3222–3228 Nucleic Acids Research, 1996, Vol. 24, No. 16
 1996 Oxford University Press
Identification of in vivo target RNA sequences bound
by thymidylate synthase
Edward Chu*, Tiziana Cogliati, Sitki M. Copur, Aldo Borre, Donna M. Voeller,
Carmen J. Allegra and Shoshana Segal
NCI–Navy Medical Oncology Branch, National Cancer Institute, National Institutes of Health, Bethesda,
MD 20889-5105, USA
Received April 17, 1996; Revised and Accepted June 26, 1996
ABSTRACT
We developed an immunoprecipitation–RNA-random
PCR (rPCR) method to isolate cellular RNA sequences
that bind to the folate-dependent enzyme thymidylate
synthase (TS). Using this approach, nine different
cellular RNAs that formed a ribonucleoprotein (RNP)
complex with thymidylate synthase (TS) in human
colon cancer cells were identified. RNA binding
experiments revealed that seven of these RNAs bound
TS with relatively high affinity (IC50 values ranging
from 1.5 to 6 nM). One of the RNAs was shown to
encode the interferon (IFN)-induced 15 kDa protein.
Western immunoblot analyses demonstrated that the
level of IFN-induced 15 kDa protein was significantly
decreased in human colon cancer H630-R10 cells
compared with parent H630 cells. While the level of
IFN-induced 15 kDa mRNA expression was the same in
parent and TS-overexpressing cell lines, the level of
IFN-induced 15 kDa RNA bound to TS in the form of a
RNP complex was markedly higher in H630-R10 cells
relative to parent H630 cells. These studies begin to
define a number of cellular target RNA sequences with
which TS interacts and suggest that these TS
protein–cellular RNA interactions may have a
biological role.
INTRODUCTION
Thymidylate synthase (TS) is a folate-dependent enzyme that
catalyzes the reductive methylation of 2′-deoxyuridine-5′-monophosphate by the reduced folate 5,10-methylenetetrahydrofolate
to form thymidylate (1). Given that the TS-catalyzed enzymatic
reaction provides the sole intracellular de novo source of
thymidylate, an essential precursor for DNA biosynthesis, this
enzyme is an important target for cancer chemotherapy (2,3).
Although its critical role in catalysis and cellular metabolism
has been well characterized, it is now appreciated that TS also
functions as an RNA binding protein (4,5). Experiments using an
in vitro translation system (rabbit reticulocyte lysate) revealed
that translation of human TS mRNA is controlled by its own
protein product via a negative autoregulatory mechanism. The
translational repression of TS mRNA is mediated by specific
binding of TS to two different cis-acting elements on its own
mRNA. The first site is contained within the first 188 nt of the
mRNA and includes the translational start site in a putative
stem–loop structure, while the second site is located within a 200
nt sequence in the protein coding region (5). Recent work has
revealed that the interaction between TS and its target TS mRNA
is exquisitely sensitive to the redox state of the protein and is
mediated by a reversible but complicated sulfhydryl switch
mechanism (6), an observation that also holds true for a number
of other RNA binding proteins (7–10).
Further evidence to support the specific interaction between TS
and its own mRNA comes from studies identifying a TS
ribonucleoprotein (RNP) complex in cultured H630 human colon
cancer cells (11). This complex consists of TS protein bound to
its own mRNA. In addition to interacting with its own mRNA, TS
forms an RNP complex both in vivo and in vitro with the mRNA
of the transcription factor c-myc (11,12). The specific cis-acting
sequence to which TS protein binds has been localized to the
C-terminal coding region. Additional studies using the rabbit
reticulocyte translation system demonstrated that binding of TS
protein to c-myc mRNA resulted in translational repression (12).
These findings, taken together, suggest that TS may be involved
in the regulation of not only its own biosynthesis but also that of
the unrelated c-myc gene.
There is now increasing evidence in the literature demonstrating
the binding of regulatory proteins to various target DNA
sequences (13–19). In contrast, relatively little work has been
done to identify RNA sequences that bind to cellular proteins in
intact cells. Given our recent results on the high affinity binding
of the mRNAs of TS and c-myc to TS protein, we investigated the
potential for TS, as an RNA binding protein, to interact with other
cellular RNAs. An immunoprecipitation–RNA-random PCR
(RNA-rPCR) method was developed to purify human cellular
RNA sequences bound to TS from actively growing cells. This
approach has led to the identification of nine RNA sequences. The
specificity of each of these RNA–TS protein interactions was
investigated by cell-free RNA binding experiments and the
results confirmed that seven of the nine newly identified RNAs
bind TS with relatively high affinity (IC50 values 1.5–6 nM).
These initial findings suggest that the immunoprecipitation–
* To whom correspondence should be addressed at present address: VA Connecticut Healthcare System, Comprehensive Cancer Center, 950 Campbell
Avenue, West Haven, CT 06516, USA
3223
Nucleic Acids
Acids Research,
Research,1994,
1996,Vol.
Vol.22,
24,No.
