Mycol Progress (2016) 15:55
DOI 10.1007/s11557-016-1199-3
ORIGINAL ARTICLE
Scolytus multistriatus associated with Dutch elm disease
on the island of Gotland: phenology and communities
of vectored fungi
Audrius Menkis 1 & Inga-Lena Östbrant 2 & Kateryna Davydenko 3 & Remigijus Bakys 4 &
Maksims Balalaikins 5 & Rimvydas Vasaitis 1
Received: 16 February 2016 / Revised: 28 April 2016 / Accepted: 13 May 2016
# German Mycological Society and Springer-Verlag Berlin Heidelberg 2016
Abstract Scolytus multistriatus Marsham, the smaller
European elm bark beetle, is a vector for Dutch elm disease
(DED) that in the year 2005 invaded the island of Gotland
(Sweden). The island possesses the largest population of elm
(mainly Ulmus minor Mill.) in northern Europe. The aim of
this study was to monitor flying periods of S. multistriatus
during three consecutive years and by using high-throughput
sequencing to assess communities of vectored fungi.
Sampling of the beetles was carried out at two different sites
in Gotland in 2012, 2013, and 2014. In total, 50 pheromone
traps were placed at each site and checked weekly during
June-August each year. From all sites and years, 177 beetles
were trapped. Among these, 6.2 % were trapped in June,
76.8 % in July, and 16.9 % in August (difference significant
at p<0.007). Sequencing of ITS rDNA from the beetles
revealed the presence of 1589 fungal taxa, among which virulent DED pathogen Ophiostoma novo-ulmi Brasier was the
second most common species (9.0 % of all fungal sequences).
O. ulmi Buisman, the less virulent DED pathogen, was also
detected but only in a single beetle, which was sampled in
2012 (0.04 % of sequences). There were 13.0 % of the beetles
infested with O. novo-ulmi in 2012, 4.0 % in 2013, and 27.7 %
in 2014. O. novo-ulmi comprised 0.8 % of fungal sequences in
2012, 0.002 % in 2013, and 8.2 % in 2014. The study showed
that the proportion of S. multistriatus vectoring O. novo-ulmi
has increased in recent years.
Keywords Ophiostoma . Invasive pathogens . Bark beetles .
Disease management . Fungal community . Ulmus
Introduction
Electronic supplementary material The online version of this article
(doi:10.1007/s11557-016-1199-3) contains supplementary material,
which is available to authorized users.
* Audrius Menkis
[email protected]
1
Department of Forest Mycology and Plant Pathology, Uppsala
BioCenter, Swedish University of Agricultural Sciences,
P.O. Box 7026, SE-75007 Uppsala, Sweden
2
Swedish Forest Agency Gotland District, P.O. Box 1417, SE-621
25 Visby, Sweden
3
Ukrainian Research Institute of Forestry and Forest Melioration,
Pushkinska str. 86, 61024 Kharkiv, Ukraine
4
Institute of Forest Biology and Silviculture, Aleksandras Stulginskis
University, Studentu str. 11, LT-53361 Akademija Kaunas
District, Lithuania
5
Institute of Life Sciences and Technology, Daugavpils University,
Vienibas str. 13, LV-5401 Daugavpils, Latvia
Scolytus multistriatus (Scolytinae: Scolytini), the smaller
European elm bark beetle, is native to Europe, the Middle
East, and northern Africa (Bellows et al. 1998), but was introduced with elm wood to other areas including North America,
New Zealand, and Australia (Brockerhoff et al. 2003; Lee
et al. 2009; Parbery and Rumba 1991) and generally occurs
within the areal of host trees (mainly Ulmus spp.). Adults (1.9
to 3.1 mm in length) bore through the bark of weakened and/
or stressed elms, breed under the bark and produce egg galleries in the vascular tissues. Females lay eggs along the egg
gallery, and larvae tunnel across the vascular tissues away
from the egg gallery (Wood 1982). S. multistriatus overwinters as larvae under the bark and new adults emerge in the
spring or early summer after elm leaves have fully developed.
S. multistriatus is one of the most effective vectors for
Dutch elm disease (DED) (Santini and Faccoli 2015;
Webber 1990) caused by fungi from the genus
55
Page 2 of 8
Ophiostoma (Ascomycota) (Kirisits 2013), which during
the last 100 years have destroyed billions of elm trees
worldwide (Phillips and Burdekin 1982). DED is a lethal vascular wilt disease comprised of three distinct
fungal pathogens, less virulent O. ulmi, and highly virulent O. novo-ulmi and O. himal-ulmi Brasier &
Mehrotra, a species endemic to the western Himalayas
(Brasier and Mehrotra 1995). Conidia, which are the
infection source of DED pathogens, are transmitted on
the body surface of the beetles into the tree, and a new
generation of beetles is only infested if the DED fungus
is present in the galleries. Conidia are produced in
sticky masses that facilitate their attachment and transportation by beetles as they emerge from the trees
(Ploetz et al. 2013). When DED-infested beetles emerge
and fly to feed in the twig crotches of healthy elms,
they form grooves in the wood through which the fungus enters the twig and spreads within the branch by a
yeast-like budding process causing leaves to wilt and
die. This is due to the blockage of the conducting system subsequent to the formation of tyloses and gels in
the xylem vessels and the production of toxins, and
eventually causing the death of a tree (Phillips and
Burdekin 1982).
