The EMBO Journal Peer Review Process File - EMBO-2011-78232
Manuscript EMBO-2011-78232
CPEB2-eEF2 interaction impedes HIF-1α RNA translation
Po-Jen Chen and Yi-Shuian Huang
Corresponding author: Yi-Shuian Huang, Academia Sinica/Institute of Biomedical Sciences
Review timeline:
Submission date:
Editorial Decision:
Revision received:
Editorial Decision:
Revision received:
Editorial Decision:
Revision received:
Accepted:
28 May 2011
24 June 2011
22 September 2011
12 October 2011
13 October 2011
08 November 2011
13 November 2011
15 November 2011
Transaction Report:
(Note: With the exception of the correction of typographical or spelling errors that could be a source of ambiguity,
letters and reports are not edited. The original formatting of letters and referee reports may not be reflected in this
compilation.)
1st Editorial Decision
24 June 2011
Thank you for submitting your manuscript for consideration by The EMBO Journal. Three referees
have now evaluated it, and their comments are shown below. As you will see while all three referees
consider the study as potentially very interesting and referee 3 is more positive, the other two
referees - in particular referee 1 - are not convinced that the conclusiveness and completeness of the
study is sufficient at this point to fully justify the conclusions drawn. Given the interest expressed by
the referees in principle, we would like to give you the possibility to address and/or respond to the
criticisms raised by the referees in a revised version of this manuscript. However, it will be
important to sort out the concerns in a fully convincing way and to the satisfaction of the referees. I
should add that it is EMBO Journal policy to allow only a single round of revision, and acceptance
or rejection of your manuscript will therefore depend on the completeness of your responses in this
revised version as well as on the final assessment by the referees.
When preparing your letter of response to the referees' comments, please bear in mind that this will
form part of the Peer Review Process File, and will therefore be available online to the community.
For more details on our Transparent Editorial Process, please visit our website:
http://www.nature.com/emboj/about/process.html
We generally allow three months as standard revision time. As a matter of policy, competing
manuscripts published during this period will not negatively impact on our assessment of the
conceptual advance presented by your study. However, we request that you contact the editor as
soon as possible upon publication of any related work, to discuss how to proceed. Should you
foresee a problem in meeting this three-month deadline, please let us know in advance and we may
be able to grant an extension.
© European Molecular Biology Organization
1
The EMBO Journal Peer Review Process File - EMBO-2011-78232
Please do not hesitate to contact me at any time should you need to discuss any aspect of the
revision further.
Thank you for the opportunity to consider your work for publication. I look forward to your
revision.
Yours sincerely,
Editor
The EMBO Journal
-----------------------------------------------REFEREE COMMENTS
Referee #1
Chen and Huang report that the RNA-binding protein (RBP) CPEB2 (cytoplasmic polyadenylation
element binding protein) interacts with the translation elongation factor (eEF2), inhibits its activity
in vitro and represses translational elongation in repoter assays. The authors present further evidence
that CPEB2 binding to the 3'-UTR of HIF-1α mRNA contributes to the translational repression of
HIF-1α and that this repression is relieved after treatment with arsenite.
This work is potentially important as it may constitute the first example of a trans-binding factor
(CPEB2) that associates with an mRNA and affects translational elongation. It has been reported
that hypoxia inhibits translation elongation by modulating eEF2 function (e.g., Connolly et al., 2006,
an important citation to include) and numerous sequence-specific RBPs that affect translational
intiation, but the influence of RBPs on translational elongation is unknown. However, despite my
initial enthusiasm with the topic, important problems with the experimental approach and
interpretation have lessened my enthusiasm.
Main Comments:
In the Introduction, the authors write: "Several polysomal profiling studies have reported that
elevated HIF1α synthesis is concomitant with the migration of HIF1α RNA from polysomes of light
density towards polysomes of heavy density, suggesting that upregulation of HIF1α RNA translation
during hypoxia may first take place at elongation (Galban et al, 2008; Hui et al, 2006; Thomas &
Johannes, 2007)."
I am not sure what the authors mean. None of these publications suggests that hypoxia increases the
elongation of HIF-1α translation (although it does increase translation initiation). The appearance of
larger polysomes is generally considered to reflect increased translation initiation (increased rate of
loading of new ribosomes), not translation elongation. In fact, in many studies, changes in
translational elongation are inferred from an absence of changes in polysome size linked to
increased or decreased translation. This incorrect interpretation appears in several places in this
manuscript.
Figure 4 is particularly important. However, these concerns remain:
- What is the rationale behind testing (comparing?) reporters pEMCV-IRES and pCrPV-IRES? It
seems that the information could be gained simply from pCrPV-IRES? If there are other reasons to
include both reporters, please explain them.
- Have the authors determined where within the HIF-1α 3'-UTR does CPEB2 bind? One critical
experiment the authors must do is substitute the region of interaction with CPEB2 (replacing the
Ms2 hairpins), and then test if changing CPEB2 levels alters pCrPV-IRES luciferase activity.
- In Figure 4D, are the effects of CPEB2bN-Ms2CP the same as CPEB2aN-Ms2CP? Since these are
key functional data, it is important that the authors characterize this effect in more detail. Does the
polysomal distribution of mRNAs expressed from pLuc, pEMCV-IRES and pCrPV-IRES change in
the presence of CPEB2aN-Ms2CP compared with EGFP-Ms2CP?
- Does Arsenite affect CPEB2 function in these reporter assays?
© European Molecular Biology Organization
2
The EMBO Journal Peer Review Process File - EMBO-2011-78232
Figure 6 is problematic in several ways:
- From Fig. 6A and 6B, it is no possible to conclude that HIF-1α translational elongation contributes
more than translational initiation, since MG132 can affect many proteins besides HIF-1α itself.
- The data in Figure 6D are especially puzzling. It is difficult to follow the logic of the authors in
their interpretation of the strikingly larger HIF-1α mRNA polysomes seen in the myc-CPEB2a
group (together with reduced HIF-1α levels in the same group, panel B). Elongation is inhibited and
according to the authors, this reflects slower elongation, what is the evidence? Is it that more
ribosomes continue loading on this mRNA? No data are shown to indicate this. HIF-1α also has an
IRES, which potentially complicates this analysis. The authors need to test if HIF-1α is translated at
a different rate by using alternative methods to measure nascent translation (e.g. de novo 35S-aa
incorporation or the Click-it assay).
- In addition, to get around the problem of the HIF-1α IRES and the short half-life of the HIF-1α
protein more directly, the authors should attach the HIF-1α 3'-UTR to a reporter (e.g. luciferase
coding region) and study the expression of the reporter protein as well as the distribution of the
reporter mRNA on polysomes.
In general (Figure 3 and 6), the quality of the polysomes is low, particularly because the polysome
peaks are very small. How many times have the authors repeated each polysome experiment? This
should also be stated in the text.