No.116
Nucleic
RNA-rPCR method can be used to identify target RNA species that
bind TS and that such an approach may begin to define those genes
whose expression may be under some regulatory control by TS.
MATERIALS AND METHODS
Cell culture
The H630 human colon cancer cell line and its 5-fluorouracilresistant H630-R10 subline have been previously described
(11,20). Cell lines were grown in 75 cm2 plastic tissue culture
flasks (Falcon Labware, Oxnard, CA) in RPMI 1640 growth
medium containing 10% dialyzed fetal bovine serum and 2 mM
glutamine. Dialyzed fetal bovine serum and all other tissue culture
reagents were obtained from Gibco BRL (Grand Island, NY).
Whole cell extraction and immunoprecipitation of TS
RNP complexes
Immunoprecipitation of TS RNP complexes was performed as
described by Steitz (21,22). In brief, extracts from ∼5 × 108 cells
were initially pre-cleared by incubation with pre-immune serum
(350 µl) for 30 min on ice. The cleared extract was then incubated
with TS polyclonal antibody (350 µl) for 30 min on ice to which
Immunoprecipitin (150 µl; Gibco BRL), 35 µg yeast carrier RNA
(US Biochemical, Cleveland, OH) and 30 U inhibitase (5-Prime,
3-Prime, Boulder, CO) were added for an additional 30 min.
Immunoprecipitates were centrifuged at 14 000 g for 3 min and
then washed five times with 300 µl NET-2 buffer (50 mM
Tris–HCl, pH 7.4, 150 mM NaCl and 0.05% v/v Nonidet P-40).
After addition of 300 µl NET-2 buffer, the pellets were subjected
to phenol/chloroform extraction. The supernatant containing the
nucleic acid was treated with 10 U RQ DNase (Promega,
Madison, WI) for 15 min at 37C. RNA was then extracted with
phenol/chloroform (1:1), chloroform/isoamyl alcohol (24:1) and
precipitated with 2.5 vol ethanol in the presence of 0.3 M sodium
acetate (5-Prime, 3-Prime) and 20 µg glycogen (Boehringer
Mannheim).
Reverse transcription (RT)–random PCR (rPCR)
analysis
Immunoprecipitated RNA was subjected to reverse transcription in
a reaction (50 µl) containing 50 mM Tris–HCl, pH 8.3, 10 mM DTT,
3 mM MgCl2, 500 µM each dNTP, 1 U RNase Block I (Stratagene),
50 U StrataScript reverse transcriptase (Stratagene) and 150 ng of
either the universal primer dN6 [5′-d(GCCGCTCGAGTGCAGAATTCNNNNNN)-3′] or a modified form of universal primer
dN6 [5′-d(GCCGGAATTCTGCAGAATTCNNNNNN)-3′]. The
reaction conditions were as previously described by Froussard
(23) except for the modifications as outlined below. In brief, the
RT reaction was performed at 42C for 1 h, after which the
sample was heated to 95C for 3 min and then cooled rapidly on
ice. RNase H (0.5 µl; Gibco BRL) was added and the reaction mix
was incubated at 37C for 15 min. The sample was then heated
to 95C for 3 min and cooled on ice. Synthesis of the cDNA was
then performed using Klenow fragment of DNA polymerase I.
After incubation at 37C for 30 min, the sample was purified on
a G-50 D-RF column (5-Prime, 3-Prime) to eliminate excess
universal primer dN6.
Double-stranded cDNA was then used as template for rPCR
amplification. The reagents used were those outlined by the
3223
Perkin-Elmer protocol (Perkin-Elmer, Foster City, CA) and
included 1.5 mM MgCl2. The total volume of the reaction was
100 µl. Amplification was performed using 100 pmol of either the
universal primer 5′-d(GCCGCTCGAGTGCAGAATTC)-3′ or the
modified universal primer 5′-d(GCCGGAATTCTGCAGAATTC)-3′. The samples were incubated at 94C for 1 min, 55C for
1 min, 72C for 3 min and amplified for 40 cycles. Following this
initial PCR step, a chase reaction was performed according to
previously published methods to ensure the synthesis of intact
double-stranded cDNA (24). Amplified, selected cDNA products
were resolved on a 1% non-denaturing agarose gel.
To verify the presence of TS, c-myc and IFN-induced 15 kDa
sequences in the amplified selected cDNA, PCR reactions were
performed using 100 pmol of each of the following primer sets:
TS-1, 5′-d(GAGCTCCCGAGACTTTTTGGACAGCC) 3′(sense),
TS-2, 5′-d(AAGCTTAAGAATCCTGAGCTTTGGGA)-3′ (antisense); c-myc-1, 5′-d(GGCGAACACACAACGTCTTGGAG)-3′
(sense), c-myc-2, 5′-d(GCTCAGGACATTCTGTTAGAAGG)-3′
(antisense); IFN-1, 5′-d(ACCAAGCTTCGTCTGGCTGTCCACCCGAG)-3′ (sense), IFN-2, 5′-d(ACCAAGCTTGATGCTCAGAGGTTCGTCGC)-3′ (antisense). Reactions were incubated as
previously described (11,12) at 97C for 1 min, 62C for 1 min,
72C for 1 min and amplified for 40 cycles. At the end of the last
cycle, the reactions were incubated for an additional 10 min at 72C
then cooled to 4C. PCR reactions were also performed with 30 and
35 cycles of amplification and identical results, as observed for the
40 cycle reaction, were obtained.