The island of Gotland (Sweden) possesses the largest
and highly valuable wild population of elms (more than
one million trees that are mainly Ulmus minor) in northern Europe, which until recently was not affected by
DED (Östbrant et al. 2009). In 2005, however, DED
was observed in Gotland and in the following years, it
rapidly spread in all directions, causing extensive mortality of elm trees (Menkis et al. 2016). Among the elm
bark beetles known from Sweden, which include
S. triarmatus Eggers., S. laevis Chapuis, S. rugulosus
O.F. Muller, S. pygmaeus F. and S. multistriatus, only
the latter species occurs in Gotland (Schlyter et al.
1987) and is therefore thought to be responsible for the
current spread of DED. Interestingly, S. multistriatus has
been known in Gotland for decades, which suggests that
until 2005 its population on the island was free of
O. novo-ulmi. Although the precise route of disease arrival is not known, it was probably brought to the island
with DED-infested elm wood that would resemble patterns of human-mediated spread of DED (Brasier et al.
2 0 0 4 ) . H o w e v e r, l i t t l e i s k n o w n a b o u t w h e n
S. multistriatus is most active in Gotland and especially
what proportion of those beetles vector conidia of DED
fungi. Moreover, little is known about other fungal species vectored by S. multistriatus.
The aim of the present study was to monitor the seasonal
flying intensity of S. multistriatus and to assess communities
of vectored fungi at different time periods, particularly focusing on DED pathogens.
Mycol Progress (2016) 15:55
Materials and methods
Study sites and sampling
Mean temperatures for the study area were retrieved from
http://luftwebb.smhi.se. The study sites were at Vallstena
(N57°36′, E18°41′) and Hogrän (N57°31′, E18°18′) on the
Baltic Sea island of Gotland. The distance between the sites
was ca. 26 km. The site at Vallstena was a mixed forest
composed of Pinus sylvestris L., Picea abies (L.) Karst.,
Betula pendula Roth, Ulmus spp. and Alnus spp. The site at
Hogrän was a mixture of open fields and forest land with
similar tree species in admixture as at the Vallstena site.
Both sites were characteristic to Gotland in terms of
landscape and trees species composition, and were in the
areas characterised by a high incidence of DED. At each
site, 50 transparent delta traps with a sticky insert
(Pherobank, Wijk bij Duurstede, The Netherlands) on the
bottom and a P188 pheromone lure (Synergy
Semiochemcials Corp., Burnaby, Canada) were placed every
50 m along a transect, which was 2.5 km long. Lures consisted
of two semi-permeable plastic pouches containing a mixture
of cubeb oil, 1-hexanol, multistriatin and 4-methyl-3heptanol. The lure used attracts Scolytus spp. beetles. In this
type of trap, beetles firmly stick to the sticky insert, which
prevents physical contact among different individuals, and
prevents cross-contamination with e.g. fungal spores. To set
the traps, two sticks 1.5 m in length were hammered to the
ground and a trap was fastened to them about 1.2 m above the
ground. Each trap was labelled and a global positioning system (GPS) coordinates were recorded in order to set the traps
at the same position each year. Sampling was carried out from
the beginning of June until the end of August in the years
2012, 2013, and 2014. During the sampling period, traps were
visited once a week and sticky inserts with trapped insects
were collected and replaced with new inserts. Collected inserts
were transported the same day to the laboratory and examined
under Carl Zeiss Stemi 2000-C dissection microscope
(Oberkochen, Germany). When the beetles of S. multistriatus
were detected, they were individually placed into 2-mL screwcap centrifugation tubes and stored at −20 °C until further
DNA processing.
DNA isolation, amplification and sequencing
Total DNA was isolated separately from each beetle. No
surface sterilisation was carried out. Prior to isolation of
DNA, the beetles were freeze-dried at −60 °C for 2 days,
and together with glass beads were homogenized for
2 min at 5000 rpm using a Fast prep shaker (Precellys
24, Bertin Technologies, Rockville, MD). Then, 800 μL
of CTAB extraction buffer (3 % cetyltrimethylammonium
bromide, 2 mM EDTA, 150 mM Tris–HCl, 2.6 M NaCl,
Mycol Progress (2016) 15:55
pH 8) was added to each tube, followed by incubation at
65 °C for 1 h. After centrifugation, the supernatant was
transferred to new 1.5-mL centrifugation tubes and then
mixed with 1 volume of chloroform by gentle vortexing.