Figure 7:
- Silencing CPEB2 instead of reducing the HIF-1α mRNA polysome peak (as one would predict,
based on the authors' interpretation of the overexpression data in Figure 6D), it also increases the
proportion of large polysomes. Here, the authors explain that larger polysomes are indicative of
more active translation, instead of less. This seriously contradicts their interpretation of Figure 6.
Besides this problem, the trend of HIF-1α mRNA mirrors that of GAPDH mRNA, although the
magnitude of the change is smaller. Therefore, this experiment is inconclusive.
- Does Arsenite affect the distribution of HIF-1α mRNA on polysomes? Does the distribution
change in a CPEB2-dependent manner?
- It is curious that the authors have studied arsenite, a relatively weaker inducer of HIF-1α. Is
CPEB2-mediated repression also relieved after exposure to hypoxia or a hypoxia mimic? (the
authors should note that arsenite is not a bona fide hypoxic stress).
Minor comments
1) Throughout the manuscript, please write HIF-1α (α = the Greek letter alpha)
2) Can the authors briefly describe 4EGI-1?
3) It would be helpful to add a schematic of how the authors envision CPEB2-eEF2 regulation of
HIF-1α translation elongation.
Referee #2
This manuscript presents an interesting case of specific regulation of gene expression at the level of
protein synthesis elongation. That said, there are numerous minor experimental details that raise
questions and a few worthwhile experiments that need to be performed. It is anticipated that the
authors should be able to address all of the concerns and submit a revised manuscript that would be
acceptable for publication.
1. There are two key experiments that would really nail the authors' conclusions down. The first is to
use an eEF2-Ms2 fusion and show that the elongation rate of an mRNA with the Ms2 stem-loop in
the 3' UTR either is or is not altered. Second, the authors should perform the classic half transit time
experiment to show directly that the elongation rate for HIF1alpha (or a reporter) is in fact increased
when CPEB2 is present.
2. On page 6 and page 22, the authors make a claim that their finding represents the "first example in
© European Molecular Biology Organization
3
The EMBO Journal Peer Review Process File - EMBO-2011-78232
which the peptide elongation rate from and individual RNA is modulated". One, claims of "first" are
not consistent with Journal policy as all submitted manuscripts are assumed to contain the first
report of some unique findings. Second, the Hussey et al. paper clearly precedes this one.
3. For the cloning of CPEB2a and b, the database designations for these nucleotide sequences need
to be included in the manuscript.
4. Page 8 - "the N-terminal 456 a.a. of CPEB2a was used as the bait for a yeast two hybrid screen to
identify its binding partners." The authors need to present the data on ALL of the proteins identified
in this screen Only one is identified in the text.
5. Page 10 - "suggesting that CPEB2 bound to ribosomal eEF2 and was likely polysome associated
in vivo." If the binding by CPEB2 required eEF2 to be ribosomal bound, how does the yeast two
hybrid screen work?
6. Figure 3 - What is the molar ratio of HIF1alpha mRNA to CPEB2? From panel C, it would appear
that almost all of the CPEB2 is bound to RNA and little is available as free protein (assuming a
protein of 150 kDa would have an S value of around 4). In this context, is the 3' UTR HIF1alpha
element found in other mRNAs as well? In panel A, it would also be good to see what the hydrolysis
profile looks like in the absence of any added His6 protein.
7. Page 12 - the authors need to describe what 4EGI-1 is.
8. Page 15 - "puromycin is only incorporated into translating ribosomes, not arrested ribosomes, ..."
The authors need to define the difference between these two types of ribosomes.
9. Figure 6E - The distribution of the GAPDH mRNA is unexpected in that so little is in polysomes.
Do the authors have an explanation for this? In particular, the distribution seen in Figure 7C seems
more appropriate. At the same time it is noted that most of the ribosomes appear to not be in
polysomes (panels D, E). Do the authors have an explanation for this?
10. Studies from the 1970's (i.e. Cabrer et al., 1972) have indicated that free EF-G can inhibit
translation, presumably by competing for binding to the A site of the ribosome. Is it possible that the
inhibition observed is due to the competition of eEF2 binding to the A site relative to the ternary
complex rather than altering the behavour of the "normal" eEF2 in the translocation reaction?
11. Methods - It is not clear whether the A. salina ribosomes will have the same properties as
mammalian ribosomes. Is there a reason why rat liver ribosomes were not used? Second, The
procedure for RNA IP needs a more detailed description. Third, the authors should justify the use of
the different cell types with each experiment and be sure to cite in each figure legend which cell
type is being used.
Referee #3
The work by Chen and Huang shows that, the RNA-binding protein, CPEB2 inhibits the elongation
phase of mRNA translation through the interaction with eEF2. This interaction impairs GTP
hydrolysis and slows/blocks peptide elongation. Although this mechanism will likely affect many
transcripts, the authors focus in one of the few (the only?) known substrate of the CPEB2 to prove
this new concept, showing that CPEB2 regulates the translational elongation of HIF1a mRNA in
response hypoxic adaptation. This report constitutes one of the few examples of mRNA-specific
translational inhibition targeting the elongation phase and it is the first report addressing the
mechanism of translational repression by other members of the CPEB-family of proteins, beyond
the extensively studied founder member of the family (CPEB1). From a conceptual point of view
this work contains relevant contributions, i.e. a new mechanism of translational repression from a
scarcely studied member of the CPEB-family of proteins and mRNA-specific translational
regulation at the elongation phase. From a technical point of view, the work is very detailed and
carefully performed.
Overall this is an excellent manuscript. However, there are few issues that deserve further
© European Molecular Biology Organization
4
The EMBO Journal Peer Review Process File - EMBO-2011-78232
clarification:
Major points:
1- HIF 1a has been shown to be regulated by both CPEB1 and CPEB2, through canonical CPE
elements and by changes in the poly(A) tail length (Hagele 2009). The regulatory role of CPEB1
and cytoplasmic polyadenylation points to the initiation phase of translation, rather than to the
elongation. This apparent contradiction should, at the very least, be discussed and, ideally, clarified
by few new experiments. Is the CPEB2-repressed HIF1a mRNA deadenylated? Is the arseniteinduced derrepression associated with polyadenylation ? is CPEB1 present in these cells and
competing with CPEB2 for the binding to the CPEs in HIF1a 3'UTR? Is CPEB2 recognizing the
canonical CPEs or different cis acting elements in HIF1a 3'UTR? Is CPEB1 also present in the
stalled polysomes?
2- Given that the authors have mapped the CPEB2 domain that binds to eEF2, it seems worth to
discuss whether a similar motif is also present in other CPEBs or whether this is a unique
mechanism for CPEB2.