Library construction and screening
The cDNA products were purified using the Promega PCR Prep
kit (Promega, Madison, WI) and digested with XhoI. For
construction of the plasmid library, 1–5 ng XhoI-digested
amplified cDNA was ligated to 100 ng XhoI-digested, dephosphorylated pGEM-7Z plasmid (Promega) and the recombinant
plasmid was used to transform JM109 cells, which were grown
overnight on ampicillin LB agar plates. Colonies were lifted onto
nitrocellulose filters (25) which were then hybridized to an
[α-32P]dCTP-labeled probe representative of the cDNA used in
construction of the library (26). To confirm the presence of an
insert in all positive clones, a colony PCR method employing SP6
and T7 promoter primers was used (27).
For construction of the phage library, 1–5 ng EcoRI-digested
amplified cDNA was ligated to 100 ng EcoRI-digested, dephosphoryated Uni-Zap II vector (Stratagene, La Jolla, CA) and the
phage packaged using the Gigapack II Gold packaging extract
(Stratagene). Plaques were lifted onto nitrocellulose filters (26)
and the filters subsequently hybridized to an [α-32P]dCTPlabeled c-myc fragment corresponding to the protein coding
region or to an [α-32P]dCTP-labeled full-length TS cDNA (26).
To confirm the presence of insert-containing phages, a colony
PCR assay (27) was employed.
Plasmid preparation and in vitro mRNA transcription
Double-stranded DNA prepared from positive clones was
sequenced by the fmol DNA sequencing system (Promega) using
either the T7 or the SP6 promoter primer. DNA from selected
clones was linearized with either HindIII or XbaI and transcribed
in vitro with T7 RNA polymerase or with SP6 RNA polymerase
to generate the corresponding mRNA transcript. All in vitro
3224 Nucleic Acids Research, 1996, Vol. 24, No. 16
transcription reactions were performed as previously described
(4,5,28). Labeled RNAs were synthesized by inclusion of
[α-32P]CTP at 200 Ci/mmol in the reaction mixture. RNA
products were analyzed on 1% agarose–formaldehyde gel to
verify their integrity and size. The concentration of unlabeled
RNA was determined by measuring UV absorbance at 260 nm,
while the concentration of radioactively labeled RNAs was
determined by the specific activity.
RNA–protein binding assay
RNA electrophoretic gel mobility shift assays (EMSAs) were
performed as previously described (4,5,28). In brief, radiolabeled
RNAs (2 fmol, 100 000 c.p.m.) were incubated with TS protein
(3 pmol) for 15 min at room temperature in a reaction mixture
containing 10 mM HEPES, pH 7.4, 40 mM KCl, 3 mM MgCl2,
3 U inhibitase (5-Prime, 3-Prime), 250 mM 2-mercaptoethanol
and 5% glycerol. RNase T1 (12 U; 5-Prime, 3-Prime) was then
added for 10 min followed by 5 mg/ml heparin (Sigma, St Louis,
MO) for an additional 10 min at room temperature. The entire
reaction mix (total volume 30 µl) was resolved on a 4%
non-denaturing polyacrylamide gel (acrylamide/methylenebisacrylamide 60:1) for ∼40 min at 500 V. The gel was dried and the
bands visualized by autoradiography.
Competition experiments were performed with blue-dye
Sepharose-purified human recombinant TS protein (3 pmol,
specific activity 0.05 U/mg) (4) and radiolabeled TS mRNA (2
fmol, 100 000 c.p.m.). These conditions were selected on the
basis of control experiments using a fixed amount of radiolabeled
RNA probe with increasing TS protein concentration to determine the linearity of protein binding. Unlabeled competitor
RNAs were mixed with radiolabeled TS mRNA probe prior to
addition of TS protein. The relative binding affinity (IC50) of each
selected RNA was established by determining the concentration
at which unlabeled RNA inhibits specific binding of radiolabeled
TS mRNA by 50%. Each RNA competition experiment was
performed three to four times. Quantitation by densitometry was
done using a ScanJet Plus scanner (Hewlett Packard) and the
results analyzed by the NIH Image 1.36 software (Wayne
Rasband, National Institute of Mental Health, Bethesda, MD).