After centrifugation for 8 min at 10000 rpm, the supernatant was precipitated with 2 volumes of cold
isopropanol, washed with 70 % ethanol and dissolved
in 50 μL TE buffer. Additionally, isolated DNA was purified using JETquick DNA Clean-Up System (Genomed,
Löhne, Germany). In each sample, concentration of genomic DNA was determined using a ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE).
Diluted (1–10 ng/μL) genomic DNA samples were amplified separately using the primer pair fITS9 (5′GAACGCAGCRAAIIGYGA-3′) (Ihrmark et al. 2012)
and ITS4 (5′-xxxxxxxxTCCTCCGCTTATTGATATGC3′) (White et al. 1990) containing 8-bp sample identification barcodes denoted by x. Using this primer pair,
amplified PCR products were estimated to be between
280–420 bp in size and to include a large part of the
5.8S rRNA gene sequence, complete sequence of the
noncoding ITS2 rRNA region, and partial sequence of
the 28S rRNA gene. The PCR reactions, 50 μL in volume for each sample, were performed using an Applied
Biosystems 2720 Thermal Cycler (Applied Biosystems,
Carlsbad, CA) and DreamTaq Green DNA polymerase
(Thermo Fisher Scientific, Waltham, MA). The PCR cycle parameters consisted of an initial denaturation at
95 °C for 2 min, 27 cycles of denaturation at 95 °C
for 30 s, annealing at 55 °C for 30 s and extension at
72 °C for 45 s, followed by a final extension step at
72 °C for 7 min. The PCR products were analysed on
1 % agarose gels (Agarose D1, Conda, Madrid, Spain)
under UV using GelDocTM 2000 gel documentation system (Bio-Rad laboratories, Berkeley, CA). To purify
amplicons, they were precipitated in a mixture of 1/10
volume 3 M NaAc and 2 volumes −20 °C pure ethanol,
vortexed for 10 min, incubated for 20 min at −70 °C and
centrifuged for 5 min at 13,000 rpm. Supernatant was
discarded and dried pellets were dissolved in 30 μL
Milli-Q water. The concentration of purified PCR products was determined using Quant-iT™ dsDNA HS Assay
Kit (Life Technologies, Carlsbad, CA, USA), and an
equimolar mix of all PCR products was used for Ion
Torrent sequencing. Construction of the sequencing library and sequencing using a 316 chip was carried out
by NGI SciLifeLab (Uppsala, Sweden).
Bioinformatics
The sequences generated were subjected to quality control and
clustering in the SCATA NGS sequencing pipeline (http://
scata.mykopat.slu.se). Quality filtering of the sequences
Page 3 of 8 55
included the removal of short sequences (<200 bp),
sequences with low read quality, primer dimers, and
homopolymers. Sequences that were missing a tag or primer
were excluded. The primer and sample tags were then
removed from the sequence, but information on the
sequence association with the sample was stored as metadata. The sequences were then clustered into different taxa
using single-linkage clustering based on 98.5 % similarity.
The most common genotype for clusters was used to represent
each taxon. For clusters containing two sequences, a consensus sequence was produced. The fungal taxa were taxonomically identified using GenBank (NCBI) database and the
Blastn algorithm. The criteria used for identification were:
sequence coverage > 80 %; similarity to taxon level 98–
100 %, similarity to genus level 94–97 %. Sequences not
matching these criteria were considered unidentified and were
given unique names, as shown in Supplementary Table 1.
Statistical analyses
As both qualitative and quantitative data of high-throughput
sequencing was shown to be consistent and highly reproducible (Porazinska et al. 2010), the number of read counts was
used to estimate relative abundance of fungal taxa in the samples. The abundance of S. multistriatus and of DED fungi in
different sampling years was compared by non-parametric
chi-squared tests calculated from the actual number of observations (Mead and Curnow 1983). As the datasets were subjected to multiple comparisons, confidence limits for p-values
of the chi-squared tests were reduced a corresponding number
of times, as required by the Bonferroni correction (Sokal and
Rohlf 1995). The rarefaction analysis was performed using
Analytical Rarefaction v.1.3 available at http://www.uga.edu/
strata/software/index.html. The rarefaction analysis was
carried out to reveal the relationship between the cumulative
number of taxa found and the sequencing intensity (Colwell
and Coddington 1994).
Results
During three sampling years, 177 beetles of
S. multistriatus were trapped, or on average, 0.59 beetle
per year per trap. Information on the number of beetles
trapped (data pooled from both sites) during each year
(2012, 2013, and 2014) and mean temperatures are shown
in Fig. 1. There were 47.5 % of S. multistriatus trapped in
2012, 21.5 % in 2013, and 31.0 % in 2014, and a chisquared test showed that it was significantly higher in
2012 than in 2013 or 2014 (p<0.003), but the number of
beetles were not significantly different between 2013 and
2014. In all years, 6.2 % of S. multistriatus were trapped
in June, 76.8 % in July, and 16.9 % in August, and it was
55
Page 4 of 8
Mycol Progress (2016) 15:55
Fig. 1 Bars show relative
abundance of Scolytus
multistriatus beetles trapped/
collected (data pooled from both
sites) and lines show mean
temperatures (retrieved from
http://luftwebb.smhi.se) during
June-August of 2012, 2013, and
2014 on the island of Gotland
significantly higher in July than in June or August
(p<0.0001), and significantly higher in August than in
June (p<0.007).
