wnt signaling; and 3) -catenin activation will correspond to an induction of known
target genes associated with growth control. Results of this study demonstrate that catenin is activated and its transcriptional targets are induced during skeletal muscle
hypertrophy. The Wnt pathway is implicated as the predominant mediator of -catenin
function during skeletal muscle growth because 1) several markers of Wnt pathway
activation are identified following synergist ablation and 2) the -catenin accumulation is
detected at a time in which levels of unphosphorylated GSK-3 (active GSK-3 ) are
significantly increased.
6
Materials and Methods
Induction of Skeletal Muscle Hypertrophy
All experimental procedures performed in this study were approved by the University
of Illinois at Chicago Institutional Animal Care and Use Committee. Animals were
housed in temperature- and humidity-controlled holding facilities with lights on at 0700
and off at 1900 and had access to food and water ad libitum. Bilateral synergist ablation
of the plantaris muscle was performed on 10-12 week old male C57BL6 mice (Jackson
Laboratories, Bar Harbor, MA) as previously described (19, 55). Following anesthesia
with 80 mg/kg Ketamine and 10 mg/kg Xylazine, the gastrocnemius and soleus muscle
were exposed by a longitudinal incision through the skin and fascia and removed in their
entirety while the plantaris muscle was left intact. Incisions were closed using 6-0 silk
sutures and the mice were returned to their cages and resumed normal locomotor activity.
At 7 or 14 days following surgery, overloaded and control plantaris muscles from nontreated mice were collected, quickly weighed, frozen in liquid nitrogen, and stored at 80OC until analysis.
Preparation of Protein Samples
For the analyses of protein expression, whole-cell extracts were prepared by
homogenizing muscles from control and overloaded mice by a polytron in 750µl or 1ml
of buffer, respectively, containing 20mmol/L Tris (pH 7.5), 150mmol/L NaCl, 1mmol/L
7
EDTA, 1 mmol/L EGTA, 10 g/L Nonidet NP40, 2.5 mmol/L sodium pyrophosphate, 1
mmol/L -glycerolphosphate, 1mmol/L sodium orthovanadate, 1 mg/L leupeptin, and 1
mmol/L phenylmethylsulfonyl fluoride. For the analyses of nuclear proteins, extracts
were prepared using the NE-PER® kit (nuclear protein isolation kit: Pierce
Biotechnology, Rockford, IL) according to the manufacturer’s instructions. Briefly,
control and overloaded muscles were homogenized in 750µL or 1mL of cytoplasmic
extraction reagent and centrifuged at 5000 rpm for 6 minutes. The supernatant, consisting
of free cytosolic protein, was collected and the remaining pellet was treated with 150µL
or 200µL of nuclear extraction reagent. The samples were then centrifuged at 14,000
rpm for 10 minutes and the supernatant was collected for nuclear proteins. Protein
concentrations were determined using the DC protein assay (Bio-Rad Laboratories,
Hercules, CA.). To verify that the NE-PER® kit isolated nuclear proteins without the
presence of cytoplasmic proteins, cytoplasmic and nuclear protein isolates were run out
on SDS page gels, stained with coomassie blue, and examined for the presence or
absence of the 205kda form of myosin heavy chain (MyHC). As predicted, myosin
expression was only detected in the cytoplasmic protein fraction (data not shown).
Western Blotting
SDS-PAGE was performed on 7.5% acrylamide gels and proteins were transferred to
polyvinylidene difluoride membranes. For these experiments, 40µg of total or nuclear
protein was analyzed with antibodies against -catenin (Sigma, Saint Louis, MO, #c2206) 1:2000, Lef-1 (Sigma, #L-3275) 1:1000, GSK-3 (BD Transduction Laboratories,
8
San Diego, CA, #610202) 1:1000, phosphorylated (Ser9) GSK-3 (Cell Signaling,
Beverly, MA, #9336S) 1:1000, Dishevelled-1 (Cell Signaling, #06-939) 1:1000, Frat1
(Abcam, Cambridge, MA, #ab2533-100) 1:1000, c-myc (Santa Cruz Biotechnology,
Santa Cruz, CA, #sc-788) 1:500, Cyclin D1 (Santa Cruz, #sc-718) 1:500, Pitx2 (Santa
Cruz, #sc-8748) 1:500, Wnt-10b (Santa Cruz, #sc-25524) 1:1000, and mFrizzled-1 (R&D
systems, Minneapolis, MN, #AF1120) 1:1000. Peroxidase-conjugated anti-rabbit (#PI1000), mouse (#PI-2000), and goat (#PI-9500) secondary antibodies were used (Vector
Laboratories, Burlingame, CA) 1:5000 and blots were visualized with an enhanced
chemiluminescence kit (Amersham Pharmacia Biotech, Piscataway, NJ). Densitometric
measurements were performed on a FluorS Max Imager using QuantityOne Software
(Bio-Rad Laboratories). Representative images and denstitometric values were made
from analysis of individual muscle samples (n 6 per group).