3- The authors extensively discuss whether CPEB2 interaction with eEF2 slows down elongation vs.
a complete block in elongation. The basis for this arguments is the additional effect of puromycin
over CPEB2 overexpression, in displacing a small percentage of the HIF1a transcript from heavy to
light polysomes (Fig 6E). However, there are several other possible interpretations for this small
difference in the polysomal distribution of Hif1a mRNA between CPEB2-overexpress and CPEB2overexpress + Puromycin treated cells: The levels of CPEB2 (properly fold) may not be sufficient,
the HIF1a mRNA in the heavy polysomes (sensitive to puromycin) may not be bound by CPEB2,
etc. While this is definitively an interesting point, it will need a significant amount of work to
determine the dynamics and equilibriums of individual ribosomes processing HIF1a mRNA and to
explain how a single CPEB2 (or multiple CPEB2s bound to the 3' UTR) can block the scanning of
multiple ribosomes. A detailed study of how CPEB2 arrest/slows-down the scanning of ribosomes
seems more the scope of future works. Therefore I would suggest to eliminate any conclusion
regarding whether CPEB2 interaction with eEF2 slows down elongation vs. a complete block in
elongation from this manuscript.
Minor points:
1- HIF1a Westerns in figs 6A, 6B and 7A seem a bit to exposed and with high background for
quantification.
2- The authors claim that this is the first time that a transcript-specific repression at the elongation
phase of translation is reported. However there are few other examples, noted by the authors, like for
Hac1, Ash1or hnRNPE1.
1st Revision - authors' response
22 September 2011
Referee #1
The reviewer asked us to clarify our interpretation of HIF-1α RNA polysome data.
- We have more carefully explained the polysome data throughout the entire manuscript and
clarified several common concepts that are not always true in interpreting polysome data (pages 6
and 15 ).
The reviewer mentioned that "none of these publications (Galban et al, 2008; Hui et al, 2006;
Thomas & Johannes, 2007) suggests that hypoxia increases the elongation of HIF-1α translation
(although it does increase translation initiation).
- None of these publications has clearly demonstrated that the increased translation of HIF-1α is
exclusively at initiation. As long as the rate of initiation increases greater than that of elongation
(i.e. loading> unloading of ribosomes on HIF-1α RNA) under the assumption that the rate of
termination remains constant, the migration of HIF-1α RNA towards larger polysomes is expected.
We have not found any of these publications has determined the rate of ribosome loading
© European Molecular Biology Organization
5
The EMBO Journal Peer Review Process File - EMBO-2011-78232
(initiation event). That is to determine the average number of ribosome associated with HIF-1α
RNA divided by the ribosomal transit time of HIF-1α RNA under normoxic and hypoxic
conditions. The intrinsic difficulties to determine the ribosomal transit time of specific RNA in
vivo is if the RNA is not efficiently translated to give sufficient amount of nascent labeled protein
that could be precipitated efficiently with a good and specific antibody using the method
established by Palmiter (1972).
The reviewer also mentioned that "the appearance of larger polysomes is generally considered to
reflect increased translation initiation (increased rate of loading of new ribosomes), not translation
elongation. ...............This incorrect interpretation appears in several places in this manuscript.
- We would like to emphasize that the polysomal profile simply reflects the number of ribosomes
associated with the RNA. Without additional data (Western, reporter assay, the molecular
mechanism, CPEB2-eEF2 interaction....), the only save conclusion to draw from the polysome
profile alone is that the RNAs distributed in the fractions of density lighter than 80S is
translationally silent. Not much more can be said for the translational status of ribosome-associated
RNA since several polysome-associated RNAs is translationally arrested (e.g. lin14, Olsen and
Ambros, 1999). Although the shift of RNAs towards polysomes is generally believed to increase
the translation of RNAs, this concept is true only when the RNAs are exclusively regulated at
initiation. Under many conditions (hormone treatment, hypoxia.....) which increase or decrease
global protein synthesis, not only the initiation but also the elongation rate was simultaneously
affected towards the same direction as judged by the change of phosphorylation status of
translation factors (eIF4E, eIF2a, eEF2....). As long as the change in global initiation rate is larger
than elongation rate, a change in polysome size is expected since the rate limiting step in most
RNA translation is at initiation,
Ref: Mathews MB, Sonenberg N, Hershey JWB (2007) Origins and principles of translational
control. In Translational Control in Biology and Medicine Mathews MB, Sonenberg N, Hershey
JWB (eds), 1, pp 1-40. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press
Figure 4 is particularly important.......
- We do expect that CPEB2 could repress both EMCV- and CrPV-mediated translation, so we have
removed the EMCV data.
- We have performed the experiments as requested to identify the region in HIF-1α 3'-UTR
required for CPEB2-mediated repression (Supplementary Figure 7B) and shown that CPEB2 could
repress translation of CrPV-Luci-HIF1-3'UTR reporter (Figure 7E)
- We have also included the CPEB2bN-Ms2CP data in Figure 4D. In terms of polysomal profiles
of pLuc, pEMCV-Luc and pCrPV-Luc reporters in the presence of CPEB2aN-Ms2CP versus
EGFP-Ms2CP with or without arsenite treatment, we decided not to address within the limited
time we have. For the reasons that polysome profile by itself does not say much about the
translational status of RNA and these are reporter RNAs, so we focused on trying the important
experiments, such as de novo HIF-1α synthesis and ribosome transit time of HIF-1αRNA to
strengthen our manuscript.
Figure 6 is problematic .........From Fig. 6A and 6B, it is no possible.......
- To detect endogenous HIF-1α under normoxia, we have to use MG132 to block degradation but
MG132 treatment does not lead to the conclusion. It is an established approach to determine the
rate-limiting step of RNA translation by applying the low concentration of inhibitors to partially
downregulate global initiation or elongation. If the rate limiting step is at elongation (like HIF-1α
under normoxia), the synthesis of HIF-1α is affected more by a decrease in elongation (CHX) than
initiation (4EGI-1). Under the blockade of HIF-1α degradation by MG132, only the wild type but
not the eEF2-interacting defective mutant CPEB2 decreased HIF-1α level. Along with the data
from Figures 2 to 5, it is not unreasonable to conclude the most possible way- "CPEB2 regulates
HIF-1α synthesis at elongation".
The data in Figure 6D are especially puzzling......
- We would like to reinforce that the polysome data by itself, cannot be simply interpreted as the
change of elongation or initiation nor the translation status of RNA.
We have emphasized our points in the revised manuscript (please see page 19).
© European Molecular Biology Organization
6
The EMBO Journal Peer Review Process File - EMBO-2011-78232
We clearly observed the reduction of HIF-1α protein level and accumulated polysomal HIF-1α
RNA when wild type but not an eEF2-interacting defective mutant CPEB2 was expressed. If the
elongation (ribosome unloading) rate of HIF-1α RNA is smaller than initiation (ribosome loading)
rate due to CPEB2-suppressed HIF-1αRNA translation at elongation, the changes shown in the
polysome date would support our finding. It will be nice to determine the real initiation and
elongation rate of HIF-1αRNA in vivo. However, we think it is impossible to do so for HIF1αRNA with the methods we know (Palmiter 1974). We have derived an alternative approach to
relatively compare the elongation rate (i.e. ribosome transit time) of HIF-1αRNA with or without
CPEB2 expression under normoxia (Figure 6F and 6G).