A total of 9,914,812 sequences were generated by Ion
Torrent sequencing from the 177 beetles. Of those, 9,474,
995 (95.6 %) did not pass quality control and were thus excluded. Clustering of the remaining 439,817 high-quality sequences (272 bp on average) resulted in 1764 non-singleton
contigs and 2745 singleton contigs, which were excluded
from the further analyses. Among the non-singletons, 1589
contigs (90.1 %) represented fungi, 163 (9.2 %) plants, nine
(0.5 %) animals, and three (0.2 %) protists. A plot of fungal
taxa vs. the number of sequences resulted in rarefaction curves
that reached the asymptote (Fig. 2). There were between two
and 158 fungal taxa detected per individual beetle that comprised 67.6 % Ascomycota, 31.0 % Basidiomycota, 0.7 %
Mortierellomycotina, 0.4 % Chytridiomycota, 0.2 %
Glomeromycota, and 0.1 % Mucoromycotina (representative
ITS rDNA fungal sequences of all non-singletons are
Fig. 2 Rarefaction curve
showing the relationship between
the cumulative number of fungal
taxa and the number of ITS rDNA
fungal sequences obtained from
177 beetles of S. multistriatus
sampled on the island of Gotland
available from GenBank under accession numbers
KP890936 - KP892524). Identification at least to genus level
was successful for 928 (58.4 %) out of 1589 fungal taxa. The
most common taxa were Cladosporium sp. 2170_0 (37.9 %),
O. novo-ulmi (9.0 %), Aureobasidium pullulans (7.5 %),
Dioszegia fristingensis (4.9 %), and Cryptococcus wieringae
(3.9 %). Information on the 30 most common fungal taxa
representing 90.1 % of all fungal sequences is shown in the
Table 1. The remaining 1559 taxa were relatively rare and
their relative abundances varied between 0.3 % and
0.00005 % (Supplementary Table 1).
In the present study, both DED pathogens, i.e. less virulent
O. ulmi and virulent O. novo-ulmi, were detected by ITS
rDNA sequencing of S. multistriatus beetles (Supplementary
Table 1). However, O. ulmi was detected in a single (0.6 %)
beetle while O. novo-ulmi was detected in 79 (44.6 %) beetles
(difference significantly at p<0.0001). O. ulmi was detected at
Hogrän in 2012, while O. novo-ulmi was detected on both
sites and during the entire sampling period (Table 2). The
Mycol Progress (2016) 15:55
Table 1 List of the 30 most
common fungal taxa found in 177
beetles of S. multistriatus sampled
on the island of Gotland
Page 5 of 8 55
Taxon
Reference
sequence
Sequence
length
Similarity,
(%)*
No. of
sequences
Frequency of
occurrence, (%)
Ascomycota
Cladosporium sp. 2170_0
HG530747
262
162589
37.9
Ophiostoma novo-ulmi
EF638891
329
38632
9.0
Aureobasidium pullulans
Cordyceps confragosa
Epicoccum nigrum
Candida sp. 2170_19
KM388542
KJ529005
KM396372
KF057719
268
274
268
212
32113
11159
7891
6873
7.5
2.6
1.8
1.6
Fusarium tricinctum
KM249082
277
6190
1.4
Alternaria sp. 2170_10
Candida sp. 2170_12
Beauveria bassiana
Penicillium kojigenum
Alternaria rosae
Sphaerosporella
sp. 2170_23
Geosmithia flava
Botryotinia fuckeliana
Rachicladosporium
eucalypti
Periconia byssoides
Pyrenophora triticirepentis
All Ascomycota
Basidiomycota
Dioszegia fristingensis
Cryptococcus wieringae
Cryptococcus albidus
KF728750
EU491501
KM114549
AM236584
KF815569
JQ711781
271
307
274
276
271
226
262/262
(100)
327/327
(100)
267/268 (99)
273/274 (99)
267/268 (99)
174/174
(100)
277/277
(100)
270/271 (99)
292/307 (95)
273/274 (99)
275/276 (99)
270/271 (99)
216/226 (96)
5554
4858
4265
4241
2879
2314
1.3
1.1
1.0
1.0
0.7
0.5
KJ513214
KJ476441
KP004448
287
260
232
286/287 (99)
259/260 (99)
227/232 (98)
1923
1388
1334
0.4
0.3
0.3
KC954160
KM011994
268
268
267/268 (99)
267/268 (99)
1264
1201
0.3
0.3
296668
69.2
20968
16636
10385
4.9
3.9
2.4
8829
8213
2.1
1.9
5692
4311
4102
3518
1.3
1.0
1.0
0.8
2962
0.7
1910
0.4
1788
89314
0.4
20.8
EU070927
KF981864
KJ589643
236
348
333
Udeniomyces pannonicus
Dioszegia crocea
AB072229
GQ911539
345
239
Cystofilobasidium macerans
Cryptococcus stepposus
Mrakiella aquatica
Cryptococcus victoriae
JX188155
JX188129
GQ911547
KM376411
347
355
345
221
Sporobolomyces roseus
KM376382
319
Dioszegia butyracea
EU266508
236
Melampsora caprearum
All Basidiomycota
AY444779
342
235/236 (99)
347/348 (99)
333/333
(100)
341/342 (99)
239/239
(100)
346/347 (99)
354/355 (99)
344/345 (99)
221/221
(100)
319/319
(100)
236/236
(100)
340/342 (99)
* Sequence similarity column shows base pairs compared between the query sequence and the reference sequence
at NCBI database, and the percentage of sequence similarity in the parenthesis
proportion of S. multistriatus infested with O. novo-ulmi did
not differ significantly between two sampling sites.