Co-immunoprecipitation Assays
Co-immunoprecipitation studies were performed using the Immunoprecipitation
Starting Kit™ (Amersham). Briefly, 300µg of total protein was precleared with a 50%
mixture of A/G beads and incubated with a 1:100 dilution of -catenin or Frat1
antibodies at 4°C with rotation overnight, followed by an additional 1hr treatment with
A/G beads. The beads were isolated by centrifugation, washed three times, and boiled in
2x loading buffer containing, 20% glycerol, 100nM Tris, 4% SDS, 0.017% Bromophenol
Blue, and 0.25M DTT for 10 minutes. Samples were loaded on SDS PAGE gels for
Western blot analysis as previously described.
9
Immunohistochemistry
Plantaris muscles were dissected from control or 7 day ablated mice, placed in tissue
freezing medium (Fisher Scientific, Hanover Park, IL), frozen in isopentane cooled with
dry ice, and stored at -80°C. 10uM thick cross-sections were cut at the muscle midbelly
and mounted on Superfrost/Plus slides (Fisher Scientific) and allowed to air dry for 60
minutes. Sections were fixed in acetone for 5 minutes, washed with 50mM Tris-buffered
saline (TBS) pH7.6 for 5 minutes and blocked in 5% fetal bovine serum in TBS for 30
minutes. Excess blocking reagent was removed and replaced with c-Myc primary
antibody, 1:100 in TBS overnight. Sections were next washed 3 x 10 minutes in TBS
containing 0.1% Triton X-100 (TBST) and treated with a Rhodamine (TRITC)conjugated anti-rabbit secondary antibody (Jackson ImmunoResearch Laboratories, West
Grove, PA, #211-025-109) 1:200 in TBS for 40 minutes. Sections were washed in TBST
and then co-stained with an anti-dystrophin goat polyclonal antibody (Santa Cruz, #sc7461) 1:100 in TBS for 1 hour. Sections were again washed before staining with a
(FITC)-conjugated anti-goat secondary antibody (Jackson, #705-095-003) 1:200 in TBS
for 40 minutes. Lastly, sections were washed in TBS and then mounted with coverslips
using VectaMount™ (Vector Laboratories, Burlingame, CA). Immunoflourescent images
were captured on a Kodak DC290 camera taken with a Nikon Diaphot 200 microscope.
RNA Isolation and Analysis
10
Total RNA was extracted by homogenizing muscles in TRIzol® reagent (Invitrogen,
Carlsbad, CA) following the protocol provided and RNA was obtained and suspended in
diethyl pyrocarbonate-treated water. cDNA was synthesized from 0.5µg total RNA using
SuperScript II (Invitrogen) and random-hexamer primers. Semi-quantitative PCR
amplification was performed in a 50µl reaction buffer containing: 1µl Taq DNA
Polymerase, 5µl 10X buffer with 15mM MgCl2, and 200µM each of dNTPs (Promega,
Madison, WI) along with 0.1µg of cDNA and 0.2mM of primers directed against c-Myc
(i) forward 5’-TGCGACGAGGAAGAGAATTT and (ii) reverse 5’ –
GAATCGGACGAGGTACAGGA that yields a 599bp product and 18S rRNA (i) forward
5’- AAACGGCTACCACATCCAAG and reverse 5’ – CCCTCTTAATCATGGCCTCA
that yields a 481 bp product. PCR was performed using an Epgradient S Mastercycler
(Eppendorf, Hamburg, Germany) under the following conditions: denaturation for 30s at
94 oC, annealing for 30s at 58 oC, and extension for 45s at 72 oC. PCR products were
resolved by running 15µl of the PCR reaction products on a 1% agrose/TBE (45 mM
Tris/borate/1 mM EDTA) gel containing 3µg/ml ethidium bromide and visualized under
UV light. Images represents analysis of individual muscle samples (n= 6 per group).
Statistical Analysis
Statistical analysis for these studies was performed using a paired student t-test or
ANOVA for multiple groups. All data are expressed as means ± SE. Differences
between groups were considered statistically significant if *p
0.05.
11
Results
-catenin is activated during overload-induced skeletal muscle hypertrophy
Synergist ablation was used to induce mechanical overload of the mouse plantaris
muscle. Consistent with previous studies, 7 days of overload produced a 67% increase in
plantaris wet weight while 14 days of overload resulted in a 139% increase in plantaris
mass (*p<0.0001) (Fig.1). No differences in protein concentration (µg protein/mg
muscle) were found among any of the groups, which indicate that changes in mass reflect
total protein accumulation (data not shown). For the remaining experiments, muscles
were studied at the 7-day time point because 1) mass is significantly elevated and 2) the
muscle is in an active growth phase.
To examine the role of -catenin in skeletal muscle hypertrophy, -catenin levels were
compared in control and overloaded plantaris muscle. Levels of total -catenin protein
increased 301% (*p=0.0004) following 7 days of mechanical overload (Fig. 2A). To gain
insight into potential functions, nuclear protein fractions were examined for -catenin
expression. Muscle overload resulted in a 434% increase (*p=0.0001) in -catenin
protein found in the nuclear enriched fraction (Fig. 2B). This large increase in nuclear
protein accumulation suggests -catenin is acting as a transcription factor during skeletal
muscle hypertrophy.