- We have performed Click-iT assay to monitor de novo HIF-1α as well as the reporter EGFPHIF1a 3'-UTR synthesis (Figure 6E and Supplementary Figure 6A).
- The polysome profiles varied because the confluence and the culture condition of cells, which
affect global protein synthesis, were different for overexpression, drug treatment or knockdown
experiments. Nonetheless, all polysome experiments were performed 2-3 times independently and
compared side-by-side for the distribution of HIF-1α RNA vs. GAPDH RNA to derive the
conclusion. We have stated this in the page 34. However, it is impossible to average the polysomal
data since the cell condition, gradient preparation, fractionation and RNA isolation vary from time
to time. The low polysome peak is also partially caused by setting the sensitivity of OD254 reading
at the minimum scale since we are afraid of off-chart recording of the profile. Nevertheless, after
local enlargement of the chart, we think the polysome peak we had is reasonable (please see
Appendix, Figure A).
Figure 7:
- We understand the reviewer's point and apologize for using a general concept- a shift of RNAs
towards larger polysomes is to increase the translation of RNAs, to explain the Figure 7C without
extensive discussion in our initial manuscript. We have reinforced the correct concept in
interpreting polysome data in the page 19. Since CPEB2 slows down translation elongation of
HIF-1α RNA, the depletion of CPEB2 is expected to accelerate the unloading of ribosomes from
HIF-1α RNA, which in turn HIF-1α RNA should migrate towards lighter density of polysome if
the regulation of HIF-1α RNA translation only occurs at elongation. It appears that an unidentified
mechanism that facilitates the ribosome loading (initiation events) on HIF-1α RNA is also
enhanced in the KD cells. Polypyrimidine tract-binding protein (PTB) was found to bind the HIF1α 3'-UTR and promoted CoCl2-induced HIF-1α synthesis (Galban et al, 2008) and PTB is
universally expressed, so we have tested whether overexpression of PTB could alleviate CPEB2mediated repression of Luc- HIF-1α 3'-UTR reporter expression (please see Appendix, Figure B).
The reporter assay indicates that PTB might be the factor to promote HIF-1α RNA translation in
the CPEB2 knockdown cells. However, the data is preliminary and requires additional experiments
to prove our speculation. Moreover, under the idea situations (identical cell culture condition,
identical gradient, identical fractionation and RNA isolation), one would expect the distribution
curves of a non-target control RNA should be superimposable from different polysome profiles.
However, it is experimentally impossible that was also demonstrated from the studies of Galban et
al, 2008 (Figure 2, CoCl2-induced a shift of GAPDH RNA towards polysome with no apparent
increase in de novo synthesis of GAPDH protein) and Hui et al, 2006 (Figure 3, TH RNA). In fact,
the difference in magnitude of the changes in target vs. non-target RNAs is the basis that we are
sure that the change is not due to the variation among gradient preparation, fractionation, RNA
isolation and/or cDNA synthesis. Again, the polysome data is only used to reinforce the result
obtained from Western, reporter assay instead of being interpreted by itself.
- For all the drawbacks as we mentioned about polysome data, we have focused on other important
concerns raised by the reviewer. We have borrowed the hypoxia chamber from our colleague and
performed the 1% O2 as well as CoCl2 treatment (Supplementary Figure 6A and 7A).
Minor comments:
1) We have changed HIF1a to HIF-1 a throughout the entire manuscript.
2) We have included the description for 4EGI-1 (page 12).
3) We have included an illustrated model in Figure 7G.
© European Molecular Biology Organization
7
The EMBO Journal Peer Review Process File - EMBO-2011-78232
Referee #2
1) We have tried the eEF2-Ms2CP experiment. It appears that the tethering of eEF2 at the 3'-UTR
does not inhibit luciferase expression. Instead, it seems to promote translation just like the
expression of flag-eEF2 (please see Appendix, Figure C). Thus, the CPEB2-eEF2 interaction is
required to downregulate translation of CPEB2-target RNA at elongation. We have used Click-iT
assay to monitor de novo synthesis of HIF-1α and a reporter, EGFP-HIF1a-3'UTR. Although the
classic ribosome transit time experiment is undoable for HIF-1α RNA, we have derived an
alternative way to relatively compare whether the elongation rate of HIF-1α RNA is inhibited
under CPEB2 overexpression (please see explanation and new data in Figure 6 and Supplementary
Figure 6A).
2) We have modified our claim.
3) We have included the accession number. The sequences are scheduled to release in October.
4) We have included the screening data (Supplementary Table I).
5) CPEB2 and eEF2 interaction does not require ribosome, so the yeast two hybrid screen could
work. Our in vitro study suggested that the binding of eEF2 to ribosome does not exclude the
association of CPEB2 and eEF2 since CPEB2 could indirectly associate with ribosome in the
presence of eEF2. Thus, CPEB2 associated with polysome in vivo is expected. However, we
cannot exclude the possibility that eEF2 in complex with CPEB2 might reduce its on-rate of
binding to ribosomes and hence decreased its GTPase activity (stated in Discussion).
6) We have not estimated the molar ratio of HIF-1α RNA vs. CPEB2 that is likely variable among
cells. Despite HIF-1α RNA is the only known CPEB2 target, we do not believe this is the only one.
We are in the process to perform HITS-CLIP (Licatalosi et al.,2008) to identify the CPEB2-target
RNAs. It is generally believed that RNA-binding proteins in vivo is assembled into some kind of
mRNP complex (P-body, transport granule...). Nonetheless, we have no data to prove or disprove
whether free form of CPEB2 exists in cells since the sucrose gradient we used is only good for
separating complex of large S value, 40S, 60S, 80S and above. The fractions 1 and 2 of S value <
40 were generally considered to be the free mRNP fraction. We have mapped the important
sequence (essential but may not be sufficient) in HIF-1α 3'-UTR for CPEB2-mediated repression
(Supplementary Figure 7B). The same sequence can be found in other mRNAs as well as within
other regions of HIF-1α 3'-UTR. Nonetheless, it appears, based on the reporter assay, only the one
we identified is essential for CPEB2-mediated repression. We have included the hydrolysis profile
in the absence of His6-tagged recombinant protein in Figure 3A.
7) 4EGI-1 explanation has been included (page 12).
8) We have included more description of puromycin to help understanding why this chemical is
only incorporated into translating but not arrested (paused translating) ribosomes (page 18).
9) Depending on the experiments, the global translation status of cells harvested for polysome
study varied depending on the confluence and culture condition of cells (please see detail
description in page 34). Thus, we do observe variations in polysome profiles from time to time.
Nonetheless, all polysome experiments were performed 2-3 times independently and compared
side-by-side for the distribution of HIF-1α RNA vs. GAPDH RNA to derive the conclusion. The
low polysome peak is also partially caused by setting the sensitivity of OD254 reading at the
minimum scale since we are afraid of off-chart recording of the profile. Nevertheless, after local
enlargement of the chart, we think the polysome peak we had is reasonable (please see Appendix,
Figure A).