Differences among years (data pooled from both sites) were
significant, with 13.0 % of beetles infested in 2012, 4.0 % in
2013, and 27.7 % in 2014 (p<0.002) (Table 2). Relative abundance of vectored O. novo-ulmi (estimated as a proportion of
all fungal sequences) also differed significantly among the
years, being 0.8 % in 2012, 0.002 % in 2013, and 8.2 % in
55
Mycol Progress (2016) 15:55
Page 6 of 8
Table 2 Relative abundance of Scolytus multistriatus beetles infested
with Ophiostoma novo-ulmi (shown as a proportion of all beetles), and
relative abundance of vectored O. novo-ulmi (shown as a proportion of all
fungal sequences) in different study sites and sampling years
Sampling year
2012
2013
2014
All
Beetles-infested
Vectored O. novo-ulmi
Hogrän
Vallstena
All
Hogrän
Vallstena
All
11.7 a
3.6 b
27.0 c
42.3
17.5 ab
5.0 a
30.0 b
52.5
13.0
4.0
27.7
44.6
1.2 a
0.0 b
11.2 c
12.4
0.0 a
0.0 a
2.4 b
2.4
0.8
0.0
8.2
9.0
Within columns of respective study site, values followed by the same
letter are not significantly different
2014 (p<0.0001) (Table 2). Although several other
ophiostomatoid fungi have also been detected, these were
identified to the genus level (Supplementary Table 1).
Discussion
The results showed that both O. ulmi and O. novo-ulmi were
present in Gotland. However, the occasional occurrence of
O. ulmi suggests that, as elsewhere, it is being replaced by
O. novo-ulmi (Brasier et al. 2004). Brasier et al. (2004) reported that O. novo-ulmi replaced O. ulmi at a relative incidence of
about 10 % per year at each location. Taken into consideration
that O. novo-ulmi was probably introduced to Gotland ten
years ago (Östbrant et al. 2009), O. ulmi should only occasionally occur or even be completely replaced, which corroborates the results of the present study. Although most of the
beetles were trapped in 2012, in 2012 a proportion of the
beetles infested with O. novo-ulmi and the abundance of vectored inoculum (estimated as a proportion of O. novo-ulmi
sequences) was relatively low and further decreased in 2013
(Table 2). In 2014, however, both of these estimates have
sharply increased even when compared to levels observed in
2012 (Table 2), showing that association between
S. multistriatus and O. novo-ulmi is very dynamic. It appears
that abundance of the beetles infested with O. novo-ulmi is
largely dependent on the accuracy of the control measures
implemented. Consequently, until 2014 all DED-infested elms
were harvested and destroyed each year, which has likely
resulted in steady decline of the beetles infested with O.
novo-ulmi. In 2014, however, due to administrative issues
952 out of 3419 DED-diseased elms were left standing during
the entire flying season of S. multistriatus (Inga-Lena
Östbrant, Swedish Forest Agency), which likely resulted in
the significant increase of beetles vectoring O. novo-ulmi
(Table 2). The latter shows that the population of S.
multistriatus infested with O. novo-ulmi may recover in a
single flying season. This is not surprising, as mutualistic
association between S. multistriatus and DED fungi is well
established (Santini and Faccoli 2015). Nevertheless, the
forthcoming availability of even more powerful molecular
and genomic tools can be expected to provide new insights
into the DED pathosystem and open possibilities for development of new control strategies (Bernier et al. 2014).
In the present study, despite the use of delta traps that resulted in a relatively small number of trapped beetles of
S. multistriatus compared to results using other type of traps
(e.g. window traps) (Menkis et al. 2016), delta traps prevented
cross-contamination among individual beetles (54.8 % of all
beetles were not infected by DED), thereby allowing abundance monitoring of the beetles vectoring DED each year.