Western immunoblot analysis
H630 cells were harvested and processed as previously described
(29). Protein concentrations were determined by the BioRad
protein assay and equivalent amounts of protein (250 µg) from
each cell line were resolved by 15% SDS–PAGE according to the
method of Laemmli (30). The gels were then electroblotted onto
Schleicher & Schuell nitrocellulose membranes. Primary antibody staining was performed by incubating filter membranes
(overnight at 4C) with either an anti-TS monoclonal antibody
(1/100 dilution) (20) or an anti-ubiquitin cross-reactive protein
(URCP) polyclonal antibody (10 µg/ml) (31) that recognizes the
interferon (IFN)-induced 15 kDa protein. The membranes were
subsequently incubated with horseradish peroxidase-conjugated
secondary antibody (1/500 dilution; BioRad) for an additional 2
h (room temperature) and processed by the ECL chemiluminescent method (Amersham Life Science, Little Chalfont, UK).
Protein bands were visualized by autoradiography.
Figure 1. Immunoprecipitation–RNA-rPCR. Strategy for isolation of RNA
sequences bound to TS in vivo.
Isolation and analysis of total RNA
H630 cells were harvested and total RNA was isolated according
to methods previously described (29). After extraction, an aliquot
of 25 µg total cellular RNA was denatured, resolved on 1%
formaldehyde–agarose gel and transferred onto a Nytran filter
membrane. The membrane was hybridized to an [α-32P]dCTPlabeled DNA insert encoding the IFN-induced 15 kDa protein.
The membrane was then processed as previously described (29).
RESULTS AND DISCUSSION
While the characterization of DNA–protein interactions by
means of immunopurification of DNA–protein complexes has
been well described (15–19), significantly less work has been
done to isolate RNA–protein complexes either in vitro or in vivo.
Previous studies by Steitz and colleagues employed an immunoprecipitation method to isolate small nuclear RNAs (snRNAs)
(21,22). Using this same technique, we attempted to identify TS
RNP complexes from human colon cancer cells. However, these
initial efforts were unsuccessful, presumably due to the relatively
low level of expression of TS mRNA, ∼1000 molecules/cell,
when compared with the relatively high level of expression of the
various snRNAs, ∼105–106 molecules/cell.
To determine the range of cellular mRNA species that directly
interact with TS in intact cells, we developed the immunoprecipitation–RNA-rPCR method. The general scheme of this
approach is outlined in Figure 1. TS RNP complexes were
immunoprecipitated from human colon cancer H630-R10 cells
using an anti-TS polyclonal antibody. The TS-bound nucleic acid
was isolated by standard phenol/chloroform extraction and then
treated with RNase-free DNase to remove contaminating DNA.
3225
Nucleic Acids
Acids Research,
Research,1994,
1996,Vol.
Vol.22,
24,No.
No.116
Nucleic
Figure 2. RNA-rPCR analysis of RNAs immunoprecipitated from H630 cancer
cells. Whole cell extracts were immunoprecipitated with TS polyclonal
antibody (lanes 1–3) or with pre-immune antiserum (lane 4), treated in the
absence (lane 1) or presence (lane 3) of MMLTV reverse transcriptase and PCR
amplified using the universal primer as described in Materials and Methods. In
lane 2, the immunoprecipitated nucleic acid was treated with RNase A prior to
the reverse transcription step. The PCR-amplified cDNA products were
resolved on a 1% agarose gel stained with ethidium bromide. The migration of
free primers is indicated by the arrow.
Since the sequences of the immunoprecipitated RNAs are unknown,
a 26 nt primer containing a random hexamer at its 3′-end was
employed for synthesis of the first and second cDNA strands.
Amplification of the resulting cDNA was performed with a 20 nt
universal primer. The cDNA products were subsequently digested with the restriction enzyme XhoI and cloned into pGEM-7Z
plasmid.
The application of such an approach for isolating cellular RNA
sequences bound to TS in vivo is presented in Figure 2.
Immunoprecipitation of H630-R10 extracts with a polyclonal
anti-TS antibody followed by rPCR amplification with a 20 nt
universal primer gave rise to a population of cDNA products,
termed amplified selected cDNAs, ranging in size from 0.1 to 1.2
kb (Fig. 2, lane 3). To verify that the cDNA bound to TS in RNP
complexes was indeed a copy of cellular RNA species, various
control experiments were performed in which cellular RNAs
immunoprecipitated with TS polyclonal antibody were either
directly PCR amplified without reverse transcription (Fig. 2, lane
1) or were treated with RNase A prior to the step of reverse
transcription (Fig. 2, lane 2). Amplified cDNA products were not
detected in either case. The specificity of the immunoprecipitation reaction was confirmed when neither an unrelated antibody,
such as pre-immune antiserum (Fig. 2, lane 4), nor the absence of
an antibody (data not shown) failed to give rise to any cDNA
products.
Following cloning of the amplified selected cDNAs into the
pGEM-7Z plasmid, insert-containing clones were identified by
hybridization with an [α-32P]-labeled probe generated from the
selected cDNAs. Positive clones were then subjected to either the
colony PCR method using SP6 and T7 promoter primers (27) or
to digestion with XhoI restriction endonuclease to verify the
presence of an insert. Using this approach, nine clones were
isolated and sequenced. The DNA inserts ranged in size from 54
to 122 bp (Table 1). A search of the gene database revealed that
each of these DNAs contained homology to a sequence previously described (Tables 1 and 2). However, no significant sequence
homology was detected among these sequences.
