Light Quality-Mediated Petiole Elongation in
Arabidopsis during Shade Avoidance Involves
Cell Wall Modification by Xyloglucan
Endotransglucosylase/Hydrolases1[C][W][OA]
Rashmi Sasidharan, C.C. Chinnappa, Marten Staal, J. Theo M. Elzenga, Ryusuke Yokoyama,
Kazuhiko Nishitani, Laurentius A.C.J. Voesenek, and Ronald Pierik*
Plant Ecophysiology, Institute of Environmental Biology, Utrecht University, 3584 CA Utrecht, The
Netherlands (R.S., L.A.C.J.V., R.P.); Department of Biological Sciences, University of Calgary, Calgary, Alberta,
Canada T2N 1N4 (C.C.C.); Ecophysiology of Plants, University of Groningen, 9750AA Haren, The
Netherlands (M.S., J.T.M.E.); and Department of Developmental Biology and Neurosciences, Graduate School
of Life Sciences, Tohoku University, Sendai 980–8578, Japan (R.Y., K.N.)
Some plants can avoid shaded conditions via rapid shoot elongation, thus growing into better lit areas in a canopy. Cell wallmodifying mechanisms promoting this elongation response, therefore, are important regulatory points during shade
avoidance. Two major cell wall-modifying protein families are expansins and xyloglucan endotransglucosylase/hydrolases
(XTHs). The role of these proteins during shade avoidance was studied in Arabidopsis (Arabidopsis thaliana). In response to two
shade cues, low red to far-red light (implying neighbor proximity) and green shade (mimicking dense canopy conditions),
Arabidopsis showed classic shade avoidance features: petiole elongation and leaf hyponasty. Measurement of the apoplastic
proton flux in green shade-treated petioles revealed a rapid efflux of protons into the apoplast within minutes, unlike white
light controls. This apoplastic acidification probably provides the acidic pH required for the optimal activity of cell wallmodifying proteins like expansins and XTHs. Acid-induced extension, expansin susceptibility, and extractable expansin
activity were similar in petioles from white light- and shade-treated plants. XTH activity, however, was high in petioles
exposed to shade treatments. Five XTH genes (XTH9, -15, -16, -17, and -19) were positively regulated by low red to far-red light
conditions, while the latter four and XTH22 showed a significant up-regulation also in response to green shade. Consistently,
knockout mutants for two of these XTH genes also had reduced or absent shade avoidance responses to these light signals.
These results point toward the cell wall as a vital regulatory point during shade avoidance.
Crowding in natural plant communities or in crop
fields leads to resource limitation and competition for
the same. In order to survive in such a situation, plants
need to be able to outgrow competing vegetation to get
to the light. Rapid shoot elongation, coupled with an
upward movement of the leaves, are two obvious
morphological characteristics displayed by plants that
are being shaded. Other features include reduced
branching and, when the shading is persistent, an
1
This work was supported by the National Science and Engineering Council of Canada (Discovery Grant to C.C.C.) and the
Netherlands Organization for Scientific Research (VENI grant no.
86306001 to R.P.).
* Corresponding author; e-mail [email protected].
The author responsible for distribution of materials integral to the
findings presented in this article in accordance with the policy
described in the Instructions for Authors (www.plantphysiol.org) is:
Rashmi Sasidharan ([email protected]).
[C]
Some figures in this article are displayed in color online but in
black and white in the print edition.
[W]
The online version of this article contains Web-only data.
[OA]
Open Access articles can be viewed online without a subscription.
www.plantphysiol.org/cgi/doi/10.1104/pp.110.162057
978
acceleration of flowering to produce seeds and thus
ensure reproduction. Collectively, this suite of responses triggered by shade is referred to as the shade
avoidance syndrome (SAS; Vandenbussche et al., 2005;
Franklin, 2008). SAS is set into motion due to the
modification of the spectral composition of light in a
canopy. Light reflected from leaves gets enriched in
far-red wavelengths due to the preferential absorption
of red light. This reduction in red to far-red (R/FR)
light is a very reliable signal of impending shade
(Ballare et al., 1990). In closed canopies, light reflected
from, as well as transmitted through, leaves has not
just a low R/FR but also low blue fluence rates and a
lower total light intensity. Perception of these light
quality changes is possible in plants due to the presence of Pr and Pfr (Smith, 2000; Ishimaru et al., 2007),
blue light receptors, the cryptochromes, and the phototropins (Christie and Briggs, 2001). Rapid shoot
elongation during SAS involves, primarily, cellular
expansion fueled by turgor-driven uptake of water,
leading to increased pressure within cells. In order to
allow further water uptake, the cell walls yield to this
pressure by becoming more extensible (Cosgrove,
2000). Cell wall loosening is defined as a process
Plant PhysiologyÒ, October 2010, Vol. 154, pp. 978–990, www.plantphysiol.org Ó 2010 American Society of Plant Biologists
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Light Regulation of Arabidopsis XTHs during Shade Avoidance
where molecular modifications of the cell wall make
a rigid, inextensible wall extensible (Cleland, 1971;
Cosgrove, 1999). This results from the action of different proteins on the cell wall matrix, which weakens the
cell wall, allowing it to yield to turgor pressure. Two
cell wall-modifying protein families that are well
characterized and implicated in cell expansion during
growth and development are the expansins and the
xyloglucan endotransglucosylase/hydrolases (XTHs;
Cosgrove, 1999, 2005; Rose et al., 2002). Expansins were
first identified as the mediators of acid-induced extension (AIE) in isolated cell walls. They are believed to act
via disruption of the noncovalent interactions between
cellulose and hemicelluloses (xyloglucan in most dicots) in the cell wall, thus allowing cell wall loosening
(McQueen-Mason et al., 1992; Cosgrove, 2000).
Expansins are required for plant growth (Cho and
Kende, 1997b; Vreeburg et al., 2005) and in developmental processes where modification of the cell wall is
required, such as fruit softening (Brummell et al.,
1999), abscission (Belfield et al., 2005), and plantpathogen interactions (Cantu et al., 2008). Although
manipulation of expansin gene expression has confirmed the role of these proteins as important players
in the regulation of cell wall extensibility, in a few
instances such studies have also revealed unexpected
and counterintuitive effects (Caderas et al., 2000;
Rochange et al., 2001) where the correlation between
growth and expansin activity did not hold. XTHs are
another family of wall-modifying proteins that exist as
a large gene family in most plant species. XTHs also
act on the xyloglucan-cellulose network in the cell wall,
but, unlike expansins, they employ enzymatic mechanisms (hydrolysis and/or transglucosylation) to modify the cell wall (Nishitani and Tominaga, 1992; Rose
et al., 2002). These proteins are also involved in plant
growth and development, where wall modification is
required (Campbell and Braam, 1999; Rose et al., 2002).
In the model plant Arabidopsis (Arabidopsis thaliana), SAS and the importance of the regulation of cell
wall extensibility by wall-modifying proteins have
been studied extensively, albeit separately. Both expansins and XTHs are present as large multigene
families in Arabidopsis (Rose et al., 2002; Sampedro
and Cosgrove, 2005) and have been implicated in
Arabidopsis growth (Hyodo et al., 2003; Schopfer and
Liszkay, 2006), in response to various environmental
stresses such as drought and salt tolerance (Schopfer
and Liszkay, 2006), and in response to pathogen/insect
attack (Wieczorek et al., 2006; Divol et al., 2007).