However, in order to more precisely monitor the flying intensity of S. multistriatus, window traps or Lindgren funnel trap
(Johnson et al. 2008), instead of delta traps, should probably
be used to obtain higher yields of beetles. Although it is acknowledged that S. multistriatus may vector Ophiostoma spp.
(Ploetz et al. 2013), information on other fungal taxa vectored
is scarce. In the present study, the use of high-throughput
sequencing showed that S. multistriatus vectors a highly diverse fungal community (Supplementary Table 1).
Furthermore, rarefaction analysis showed that a great majority
of fungal taxa was detected (Fig. 2) thereby highlighting the
efficacy of the sequencing method even though only a relatively small proportion of all sequences was of high quality
and could be used in analyses. The detected richness of fungal
taxa was one or two orders of magnitude as compared to
similar studies, which were based on fungal culturing and/or
direct Sanger sequencing (Davydenko et al. 2014; Persson
et al. 2009), showing that our detection method allowed indepth analysis of fungal communities associated with
S. multistriatus. However, there is increasing evidence that
fungal culturing and sequencing methods are both needed,
and should be regarded as complementary, to obtain a complete picture of fungal communities associated with beetles
(Giordano et al. 2012; Lim et al. 2005). Furthermore, our data
corroborates previous observations that fungi from the phylum Ascomycota are predominantly associated with the bark
beetles (Davydenko et al. 2014; Persson et al. 2009). Among
different bark beetle species, probably the best described are
interactions between the European spruce bark beetle (Ips
typographus L.) and ophiostomatoid fungi, which, depending
on the fungal species, may have variable effects including
antagonism, commensalism or mutualism (Vega and
Blackwell 2005). In the present study, Cladosporium sp.
2170_0 dominated the fungal community vectored by
S. multistriatus (Table 1). The genus Cladosporium
(Ascomycota) includes over 500 different fungal taxa of common moulds, saprotrophs, and plant and fungal pathogens that
are all characterised by dark-pigmented mycelium (Domsch
et al. 2007). Among other fungi, yeasts from the genera
Dioszegia, Cryptococcus, Udeniomyces, Candida,
Mycol Progress (2016) 15:55
Mrakiella, and Sporobolomyces were very common (Table 1).
Similarly, a number of different yeasts were reported previously, which let to suggestion on a very long association between some yeasts and bark beetles (Giordano et al. 2012;
Persson et al. 2009). Fungi from the genus Geosmithia were
also detected (Table 1, Supplementary Table 1). While
Geosmithia is known to develop stable symbioses with different bark beetle species (Kolarik and Jankowiak 2013; Kolarik
et al. 2008), the results of the present study expand knowledge
on the host, ecology, and distribution in Europe. The detected
fungi also included a number of entomopathogens, among
which Beauveria bassiana (Bals.-Criv.) Vuill. and
Paecilomyces fumosoroseus (Wize) A.H.S.Br. & G.Sm. were
shown to infect larvae of S. multistriatus more efficiently than
other fungi tested (Houle et al. 1987). Interestingly, recently
described ubiquitous soil fungi of the genus
Archaeorhizomyces (Menkis et al. 2014; Rosling et al. 2011)
were also detected (Supplementary Table 1). Although reproduction structures and dispersal strategy of these fungi are
largely unknown, the current observation in beetles provides
new insights into their biology and ecology. Taken together,
the study demonstrated that S. multistriatus vectors different
functional groups of fungi and that some of these may have a
direct negative effect on the insect itself and on colonised elm
trees.
The flying intensity of S. multistriatus in Gotland varied among different years (Fig. 1). Bartels and Lanier
(1974) showed that S. multistriatus did not emerge from
the trees when the temperature was at or below 20 °C. In
Gotland, a majority of the beetles were trapped each year
at or above 16 °C (Fig. 1), suggesting a certain temperature specificity of S. multistriatus in Gotland but at the
same time corroborating a finding by Bartels and Lanier
(1974) that the activity of S. multistriatus is temperature
dependent. Besides, attractiveness of the bark beetles to
the traps is not increased by a combination of different
bark beetle attractants (Wang et al. 2014) or different supplementary chemicals (Edde et al. 2011). Taken together,
this may suggest that flying intensity of the beetles in
Gotland is mainly influenced by the environmental conditions of each year. Within a year, however, flying intensity of S. multistriatus was more or less consistent, being
highest in July, then in August, and lowest in June
(Fig. 1). This information is of key practical importance,
demonstrating that in case harvesting and destruction of
DED-diseased elms is not completed before the beginning
of the flying season of S. multistriatus, it should be continued and completed before July, which will result in
only minor release of the beetles vectoring DED.
Moreover, it demonstrates that an extensive use of the
pheromone traps alone was shown to have little or no
reduction effect on the population of S. multistriatus
(Paine et al. 1984).
Page 7 of 8 55
Conclusions
This study demonstrated that S. multistriatus exhibits highest
flying intensity during July each year, and that the proportion
of the beetles vectoring O. novo-ulmi has increased in recent
years.