12
Reports have established that -catenin dimerizes in the nucleus with the DNA
binding protein Lef-1 to function as a transcriptional activator in skeletal muscle cells (5,
8, 40, 45). Lef-1 protein levels were undetectable in nuclear lysates (40µg) from control
plantaris muscles but were strongly induced following 7 days of muscle overload (Fig.
2C). To test for a functional interaction between -catenin and Lef-1, coimmunoprecipitation studies were performed with nuclear extracts. Results of these
experiments confirmed that a -catenin/Lef-1 transcriptional complex is not detectable in
control lysates but is formed during overload-induced hypertrophy (Fig. 2C).
-catenin activation does not require increased GSK-3 phosphorylation (Ser9)
Numerous studies indicate that -catenin protein levels are regulated by targeted
degradation following GSK-3 mediated phosphorylation (28, 61). To determine the role
of GSK-3 in -catenin activation, the amount of total and phosphorylated GSK-3 , at
the serine 9 site (Ser9), was examined in control and overloaded muscle samples. Total
GSK-3 protein levels increased 46% (*p<0.02) with 7 days of muscle overload while
the amount of phosphorylated GSK-3 did not significantly change (Fig. 3). These results
show that during skeletal muscle growth, -catenin protein levels are significantly
increased while there is also a significant increase in the level of unphosphorylated GSK3 protein.
13
-catenin activation corresponds with increased expression of Wnt signaling
components
Adult skeletal muscle expresses several different Wnt and Frizzled isoforms (38, 43).
However, Wnt10b and mFrizzled-1 (mFzd-1) have previously been detected in murine
skeletal muscle and are known to function in Wnt/ -catenin signaling (10, 43, 53).
Therefore, to examine if these components of Wnt signaling change following
mechanical overload, levels of Wnt10b and mFzd-1 were examined in whole-cell extracts
from control and overloaded muscle. Wnt-10b protein expression did not significantly
change with overload but levels of mFzd-1 increased 71% (*p=0.006) (Fig. 4A).
Dishevelled (Dvl) proteins have been shown to function downstream of Wnt binding
to its receptor (Fzd) in the inactivation of the -catenin degradation complex (25, 34). Of
the three mouse Dishevelled genes (Dvl-1,2,3), Dvl-1 is the most well characterized (25).
Dvl-1 is expressed in skeletal muscle cells and is known to participate in Wnt-induced catenin activation (23, 26, 29, 37). Therefore, in this study, Dvl-1 protein levels were
examined in whole-cell extracts from control and overloaded muscle. Consistent with
increased Wnt signaling, total Dvl-1 expression increased 88% (*p=0.002) with skeletal
muscle overload (Fig. 4B).
Dishevelled activation can disrupt GSK-3 -mediated degradation of -catenin via
activation of the inhibitory protein Frat1 (26). Since increased GSK-3
phosphorylation/inhibition was not detected during muscle overload (Fig. 3), the
14
relationship between GSK-3 and Frat1 was examined in control and overloaded muscle.
Frat1 protein levels did not significantly change with overload, however, the interaction
between GSK-3 and Frat1 was induced, consistent with Wnt/ -catenin signaling (Fig.
4C).
-catenin/Lef-1 transcriptional targets are induced
The observation of increased nuclear -catenin/Lef-1 complexes during overload (Fig.
2C) suggested potential changes in target gene expression. Several of the known
transcriptional targets of -catenin are growth-associated genes (32, 58). One welldefined growth gene and transcriptional target of active -catenin/Lef-1 is c-Myc (5, 17,
50). Levels of c-Myc mRNA, examined by semi-quantitative RT-PCR, were undetectable
in control muscle (45 cycles) but significantly expressed in muscle following 7 days of
overload (Fig. 5). No c-Myc product was detected in control muscle samples with up to
50 cycles (data not shown).
Consistent with the expression pattern of c-Myc mRNA, c-Myc and Cyclin D1
proteins were undetectable in whole-cell extracts from control muscle but were
significantly expressed following 7 days of skeletal muscle overload (Fig. 6A).
Expression of Pitx2, another target of -catenin/Lef-1 transcription and itself a
transcriptional activator of c-Myc and Cyclin D1, was also examined during muscle
overload. Consistent with changes in c-Myc and Cyclin D1 protein levels, Pitx2 was
significantly induced following 7 days of skeletal muscle overload (Fig. 6A).
15
Immunohistochemical localization of c-Myc was performed to determine whether the
increase in c-myc protein observed with overload occurred in skeletal muscle fibers or
other cell types. c-Myc expression was undetectable in control muscle cross-sections.
However, in overloaded skeletal muscle cross-sections, c-Myc was readily visualized in
nuclei within the dystrophin-stained sarcolemma, as well as outside of the muscle
membrane, and in the interstitial space (Fig. 6B). These results suggest that c-Myc was
induced in both muscle and nonmuscle/satellite cell nuclei within the muscle tissue.