Rosette plants like Arabidopsis mostly respond to
shade by moving their leaves (which normally have
a prostrate orientation) upward, accompanied by an
elongation of the petiole (Mullen et al., 2006; DjakovicPetrovic et al., 2007). Numerous microarray studies
have shown that this response involves massive and
rapid changes in gene expression (Devlin et al., 2003;
Salter et al., 2003; Sessa et al., 2005). In addition to
transcription factors and hormone regulatory genes, a
number of cell wall-related genes including XTHs and
expansins are also regulated following treatment with
shade signals (Ma et al., 2001; Sessa et al., 2005; RoigVillanova et al., 2006). The aim of this study was to
make use of this vast amount of available microarray
data as well as other genomic resources in order to
study the regulation of cell wall properties mediated
by expansins and XTHs during shade avoidance responses in Arabidopsis. We used two types of light
manipulations to mimic different stages of shading. A
low R/FR indicates the presence of proximal neighbors and provides an early warning of impending
canopy closure. Green shade replicates conditions that
would occur in a dense canopy where there is already
persistent shading and crowding from neighboring
plants. Using these two distinct shade cues allowed
any differences in the detection and response to these
signals to be observed. Furthermore, it was of interest
to see which particular members of the expansin or
XTH multigene families might be involved and
whether the regulation of these genes is light signal
specific even though they ultimately bring about the
same morphological response.
RESULTS
Arabidopsis Displays Typical Shade Avoidance
Characteristics in Response to Shade Signals
In response to low-R/FR (R/FR = 0.25) growth
conditions, Arabidopsis Columbia (Col-0) plants
showed a significant increase in the length of the
petioles relative to control plants grown under white
light (R/FR = 1.2) conditions after 24 h (Fig. 1A). The
same trend was observed in plants grown under green
shade conditions (combined reductions of blue, R/FR,
and total light intensity), where a significant increase
in the length of the petiole relative to control plants
was observed after 24 h of treatment (Fig. 1C). The
petiole growth rate of low-R/FR plants was almost
double that of control plants, while the growth rate of
green shade plants was more than twice that of controls (Fig. 1, B and D). Both these shade signals also
induced an increase in leaf angle called hyponastic leaf
movement. Under low R/FR, young leaves showed a
significantly higher angle (to the horizontal axis) than
their white light counterparts (Fig. 2A). At 5 h, this
angle was already almost double that of white light
controls and stayed higher until the 24-h measurement. The same was observed for green shade-treated
plants, where the petiole angles were much higher at
all the time points measured (except at 0 h; Fig. 2B).
The increase in the angle of the petioles, however, was
much higher in the green shade-treated plants compared with the low-R/FR-treated plants. Furthermore,
while in low-R/FR-treated plants only the youngest
leaves (also used for the measurements in Fig. 2)
showed hyponasty, in green shaded plants, by 24 h
almost all the leaves were hyponastic (Fig. 2, C–E).
Also, in low R/FR, the petiole angles decreased some-
Plant Physiol. Vol. 154, 2010
979
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Sasidharan et al.
Figure 1. Petiole elongation in Arabidopsis in
response to shade signals. Petiole length (A and C)
and growth rates (B and D) of Arabidopsis (Col-0)
plants in low R/FR and green shade as compared
with plants grown under white light (spectral
composition unaltered). Data are means 6 SE
(n = 10). Asterisks indicate significant differences
between light treatments (P , 0.05, Student’s t
test).
what at 24 h relative to the 8-h reading, while the green
shade leaves retained their strongly hyponastic response until the 24-h time point (Fig. 2, A and B).
Shade Treatment Induces Rapid Apoplastic Acidification
in Arabidopsis Petioles
The microelectrode ion flux estimation technique was
used in order to estimate the H+ fluxes in the apoplast of
Arabidopsis petioles. Under white light conditions,
there was a net negative efflux, which indicates an
influx of protons from the apoplast into the cytoplasm.
This influx was maintained, with some variation in the
magnitude, throughout the period of measurement. In
contrast, application of shade conditions using a green
filter resulted in a rapid increase in the net proton flux
into the apoplast (an efflux) that reached a maximum
value in around 10 min (Fig. 3). Thereafter, although
there was no increase in the flux, a steady efflux of
protons was maintained for the remaining duration of
the measurement (approximately 2.5 h).
Expansin Activity Measured as AIE Is Not Regulated in
Response to Shade Signals
AIE in the petioles of low-R/FR-grown plants was
not significantly different from AIE values measured
in control plants (Fig. 4A). The same was observed for
the petioles of plants grown in green shade (Fig. 4B).
Figure 2. Petiole angles of Arabidopsis
plants in response to shade signals. A
and B, Petiole angles of Arabidopsis
(Col-0) plants in low R/FR (white circles) and green shade (gray circles)
compared with plants grown in white
light (black circles; unaltered spectral
composition). Data points represent
means 6 SE (n = 10). Values were
significantly different from each other
at all time points measured (5, 8, and
24 h) except at 0 h (P , 0.05, Student’s
t test). Error bars are smaller than the
symbols depicted. C to E, Representative images showing petiole angles of
Arabidopsis plants after 24 h in white
light (C), low R/FR (D), and green
shade (E). [See online article for color
version of this figure.]
980
Plant Physiol. Vol. 154, 2010
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Light Regulation of Arabidopsis XTHs during Shade Avoidance
measured as the amount of xyloglucan degraded by
XTHs present in a crude enzyme extract made from
petioles and was referred to as XDA. Enzyme extracts
from the petioles of plants grown under low R/FR and
green shade for 24 h had higher XDA values than
corresponding white light controls (Fig. 7). In both
treatments, the values were significantly higher than
controls after 24 h of treatment. After 24 h in treatment,
there were approximately 27% and 35% increases in
the XTH activity in low-R/FR and green shade treatments, respectively, as compared with controls (Fig. 7).
XTHs Are Differentially Regulated in Response to
Shade Signals
Figure 3. Apoplastic acidification in Arabidopsis petioles in response
to green shade. Typical traces are shown for the net proton efflux at the
abaxial side of an Arabidopsis (Col-0) petiole when illuminated with
white light (dotted line) or green shade (solid line) conditions. Treatments started at 0 min. For each treatment, at least three runs were
performed.
At all time points tested, there was no difference
between the AIE of the petioles from plants in green
shade and those in white light control growth conditions. However, for both light treatments, AIE values
decreased after 24 h in treatment.
Extractable Expansin Activity as Well as Susceptibility of
Petioles to Expansins Are Similar in Control and
Shade-Treated Plants
AIE values reflect the amount of extractable expansin activity in the petioles as well as the susceptibility
of the cell walls in the petioles to an added expansin
extract. Both these parameters were checked in plants
grown in low-R/FR and green shade conditions. In
response to the addition of equal amounts of a cucumber (Cucumis sativus) crude cell wall extract, the
petioles from plants grown under both low R/FR and
green shade showed similar extension rates as petioles
from white light-grown control plants (Fig. 5). Thus,
low-R/FR and green shade conditions did not make
the petioles of the plant more sensitive to expansin
action as compared with petioles from white lightgrown control plants. The amount of extractable
expansin present in petioles was checked via measurement of the extension produced in cucumber
hypocotyls in response to the addition of expansin extracts from Arabidopsis petioles. Crude extracts from
the petioles of plants grown in low R/FR and green
shade produced comparable extension rates to that
from petioles of plants grown in white light (Fig. 6).
XTH Activity Is Up-Regulated in Response to
Shade Signals
An in vitro assay was used to check for XTH activity
in the petioles of Arabidopsis plants. XTH activity was
The Genevestigator Web site (https://www.
genevestigator.com/; Hruz et al., 2008) was mined
for light quality control of XTH gene expression data.
These light quality manipulations involved changes
in the R/FR in a white light background as well as
exposures to monochromatic red, far-red, or blue light
intensities. These data were used for the selection of
XTH genes that showed a 2-fold or more change in
expression in response to light quality manipulations,
resulting in an initial list of 20 XTH genes (Table I;
Supplemental Fig. S1). Data for organ-specific expression profiles of XTH genes were also obtained from the
Genevestigator Web site (Supplemental Fig. S2). The
initial list of 20 XTH genes was further filtered for
genes that were highly expressed in the petioles (Table
I). We also used available XTH pro::GUS lines to
identify genes that showed GUS staining in shaded
petioles (data not shown; Supplemental Table S1). The
Figure 4. AIE of Arabidopsis is not affected by shade signals. AIE is
shown for petioles of Arabidopsis (Col-0) plants grown under low R/FR
(white circles; A) and green shade (gray circles; B) compared with white
light (black circles; spectral composition unaltered) controls. Data
points represent means 6 SE (n = 8–10). Experiments were repeated
twice with similar results.