Acknowledgments We thank Diem Nguyen at the Dept. of Forest
Mycology and Plant Pathology, SLU, for language revision and Karin
Wågström at the Swedish Forest Agency for help with the field work. The
financial support is gratefully acknowledged from Foundation Oscar and
Lili Lamms Minne, Carl Tryggers Foundation, the Swedish Research
Council Formas, and the EU Life+ Nature Elmias (LIFE12 NAT/SE/
001139) project.
Compliance with ethical standards
Conflict of interest The authors declare that they have no conflicts of
interest.
References
Bartels JM, Lanier GN (1974) Emergence and mating in Scolytus
multistriatus (Coleoptera, Scolytidae). Ann Entomol Soc Am 67:
365–370
Bellows TS, Meisenbacher C, Reardon RC (1998) European elm bark
beetle biological control. Paper presented at the Biological control of
arthropod forest pests of the western United States: a review and
recommendations. USDA Forest Service, FHTET–96–21, The
University of Georgia, and Southern Forest Insect Work
Conference. Available from http://www.barkbeetles.org/Biocontol/
europeanelmbarkbeetle.html Accessed 15 January 2016
Bernier L, Aoun M, Bouvet GF, Comeau A, Dufour J, Naruzawa ES,
Nigg M, Plourde KV (2014) Genomics of the Dutch elm disease
pathosystem: are we there yet? iForest 8:149–157. doi:10.3832/
ifor1211-008
Brasier CM, Mehrotra MD (1995) Ophiostoma himal-ulmi sp. nov., a
new species of Dutch elm disease fungus endemic to the
Himalayas. Mycol Res 99:205–215
Brasier CM, Buck K, Paoletti M, Crawford L, Kirk S (2004) Molecular
analysis of evolutionary changes in populations of Ophiostma novoulmi. For Res Syst 13:93–103
Brockerhoff EG, Knížek M, Bain J (2003) Checklist of indigenous and
adventive bark and ambrosia beetles (Curculionidae: Scolytinae and
Platypodinae) of New Zealand and interceptions of exotic species
(1952–2000). N Z Entomol 26:29–44. doi:10.1080/00779962.2003.
9722106
Colwell RK, Coddington JA (1994) Estimating terrestrial biodiversity
through extrapolation. Philos Trans R Soc London Ser Biol Sci
345:101–118
Davydenko K, Vasaitis R, Meshkova V, Menkis A (2014) Fungi associated with the red-haired bark beetle, Hylurgus ligniperda
(Coleoptera: Curculionidae) in the forest-steppe zone in eastern
Ukraine. Eur J Entomol 111:561–565. doi:10.14411/eje.2014.070
Domsch KH, Gams W, Anderson TH (2007) Compendium of soil fungi.
IHW-Verlag, Eching
Edde PA, Toews MD, Phillips TW (2011) Effects of various semiochemicals on the responses of Rhyzopertha dominica to pheromone traps
in the field. Ann Entomol Soc Am 104:1297–1302. doi:10.1603/
an11090
55
Page 8 of 8
Giordano L, Garbelotto M, Nicolotti G, Gonthier P (2012)
Characterization of fungal communities associated with the bark
beetle Ips typographus varies depending on detection method, location, and beetle population levels. Mycol Prog 12:127–140. doi:10.
1007/s11557-012-0822-1
Houle C, Hartmann GC, Wasti SS (1987) Infectivity of 8 species of
entomogenous fungi to the larvae of the elm bark beetle, Scolytus
multistriatus (Marsham). J NY Entomol Soc 95:14–18
Ihrmark K, Bodeker ITM, Cruz-Martinez K, Friberg H, Kubartova A,
Schenck J, Strid Y, Stenlid J, Brandstrom-Durling M,
Clemmensen KE, Lindahl BD (2012) New primers to amplify the
fungal ITS2 region - evaluation by 454-sequencing of artificial and
natural communities. FEMS Microbiol Ecol 82:666–677. doi:10.
1111/j.1574-6941.2012.01437.x
Johnson PL, Hayes JL, Rinehart J, Sheppard WS, Smith SE (2008)
Characterization of two non-native invasive bark beetles, Scolytus
schevyrewi and Scolytus multistriatus (Coleoptera: Curculionidae:
Scolytinae). Can Entomol 140:527–538
Kirisits T (2013) Dutch Elm Disease and Other Ophiostoma Diseases. In:
Gonthier P, Nicolotti G (eds) Infectious Forest Diseases. CABI, pp
256–282
Kolarik M, Jankowiak R (2013) Vector affinity and diversity of
Geosmithia fungi living on subcortical insects inhabiting Pinaceae
species in central and northeastern Europe. Microb Ecol 66:682–
700. doi:10.1007/s00248-013-0228-x
Kolarik M, Kubatova A, Hulcr J, Pazoutova S (2008) Geosmithia fungi
are highly diverse and consistent bark beetle associates: Evidence
from their community structure in temperate europe. Microb Ecol
55:65–80. doi:10.1007/s00248-007-9251-0
Lee JC, Aguayo I, Aslin R, Durham G, Hamud SM, Moltzan BD,
Munson AS, Negron JF, Peterson T, Ragenovich IR, Witcosky JJ,
Seybold SJ (2009) Co-occurrence of the invasive banded and
European elm bark beetles (Coleoptera: Scolytidae) in North
America. Ann Entomol Soc Am 102:426–436
Lim YW, Kim JJ, Lu M, Breuil C (2005) Determining fungal diversity on
Dendroctonus ponderosae and Ips pini affecting lodgepole pine
using cultural and molecular methods. Fungal Divers 19:79–94
Mead R, Curnow RN (1983) Statistical methods in agriculture and experimental biology. Chapman & Hall, London
Menkis A, Urbina H, James TY, Rosling A (2014) Archaeorhizomyces
borealis sp. nov. and a sequence-based classification of related soil
fungal species. Fungal Biol 118:943–955. doi:10.1016/j.funbio.