16
Discussion
-catenin regulation has been well studied during developmental and oncogenic
growth. Recently, -catenin was determined to be both necessary and sufficient for
hypertrophy of terminally differentiated cardiomyocytes (15). In cardiac muscle, active catenin was found to be associated with Akt-mediated GSK-3 (Ser9) phosphorylation
(15). In contrast, results from this study, indicate that -catenin activation during
overload-induced skeletal muscle hypertrophy is predominantly associated with Wnt
signaling and is likely not the result of phosphorylation-induced GSK-3 inhibition.
Mechanical overload of skeletal muscle is associated with Wnt activation,
characterized by -catenin accumulation accompanied with increases in mFzd-1, Dvl-1,
and GSK-3 -Frat1 complex formation. In contrast to the findings in cardiomyocytes, the
results of this study argue that the Wnt pathway, and not phosphorylation of GSK-3 , is
the more dominant pathway affecting -catenin activation in response to skeletal muscle
overload. In fact, -catenin accumulation was associated with increased levels of
unphosphorylated GSK-3 that would normally predict decreased -catenin expression.
Thus, while this study cannot rule out a role for GSK-3 phosphorylation during skeletal
muscle hypertrophy, the findings suggest that it is likely not the dominant mechanism
responsible for induction of -catenin protein in mouse skeletal muscle following
synergist ablation.
17
The lack of a change in GSK-3 phosphorylation in the mouse plantaris muscle
following synergist ablation is in contrast to the findings of Bodine et al. (2001) in which
GSK-3 phosphorylation was increased following mechanical overload of the rat
plantaris muscle (9). One potential explanation is that the antibody used in the Bodine
paper recognizes phosphorylation of both GSK-3 and GSK-3 at ser 21 and ser 9 sites
so the increased phosphorylation detected in the previous study could reflect changes in
GSK-3 (9). Secondly, the measurement of phosphorylated GSK-3 in this study was
done at a 7 days, while the previous work examined GSK-3 phosphorylation following 14
days of overload making the timecourse a potential source of the difference (9). Finally,
because GSK-3 is a multifunctional kinase with many forms of regulation, it is possible
that mice and rats have intrinsic and yet unidentified differences in GSK-3 regulation
during overload-induced skeletal muscle growth (30, 60).
Although other Wnt proteins may be involved, no change was detected in Wnt-10b
protein levels, suggesting that induction of other signaling components mediate Wnt
pathway activation in response to skeletal muscle overload. The increase in mFzd-1
protein levels observed in this study are consistent with findings from Carson et al.
(2002) which showed significant induction of mFzd-1 mRNA levels at 3 days following
mechanical overload in rat soleus muscle (10, 43). Increased Dvl-1 expression following
skeletal muscle overload is also consistent with Wnt-induced -catenin activation. In
some forms of cancer, total Dvl protein levels directly correlate with -catenin activation
(56). However, Wnt activation is generally associated with the hyperphosphorylation of
Dvl, characterized by a decreasing mobility in SDS PAGE gels (23, 25, 34). In this
18
study, Dvl-1 protein levels, including the phosphorylated forms of higher molecular
weight, are elevated following skeletal muscle overload (Fig. 4B). Therefore, increasing
levels of phosphorylated Dvl-1 protein may be critical for Wnt-induced -catenin
activation during skeletal muscle growth.
An important finding of this study is the induction of Lef-1 protein and the formation
of a -catenin-Lef-1 complex with overload. As expected, known -catenin/Lef-1
transcriptional targets c-Myc, Cyclin D1, and Pitx2 were induced during skeletal muscle
overload. c-Myc and Cyclin D1 are well known for their roles in cell-cycle regulation
but recent papers demonstrate that they are critical for the regulation of cell size (31, 46).
While the function of these genes has not been tested, many models of hypertrophic
growth report increased c-Myc and Cyclin D1 gene expression (1, 10, 11). One potential
downstream function could be their role in regulated ribosomal biogenesis which is
critical for maintaining increased rates of protein synthesis (4, 11, 24, 39, 41). In this
study, c-Myc was induced following overload in both muscle and nonmuscle or satellite
cell nuclei. Thus, increased levels of c-Myc may be contributing to proliferation of
satellite cells and other non-muscles cells such as fibroblasts and/or endothelial cells.
In summary, the results from this study demonstrate that -catenin is activated during
skeletal muscle overload primarily through Wnt signaling and is not the sole result of
phosphorylation-induced GSK-3 inhibition. Wnt-induced -catenin activation was
associated with increased protein expression of many Wnt signaling components,
including, mFzd-1, Dvl-1, and Lef-1. This indicates that mechanical overload also results
19
in significant increases in the Wnt pathway machinery. The Wnt-induced -catenin/Lef-1
complex formation detected following mechanical overload is associated with increases
in known targets, such as c-Myc and Cyclin D, which may contribute to hypertrophic
growth. Thus, these findings implicate Wnt signaling and the activation of -catenin as
an important response to mechanical overload which may contribute to the compensatory
hypertrophic response.
20
Acknowledgements
Present addresses: D. Armstrong and K. Esser, Dept. of Physiology, Univ of
Kentucky, Albert B. Chandler Medical Center, 800 Rose St., Lexington, KY 40536-0298.
Grants
This research was supported by the NIH grant AR 45617 and Pfizer funding to K. A.