Plant Physiol. Vol. 154, 2010
981
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Sasidharan et al.
significantly higher compared with controls at all time
points measured. For all the genes, the highest fold upregulation was observed at the 5-h time point (Fig. 8).
XTH6 showed no differences in expression between
controls and shade-treated plants (data not shown).
XTH Mutants Have Reduced Petiole Growth Rates under
Shade Conditions
Two knockout mutant lines for the XTH genes
XTH15 and XTH17 showed reduced petiole growth
rates in response to both low R/FR and green shade
(Fig. 9). This reduction was more pronounced for a
plant growing under low-R/FR conditions, where the
normally enhanced petiole growth rates seen in wildtype plants was completely abolished. In green shade,
although there was an increase in growth rates relative
to white light controls, this increase appears reduced
compared with the trend observed for wild-type plants.
DISCUSSION
The control of cell wall extensibility is an important
regulatory point during fast elongation responses. The
Figure 5. Susceptibility of Arabidopsis petioles to a crude expansin
extract. Petioles from Col-0 plants grown under low R/FR (A) and green
shade (B) for 8 and 24 h were tested for their susceptibility to equal
amounts of a crude cell wall expansin extract (CCWE) in an extensometer relative to white light control petioles. Data points represent
means 6 SE (n = 5). Similar letters above the bars indicate nonsignificant
differences (P , 0.05, Tukey’s b test).
final list of candidate genes thus included genes that
were found to be light quality regulated and that were
either highly expressed in the petioles or showed
positive GUS staining in the petioles, or both. This
list was composed of the genes XTH6, -9, -15, -17, -19,
and -22. In addition, two other XTHs were included in
this final list: Because of the high sequence homology
between XTH15 and XTH16 (Rose et al., 2002), the
latter was added to the final list of candidate XTH
genes. XTH17 was included since it shares promoter
sequences with XTH19 (Vissenberg et al., 2005). The
expression pattern of these eight XTH genes was
studied using real-time quantitative reverse transcription (RT)-PCR.
In response to low R/FR, five genes, XTH9, -15, -16,
-17 and -19, were up-regulated. For all genes, significant increases in transcript abundance were observed
at 5 h. This up-regulation was maintained until the last
time point measured only for XTH15 (Fig. 8). In
response to green shade, the expression of five XTH
genes, XTH15, -16, -17, -19, and -22, was up-regulated
relative to white light controls (Fig. 8). XTH9 showed
no differential regulation in response to green shade
(data not shown). XTH15 and -19 transcripts were
Figure 6. Extractable expansin activity in Arabidopsis petioles. The
amount of extractable expansin activity in the petioles of Col-0 plants
grown for 8 and 24 h in low R/FR (A) and green shade (B) relative to
white light controls was measured as the extension produced upon
addition of the crude extract to cucumber hypocotyls. Data points
represent means 6 SE (n = 3). Similar letters above the bars indicate
nonsignificant differences (P , 0.05, Tukey’s b test).
982
Plant Physiol. Vol. 154, 2010
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Light Regulation of Arabidopsis XTHs during Shade Avoidance
shade signals triggered a hyponastic response, angles
were much higher under green shade than in low R/FR
(Fig. 2). These responses are consistent with the implication of the individual signals. Low R/FR implies a
threat of shading and elicited a milder response than
green shade, which mimicked an already present
shading stress and therefore would require a stronger
and persistent response. In Arabidopsis, both petiole
growth and hyponasty require, primarily, cellular
expansion, hyponasty being the result of differential
growth in the petiole (Millenaar et al., 2005). This rapid
cellular expansion is the result of turgor-driven water
uptake and concomitant modification of the cell wall by
proteins such as expansins and XTHs, allowing extension of the cell wall.
Cellular Expansion and Cell Wall Loosening during SAS
Figure 7. XTH activity in Arabidopsis petioles in response to shade
signals. XTH activity was measured as XDA in the petioles of Arabidopsis (Col-0) plants grown in low-R/FR (white circles; A) and green
shade (gray circles; B) conditions for 5, 8, and 24 h. Control refers to
petioles from plants grown in white light (black circles) conditions.
Data points represent means 6 SE (n = 4). Asterisks indicate significant
differences (P , 0.05, Student’s t test). Experiments were repeated
twice with similar results.
primary goal of this study was to investigate this
regulation in Arabidopsis during shade avoidance,
when timely and rapid elongation of the petiole is
crucial when competing for limited resources in a
dense canopy. We investigated the possible role of two
candidate wall-modifying proteins, expansins and
XTHs, in regulating cell wall extensibility and hence
growth responses to two shade signals, low R/FR (an
early warning signal of impending shade) and green
shade (mimicking a dense canopy).
Shade Avoidance and Arabidopsis
Rosette plants like Arabidopsis are more prone to
shading because they form leaves that are close to the
ground. Perception of shade in such plants usually
results in a repositioning of the leaves, which helps to
avoid shading imposed by neighboring plants. Similar
morphological responses were observed when Arabidopsis was exposed to low-R/FR and green shade
conditions (Figs. 1 and 2). Petiole growth rates were
significantly higher in Arabidopsis plants exposed to
low R/FR and green shade as compared with control
plants grown in white light. The magnitude of the
response, however, was greater in green shade than in
low R/FR (Fig. 1). Similar trends were observed when
the angle of the petiole was measured. Although both
Among wall-modifying agents, expansins and
XTHs have received particular attention, since their
activity and gene expression profiles have most often
matched growth trends during plant development and
responses to biotic and abiotic stresses (Cosgrove et al.,
2002; Rose et al., 2002). However, to our knowledge,
this study is the first to characterize expansin and XTH
activity during shade avoidance in Arabidopsis. Expansins are considered the primary mediators of cell
Table I. XTH genes showing a minimum 2-fold change in
expression based on Genevestigator data
A selection of XTH genes based on expression data compiled from
relevant light quality manipulation microarray experiments extracted
from the Genevestigator Web site is shown.
Gene Name
AtXTH2
AtXTH3
AtXTH5
AtXTH6
AtXTH8
AtXTH10
AtXTH11
AtXTH12
AtXTH13
AtXTH14
AtXTH15
AtXTH19
AtXTH22
AtXTH23
AtXTH24
AtXTH25
AtXTH29
AtXTH31
AtXTH32
AtXTH33
Arabidopsis Genome
Initiative Identifier
At4g13090
At3g25050
At5g13870
At5g65730
At1g11545
At2g14620
At3g48580
At5g57530
At5g57540
At4g25820
At4g14130
At4g30290
At5g57560
At4g25810
At4g30270
At5g57550
At4g18990
At3g44990
At2g36870
At1g10550
High Petiole
Expressiona
+
+
+
+
+
+
GUS Staining
in Petioleb
NA
NA
2
NA
2
NA
NA
2
NA
2
+
+
NA
2
2
2
2
NA
2
2
a
Based on the data in Supplemental Figure S2, a gene is designated
b
as highly expressed (+) in petioles or not.
Based on GUS staining
in shaded petioles relative to white light controls: +, staining observed
in shaded petioles of XTHpro::GUS reporter line plants; 2, no staining;
NA, no XTHpro::GUS lines available.
Plant Physiol. Vol. 154, 2010
983
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Sasidharan et al.