The corresponding cRNAs for the nine inserts were subsequently synthesized in vitro. The relative binding affinities of
these RNA species to TS were then determined using the RNA gel
shift competition assay. Previous studies showed that TS binds
with relatively high affinity to its own mRNA (IC50 1 nM) as well
as to c-myc mRNA (IC50 1.5 nM). Seven of nine RNA sequences
bound to TS protein with relatively high affinity, with IC50 values
ranging from 1.5 to 6.0 nM (Table 1). RNA sequences with high
similarity to the human p53 gene (IC50 1.5 nM) and the gene
encoding human IFN-induced 15 kDa protein (IC50 1.6 nM)
respectively bound TS with an affinity nearly identical to that
previously reported for the human TS mRNA (IC50 1 nM). Five
other RNA sequences with high similarity to the human gene for
small cytoplasmic 7S RNA, human zinc finger protein 8 gene,
Aspergillus niger zinc finger protein gene, human kinesin heavy
chain gene and human mitochondrial complete gene also bound
TS with relatively high affinity. Two sequences corresponding to
18S and 28S rRNA were also found to form RNP complexes with
TS. However, in contrast to the other RNA species, competition
analysis revealed that each of these rRNAs bound TS with
significantly lower affinity (IC50 >50 nM), suggesting that they
may have been immunoprecipitated as part of a polysome complex
with TS.
Table 1. Sequence and relative binding affinities of the TS-bound RNAs
Gene sequence
Human p53 mRNA
Size of cDNA
insert (bp)
Similarity of cDNA insert
to gene sequence (%)
Relative binding
affinity (nM)
93
90
1.5
Human IFN-induced 15 kDa mRNA
123
95
1.6
Human gene for small cytoplasmic 7S RNA
102
100
2.3
Human zinc finger protein 8 mRNA
73
80
2.9
Aspergillus niger zinc finger protein mRNA
54
68
3.0
Human kinesin heavy chain mRNA
61
75
4.0
Human mitochondrial complete RNA
3225
120
98
6.0
Human 28S ribosomal RNA
76
100
> 50
Human 18S ribosomal RNA
111
100
> 50
3226 Nucleic Acids Research, 1996, Vol. 24, No. 16
Table 2. Sequences of TS-bound RNAs
1. Human p53 mRNA
5′-AAGACCTGCTCTGTGCAGGAGTGGGTTGATTCCACACGGCCGCCCGGCACCCGCGTCCGCGCCATGGGATCTACAAGCAGTCACAGCCCATG-3′
2. Human IFN-induced 15 kDa mRNA
5′-CGTCGTGCTGTCCACCCGAGCGGCTGTGGCGCTGCAGGACAGGGTCCCCCTTGCCAGCCAGGGCCTGGGCCCCGGCAGCACGGTCCTGCTGGTGGTGGACAAATGCGACGAACCACTAAGCATC-3′
3. Human gene for small cytoplasmic 7S RNA
5′-CCAGCTACTCGGGAGGCTGACCTGGGAGGATCGCTTGAGCCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAGTTCGGCATCA-3′
4. Human zinc finger protein 8 mRNA
5′-TTTACCCAGGAGGAGTGGGGGCAGTTGGACGTGACCCAGAGGGCCTTGTACGTGGAGGTGATGCTGGAGACTT-3′
5. Aspergillus niger zinc finger protein mRNA
5′-TTTCCCCCATCTTCTCTTTTCTTTCACTTTTTGCAAGGTTCTCCCATTCTGCTC-3′
6. Human kinesin heavy chain mRNA
5′-ACTTAAATAAACATCACGGTGCGAATAAAGATAAGCAAGCTGTTGAACAAGCAATTCAAAG-3′
7. Human mitochondrial RNA
5′-AGCCCAAATACACCCCCCACAGTTTATGTAGCTTACCTCCTCAAAGCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTA-3′
8. Human 28S rRNA
5′-GGATTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGCTGTGTTGTTGCCATGGTAATCCTGCTCAGTAC-3′
9. Human 18S rRNA
5′-CCGGGGGCATTCGTATTGCGCCTCTAGAGGTGAAATTCTTGGACCGGCGCAAGACGGCCGGCCAGAGCGAAAGCATTTGCCAAGAATGTTTTCATTAATCAAGAACGAACG-3′
Nucleotides with no identity to the known genomic sequence are underlined and in bold.
To investigate the potential biological relevance of TS-bound
RNA sequences, we immunoprecipitated TS RNP complexes
from H630-R10 cells, isolated the RNA fraction bound to TS and
performed RT–PCR amplification using primers specific for the
IFN-induced 15 kDa gene. This immunoprecipitation gave rise to
a 123 nt RNA fragment (Fig. 3, lane 5). In contrast, no detectable
level of IFN-induced 15 kDa mRNA was complexed to TS in
H630 cells that express ∼20-fold less TS protein (Fig. 3, lane 4).