Esser.
21
Figure Legends
Fig. 1. Plantaris muscle mass increases following synergist ablation. A
67% increase in muscle weight is seen following 7 days of overload while 14 days of
compensatory hypertrophy resulted in a 139% increase in plantaris mass, 23±1 vs. 39±2
vs. 57±2 (mg). Values represent means ± SE (*p<0.0001). ( ) Significantly greater than
day 0. ( ) Significantly greater than day 7.
Fig. 2.
-catenin is activated during overload-induced hypertrophy. (A)
Total -catenin protein is expressed at a level
3-fold higher in overloaded muscle,
100%±19 vs. 401%±33 (*p=0.0004). (B) Nuclear -catenin levels increased
4-fold with
overload, 100±25% vs. 534±65% (*p=0.0001). (C) The transcriptional co-activator Lef-1
and complex formation between -catenin and Lef-1 is induced with 7 days of overload.
Nuclear protein fractions and coimmunoprecipitation experiments were performed as
described in Materials and Methods. Values represent mean optical density expressed as
a percent of control ± SE.
Fig. 3. Skeletal muscle overload is associated with an induction in
unphosphorylated GSK-3 protein. Total GSK-3 protein levels increased 46%
with overload, 100%±11 vs. 146%±13 (*p=0.02), while the amount of GSK-3
phosphorylated at Ser9 did not significantly change, 100%±19 vs. 104%±17 (p=0.86).
Values represent mean optical density expressed as a percent of control ± SE.
22
Fig 4. Skeletal muscle overload is associated with increased expression
of mFzd-1, Dvl-1, and GSK-3 -Frat1 complex formation. (A) Wnt-10b
protein levels showed no significant change, 100%±9 vs. 109%±11 (p=0.55), but mFzd-1
protein levels increased 71% with overload, 100%±17 vs. 171%±8 (*p=0.006). (B) Total
Dvl-1 protein levels increased 88% with overload, 100%±6 vs. 188±12 (*p=0.002). (C)
Total Frat1 levels did not significantly change, 100%±10 vs. 99%±9 (p=0.95), but GSK3 bound to Frat1, while not detectable in control muscle, was significantly expressed in
overloaded muscle samples. Values represent mean optical density expressed as a percent
of control ± SE.
Fig. 5. The -catenin/Lef-1 transcription target c-Myc shows induced
mRNA expression with overload. c-Myc mRNA was readily detected in
overloaded muscle samples while RNA extracted from control muscle and used for RTPCR failed to produce a detectable c-Myc product (45 cycles). Primers directed against
18S rRNA were used to determine equal loading (30 cycles). Images represents analysis
of individual muscle samples (n= 6 per group).
Fig. 6.
-catenin/Lef-1 transcription targets, c-Myc, Cyclin D1, and
Pitx2 show induced protein expression with overload. (A) c-Myc, Cyclin
D1, and Pitx2 expression was undetectable in control lysates (40 µg) but significantly
expressed in overloaded muscle. (B) Histological sections from control and 7 day
23
overloaded plantaris muscles were prepared as described in Materials and Methods. cMyc (red) was not detected in control muscle cross-sections but 7 day overloaded
plantaris muscle showed c-Myc staining in nuclei which appear within the Dystrophin
(green) stained sarcolemma (arrow head), outside of the muscle membrane, and in the
interstitial space (arrow) (x100 magnification).
24
References
1.
Adams GR, Caiozzo VJ, Haddad F, and Baldwin KM. Cellular and molecular
responses to increased skeletal muscle loading after irradiation. Am J Physiol Cell
Physiol 283: C1182-1195, 2002.
2.
Amit S, Hatzubai A, Birman Y, Andersen JS, Ben-Shushan E, Mann M, BenNeriah Y, and Alkalay I. Axin-mediated CKI phosphorylation of beta-catenin at Ser 45:
a molecular switch for the Wnt pathway. Genes Dev 16: 1066-1076, 2002.
3.
Anakwe K, Robson L, Hadley J, Buxton P, Church V, Allen S, Hartmann C,
Harfe B, Nohno T, Brown AM, Evans DJ, and Francis-West P. Wnt signalling
regulates myogenic differentiation in the developing avian wing. Development 130:
3503-3514, 2003.
4.
Arabi A, Wu S, Ridderstrale K, Bierhoff H, Shiue C, Fatyol K, Fahlen S,
Hydbring P, Soderberg O, Grummt I, Larsson LG, and Wright AP. c-Myc associates
with ribosomal DNA and activates RNA polymerase I transcription. Nat Cell Biol 7: 303310, 2005.
5.
Baek SH, Kioussi C, Briata P, Wang D, Nguyen HD, Ohgi KA, Glass CK,
Wynshaw-Boris A, Rose DW, and Rosenfeld MG. Regulated subset of G1 growthcontrol genes in response to derepression by the Wnt pathway. Proceedings of the
National Academy of Sciences of the United States of America 100: 3245-3250, 2003.
6.