10) The study from Cabrer 1972 was done at the time when scientists were still trying to delineate
whether EF-Tu and EF-G bind to the same site of ribosome. The Cabrer's study showed that free
EF-G inhibited the binding of aminoacylated-tRNA to the ribosome and "hence inhibits
translation". The conclusion is not right since we know now that both EF-Tu- aminoacylated tRNA
(eEF1A- aminoacylated tRNA) and EF-G (eEF2) bind to the A site of ribosomes and promote
peptide elongation. Even if the conclusion is right and CPEB2 binding to eEF2 could compete its
© European Molecular Biology Organization
8
The EMBO Journal Peer Review Process File - EMBO-2011-78232
binding ability to the A site of ribosome, an increase instead of decrease in translation was
expected, which is definitely not the case in our study.
11) The study reported by Zasloff and Ochoa 1971, which indicated the ribosomes in A. salina
cysts exist mainly as free 80 S ribosomes and are easily purified to the state free from any
elongation factor. We have tried to purify ribosomes from rat liver but the preparation was not
clean. Thus, we used ribosomes purified from A. salina cysts since A. salina ribosome has been
widely used along with elongation factors purified from other species (Iwasaki and Kaziro, 1979).
We have included more detail description about RNA IP and stated clearly for the cell types used
in each experiment.
Referee #3
Major points:
1. We have tried the PAT assay to measure the poly(A) length of HIF-1α. The Hagele's study
indirectly demonstrated that HIF-1α 3'-UTR was subject to CPEB1-mediated polyadenylation in
frog oocytes and both CPE and noncanonical-CPE (NC-CPE) in the HIF-1α 3'-UTR were required
for the elevated expression of Luci- HIF-1α 3'-UTR reporter in response to (1%O2 + insulin)
treatment in SK-N-MC cells. It is known that any artificial RNA containing CPE (UUUUAAU)
and polyadenylation signal (AAUAAA) when injected to frog oocytes could undergo CPEB1mediated polyadenylation in response to progesterone-induced oocyte maturation. However, there
is no direct evidence to show the HIF-1α RNA is regulated by polyadenylation in 1%O2 or (1%O2
+ insulin) condition in the Hagele's study. Thus, we have measured the poly(A) length of HIF-1α
and performed additional experiments (Supplementary Figure 8). It appears that with or without
arsenite, with or without myc-CPEB1 or myc-CPEB2 expression, the poly(A) tail of HIF-1α
remains unchanged. Then we also tried the RNA reporter assay with HIF-1α 3'-UTR containing or
lacking the polyadenylation signal. Since CPEB1-mediated polyadenylation-activated translation
requires not only CPE but also polyadenylation signal, AAUAAA. We found the reporter RNAs
with or without AAUAAA were repressed by both CPEB1 and CPEB2 but were translationally
derepressed in response to arsenite in a polyadenylation-independent manner. We have also
mapped the NC-CPE1 (see Supplementary Figure 7B) was required for CPEB2-mediated
repression. In our opinions, nothing has been demonstrated directly to implicate how CPEB1 and
CPEB2 promoted (1%O2 + insulin)-induced HIF-1α synthesis. For example, whether the (1%O2 +
insulin) treatment could induce phosphorylation of CPEB1 on Ser/Thr 174 to activate
polyadenylation machinery and change the poly(A) length of HIF-1α RNA. However, the
treatment and cell lines we used are different from those used by Hagele, so we could not discuss
extensively about their finding along with the elongation-repression we identified for CPEB2. We
are not able to address whether CPEB1 is present in those cells we used since the antibody we
purchased from Santa Cruz Biotechnology did not work on detecting endogenous CPEB1 (please
see Appendix, Figure D). Although the antibody detected a band (non-specific) of right molecular
weight, this band was not reduced under the CPEB1 knockdown condition (control: EGFPmCPEB1). In addition, we did not see the poly(A) tail of HIF-1α RNA elongates in response to
arsenite. At this moment, we cannot rule out that CPEB1 may have additional repression/
derepression mechanism besides polyadenylation.
2. The similar motif is present in CPEB3 and CPEB4 but not CPEB1. We have performed
characterization to delineate the eEF2-interacting motif in CPEB3 (Supplementary Figure 4).
3. We have performed additional experiments (Figure 6E, 6F, 6G and Supplementary Figure 6A)
to compare the rate of de novo synthesis of HIF-1α as well as to derive a way to relatively compare
the elongation rate of HIF-1α RNA with or without CPEB2 expression. The puromycin data has
been moved to Supplementary Figure 6B. The points raised by the reviewer are interesting but may
be difficult to perform in the case of HIF-1α RNA. Please see our explanation in the revised Figure
6 (pages 16-18). We are in the process to perform HITS-CLIP (Licatalosi et al.,2008) to identify
the CPEB2-target RNAs. It will be interesting to determine whether the elongation rate of CPEB2target RNAs are affected in a degree correlated with the number of CPEB2 protein associated with
the RNAs.
© European Molecular Biology Organization
9
The EMBO Journal Peer Review Process File - EMBO-2011-78232
Minor points:
1 The quantification is done by using the image that was not overexposed. We have changed the
figure.
2. We have modified our claim.
Appendix: Figures for Reviewers
2nd Editorial Decision
12 October 2011
Thank you for sending us your revised manuscript. Our original referees have now seen it again. In
general, the referees are now positive about publication of your paper. However, referee 2 feels that
there are a few concerns that still need to be addressed (see below) before we can ultimately accept
your manuscript. I would therefore like to ask you to deal with the issues raised. Please let us have a
suitably amended manuscript as soon as possible.
Yours sincerely,
Editor
The EMBO Journal
© European Molecular Biology Organization
10
The EMBO Journal Peer Review Process File - EMBO-2011-78232
-----------------------------------------------REFEREE COMMENTS
Referee #1
The authors have addressed my concerns adequately.
Referee #2
This is an improved manuscript and in its current version, does provide extensive data to support the
mechanism for CPEB2 regulation of expression of the HIF-1α mRNA although most of the data
indicate only a 2-fold affect. That said, there remain several concerns that should be addressed.
1. It is not clear why the "classical half transit time" experiment cannot be done. The authors state
that "we could not detect nascent chains" (page 17) and thus could not use the method of Palmiter.
However, in the Palmiter paper, there is no determination of half transit times and on page 6458
Palmiter states" The main assumptions are that: (a) all genes are transcribed at the same rate, (b) all
mRNAs are activated at the same rate, and (c) all mRNAs are translated at the same rate. There is
some evidence to support the third assumption, but the others are unfounded." It would be
worthwhile for the authors to review either of the following papers: Mueckler, Merrill and Pitot
(1983) or Fan and Penman (1970). What needs to be measured is completed chains, not nascent
chains.
2. page 7 - The sequence NP_787951.2 was put in the database in February 2011. Therefore, it is not
clear why the authors trace the evolution of this "larger" form from the 521 amino acid version
(unless this represents the author's history in which case the text should be written with this in
mind).