The specificity of antibody recognition was confirmed by using
pre-immune antiserum in the immunoprecipitation reaction and
no DNA product was amplified (Fig. 3, lane 6). As controls, we
performed the following: (i) the immunoprecipitated nucleic acid
was treated with RNase prior to RT–PCR amplification (Fig. 3, lane
7); (ii) the immunoprecipitated nucleic acid fraction was subjected
to direct PCR amplification (Fig. 3, lane 8). In neither case was an
amplified cDNA product detected. Although the level of IFNinduced 15 kDa mRNA bound to TS protein in the form of a RNP
complex was significantly higher in TS-overexpressing H630-R10
cells, the level of mRNA expression in both cell lines (H630 and
H630-R10) was nearly the same, as determined by RT–PCR (Fig.
3, lanes 2 and 3) and by Northern blot analysis (Fig. 4C).
To determine the potential biological effect of the binding of TS
protein to the IFN-induced 15 kDa mRNA, the level of expression
of the 15 kDa protein product in H630 and H630-R10 cells was
determined. A striking inverse relationship was observed between
the level of expression of TS and the 15 kDa protein (Fig. 4). In
H630-R10 cells expressing 20-fold higher levels of TS relative to
their H630 parental cells, significantly lower levels (7-fold) of the
15 kDa protein were observed (Fig. 4). To lend further support to
Figure 3. Analysis of total cellular RNAs and immunoprecipitated RNAs from
human colon cancer cells. Total RNAs isolated from parent H630 (lane 2) and
resistant H630-R10 (lane 3) cells were RT–PCR amplified using IFN-induced 15
kDa protein-specific primers. Whole-cell extracts from H630 (lane 4) and
H630-R10 cells (lanes 5, 7 and 8) were immunoprecipitated with TS polyclonal
antibody. In lane 6, H630-R10 cell extracts were immunoprecipitated with
pre-immune antiserum; in lane 7, the immunoprecipitated nucleic acid fraction was
treated with RNase A prior to reverse transcription; in lane 8, the immunoprecipitated nucleic acid fraction was PCR amplified without the reverse transcription
reaction. A control PCR reaction was performed with primers and no DNA
template (lane 1). The 123 nt DNA product is indicated by the arrow.
the role of TS in regulating expression of the 15 kDa protein, we
investigated revertants of H630-R10 cells. These H630-R10rev
cells were established by growing H630-R10 cells in the absence
of the selective pressure of fluoropyrimidine. The level of TS
protein in these revertant cells dropped to the same level seen in
the parental H630 cell line (Fig. 4A) and the level of expression
of the 15 kDa protein in the H630-R10rev cells was restored to a
level approaching that observed in H630 cells (Fig. 4B). Since the
3227
Nucleic Acids
Acids Research,
Research,1994,
1996,Vol.
Vol.22,
24,No.
No.116
Nucleic
Figure 4. Western immunoblot analysis of (A) TS and (B) IFN-induced 15 kDa
protein in human colon cancer cells. Equal amounts (250 µg) from human colon
cancer H630 (lane 1), H630-R10 (lane 2) and H630-R10rev (lane 3) cells were
loaded onto each lane and TS protein was detected by immunoblot analysis
using an anti-TS monoclonal antibody as described in Materials and Methods.
Filter membranes were stripped and re-probed with an anti-URCP polyclonal
antibody (31). (C) Northern blot analysis of IFN-induced 15 kDa mRNA in
H630 (lane 1), H630-R10 (lane 2) and H630-R10rev (lane 3). Total RNA (25
µg) from each cell line was fractionated on a 1% formaldehyde–agarose gel,
transferred onto a Nytran filter membrane and hybridized with an
[α-32P]-labeled IFN-induced 15 kDA cDNA insert. Quantitation of signal
intensities was performed by densitometric scanning.
level of expression of the mRNA for the 15 kDa protein was
nearly the same in parent H630, resistant H630-R10 and revertant
H630-R10 cells (Fig. 4C), these findings suggest that synthesis of
the 15 kDa IFN-induced protein is controlled, in part, at the
translational level. Furthermore, expression of 15 kDa protein in
cells overexpressing TS may be regulated via direct binding of TS
to the 15 kDa mRNA.
In this manuscript, we employed an immunoprecipitation–
RNA-rPCR method to identify cellular RNA sequences that bind
to TS in intact cells. This new approach has several important
advantages over previously developed methods. First, using the
rPCR step, picomole amounts of immunoprecipitated RNA can
be amplified and employed. Second, the effects of efficiency of
recovery at each step is greatly minimized by inclusion of the
amplification reaction. As a result, the selection process can be
designed to allow for maximal stringency. Third, the use of
universal random primers in both the reverse transcription and
PCR amplification steps readily allows for the isolation of
TS-bound cellular mRNAs whose sequences are unknown. This
is in marked contrast to the immunoprecipitation–RT–PCR
method, where sequences of the bound mRNAs are already
known, thereby requiring gene-specific primers to be employed
in the amplification reaction. Fourth, the amplified selected
cDNAs can be cloned directly into either a plasmid or phage
vector and, finally, the relative binding affinities of RNA to TS
protein can be rapidly determined by RNA gel shift competition
assays.