Bax B, Carter PS, Lewis C, Guy AR, Bridges A, Tanner R, Pettman G,
Mannix C, Culbert AA, Brown MJ, Smith DG, and Reith AD. The structure of
phosphorylated GSK-3beta complexed with a peptide, FRATtide, that inhibits betacatenin phosphorylation. Structure (Camb) 9: 1143-1152, 2001.
7.
Ben-Ze'ev A, Shtutman M, and Zhurinsky J. The integration of cell adhesion
with gene expression: the role of beta-catenin. Exp Cell Res 261: 75-82, 2000.
8.
Billin AN, Thirlwell H, and Ayer DE. Beta-catenin-histone deacetylase
interactions regulate the transition of LEF1 from a transcriptional repressor to an
activator. Mol Cell Biol 20: 6882-6890, 2000.
9.
Bodine SC, Stitt TN, Gonzalez M, Kline WO, Stover GL, Bauerlein R,
Zlotchenko E, Scrimgeour A, Lawrence JC, Glass DJ, and Yancopoulos GD.
Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent
muscle atrophy in vivo. Nat Cell Biol 3: 1014-1019, 2001.
10.
Carson JA, Nettleton D, and Reecy JM. Differential gene expression in the rat
soleus muscle during early work overload-induced hypertrophy. FASEB Journal 16: 207209, 2002.
11.
Chen YW, Nader GA, Baar KR, Fedele MJ, Hoffman EP, and Esser KA.
Response of rat muscle to acute resistance exercise defined by transcriptional and
translational profiling. J Physiol 545: 27-41, 2002.
12.
Cossu G and Borello U. Wnt signaling and the activation of myogenesis in
mammals. Embo J 18: 6867-6872, 1999.
13.
Delcommenne M, Tan C, Gray V, Rue L, Woodgett J, and Dedhar S.
Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and
25
protein kinase B/AKT by the integrin-linked kinase. Proc Natl Acad Sci U S A 95: 1121111216, 1998.
14.
Gao ZH, Seeling JM, Hill V, Yochum A, and Virshup DM. Casein kinase I
phosphorylates and destabilizes the beta-catenin degradation complex. Proc Natl Acad
Sci U S A 99: 1182-1187, 2002.
15.
Haq S, Michael A, Andreucci M, Bhattacharya K, Dotto P, Walters B,
Woodgett J, Kilter H, and Force T. Stabilization of beta-catenin by a Wnt-independent
mechanism regulates cardiomyocyte growth. Proceedings of the National Academy of
Sciences of the United States of America 100: 4610-4615, 2003.
16.
Hardt SE and Sadoshima J. Glycogen synthase kinase-3beta: a novel regulator
of cardiac hypertrophy and development. Circulation Research 90: 1055-1063, 2002.
17.
He TC, Sparks AB, Rago C, Hermeking H, Zawel L, da Costa LT, Morin PJ,
Vogelstein B, Kinzler KW, Howard Hughes Medical I, and Johns Hopkins Oncology
Center NBSBMDUSA. Identification of c-MYC as a target of the APC pathway. Science
281(5382): 1509-1512, 1998.
18.
Hesketh JE and Whitelaw PF. The role of cellular oncogenes in myogenesis and
muscle cell hypertrophy. International Journal of Biochemistry 24: 193-203, 1992.
19.
Hornberger TA, McLoughlin TJ, Leszczynski JK, Armstrong DD, Jameson
RR, Bowen PE, Hwang ES, Hou H, Moustafa ME, Carlson BA, Hatfield DL,
Diamond AM, and Esser KA. Selenoprotein-deficient transgenic mice exhibit enhanced
exercise-induced muscle growth. J Nutr 133: 3091-3097, 2003.
20.
Ikeda S, Kishida S, Yamamoto H, Murai H, Koyama S, and Kikuchi A. Axin,
a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3beta and
beta-catenin and promotes GSK-3beta-dependent phosphorylation of beta-catenin. Embo
J 17: 1371-1384, 1998.
21.
Ikeya M and Takada S. Wnt signaling from the dorsal neural tube is required for
the formation of the medial dermomyotome. Development 125: 4969-4976, 1998.
22.
Kang UG, Seo MS, Roh MS, Kim Y, Yoon SC, and Kim YS. The effects of
clozapine on the GSK-3-mediated signaling pathway. FEBS Lett 560: 115-119, 2004.
23.
Karasawa T, Yokokura H, Kitajewski J, and Lombroso PJ. Frizzled-9 is
activated by Wnt-2 and functions in Wnt/beta -catenin signaling. J Biol Chem 277:
37479-37486, 2002.
24.
Kim S, Li Q, Dang CV, and Lee LA. Induction of ribosomal genes and
hepatocyte hypertrophy by adenovirus-mediated expression of c-Myc in vivo. Proc Natl
Acad Sci U S A 97: 11198-11202, 2000.
25.
Lee JS, Ishimoto A, and Yanagawa S. Characterization of mouse dishevelled
(Dvl) proteins in Wnt/Wingless signaling pathway. J Biol Chem 274: 21464-21470, 1999.
26.
Li L, Yuan H, Weaver CD, Mao J, Farr GH, 3rd, Sussman DJ, Jonkers J,
Kimelman D, and Wu D. Axin and Frat1 interact with dvl and GSK, bridging Dvl to
GSK in Wnt-mediated regulation of LEF-1. EMBO Journal 18: 4233-4240, 1999.