Figure 8. Differential regulation of XTHs in response to low R/FR and green shade. XTH expression profiles are shown for the petioles of
Arabidopsis (Col-0) plants in response to low R/FR
(white circles) and green shade (gray circles) as
compared with white light controls (black circles). Values are expressed relative to the transcript abundance at 0 h, which was set as 1. Data
points represent means 6 SE (n = 4). Asterisks
beside data points indicate statistically significant
differences (P , 0.05, Student’s t test) for the lowR/FR and green shade treatments relative to white
light controls at corresponding time points.
wall loosening, and expansin gene expression and
protein activity are usually found to be highly correlative to growth changes (Cosgrove, 2000; Cosgrove
et al., 2002). The experiments performed here, however, suggested otherwise. There were no differences
in the AIE values (reflecting in planta expansin activity) between low-R/FR- or green shade-treated petioles relative to their white light controls (Fig. 4). AIE
values reflect the amount of extractable expansins in
a tissue as well as the sensitivity of that tissue to
expansins. However, these two factors were also not
different between shade-treated and white light controls (Figs. 5 and 6). Expansin activity, therefore, did
not show a clear correlation with petiole elongation
during shade avoidance in Arabidopsis. However, it
could be argued that in low-R/FR- and green shade-
treated petioles, only a certain part of the petiole
undergoes rapid elongation and hence would also
have a correspondingly higher AIE value. Such differential cell wall extensibility in different parts of the
same plant organ has been observed for rice (Oryza
sativa; Cho and Kende, 1997a). However, experiments
on Arabidopsis plants in our shade treatment setup
suggest that petiole growth under shaded conditions
occurs uniformly along the length of the petiole (data
not shown). Furthermore, this is not the first instance
where expansin activity has not correlated with growth
responses. Similar findings have been cited in studies
with tomato (Solanum lycopersicum) and Festuca pratensis, where growth trends did not coincide with expansin
gene expression or protein levels (Caderas et al., 2000;
Reidy et al., 2001; Rochange et al., 2001).
984
Plant Physiol. Vol. 154, 2010
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Light Regulation of Arabidopsis XTHs during Shade Avoidance
Figure 9. Petiole growth rates of wild-type Col-0, xth15, and xth17 in
response to low R/FR and green shade. Data points represent means 6
SE (n = 5–7). Similar letters above the bars indicate nonsignificant
differences (P , 0.05, Tukey’s b test).
Since expansin activity did not seem to be regulated
during shade avoidance, we turned our attention to
XTHs as a possible means of regulation of cell wall
properties. XTH activity was up-regulated in response
to both low R/FR and green shade relative to white
light controls (Fig. 7). The XTH gene family in Arabidopsis consists of 33 members with distinct organ- and
developmental stage-specific expression (Rose et al.,
2002; Becnel et al., 2006; Kurasawa et al., 2006). In
order to identify which of these candidates were
required during shade avoidance, we used a combination of available XTH::GUS reporter lines and published microarray data. This allowed us to narrow our
search for potential candidates. These were further analyzed for the regulation of gene expression using realtime quantitative RT-PCR. In response to low R/FR,
five genes, XTH9, -15, -16, -17, and -19, were found to
be positively regulated, while green shade induced the
up-regulation of XTH15, -16, -17, -19, and -22 transcripts (Fig. 8). Increase in XTH transcript abundance
occurred already at the first time point measured (5 h),
while XTH activity showed a significant increase only
after 24 h of shade treatment. High-resolution growth
measurements on Arabidopsis petioles exposed to low
R/FR have demonstrated an enhancement of petiole
growth relative to white light controls already within 2
h of the treatment (Djakovic-Petrovic et al., 2007).
Discrepancies between XTH activity and growth profiles could be due to the following reasons. (1) Higher
enzyme activities might be associated with particular
fast-growing regions or even particular cell types of
the petiole, which could get diluted when whole
petioles were used for activity measurements. In fact,
among all the XTH genes, XTH15 and XTH17 are
found to be relatively enriched in epidermal cells
compared with other cell types (Mustroph et al.,
2009; J. Bailey-Serres, personal communication). This
also lends more credence to the involvement of these
genes in cellular expansion, since the epidermis has
been implicated in driving expansive growth (Savaldi-
Goldstein et al., 2007). (2) XTHs can also be involved in
wall strengthening (Antosiewicz et al., 1997). It is
possible that some XTH genes are also down-regulated during shade avoidance, leading to a total lower
XTH activity in shade-treated petioles. (3) Rapid
growth rates as seen within 2 h probably involve
mechanisms in addition to XTH gene expression regulation. Cell wall dynamics are affected by the action
of numerous cell wall proteins, the production of
reactive oxygen species, which can also affect the cell
wall structure (Schopfer and Liszkay, 2006), and a
balance between the rates of wall loosening and wall
synthesis.
The functionality of XTHs in the context of shade
avoidance responses was confirmed in a screen of XTH
T-DNA insertion lines exposed to shade conditions.
Specifically, the mutant lines xth15 and xth17 showed
decreased petiole elongation responses, particularly to
low R/FR but also to green shade. Both these genes
show strong up-regulation in plants growing under lowR/FR and green shade conditions (Fig. 9). This confirms
the functional role of XTHs in the restructuring of the cell
wall required for the cellular expansion process that
fuels rapid petiole elongation during shade avoidance.
Apoplastic Acidification
Another theory that could account for the rapid
elongation growth in response to shade, while reconciling the discrepancy between the timing of the
growth rate increase and the protein activity profiles,
is the acid growth theory. This theory describes the
rapid elongation of plant organs in response to acidic
conditions and states that the extrusion of protons into
the apoplast allows immediate wall modification via
the activation of wall-modifying proteins already present in the apoplast (Hager, 2003). Within minutes of a
green shade treatment, Arabidopsis petioles showed a
net increase in proton efflux as compared with white
light-treated petioles, where this efflux was absent
(Fig. 3). This rapid apoplastic acidification probably sets
the optimal milieu for the activity of wall-modifying
proteins such as expansins (Cosgrove, 2000), XTHs
(Fry, 1998), and yieldins (Okamoto-Nakazato et al.,
2000), all of which require acidic conditions for activity. Low pH is also known to enhance the production
of hydroxyl radicals, which have been demonstrated
to induce cell wall extension (Fry, 1998). In such a
scenario, even with equal amounts of wall-loosening
proteins in the cell walls of white light- and shadetreated plants, an apoplastic acidification in the latter
situation would result in elongation growth only in
response to shade. Such apoplastic acidification has
also been reported in submergence-induced petiole
elongation (Vreeburg et al., 2005).
Synergism of Cell Wall Loosening
We recently published a study implicating expansins in the shade-induced elongation growth in two
Plant Physiol. Vol. 154, 2010
985
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Sasidharan et al.
ecotypes of the Caryophyllaceae species Stellaria longipes (Sasidharan et al., 2008). It was expected that the
basic wall-modifying mechanism underlying elongation responses to identical cues (low R/FR and green
shade) would be similar. Therefore, it was surprising
to observe that, unlike S. longipes, in Arabidopsis XTHs
show a much stronger correlation with shade-induced
elongation growth. Even though the cell wall contains
numerous enzyme activities, expansins have been
considered primary wall-loosening agents mostly
due to their ability to bring about extension of isolated
wall specimens (Cosgrove, 2005). Most studies investigating elongation growth in response to environmental cues have supported this notion (Wu et al.,
1996; Cho and Kende, 1997a; Vriezen et al., 2000;
Cosgrove et al., 2002; Sasidharan et al., 2008). However, there have also been a few studies where expansin activity and/or gene expression have not
matched growth trends (Caderas et al., 2000; Rochange
et al., 2001). In addition, XTHs have recently been
demonstrated to be able to bring about wall-loosening
activity in vitro (Van Sandt et al., 2007). Therefore,
XTHs, although sometimes considered secondary
wall-loosening agents, do have the ability to be primary candidates. This study also supports the role of
XTHs as primary wall-modifying agents during shade
avoidance in Arabidopsis. However, it is likely not to
be the sole mechanism. Cell wall properties are very
often the result of coordinate activities of cell wall
assembly, disassembly, polymer synthesis, and secretion. Most large-scale analyses of cell walls have
revealed a number of cell wall-related proteins to be
regulated during different developmental stages and
in response to environmental stresses. These proteins
act on specific parts of the cell wall and have characteristic effects on it. In all likelihood, wall loosening
requires a synergism between these different proteins.
In Arabidopsis as well, the primary action of XTHs is
probably enhanced or supplemented by other wallmodifying agents such as expansins, endoglucanases,
and free radicals.