3. page 8 - in the yeast 2 hybrid assay, what proteins are identified if the C-terminal amino acids of
CPEB2a are used (456-1014)? For Supplemental Table 1, were each of the identified proteins found
only once or were some clones found more frequently than others? If the latter, it would be good to
have an additional column that reflected this frequency.
4. page 14 - delete the sentence "Thus, CPEB-like proteins, distinct from CPEB1, repress translation
at elongation." At this point in the manuscript, there is no data to support this conclusion.
5. Although the manuscript is written well enough to be readily understood, it would still benefit
from a review by a colleague more familiar with English. As a single example: (from page 3)
"mRNA is decoded by the repetitive and coordinated actions of the 80S ribosome, eukaryotic
elongation factors (eEFs) and aminoacyl-charged tRNAs to synthesize specific amino acid chain
until the entire ..." should be "mRNA is decoded by the repetitive and coordinated actions of the 80S
ribosome, eukaryotic elongation factors (eEFs) and aminoacyl-tRNAs to synthesize a specific
polypeptide chain until the entire ..."
Referee #3
In light of the new experiments and the detailed explanations provided, I consider the points raised
in the previous review of the manuscript satisfactorily addressed.
2nd Revision - authors' response
13 October 2011
Thank you for giving us another chance to address the additional concerns raised by the second
reviewer. We will respond to his/her comments point-by-point.
© European Molecular Biology Organization
11
The EMBO Journal Peer Review Process File - EMBO-2011-78232
Referee #2
1. We have changed one citation in our manuscript- it should be another 1972 paper from Palmiter,
which described the ribosome transit time for total RNAs and specific RNAs encoding egg white
proteins. We have reviewed several papers (Fan and Penman 1970, Palmiter 1972 & 1974, Rofer
and Wicks 1978, Mueckler et al, 1983) about the determination of ribosome transit time. As we
stated earlier in our first revision letter, "the intrinsic difficulties to determine the ribosomal transit
time of specific RNA in vivo is if the RNA is not efficiently translated to give sufficient amount of
nascent labeled protein that could be precipitated efficiently with a good and specific antibody
using the method established by Palmiter (1972)". The papers published in the earlier time used H3
or C14-labeled amino acids to tag the newly synthesized proteins and then immunoprecipitated the
specific nascent protein, followed by scintillation counting. The precipitated substance was
automatically assumed to be the antibody-targeted protein without separation on SDS-PAGE. As
we know that immunoprecipitation pulls down not only the target protein but also other proteins
either specifically associated with the immunoprecipitated protein or non-specifically bound to the
beads. If the target proteins as analyzed in the earlier studies (Palmiter 1972 & 1974, Rofer and
Wicks 1978, Mueckler et al, 1983) are abundantly synthesized, the contaminated background
signal is likely ignorable. In contrast, for proteins like HIF-1α, such a measurement is problematic.
In the Appendix Figure A, using the non-radioactive labeling method, we found only CoCl2 but not
arsenite or MG132 treatment enabled us to detect nascent HIF-1α on the Western blot (we do mean
the nascent proteins are polypeptide chains completely released from polysome). We have used
this treatment to monitor the rate of HIF-1α synthesis with or without CPEB2 overexpression
(Supplementary Figure 6A). To monitor the rate of HIF-1α synthesis under normoxic condition,
we have to use a reporter, EGFP-HIF1a-3'UTR, or measure the relative migration rate of HIF-1α
RNA on polysomes (Figure 6E, 6F and 6G) to demonstrate that CPEB2 affects the elongation rate
of HIF-1α synthesis. The similar situation was reported from the Galbin's study (Appendix Figure
B). The authors have used S35Met/Cys to label nascent proteins and performed
immunoprecipitation using GAPDH and HIF-1α antibodies. Instead of just counting the S35
radioactivity, they separated the precipitated substances on SDS-PAGE. Under CoCl2 but not 1%
O2 treatment, the nascent HIF-1α could be evidently detected. In this figure, we can also see nonspecific radioactive signals are present in the IgG as well as GAPDH and HIF-1α antibodyimmunoprecipitates. Especially in the 1% O2, HIF-1α pull-down lane, the radioactive signal of the
background is greater than that of the HIF-1α band. Thus, it is impossible for us to use the
conventional way to determine the transit time for HIF-1α RNA.
2. We have mentioned how we identified CPEB2a and CPEB2b on page 7. The two clones were
amplified using primers designed based on a predicted rat CPEB2 sequence (using CPEB2 genomic
DNA sequence to predict cDNA) published in 2007, XM_001060239. However, CPEB2a and
CPEB2b amplified from rat neuronal cDNA do not contain exact sequences as the predicted clone,
so we have deposited both sequences in the database. The XM_001060239 sequence has been
removed from the database since the publication of NP_787951.2. Nevertheless, we have saved
XM_001060239 sequence that is shown in the Appendix Figure C.
3. The expression of the GAL4-DNA binding domain fused with the full length or the C-terminal
RNA-binding domain of CPEB2a were somehow toxic to the yeasts, so we could only use the
CPEB2a N-terminus as the bait for the screening. This was also the case when we used CPEB3 for
the yeast two hybrid screen in our previous study (Peng et al., NAR 2010). We have included the
clone appearing frequency in the Supplementary Table I.
4. We have deleted the sentence.
5. We have already used the professional editing service, OnLine English, to correct our manuscript
prior to submission to the EMBO journal. We have also asked our senior colleague to check the
manuscript one more time and make several additional changes in pages 3, 5, 6, 7, 14, 15, 16 and
19.