27.
Liu C, Kato Y, Zhang Z, Do VM, Yankner BA, and He X. beta-Trcp couples
beta-catenin phosphorylation-degradation and regulates Xenopus axis formation. Proc
Natl Acad Sci U S A 96: 6273-6278, 1999.
28.
Liu C, Li Y, Semenov M, Han C, Baeg GH, Tan Y, Zhang Z, Lin X, and He
X. Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism.
Cell 108: 837-847, 2002.
26
29.
Luo Z, Wang Q, Dobbins GC, Levy S, Xiong WC, and Mei L. Signaling
complexes for postsynaptic differentiation. J Neurocytol 32: 697-708, 2003.
30.
Michael A, Haq S, Chen X, Hsich E, Cui L, Walters B, Shao Z, Bhattacharya
K, Kilter H, Huggins G, Andreucci M, Periasamy M, Solomon RN, Liao R, Patten
R, Molkentin JD, and Force T. Glycogen synthase kinase-3beta regulates growth,
calcium homeostasis, and diastolic function in the heart. J Biol Chem 279: 21383-21393,
2004.
31.
Montagne J. Genetic and molecular mechanisms of cell size control. Molecular
Cell Biology Research Communications 4: 195-202, 2000.
32.
Moon RT, Bowerman B, Boutros M, and Perrimon N. The promise and perils
of Wnt signaling through beta-catenin. Science 296: 1644-1646, 2002.
33.
Novak A and Dedhar S. Signaling through beta-catenin and Lef/Tcf. Cellular &
Molecular Life Sciences 56: 523-537, 1999.
34.
Pan WJ, Pang SZ, Huang T, Guo HY, Wu D, and Li L. Characterization of
function of three domains in dishevelled-1: DEP domain is responsible for membrane
translocation of dishevelled-1. Cell Res 14: 324-330, 2004.
35.
Petropoulos H and Skerjanc IS. Beta-catenin is essential and sufficient for
skeletal myogenesis in P19 cells. Journal of Biological Chemistry 277: 15393-15399,
2002.
36.
Piedra ME, Delgado MD, Ros MA, and Leon J. c-Myc overexpression
increases cell size and impairs cartilage differentiation during chick limb development.
Cell Growth Differ 13: 185-193, 2002.
37.
Pizzuti A, Amati F, Calabrese G, Mari A, Colosimo A, Silani V, Giardino L,
Ratti A, Penso D, Calza L, Palka G, Scarlato G, Novelli G, and Dallapiccola B.
cDNA characterization and chromosomal mapping of two human homologues of the
Drosophila dishevelled polarity gene. Hum Mol Genet 5: 953-958, 1996.
38.
Polesskaya A, Seale P, and Rudnicki MA. Wnt signaling induces the myogenic
specification of resident CD45+ adult stem cells during muscle regeneration. Cell 113:
841-852, 2003.
39.
Pollack PS, Houser SR, Budjak R, and Goldman B. c-myc gene expression is
localized to the myocyte following hemodynamic overload in vivo. J Cell Biochem 54:
78-84, 1994.
40.
Porfiri E, Rubinfeld B, Albert I, Hovanes K, Waterman M, and Polakis P.
Induction of a beta-catenin-LEF-1 complex by wnt-1 and transforming mutants of betacatenin. Oncogene 15: 2833-2839, 1997.
41.
Prober DA and Edgar BA. Growth regulation by oncogenes--new insights from
model organisms. Current Opinion in Genetics & Development 11: 19-26, 2001.
42.
Rommel C, Bodine SC, Clarke BA, Rossman R, Nunez L, Stitt TN,
Yancopoulos GD, and Glass DJ. Mediation of IGF-1-induced skeletal myotube
hypertrophy by PI(3)K/Akt/mTOR and PI(3)K/Akt/GSK3 pathways. Nature Cell Biology
3: 1009-1013, 2001.
43.
Sagara N, Toda G, Hirai M, Terada M, and Katoh M. Molecular cloning,
differential expression, and chromosomal localization of human frizzled-1, frizzled-2,
and frizzled-7. Biochem Biophys Res Commun 252: 117-122, 1998.
27
44.
Sakamoto K, Arnolds DE, Ekberg I, Thorell A, and Goodyear LJ. Exercise
regulates Akt and glycogen synthase kinase-3 activities in human skeletal muscle.
Biochem Biophys Res Commun 319: 419-425, 2004.
45.
Schmidt M, Tanaka M, and Munsterberg A. Expression of (beta)-catenin in the
developing chick myotome is regulated by myogenic signals. Development 127: 41054113, 2000.
46.
Schuhmacher M, Staege MS, Pajic A, Polack A, Weidle UH, Bornkamm
GW, Eick D, and Kohlhuber F. Control of cell growth by c-Myc in the absence of cell
division. Curr Biol 9: 1255-1258, 1999.
47.
Seale P, Polesskaya A, and Rudnicki MA. Adult stem cell specification by Wnt
signaling in muscle regeneration. Cell Cycle 2: 418-419, 2003.