In the present report, a plasmid cDNA library was constructed to
isolate novel RNA sequences that interact with TS. Of note, a
Uni-Zap phage library was also constructed. Previous studies have
shown that TS RNP complexes contain both TS and c-myc mRNAs.
Although these mRNAs were not present in the plasmid library, they
3227
were detected in the λ cDNA library (data not shown), demonstrating that this library contains a more complete representation of the
cellular RNAs that form RNP complexes with TS.
Recent studies have demonstrated that RNA binding proteins
can interact with more than one RNA species (32–37). The results
presented herein support this concept. Comparative analysis of
the nine sequences isolated from the plasmid library with those of
TS and c-Myc have failed, thus far, to identify a consensus
nucleotide binding sequence. One potential drawback of employing such a ‘consensus’ approach is that most RNA binding
proteins characterized to date appear to recognize a combination
of structure and sequence.
The seven newly isolated cellular RNAs that form RNP
complexes with TS are noteworthy, since several of them display
homology to genes encoding the human p53 protein, IFNinduced 15 kDa protein and human zinc finger protein 8, all of
which have been implicated as playing a role in cellular growth
and metabolism. Both p53 and c-myc encode nuclear phosphoproteins that play critical roles in the regulation of cell cycle
progression, DNA synthesis and apoptosis (38–45). Recent
studies from this laboratory confirmed that human recombinant
TS specifically binds to a 489 nt sequence in the protein coding
region of the human p53 mRNA. Furthermore, this interaction
results in the repression of p53 mRNA translation (46). Our
recent studies have also shown that TS specifically interacts with
the mRNA of the transcription factor c-myc (11,12). Although the
binding of TS to 28S and 18S rRNA may only result from a
physical interaction at the level of the polysome, it is possible that
the interaction with these cytoplasmic rRNAs, albeit weak, may
also play some role in the overall control of translation within the
cell. Thus, TS may be involved in the coordinate regulation of
expression and/or function of various cellular genes and it may
play an important role as a regulator of certain critical aspects of
cellular metabolism.
These studies contribute to our understanding of the complex
interactions between TS and cellular RNAs and they underscore
the concept that the mechanisms that underlie the regulation of
cellular gene expression are highly complex events. Finally, the
general strategy employed herein may be directly applicable for
the identification and isolation of in vivo target RNA sequences
of other RNA binding proteins.
ACKNOWLEDGEMENTS
The authors thank Drs Bruce Chabner, Frank Maley and Gladys
Maley for their insightful and helpful discussions and Janet Edds
for her editorial assistance in the preparation of this manuscript.
REFERENCES
1 Friedkin,M. and KornbergA. (1957) In McElroy,W.D. and Glass,B. (eds),
Chemical Basis of Heredity. Johns Hopkins Press, Baltimore, MD, pp.
609–614.
2 Santi,D.V. and Danenberg, P.V. (1984) In Blakely,R.L. and Benkovic,S.J.
(eds), Folates and Pteridines. Wiley, New York, NY, Vol. 1, pp. 345–398.
3 Hardy,L.W., Finer-Moore,J.S., Montfort,W.R., Jones,M.O., Santi,D.V. and
Stroud,R.M. (1987) Science, 235, 448–455.
4 Chu,E., Koeller,D.M., Casey,J.L., Drake,J.C., Chabner,B.A., Elwood,P.C.,
Zinn,S. and Allegra,C.J. (1991) Proc. Natl. Acad. Sci. USA, 88,
8977–8981.
5 Chu,E., Voeller,D.M., Koeller,D.M., Drake,J.C., Takimoto,C.H., Maley,F.,
Maley,G.F. and Allegra,C.J. (1993) Proc. Natl. Acad. Sci. USA, 90,
517–521.
3228 Nucleic Acids Research, 1996, Vol. 24, No. 16
6 Chu,E., Voeller,D.M., Morrison,P.F., Jones,K.L., Takechi,T., Maley,G.F.,
Maley,F. and Allegra,C.J. (1994) J. Biol. Chem., 269, 20289–20293.
7 Romaniuk,P.J. and Uhlenbeck,O.C. (1985) Biochemistry, 24, 4239–4244.
8 Hentze,M.W., Rouault,T.A., Harford,J.B. and Klausner,R.D. (1989)
Science, 244, 357–359.
9 Haile,D.J., Hentze,M.W., Rouault,T.A., Harford,J.B. and Klausner,R.D.
(1989) Mol. Cell. Biol., 9, 5055–5061.
10 Clerch,L.B. and Massaro,D. (1992) J. Biol. Chem., 267, 2853–2855.
11 Chu,E., Voeller,D.M., Jones,K.L., Takechi,T., Maley,G.F., Maley,F.,
Segal,S. and Allegra,C.J. (1994) Mol. Cell. Biol., 14, 207–213.