© European Molecular Biology Organization
12
The EMBO Journal Peer Review Process File - EMBO-2011-78232
Appendix: Figures for the Reviewer
C
XM001060239: predicted rat CPEB2 (5954 nt/ 724 aa)
nt 1-2175 coding region (highlighted in bold)
atgcgggacttcgggttcggggtgctgcacactgccctgctgcgcagcggcagcccccggtcctcgcccggcggcagcgcctaccggcc
cttcgccgccgggccctcagccgcagcttcctcttcctccccgctcgtggcgcatcagcaggccgtgcaggatgagctgctgctcgggct
gacacagcagccggcgaggccgctctcgggggcggcggccgcagagcagctccccagccaccaccccggcggcggcacgaacgcg
ggcggctccgcgtctccgccaccgctgcccggcttcggcaccccctggtccgtgcagaccgcgtcgccgccgccgccccagcctccgcc
ggcgccccagcagcagccatcccagcagcagcagccgcctcagcagccgccgcagccacagcccccgggctcctccgctgccacccc
gggcggcggcggcggcgcgggcggctctctgagcgccatgccgccgcccagcccggactcggagaacggcttctaccccgggctgcc
gtcgtccatgaacccggccttcttcccgagcttctcgccggtgtcgccgcacggctgcgcggggctcagcgtgccggccggcggtggcg
gcggtggcggcggcttcggcggcccgttctctgctcccgcggtgcccgcgccgcccgccatgaatttacctcaacagcagccgccgccg
gcagcgccgcagcagccgcagagccggaggtcacccgtcagcccgcagctgcagcagcagcaccaggcagccgcagccgccttcct
gcagcagaggaactcgtacaaccaccaccagcctcttctgaaacaatctccttggagcaaccatcagagcagtggttggggcactgca
agcatgtcctggggagcaatgcatggcagagatcaccgtagaagcggaaacatgggaattccagggactatgaatcagatatctccgt
tgaagaaaccgttttcgggtaatgttatagcaccaccgaaattcactcgctctactccatcactgactccaaaatcttggattgaagataa
tgtgttcaggacagacaacaatagtaacacactcttacccttacaggatcgaagtaggatgtatgatagcttgaatatgcactctctgga
aaattcccttattgatatcatgagagcagagcacgatcctctcaagggtcgtttgagctatcctcatccaggaaccgacaatctgttaatg
ttaaatgcaaggagttatgggcgaagacgaggtcgatcttccctatttccaatagatgatagcttgttggatgatggtcacagtgatcaa
gttggtgtgttaaattcaccaacatgttattcagctcatcaaaatggagaacgaatagaacgcttctctcgaaaagtttttgttggagggct
tcctccagatattgatgaagatgagatcactgccagcttccggagatttggacctttggtagtagattggccccataaagcagaaagcaa
gtcctatttcccaccaaaaggctacgccttcctcctctttcaagaggagagctcggttcaggcactcattgacgcttgcattgaagaagat
gggaagctctacctgtgtgtctccagccctactatcaaagacaaacctgttcaaatccgtccttggaatttaagtgatagtgattttgtcat
ggatggttctcagcctttggatccccgaaaaacaatttttgttggaggtgttcctaggccattaagggctgtggaacttgctatgatcatgg
accggctgtatggtggtgtgtgttacgcaggaatcgatacagatccagaactcaaatacccgaaaggtgctgggcgagtggctttctcc
aatcagcagagctacattgctgccatcagtgctcggtttgttcagcttcagcatggtgacattgataaacgcgtggaggtgaagccatat
gtgctagatgaccagatgtgtgacgagtgccagggtgcgcgctgcggtgggaaatttgccccctttttctgtgccaatgtcacctgcctgc
agtattactgtgagttttgttgggcaaatatccactctcgtgcgggacgcgagttccataagccattggtgaaggaaggtgctgatcgccc
© European Molecular Biology Organization
13
The EMBO Journal Peer Review Process File - EMBO-2011-78232
gcgtcagatccacttccgctggaactaagtttagcaaaccggcctccgtctgacaaggaaggaaagggtgcatgtggcttactgtgctgcaga
cactgcgtgcaggagaaataagtgcattcttctgcttctcacccagctccgagacatgcatcgttatcagcagccaaaacactacaagcctcttgttt
ttcaccaaaaccctacatctcaggcttactaatttttgtgatattttcatgttaaaataaaatgtttttttgtattttctccaagttatttttatatgtaaagttaaa
attagatatgagaatgttttgcgtaggggcaacagtctgctgctatacagtgggtgaagcgtgcacttatttcttaacatgggtttttaacttcaagatc
tgccccagtactttaccaaaggtagcaaaataatagtgaagatggaatatgtctgctacaaatgcttatttttattgttgctgttttcagtgtgtacataaa
ctaaaaattagggttgattttgttgctctccattttgacttgcaagaaataatacctcaagataatctgatttattagctatttttaaacatttttaatcacaag
ctgtattagctttgctgctatatagatgttatgtgtaaatgtcacctattaatacgggattgaaaacgttagagacacactgcattgcggatgaaatgca
ggcagcacaatatggccgatactgccatagtttagaatgtgaaacaatgcatgtttacttacctgtgtccaccatatgcatgcactcggacattaact
aatgaggtgaggtattgcagatgttcaaaaagctctcttgaattctaggtagcatgaacaaattagaaaatttgtttctttacaaaaaagcaaacttgc
atgcattattgtgacttcaagttaaaaatgttgtcctacatgtgtacaatatgcaaattagttttagattagagagtgcagccattttgtgatctggtcagt
agtggaattcgattttatgcagactggatgtaatatttgtaatccctgtgcaattttgtgatgtgcggttctaattcatgtgcagtgatatagtatagataa
aagattgaataaaagaaaaacacaggaattttaaagaaagttgattttagcccctttgatagttcatggttaagacatcctttaaaaaccaaagatgg
ccagcacactgctaaccagtcaccgaatgtgagacccatggaaagcccatacataaagagagggttttatagaagaacacagaactttagtgaa
gtcaaaatggagatgggaaaatataacagatggctagttgcataaaatttacctttacgacaatggtgaaatctggcttaaatttgcttacatgtttga
cctatgtacctggggtcttctgtctaaactggggtcactgttgcatggagcactgttattcttaatggttaagaattgcttttttaactttgatgaaggaat
ttcagtaatgactttgcttgcatttttttcttctttctttattgagggagttgcgtggaaaaatgcacggttctgacctagaacatggttcgttgtggtggct
ttcctctttagagcatcctaacagcagctagccgctgtgttaataatgtaggagttaccctgcagtctaagcaaagcaccccacatggtaaatgttgt
tttttgttgttgttgttgttgttttttatttttttaatgcagaactaagatttttgactctaaagagagaaaattgcaagggtatggcctgtgcagcaaaccctt
gggacaatccttcacatgagcaaagtgctgatctcaacattggttgtcgatggtatgcttttttgtactgtaaaaacgcgtggttcatgtctaactctgc
tgttttattgtggttgtggctcaagtttttagtgtttgacgttgacgctgttttcagaggagctctttactaatttatttgtccgtgtcccaacctgttactccc
cacgaccctccagagtttctggagcattcttttctaccctcaccctgccagaccttgatccattttgacatttgttatgcactacttttatatctctgtgag
agatttttccaacagtcagctattttatggcacactttttttgactgatgacatctcctttgctatacctcaatttttggaatttagaaaagaaatcagtagtt
ttgcaatgttaattatttagatatttaatttcgcagatttttaactttattttcataatttctgcttaatgtttaaaattgaagagccttttcatgtattaaataatg
aactctaaaataaattatatgataaaataattggagatgccgaaaatcattttcccttcttaaacagaagtaaatatttgaaatgaagggaaatgcaag
agaaacaccttctcctaccagggtgaacgtgacggaaatgctggtttgtgtcaccttcgttcctgttagggcaaagctcattggtctaatactgtgtc
cctccctgcctctcccctacctctgatttgtttcgttttctgtttgtttggggattccttttccttttatgtactacattcttattttctaactgttaaacactgtatt
agagtttttttaatttacagatcatatttattttactatttttgtagaaaattattaattttgattgtatttttgtattttcaaagctttttcatttgtgttccctaaatgt
tcatattgctgcccaaaagtatgaatgactgtggaggaaaaagtactttaaaaatccacactttttgttaagaaggaaacatttagcatttatatatttgt
gtatggaaaacacttgatattttatccctgttgcatctggctgcacgagcctctcctcaaagatgccacaaaacttgaatataacacattttggaaggc
tgactaacctcgattctgtgttgtgatgtgcaatactgtttctaatgtttgtataaagatacagtgtaaacctttttaatgcaaatttatttttttcattgcatat
tttgcagactttatccacagtgtcattttttactgtcagaaaagatgccccttttgtcattgcaactattttttaaacccagaaatctttgtactgatgtaaat
gattgtagttattttggatagtgttttgctaacaaaaggagagacttttttcatgcatatttctattttgtttttttgggttttattttattttaatagtagtaaaata
cttggaataatttttcatattcttgtcattaatattattttgtatttttatgtgaaaatatataattttatgacactaattgctaaagtttattttatgttgaattattttt
ggagctgaaatctttgtaatattaaagcaactagtttctaattcccagtttctgtatagaatcgcacaagtggtttatggagtgtttggattgtaactataa
atggttctttgatatgcaaattaatattttcagttgattttattttatattcctaatggggtgttaaagccgttttttatttttttctaaataaaaagagaacccat
gcttttatggacactaggtaaaacgccttcagcttaaaatttttgttaaataatttagtttattttattgttatcttccaggtgtctaaatctccagtctgtctgt
tgtactggtaatttaactctgtaatggaatagtttgctgccaactatttatattaagtcatttttaaatatttgtaatattgttgactgactaataaactattaa
gttattggcatag
3rd Editorial Decision
08 November 2011
Thank you for sending us your re-revised manuscript. In the meantime, referee 2 has seen it again
and supports publication here. Still, he/she feels strongly that your conclusion that it is the
translation elongation step that is affected needs to be toned down, and I would like to ask you to do
that in an amended version of the manuscript text.