During expansion, regulation occurs not just at the
level of wall modification but also for the delivery of
wall components to the cell wall (Cosgrove, 2005).
Furthermore, cell wall composition differs not just
between species but also between different developmental stages and in response to different environ-
mental stresses, as has been demonstrated for
Arabidopsis roots (Freshour et al., 1996). Thus, the
composition of a particular cell wall at a particular
time, and in a particular species and organ, would
probably dictate the kind of enzymatic activities required. This suggestion is supported by large-scale
transcriptomic and proteomic studies that have revealed how not just different protein families, but also
specific members within these protein families, are
coordinately expressed at different developmental
stages (Yokoyama et al., 2004; Imoto et al., 2005; Irshad
et al., 2008). In addition, comparisons have been
drawn with cellulose-digesting microbes that utilize
multiprotein complexes to coordinate multiple protein
activities while acting on their target. It is speculated
that such a complex might exist in plants and would
allow multiple proteins to be present together at the
right location in the cell wall, thereby increasing the
efficiency of wall modification (Rose and Bennett,
1999). Finally, the activities of both expansins and
XTHs can be affected by conditions in the cell wall,
such as substrate availability, accessibility to the target,
the presence of activators/inhibitors, and also the pH
of the apoplast. There was a rapid efflux of protons
into the apoplastic space in Arabidopsis petioles when
exposed to shaded conditions. Thus, the amount of
acidification can also determine which proteins are
active and to what extent. Therefore, coordination
with other pathways that determine the optimal milieu for enzyme activities would also be essential.
CONCLUSION
In conclusion, these results demonstrate that Arabidopsis can clearly distinguish between different shade
signals that imply either neighbor proximity (low R/FR)
or shade (green shade). In response to each of these
signals, Arabidopsis plants responded with characteristic morphological responses that differed in magnitude
and that corresponded with an increase in XTH activity.
Different XTH genes were expressed in response to each
shade cue, and this increase in gene expression is
probably responsible for the observed increase in XTH
activity. Furthermore, the reduced ability of xth mutants
to enhance petiole elongation when shaded points
toward a functional role for XTHs in regulating cell
Table II. Sequences (5#–3#) of primer combinations and annealing temperatures for the genes studied using real-time RT-PCR
Arabidopsis Genome
Initiative Identifier
Gene Name
Forward Primer
Reverse Primer
Annealing
Temperature
At4g03210
At4g14130
At3g23730
At1g65310
At4g30290
At5g57560
At4g05320
AtXTH9
AtXTH15
AtXTH16
AtXTH17
AtXTH19
AtXTH22
AtUBQ10
TACCATGAATACAACACTGCGTTTACT
CGGCACCGTCACTGCTTAC
CCGGTAACTCCGCTGGAA
ATGGGCTAATGGAAAATCATCTTGTT
TGCAGCTAAATGATTGATTCTTTGAT
CTAAAGAGTGCTTAGCTGCATAGAGAGA
GGCCTTGTATAATCCCTGATGAATAAG
TACCATGAATACAACACTGCGTTTACT
GAAACTCAAAGTCTATCTCGTCATGTG
TCTCGTCGTGTGTTGGTCCTT
TACTTTGCACACCTTTCATTCTTGTC
CCATTGAGTTACAAAGACAACGTCA
CAAATCAATAAAATTCACGTGATCTACAA
AAAGAGATAACAGGAACGGAAACATAGT
62
62
62
62
62
62
62
°C
986
Plant Physiol. Vol. 154, 2010
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Light Regulation of Arabidopsis XTHs during Shade Avoidance
wall properties that are essential for elongation responses during shade avoidance. Although expansin
activity appeared not to be regulated during responses
to shade, they may play a role in regulating wall
extensibility through a collaborative or synergistic
action with other wall-modifying mechanisms, including XTHs. Rapid apoplastic acidification was initiated
upon green shade conditions and probably provides
the optimum environment for wall-modifying processes to occur.
MATERIALS AND METHODS
Plant Growth
Both wild-type and transgenic Arabidopsis (Arabidopsis thaliana) plants
used were in the Col-0 wild-type background. Seeds were sown on a moist
filter paper placed in sealed petri dishes. After a 4-d stratification period in the
dark at 4°C, the petri dishes were placed in a growth chamber for another 4 d
in order to allow seed germination. Seedlings were then transferred to 70-mL
pots filled with a soil and perlite (1:2, v/v) mixture containing 0.14 mg of
MgOCaO (17%; Vitasol) and 0.14 mg of slow-release fertilizer (Osmocote
“plus mini”; Scotts Europe). Prior to seedling transfer, the pots containing soil
were allowed to soak up 20 mL of nutrient solution containing 2.6 mM KNO3,
2.0 mM Ca(NO3)2, 0.6 mM KH2PO4, 0.9 mM MgSO4, 6.6 mM MnSO4, 2.8 mM
ZnSO4, 0.5 mM CuSO4, 66 mM H3BO3, 0.8 mM Na2MoO4, and 134 mM Fe-EDTA,
pH 5.8. All chemicals were analytical reagent grade and obtained from Merck.
The pots were placed on irrigation mats that were automatically watered
every day in a short-day (9-h photoperiod, 200 mmol m22 s21 photosynthetically active radiation [PAR]) growth chamber for 4 weeks before being used
for experiments.
Light Treatments
Four-week-old plants were used for experiments. Light quality manipulations took place in a white light background (Philips Master HPI-T Plus 400
W and Philips Plus Line Pro 150 W). The R/FR was reduced from 1.2 to 0.25 by
supplemental far-red light (730-nm light-emitting diode; Shinko Electronics
[http://www.shinkohelecs.com]). PAR for this light treatment was maintained at 140 mmol m22 s21. Green shading mimicking light conditions in a
dense canopy was achieved using two layers of Lee 122 Fern Green, which
reduced the PAR to 65 mmol m22 s21, the R/FR to 0.19, and the blue light
photon fluence rate to 2 mmol m22 s21. Wherever mentioned, white light
control refers to data from plants grown in light conditions with an unaltered spectral composition and PAR of 140 mmol m22 s21. All light treatments were started at approximately 10 AM each time the experiments were
performed.
Measurement of Plant Growth
Care was taken to choose similar-sized plants. The same leaf in each pot
was marked with ink, and the corresponding petiole was measured using a
digital caliper at relevant time points at the start and for the duration of
specific treatments. For each treatment, petiole lengths were measured from at
least 10 individual plants. Measurements were made for three independent
trials.
Measurement of Leaf Angle
The leaves to be measured were marked with ink before the start of the
treatments. Leaves obstructing the leaves to be measured were cut in order to
be able to make angle measurements. Angle measurements were made by
photographing the plants at relevant time points and then measuring the
angle X between the two marked leaves using the angle measurement tool of
the image software ImageJ (Abramoff et al., 2004). This angle X was then used
to estimate the angle of the marked leaf (Y) from the soil surface using the
formula Y = (180 – X)/2. At least 10 plants were used per treatment per time
point. The experiments were repeated twice.
Measurement of Apoplastic Proton Fluxes
The microelectrode ion flux estimation (Newman, 2001) technique was
used to measure net H+ fluxes in petioles from 28-d-old Arabidopsis plants.