12 Chu,E., Takechi,T., Jones,K.L., Voeller,D.M., Copur,S.M., Maley,G.F.,
Maley,F., Segal,S. and Allegra,C.J. (1995) Mol. Cell. Biol., 15, 179–185.
13 Kinzler,K.W. and Vogelstein,B. (1989) Nucleic Acids Res., 17, 3645–3653.
14 El-Deiry,W.S., Kern,S.E., Pietenpol,J.A., Kinzler,K.W. and Vogelstein,B.
(1992) Nature Genet., 1, 45–49.
15 Gilmour,D.S. and Lis,J.T. (1984) Proc. Natl. Acad. Sci. USA, 81,
4275–4279.
16 Gould,A.P., Brookman,J.J., Strutt,D.I. and White,R.A.H. (1990) Nature
(Lond.) , 348, 308–311.
17 Dedon,P.C., Soults,J.A, Allis,C.D. and Gorovsky,M.A. (1991) Mol. Cell.
Biol., 11, 1729–1733.
18 Tomotsune,D., Shoji,H., Wakamatsu,Y., Kondoh,H. and Takahashi,N.
(1993) Nature (Lond.) , 365, 69–72.
19 Bigler,J. and Eisenman,R.N. (1994) Mol. Cell. Biol., 14, 7621–7632.
20 Johnston,P.G., Liang,C.M., Henry,S., Chabner,B.A. and Allegra,C.J.
(1991) Cancer Res., 51, 6668–6676.
21 Lerner,M.R. and Steitz,J.A. (1979) Proc. Natl. Acad. Sci. USA, 76,
5495–5499.
22 Steitz,J.A. (1989) Methods Enzymol., 180, 18468–481.
23 Froussard,P. (1993) PCR Methods Applicat., 2, 185–190.
24 Davis,L., Kuehl,M. and Battey,J. (1994) In Methods in Molecular Biology,
2nd Edn. Appleton and Lange, Norwalk, CT, pp. 534–540.
25 Davis,L., Kuehl,M. and Battey,J. (1994) In Methods in Molecular Biology,
2nd Edn. Appleton and Lange, Norwalk, CT, pp. 302–304.
26 Feinberg,A. and Vogelstein,B. (1983) Anal. Biochem., 137, 6–13.
27 Davis,L., Kuehl,M. and Battey,J. (1994) In Methods in Molecular Biology,
2nd Edn. Appleton and Lange, Norwalk, CT, pp. 263–266.
28 Leibold,E.A. and Munro,H.N. (1979) Proc. Natl. Acad. Sci. USA, 85,
2171–2175.
29 Copur,S., Aiba,K., Drake,J.C., Allegra,C.J. and Chu,E. (1995) Biochem.
Pharmacol., 49, 1419–1426.
30 Laemmli,U.K. (1970) Nature, 227, 680–685.
31 Loeb,K.R. and Haas,A.L. (1992) J. Biol. Chem., 267, 7806–7813.
32 Uhlenbeck,O.C., Wu,H.-N. and Sampson,J.R. (1987) In Molecular Biology
of RNA. Academic Press, New York, NY, pp. 285–294.
33 Tsai,D.E., Harper,D.S. and Keene,J.D. (1991) Nucleic Acids Res., 19,
4931–4936.
34 Klausner,R.D., Rouault,T.A. and Harford,J.B. (1993) Cell, 72, 19–28.
35 Melefors,O. and Hentze,M.W. (1993) BioEssays, 15, 85–90.
36 Henderson,B.R., Menotti,E., Bonnard,C. and Kühn,L.C. (1994) J. Biol.
Chem., 269, 17481–17489.
37 McCarthy,J.E.G. and Kollmus,H. (1995) Trends Biochem. Sci., 20,
191–197.
38 Levine,A.J., Momand,J. and Finlay,C.A. (1991) Nature, 351, 453–456.
39 Ullrich,S.J., Anderson,C.W., Mercer,W.E. and Appela,E.J. (1992) J. Biol.
Chem., 267, 15259–15262.
40 Vogelstein,B. and Kinzler,K.W. (1992) Cell, 70, 523–526.
41 Harris,C.C. and Hollstein,M. (1993) New Engl. J. Med., 329, 1318–1327.
42 Caelles,C., Helmberg,A. and Karin,M. (1994) Nature, 370, 220–223.
43 Luscher,B. and Eisenman,R.N. (1990) Genes Dev., 4, 2025–2035.
44 DePinho,R.A., Schreiber-Agus,N. and Alt,F.W. (1991) Adv. Cancer Res.,
57, 1–46.
45 Blackwood,E.M., Kretzner,L. and Eisenman,R.N. (1992) Curr. Opin.
Genet. Dev., 2, 227–235.
46 Chu,E., Copur,S., Jones,K.L., Khleif,S., Voeller,D., Maley,G.F., Maley,F.
and Allegra,C.J. (1995) Proc. Am. Ass. Cancer Res., 36, 563.