2014.08.005
Menkis A, Östbrant I-L, Wågström K, Vasaitis R (2016) Dutch elm disease on the island of Gotland: monitoring disease vector and combat
measures. Scand J For Res 31:237–241. doi:10.1080/02827581.
2015.1076888
Östbrant IL, Wågström K, Persson M, Smedberg AL (2009) Holländsk
almsjuka. Ophiostoma novo-ulmi i Gotlands län år 2009 Dutch elm
disease. Ophiostoma novo-ulmi in county of Gotland year 2009.
Länsstyrelsen Gotlands Län, Dnr:640-7109-09 (In Swedish)
Mycol Progress (2016) 15:55
Paine TD, Birch MC, Miller JC (1984) Use of pheromone traps to suppress populations of Scolytus multistriatus (Marsham) (Coleoptera,
Solytidae) in 3 isolated communities of elms. Agric Ecosyst Environ
11:309–318. doi:10.1016/0167-8809(84)90004-5
Parbery DG, Rumba KA (1991) Michenera artocreas in elm wood
infested with Scolytus multistriatus in Australia. Mycol Res 95:
761–762. doi:10.1016/S0953-7562(09)80829-0
Persson Y, Vasaitis R, Langstrom B, Ohrn P, Ihrmark K, Stenlid J (2009)
Fungi vectored by the bark beetle Ips typographus following hibernation under the bark of standing trees and in the forest litter. Microb
Ecol 58:651–659. doi:10.1007/s00248-009-9520-1
Phillips DH, Burdekin DA (1982) Diseases of forest and ornamental
trees. The Macmillan Press, London
Ploetz RC, Hulcr J, Wingfield MJ, de Beer ZW (2013) Destructive tree
diseases associated with ambrosia and bark beetles: black swan
events in tree pathology? Plant Dis 97:856–872. doi:10.1094/pdis01-13-0056-fe
Porazinska DL, Sung W, Giblin-Davis RM, Thomas WK (2010)
Reproducibility of read numbers in high-throughput sequencing
analysis of nematode community composition and structure. Mol
Ecol Resour 10:666–676. doi:10.1111/j.1755-0998.2009.02819.x
Rosling A, Cox F, Cruz-Martinez K, Ihrmark K, Grelet GA, Lindahl BD,
Menkis A, James TY (2011) Archaeorhizomycetes: unearthing an
ancient class of ubiquitous soil fungi. Science 333:876–879. doi:10.
1126/science.1206958
Santini A, Faccoli M (2015) Dutch elm disease and elm bark beetles: a
century of association (Dutch elm disease and elm bark beetles: a
century of association). iForest 8:126–134. doi:10.3832/ifor1231-008
Schlyter F, Anderbrant O, Lindquist G, Jansson A (1987) Dutch elm
disease (Ceratocystis ulmi) and elm bark beetles in Malmö town
1985 - distribution, phenology and practical measures in an integrated control program. Vaxtskyddsnotiser 51:2–10
Sokal RR, Rohlf FJ (1995) Biometry: the principles and practice of statistics
in biological research, 3rd edn. W.H. Freeman and Co, New York
Vega FE, Blackwell M (2005) Insect-fungal associations: ecology and
evolution. Oxford University Press, Oxford
Wang Y-P, Guo R, Deng J-Y, Zhang Z (2014) Field efficacy of combinations of attractants for bark beetles and longicorn beetles in trapping
wood-boring beetles. Acta Entomol Sin 56:452–456
Webber JF (1990) Relative effectiveness of Scolytus scolytus,
S. multistriatus and S. kirschi as vectors of Dutch elm disease. Eur
J For Pathol 20:184–192. doi:10.1111/j.1439-0329.1990.tb01129.x
White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In:
Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols:
A guide to methods and applications. Academic Press, Inc, San
Diego, pp 315–322
Wood SL (1982) The bark and ambrosia beetles of North and Central
America (Coleoptera: Scolytidae), a taxonomic monograph. Great
Basin Nat Mem 6:1–359