Microelectrodes were pulled from borosilicate glass capillaries (GC150-10;
Harvard Apparatus) and silanized with tributylchlorosilane (Fluka). Before
use, the microelectrodes were backfilled with 15 mM NaCl plus 40 mM KH2PO4
and the tip was filled with Hydrogen Ionophore II (Cocktail A; Fluka). After
calibration of the microelectrode (pH 5.1–7.8), a young Arabidopsis leaf was
detached from the plant, its petiole was gently abraded using Carborundum,
and the leaf was then mounted in a 3-mL cuvette filled with 1 mM KCl. The
cuvette was then placed in front of an inverted microscope (Nikon), and the
H+ selective microelectrode was mounted vertically in a holder connected to a
three-way piezo-controlled micromanipulator (Luigs and Neumann) driven
by a computer-controlled motor (M061-CE08; Superior Electric). The electrode
was then brought into position next to the abaxial surface of the petiole at a
distance of 20 mm. During measurements, the distance between the microelectrode and the petiole surface changed from 20 to 60 mm with a frequency
of 0.1 Hz. For controls, measurements were performed with the leaf illuminated using two fiber-optic cables (PAR of 180 mm m22 s21). For shade
treatments, two layers of green filter (Lee 122 Fern Green) were placed across
the two fiber-optic cables. The solution used to submerge the leaf was bubbled
overnight with CO2-free air, and during the experiment CO2-free air was
blown over the surface of the cuvette to minimize the effect of changing CO2
concentrations on the pH of the experimental solution. Chemical activity of
H+ was recorded at two distances, and these data were then used to generate
H+ flux values according to Newman (2001).
Measurement of AIE
Leaves with petioles that were at least 6 mm in length were marked before
the start of the light treatments. This was the minimal starting length required
in order to be able to place the petiole in the extensometer setup. Petioles were
harvested at relevant time points and immediately frozen in liquid nitrogen.
Thawed, abraded, and pressed petioles were clamped in the extensometer
cuvette under a constant weight of 20 g. The petioles were first bathed in 160
mL of a 50 mM HEPES (pH 6.8) buffer for 30 min, after which the buffer was
replaced with a 50 mM sodium acetate (pH 4.5) buffer for another 30 min. AIE
was measured as the difference in the slopes of lines fitted through 10-min
intervals before and after the observed bending point obtained upon the
change in pH of the buffer. For each treatment, at least six to eight petioles
from individual plants were measured. Experiments were repeated at least
two times.
Extraction of Cell Wall Proteins and Measurement of
Extractable Expansin Protein Activity
Crude cell wall extracts were made as described by Rochange et al. (2001)
and modified to extract in 1.5-mL tubes. Briefly, 30 Arabidopsis petioles (two
petioles per plant) were harvested and pooled per biological replicate, per
treatment, per time point. The petioles were immediately frozen and then
ground in a homogenization buffer. The cell walls were retained via centrifugation (21,000g, 1 min). The cell wall pellet was then washed several times
with a wash buffer. This was followed by the addition of the extraction buffer
containing 1 M NaCl. The cell walls were then allowed to incubate in this
extraction buffer, after which the supernatant was recovered via centrifugation. The proteins were precipitated via the addition of ammonium sulfate and
then recovered via centrifugation. Protein pellets were suspended in 50 mM
sodium acetate buffer, pH 4.5, and the amount of protein was estimated using
the method of Bradford (1976).
Susceptibility of Arabidopsis Petioles to Crude Cell Wall
Extracts from Cucumber Hypocotyls
Arabidopsis petioles were harvested from plants grown under different
light treatments (control, low R/FR, and green shade) and then frozen
immediately and stored at 280°C. Frozen, thawed petioles were then boiled
for 5 min to eliminate any endogenous expansin activity. These petioles were
then pressed for 2 min and mounted in the extensometer setup under a
constant pulling weight of 20 g. Extension was first measured for 30 min in an
acidic (50 mM sodium acetate, pH 4.5) buffer, after which the buffer was
Plant Physiol. Vol. 154, 2010
987
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Sasidharan et al.
replaced with a crude cell wall cucumber (Cucumis sativus) extract in the same
acidic buffer. All petioles received an equal amount of the protein extract.
Susceptibility of the petioles to this crude protein extract was measured as the
difference in the slopes of the lines produced before and after the addition of
the protein extract.
Measurement of XDA
Petioles from Arabidopsis Col-0 plants grown under different light treatments were harvested at different (0, 5, 8, and 24 h) time points. Harvested
material was immediately frozen in liquid nitrogen and stored at 280°C until
it was ready to be used. Enzyme extracts were prepared as described by Soga
et al. (1999). Briefly, frozen petioles were homogenized in ice-cold sodium
phosphate buffer (10 mM, pH 7). The homogenate was centrifuged, and the
supernatant was discarded. The remaining cell wall pellet was washed twice
with sodium phosphate buffer (10 mM, pH 7), after which the wall pellet was
resuspended in sodium phosphate buffer (10 mM, pH 6) containing 1 M NaCl.
The walls were then allowed to extract in this buffer for 24 h at 4°C before
centrifugation and removal of the supernatant. This supernatant was then
used as a crude enzyme extract to measure XDA as described by Sulova et al.
(1995). The reaction mixture contained 15 mL of the enzyme extract, 0.4 mg
mL21 xyloglucan (Megazyme International), and 0.2 mg mL21 xyloglucan
oligosaccharides (XGOs; Megazyme International) in 0.2 mL of 0.1 M sodium
phosphate buffer, pH 6. XGOs act as additional glycosyl acceptors for the
transglucosylation reaction and thereby stimulate the depolymerization of
xyloglucan by the enzyme. Following incubation of the reaction mixture for
1 h at 37°C, the reaction was terminated via the addition of 0.1 mL of 1 N HCl.
The remaining xyloglucan was then detected by the iodine staining method,
followed by spectrophotometric measurement of the resulting xyloglucaniodine complex as described by Sasidharan et al. (2008). The XDA measured
includes the transglucosylating activity and hydrolytic activity of XTHs as
well as the hydrolytic activity of nonspecific endoglucanases. However,
parallel assays run without XGOs (wherein the enzyme would function
only as a hydrolase) indicated that the measured values had negligible
hydrolytic activity at the termination of the assay. The values measured,
therefore, are indicative of XET activity and are expressed as percentage XDA
per microgram of cell wall protein. Protein estimation was performed using
the Bradford (1976) assay using a commercially available Bradford Reagent
(Bio-Rad). Twenty petioles from different plants were pooled together to
obtain a crude enzyme extract, and this constituted one biological replicate.
Each experiment used at least three biological replicates. Experiments were
repeated twice.
standard in a 20-mL reaction that contained 11 mL of SYBR Green Supermix
(Bio-Rad; catalog no. 170-8882), 30 ng of cDNA (0.1 ng for 18S rRNA), and
gene-specific primers (Table I). A Bio-Rad MyiQ single-color real-time PCR
detection system was used. The following program was used for all the genes
tested: 3 min at 95°C, followed by 40 cycles of 30 s at 95°C, 30 s at gene-specific
annealing temperature, and 60 s at 72°C. The annealing temperature was
optimized for each primer pair to result in specific amplification of the
transcript of interest while avoiding the formation of primer dimers. Primer
sequences and annealing temperatures are given in Table II. In addition, for
every primer combination used, efficiency and melting curves were obtained.
PCR products were also resolved on 1% agarose gels in order to confirm single
products of the expected size. The cycle threshold (Ct) value for each gene was
normalized relative to the Ct value of AtUBQ10. Relative transcript levels
were calculated using the comparative Ct method (Livak and Schmittgen,
2001) and expressed relative to the average value at day 0, which was set as 1.
Mutant Screen
T-DNA insertion lines for several XTH genes were obtained from the Salk
Institute. xth17 (SALK_008429) has been previously characterized (Osato et al.,
2006). xth15 (SALK_039464) was subjected to the following analyses after three
backcrosses to the wild type. The genotype of the T-DNA insertion allele was
determined by PCR of genomic DNA using primer sets of an XTH15-specific
forward primer (5#-CTGGAAGCTTAATCACTATGTAGGAGGATGCG-3#), a
T-DNA left border-specific primer (5#-GCGTGGACCGCTTGCTGCAACT-3#),
and an XTH15-specific reverse primer (5#-CCAGGAATGCTTTATTGATCTTGAC-3#). Mutant lines were exposed to low R/FR and green shade conditions,
which were as described before. There were no size differences between wildtype Col-0 and mutant plants. Petiole measurements were made at 0 and 24 h
after the start of the light treatments. Measurements were made as described
before. Experiments were repeated twice.
Supplemental Data
The following materials are available in the online version of this article.
Supplemental Figure S1. Genevestigator Arabidopsis XTH gene expression in response to light quality manipulations.