Furthermore, I do have one editorial request. As a novel feature, we now encourage the publication
of source data, particularly for electrophoretic gels and blots, with the aim of making primary data
more accessible and transparent to the reader. Would you be willing to provide files comprising the
original, uncropped and unprocessed scans of all (or the key) gels used in the figures? We would
need 1 file per figure (which can be a composite of source data from several panels) in jpg, gif or
PDF format, uploaded as "Source data files". The gels should be labelled with the appropriate
figure/panel number, and should have molecular weight markers; further annotation would clearly
be useful but is not essential. These files will be published online with the article as a supplementary
"Source Data". Please let me know if you have any questions about this policy. I should point out
that providing such data is voluntary.
© European Molecular Biology Organization
14
The EMBO Journal Peer Review Process File - EMBO-2011-78232
We are looking forward to the final version of your manuscript, which I will formally accept once
we receive it.
Yours sincerely,
Editor
The EMBO Journal
-----------------------------------------------REFEREE COMMENTS
Referee #2
I have made a quick read of the authors response and the manuscript. My short assessment is that the
data obtained are consistent with, but not proof of, a block in elongation of the HIF-1α mRNA when
CPEB2 is present. I would be happy to accept the manuscript if this language was used throughout.
In part, like Accam's razor, a block in elongation is the simplest answer. However, there is no
evidence that the regulation is not achieved through a block in termination (although I anticipate this
would be very unusual). Second, the authors misuse the word nascent. In translation discussions,
nascent means that the peptide/protein is still associated with the ribosome. It is possible that the
authors mean native instead.
In this light, the title of the paper should be change to "CPEB2-eEF2 interaction impedes HIF-1α
synthesis". I concur that elongation is the most likely step and encourage the authors to favor this
hypothesis. But until proof is obtained that directly shows a change in the elongation rate, the
hypothesis is just well founded. That said, it is still not clear why eEF2 was only one of the 24
identified clones (i.e. not more heavily favored), but that will likely be life's little mystery.
It is noted that the authors do have extensive data to support their hypothesis and have done as good
a job as seems possible with the limitations of their system. They should not take it as a denial of
their hypothesis that I feel that they should not be allowed to proclaim a solution to the problem.
3rd Revision - authors' response
13 November 2011
Thanks for letting us know that our manuscript is one step closer to be accepted by the EMBO
Journal. We have read about the comments from Referee #2 and agree to trim down some (but not
all) of our claims about regulation at elongation for the reasons as below.
Because the method we used to estimate the disappearance of polysomal HIF-1α RNA
(ribosome unloading) in the presence of initiation inhibitor or the traditional ribosome transit time
experiment used to measure the newly synthesized radiolabeled protein released from polysomes,
none of the methods, strictly speaking, can unequivocally rule out the possible contribution from the
change at termination. Thus, if from the methodological point of view, we agree with the Referee #2
to point out that such an unlikely possibility exists in our revised manuscript (page 18). However,
we have demonstrated that the CPEB2's repression effect on the target RNA translation is sensitive
to elongation blocker and is dependent on its interaction with eEF2. Moreover, there is no study
published to show that eEF2 has a role at the termination step, so it is fair for us to claim that
CPEB2 can slow down translation, at least in part (if not at all), at the elongation stage. To respect
the Referee #2's point, we have removed the strong word like "specifically" from the sentences,
'CPEB2 "specifically " impedes target RNA translation at elongation' and 'CPEB2 uses a distinct
mechanism to "specifically" govern translation at elongation'. We have also removed "at elongation"
from the title and several other places in the text (pages 2, 6, 27, 54) and clearly point out that a
slight possibility due to regulation at termination may exist in the Result section (Page 18).
To avoid confusion with the "nascent chain" (polypeptide associated with ribosome) in the
translation field, we have changed the word "nascent" to "newly synthesized/ or translated" or "de
no synthesized/ or translated". We prefer not to use "native" as suggested by Reviewer #2 because
"native protein" in the protein-folding field refers to a folded functional protein, which cannot be
determined by Western blotting.
© European Molecular Biology Organization
15
The EMBO Journal Peer Review Process File - EMBO-2011-78232
There is no published report claiming that the appearing frequency of positive interaction
clones in a yeast two hybrid screen (Y2H) is correlated with the accuracy of interaction. First, it is
well known that the Y2H screen always identifies false positive clones or peptide sequences that do
not exist in nature. For example, many of our positive clones contain 3′-UTR sequences or out-offrame coding sequences. We did not chase after these clones since the peptides encoded by these
sequences do not exist in nature. Second, even with in-framed coding sequences, such interactions
may not be confirmed when using the full length CPEB2 and identified proteins in the
coimmunoprecipitation assay. The Y2H screening results need to be experimentally confirmed
instead of counting the appearing frequency of the clone.
We have included the Source data files. For some Western blots like those in Figure 3, the
membranes were cut to top and bottom halves for probing with CPEB2 and RSP6 antibodies,
respectively, so the uncropped blot is only half-size.
© European Molecular Biology Organization
16