48.
Shapiro L. The multi-talented beta-catenin makes its first appearance. Structure
5: 1265-1268, 1997.
49.
Sharma M, Chuang WW, and Sun Z. Phosphatidylinositol 3-kinase/Akt
stimulates androgen pathway through GSK3beta inhibition and nuclear beta-catenin
accumulation. J Biol Chem 277: 30935-30941, 2002.
50.
Shtutman M, Zhurinsky J, Simcha I, Albanese C, D'Amico M, Pestell R,
Ben-Ze'ev A, and Department of Molecular Cell Biology TWIoSRI. The cyclin D1
gene is a target of the beta-catenin/LEF-1 pathway. Proc Natl Acad Sci U S A 96(10):
5522-5527, 1999.
51.
Snider L and Tapscott SJ. Emerging parallels in the generation and regeneration
of skeletal muscle. Cell 113: 811-812, 2003.
52.
Tajbakhsh S, Borello U, Vivarelli E, Kelly R, Papkoff J, Duprez D,
Buckingham M, and Cossu G. Differential activation of Myf5 and MyoD by different
Wnts in explants of mouse paraxial mesoderm and the later activation of myogenesis in
the absence of Myf5. Development 125: 4155-4162, 1998.
53.
Taylor-Jones JM, McGehee RE, Rando TA, Lecka-Czernik B, Lipschitz DA,
and Peterson CA. Activation of an adipogenic program in adult myoblasts with age.
Mechanisms of Ageing & Development 123: 649-661, 2002.
54.
Thomas GM, Frame S, Goedert M, Nathke I, Polakis P, and Cohen P. A
GSK3-binding peptide from FRAT1 selectively inhibits the GSK3-catalysed
phosphorylation of axin and beta-catenin. FEBS Lett 458: 247-251, 1999.
55.
Timson BF. Evaluation of animal models for the study of exercise-induced
muscle enlargement.[comment]. Journal of Applied Physiology 69: 1935-1945, 1990.
56.
Uematsu K, Kanazawa S, You L, He B, Xu Z, Li K, Peterlin BM,
McCormick F, and Jablons DM. Wnt pathway activation in mesothelioma: evidence of
Dishevelled overexpression and transcriptional activity of beta-catenin. Cancer Res 63:
4547-4551, 2003.
57.
Vyas DR, Spangenburg EE, Abraha TW, Childs TE, and Booth FW. GSK3beta negatively regulates skeletal myotube hypertrophy. American Journal of
Physiology - Cell Physiology 283: C545-551, 2002.
58.
Willert J, Epping M, Pollack JR, Brown PO, and Nusse R. A transcriptional
response to Wnt protein in human embryonic carcinoma cells. BMC Dev Biol 2: 8, 2002.
59.
Willert K and Nusse R. Beta-catenin: a key mediator of Wnt signaling. Curr
Opin Genet Dev 8: 95-102, 1998.
28
60.
Woodgett JR. Judging a protein by more than its name: GSK-3. Sci STKE 2001:
RE12, 2001.
61.
Woodgett JR. Physiological roles of glycogen synthase kinase-3: potential as a
therapeutic target for diabetes and other disorders. Curr Drug Targets Immune Endocr
Metabol Disord 3: 281-290, 2003.
62.
Xiao G, Mao S, Baumgarten G, Serrano J, Jordan MC, Roos KP, Fishbein
MC, and MacLellan WR. Inducible activation of c-Myc in adult myocardium in vivo
provokes cardiac myocyte hypertrophy and reactivation of DNA synthesis. Circ Res 89:
1122-1129, 2001.
29
Fig. 1.
70
Plantaris Wet Muscle
Weight (mg)
60
50
40
30
20
10
0
0
7
14
Days of Overload
Fig. 2.
A.
l
tro
n
Co
O
C.
ad
rl o
e
v
ro
nt
o
C
Total
-catenin
l
O
ad
rl o
e
v
Lef-1
100
*401
B.
ro
nt
Co
l
O
rlo
ve
% of Control
ad
Nuclear
-catenin
100
*534
% of Control
IP:
-catenin
Lef-1
*Undetectable in Controls
30
Fig. 3.
ro
nt
Co
l
rl o
ve
O
ad
GSK-3
100
*146
% of Control
100
104
% of Control
pGSK-3
(ser9)
Fig. 4.
A.
ro
nt
o
C
l
O
ad
lo
r
ve
Wnt-10b
C.
ro
nt
Co
l
O
ad
lo
r
ve
Frat1
100
109
100
*171
100
% of Control
mFzd-1
% of Control
IP:
Frat1
99
% of Control
IGg
GSK-3
*Undetectable in Control
B.
ro
nt
o
C
l
O
rlo
ve
ad
mDvl-1
100
*188
% of Control
31
Fig. 5.
l
ad
tro erlo
n
v
Co O
c-myc
product
599 bp
18S rRNA
product
481 bp
100 bp
ladder
Fig. 6.
A.
ro
nt
o
C
l
O
rlo
ve
ad
c-Myc
Cyclin D1
Pitx2
*Undetectable in Controls
B.
Control
Overload