Supplemental Figure S2. Genevestigator XTH organ-specific expression.
Supplemental Table S1. XTH genes screened for shade-induced differential gene expression using XTHpro::GUS lines.
Selection of Candidate XTH Genes
In order to identify which of the 33 Arabidopsis XTH genes are regulated
during shade-induced petiole elongation, we mined the Genevestigator Web
site (https://www.genevestigator.com/; Hruz et al., 2008) for a comprehensive analysis of XTH expression regulation. Expression data for the effect of
light quality (R/FR, red, far-red, and blue light wavelengths) manipulations
were compiled. The raw data from the Web site were used to generate a heat
map using the TM4 MeV software (download available from http://www.
tm4.org/; Saeed et al., 2006). The Genevestigator Web site was also used to
extract XTH organ-specific expression data, which were plotted using the
same software (TM4 MeV). We also screened available XTHpro::GUS lines
(Vissenberg et al., 2005; Becnel et al., 2006; Liu et al., 2007) for candidate genes
regulated upon shade treatment. The Genevestigator and XTHpro::GUS reporter data were combined to get the final list of XTH candidate genes. The
regulation of these XTH genes was studied using real-time RT-PCR.
Real-Time RT-PCR
Petioles from 4-week-old Arabidopsis Col-0 plants grown under different
light treatments (low R/FR, green shade, and control light conditions) were
harvested at different time points (5, 8, and 24 h) during the treatments. Two
petioles per plant were harvested, and at least 10 petioles were pooled to form
one biological replicate. The same two petioles were harvested from each
plant. Harvested material was immediately frozen and stored at 280°C. All
the data shown are means of four biological replicates. Total RNA from these
samples was extracted using the RNeasy plant mini kit (Qiagen). RT of total
RNA using random hexamers was performed as described above. Real-time
RT-PCR was performed using Arabidopsis ubiquitin (AtUBQ10) as an internal
ACKNOWLEDGMENT
We thank Prof. Janet Braam (Rice University) for supplying XTH::GUS
lines that were used in screening for candidate XTH genes.
Received July 1, 2010; accepted August 2, 2010; published August 5, 2010.
LITERATURE CITED
Abramoff MD, Magelhaes PJ, Ram SJ (2004) Image processing with
ImageJ. Biophotonics International 11: 36–42
Antosiewicz DM, Purugganan MM, Polisensky DH, Braam J (1997)
Cellular localization of Arabidopsis xyloglucan endotransglycosylaserelated proteins during development and after wind stimulation. Plant
Physiol 115: 1319–1328
Ballare CL, Scopel AL, Sanchez RA (1990) Far-red radiation reflected from
adjacent leaves: an early signal of competition in plant canopies. Science
247: 329–332
Becnel J, Natarajan M, Kipp A, Braam J (2006) Developmental expression
patterns of Arabidopsis XTH genes reported by transgenes and Genevestigator. Plant Mol Biol 61: 451–467
Belfield EJ, Ruperti B, Roberts JA, McQueen-Mason S (2005) Changes in
expansin activity and gene expression during ethylene-promoted leaflet
abscission in Sambucus nigra. J Exp Bot 56: 817–823
Bradford MM (1976) A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye
binding. Anal Biochem 72: 248–254
988
Plant Physiol. Vol. 154, 2010
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Light Regulation of Arabidopsis XTHs during Shade Avoidance
Brummell DA, Harpster MH, Dunsmuir P (1999) Differential expression of
expansin gene family members during growth and ripening of tomato
fruit. Plant Mol Biol 39: 161–169
Caderas D, Muster M, Vogler H, Mandel T, Rose JK, McQueen-Mason S,
Kuhlemeier C (2000) Limited correlation between expansin gene expression and elongation growth rate. Plant Physiol 123: 1399–1414
Campbell P, Braam J (1999) Xyloglucan endotransglycosylases: diversity of
genes, enzymes and potential wall-modifying functions. Trends Plant
Sci 4: 361–366
Cantu D, Vicente AR, Greve LC, Dewey FM, Bennett AB, Labavitch JM,
Powell ALT (2008) The intersection between cell wall disassembly,
ripening, and fruit susceptibility to Botrytis cinerea. Proc Natl Acad Sci
USA 105: 859–864
Cho HT, Kende H (1997a) Expression of expansin genes in rice is correlated
with growth. Plant Physiol (Suppl) 114: 810
Cho HT, Kende H (1997b) Expression of expansin genes is correlated with
growth in deepwater rice. Plant Cell 9: 1661–1671
Christie JM, Briggs WR (2001) Blue light sensing in higher plants. J Biol
Chem 276: 11457–11460
Cleland R (1971) Cell wall extension. Annu Rev Plant Physiol 22: 197–222
Cosgrove DJ (1999) Enzymes and other agents that enhance cell wall
extensibility. Annu Rev Plant Physiol 50: 391–417
Cosgrove DJ (2000) Expansive growth of plant cell walls. Plant Physiol
Biochem 38: 109–124
Cosgrove DJ (2005) Growth of the plant cell wall. Nat Rev Mol Cell Biol 6:
850–861
Cosgrove DJ, Li LC, Cho HT, Hoffmann-Benning S, Moore RC, Blecker D
(2002) The growing world of expansins. Plant Cell Physiol 43: 1436–1444
Devlin PF, Yanovsky MJ, Kay SA (2003) A genomic analysis of the shade
avoidance response in Arabidopsis. Plant Physiol 133: 1617–1629
Divol F, Vilaine F, Thibivilliers S, Kusiak C, Sauge MH, Dinant S (2007)
Involvement of the xyloglucan endotransglycosylase/hydrolases encoded by celery XTH1 and Arabidopsis XTH33 in the phloem response
to aphids. Plant Cell Environ 30: 187–201
Djakovic-Petrovic T, de Wit M, Voesenek LACJ, Pierik R (2007) DELLA
protein function in growth responses to canopy signals. Plant J 51:
117–126
Franklin KA (2008) Shade avoidance. New Phytol 179: 930–944
Freshour G, Clay RP, Fuller MS, Albersheim P, Darvill AG, Hahn MG
(1996) Developmental and tissue-specific structural alterations of the
cell-wall polysaccharides of Arabidopsis thaliana roots. Plant Physiol 110:
1413–1429
Fry SC (1998) Oxidative scission of plant cell wall polysaccharides by
ascorbate-induced hydroxyl radicals. Biochem J 332: 507–515
Hager A (2003) Role of the plasma membrane H+-ATPase in auxin-induced
elongation growth: historical and new aspects. J Plant Res 116: 483–505
Hruz T, Laule O, Szabo G, Wessendorp F, Bleuler S, Oertle L, Widmayer P,
Gruissem W, Zimmermann P (2008) Genevestigator V3: a reference
expression database for the meta-analysis of transcriptomes. Adv
Bioinformatics 2008: 420747
Hyodo H, Yamakawa S, Takeda Y, Tsuduki M, Yokota A, Nishitani K,
Kohchi T (2003) Active gene expression of a xyloglucan endotransglucosylase/hydrolase gene, XTH9, in inflorescence apices is related to cell
elongation in Arabidopsis thaliana. Plant Mol Biol 52: 473–482
Imoto K, Yokoyama R, Nishitani K (2005) Comprehensive approach to
genes involved in cell wall modifications in Arabidopsis thaliana. Plant
Mol Biol 58: 177–192
Irshad M, Canut H, Borderies G, Pont-Lezica R, Jamet E (2008) A new
picture of cell wall protein dynamics in elongating cells of Arabidopsis
thaliana: confirmed actors and newcomers. BMC Plant Biol 8: 94
Ishimaru M, Smith DL, Gross KC, Kobayashi S (2007) Expression of three
expansin genes during development and maturation of Kyoho grape
berries. J Plant Physiol 164: 1675–1682
Kurasawa K, Matsui A, Saitou K, Yokoyama R, Nishitani K (2006) A
comprehensive analysis of all members of the group III subfamily of
xyloglucan endotransglucosylase/hydrolase (XTH) family of Arabidopsis. Plant Cell Physiol 47: S72
Liu YB, Lu SM, Zhang JF, Liu S, Lu YT (2007) A xyloglucan endotransglucosylase/hydrolase involved in growth of primary root and alters
the deposition of cellulose in Arabidopsis. Planta 226: 1547–1560
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data
using real-time quantitative PCR and the 22DDCT method. Methods 25:
402–408
Ma L, Li J, Qu L, Hager J, Chen Z, Zhao H, Deng XW (2001) Light control of
Arabidopsis development entails coordinated regulation of genome
expression and cellular pathways. Plant Cell 13: 2589–2607
McQueen-Mason S, Durachko DM, Cosgrove DJ (1992) Two endogenous
proteins that induce cell wall extension in plants. Plant Cell 4: 1425–1433
Millenaar FF, Cox MCH, de Jong van Berkel YEM, Welschen RAM, Pierik
R, Voesenek LACJ, Peeters AJM (2005) Ethylene-induced differential
growth of petioles in Arabidopsis: analyzing natural variation, response
kinetics, and regulation. Plant Physiol 137: 998–1008
Mullen JL, Weinig C, Hangarter RP (2006) Shade avoidance and the
regulation of leaf inclination in Arabidopsis. Plant Cell Environ 29:
1099–1106
Mustroph A, Zanetti ME, Jang CJH, Holtan HE, Repetti PP, Galbraith
DW, Girke T, Bailey-Serres J (2009) Profiling translatomes of discrete
cell populations resolves altered cellular priorities during hypoxia in
Arabidopsis. Proc Natl Acad Sci USA 106: 18843–18848
Newman IA (2001) Ion transport in roots: measurement of fluxes using ionselective microelectrodes to characterize transporter function. Plant Cell
Environ 24: 1–14
Nishitani K, Tominaga R (1992) Endo-xyloglucan transferase, a novel class
of glycosyltransferase that catalyzes transfer of a segment of xyloglucan
molecule to another xyloglucan molecule. J Biol Chem 267: 21058–21064
Okamoto-Nakazato A, Takahashi K, Kido N, Owaribe K, Katou K (2000)
Molecular cloning of yieldins regulating the yield threshold of cowpea
cell walls: cDNA cloning and characterization of recombinant yieldin.
Plant Cell Environ 23: 155–164
Osato Y, Yokoyama R, Nishitani K (2006) A principal role for AtXTH18 in
Arabidopsis thaliana root growth: a functional analysis using RNAi
plants. J Plant Res 119: 153–162
Reidy B, McQueen-Mason S, Nosberger J, Fleming A (2001) Differential
expression of alpha- and beta-expansin genes in the elongating leaf of
Festuca pratensis. Plant Mol Biol 46: 491–504
Rochange SF, Wenzel CL, McQueen-Mason SJ (2001) Impaired growth in
transgenic plants over-expressing an expansin isoform. Plant Mol Biol
46: 581–589
Roig-Villanova I, Bou J, Sorin C, Devlin PF, Martinez-Garcia JF (2006)
Identification of primary target genes of phytochrome signaling: early
transcriptional control during shade avoidance responses in Arabidopsis. Plant Physiol 141: 85–96
Rose JKC, Bennett AB (1999) Cooperative disassembly of the cellulosexyloglucan network of plant cell walls: parallels between cell expansion
and fruit ripening. Trends Plant Sci 4: 176–183
Rose JKC, Braam J, Fry SC, Nishitani K (2002) The XTH family of enzymes
involved in xyloglucan endotransglucosylation and endohydrolysis:
current perspectives and a new unifying nomenclature. Plant Cell
Physiol 43: 1421–1435
Saeed AI, Bhagabati NK, Braisted JC, Liang W, Sharov V, Howe EA, Li
JW, Thiagarajan M, White JA, Quackenbush J (2006) TM4 microarray
software suite. In AR Kimmel, B Oliver, eds, DNA Microarrays, Part B:
Databases and Statistics, Vol 411. Elsevier Academic Press, San Diego,
pp 134–193
Salter MG, Franklin KA, Whitelam GC (2003) Gating of the rapid shadeavoidance response by the circadian clock in plants. Nature 426: 680–683
Sampedro J, Cosgrove DJ (2005) The expansin superfamily. Genome Biol
6: 242
Sasidharan R, Chinnappa CC, Voesenek LACJ, Pierik R (2008) The
regulation of cell wall extensibility during shade avoidance: a study
using two contrasting ecotypes of Stellaria longipes. Plant Physiol 148:
1557–1569
Savaldi-Goldstein S, Peto C, Chory J (2007) The epidermis both drives and
restricts plant shoot growth. Nature 446: 199–202
Schopfer P, Liszkay A (2006) Plasma membrane-generated reactive oxygen
intermediates and their role in cell growth of plants. Biofactors 28: 73–81
Sessa G, Carabelli M, Sassi M, Ciolfi A, Possenti M, Mittempergher F,
Becker J, Morelli G, Ruberti I (2005) A dynamic balance between gene
activation and repression regulates the shade avoidance response in
Arabidopsis. Genes Dev 19: 2811–2815
Smith H (2000) Phytochromes and light signal perception by plants: an
emerging synthesis. Nature 407: 585–591
Soga K, Wakabayashi K, Hoson T, Kamisaka S (1999) Hypergravity
increases the molecular mass of xyloglucans by decreasing xyloglucandegrading activity in azuki bean epicotyls. Plant Cell Physiol 40:
581–585
Plant Physiol. Vol. 154, 2010
989
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.
Sasidharan et al.
Sulova Z, Lednicka M, Farkas V (1995) A colorimetric assay for xyloglucanendotransglycosylase from germinating seeds. Anal Biochem 229:
80–85
Vandenbussche F, Pierik R, Millenaar FF, Voesenek LACJ, Van der
Straeten D (2005) Reaching out of the shade. Curr Opin Plant Biol 8:
462–468
Van Sandt VST, Suslov D, Verbelen JP, Vissenberg K (2007) Xyloglucan
endotransglucosylase activity loosens a plant cell wall. Ann Bot (Lond)
100: 1467–1473
Vissenberg K, Oyama M, Osato Y, Yokoyama R, Verbelen JP, Nishitani K
(2005) Differential expression of AtXTH17, AtXTH18, AtXTH19 and
AtXTH20 genes in Arabidopsis roots: physiological roles in specification
in cell wall construction. Plant Cell Physiol 46: 192–200
Vreeburg RAM, Benschop JJ, Peeters AJM, Colmer TD, Ammerlaan
AHM, Staal M, Elzenga TM, Staals RHJ, Darley CP, McQueen-Mason
SJ, et al (2005) Ethylene regulates fast apoplastic acidification and
expansin A transcription during submergence-induced petiole elongation in Rumex palustris. Plant J 43: 597–610
Vriezen WH, De Graaf B, Mariani C, Voesenek LACJ (2000) Submergence
induces expansin gene expression in flooding-tolerant Rumex palustris
and not in flooding-intolerant R. acetosa. Planta 210: 956–963
Wieczorek K, Golecki B, Gerdes G, Heinen P, Szakasits D, Durachko DM,
Cosgrove DJ, Kreil DP, Puzio PS, Bohlmann H, et al (2006) Expansins
are involved in the formation of nematode-induced syncytia in roots of
Arabidopsis thaliana. Plant J 48: 98–112
Wu Y, Sharp RE, Durachko DM, Cosgrove DJ (1996) Growth maintenance
of the maize primary root at low water potentials involves increases in
cell-wall extension properties, expansin activity, and wall susceptibility
to expansins. Plant Physiol 111: 765–772
Yokoyama R, Rose JKC, Nishitani K (2004) A surprising diversity and
abundance of xyloglucan endotransglucosylase/hydrolases in rice:
classification and expression analysis. Plant Physiol 134: 1088–1099
990
Plant Physiol. Vol. 154, 2010
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2010 American Society of Plant Biologists. All rights reserved.