From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Blood First Edition Paper, prepublished online March 16, 2006; DOI 10.1182/blood-2005-06-2383
The chemokine CXCL13 is a key molecule in autoimmune Myasthenia Gravis
A. Meraouna1, G. Cizeron-Clairac1, R. Le Panse1, J. Bismuth1, F. Truffault1,
C. Tallaksen2 and S. Berrih-Aknin1
1
CNRS-UMR 8162, IPSC, Université Paris XI, Hôpital Marie Lannelongue, 133 Avenue de
la Résistance, 92350 Le Plessis-Robinson, France
2
Department of Neurology, Ulleval University Hospital, N-0407 Oslo, Norway
Corresponding author: Dr Sonia Berrih-Aknin [email protected]
Phone number: 33 1 45 37 15 51, Fax number:33 1 46 30 45 64
Abstract word count: 200, Total text word count: 4619
Financial support:
This work was supported by grants from the National Institute of Health (NS39869), the
European Commission (QLG1-CT-2001-01918 and QLRT-2001-00225) and the “Association
Française contre les Myopathies”.
1
Copyright © 2006 American Society of Hematology
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Abstract
Myasthenia Gravis (MG) is associated with ectopic germinal centres in the thymus.
Thymectomy and glucocorticoids are the main treatments but they induce operative risks and
side effects, respectively. The aim of this study was to propose new therapies more efficient
for MG. We hypothesized that molecules dysregulated in MG thymus and normalized by
glucocorticoids may play a key role in thymic pathogenesis. Using gene chip analysis, we
identified 88 genes complying with these criteria, the most remarkable being the B cell
chemoattractant (CXCL13). Its expression was increased in thymus and sera of glucocorticoid
untreated patients and decreased in response to treatment in correlation with clinical
improvement. Normal B cells were actively chemoattracted by thymic extracts from
glucocorticoid untreated patients, an effect inhibited by anti-CXCL13 antibodies. In the
thymus, CXCL13 was preferentially produced by epithelial cells and overproduced by
epithelial cells from MG patients. Altogether, our results suggest that a high CXCL13
production by epithelial cells could be responsible for germinal centre formation in MG
thymus. Furthermore, they show that this gene is a main target of corticotherapy. Thus, new
therapies targeting CXCL13 could be of interest for MG and other autoimmune diseases
characterized by ectopic germinal centre formation.
Abbreviations: MG: Myasthenia Gravis, GC: Germinal Centre, TEC: Thymic Epithelial Cells,
FDC: Follicular Dendritic Cells.
2
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Introduction
Myasthenia Gravis (MG) is a neuromuscular disease with an autoimmune or a congenital
etiology 1. It is characterized by a defect in neuromuscular transmission, causing muscle
weakness 2. In 85% of cases, autoimmune MG is caused by autoantibodies directed against
the nicotinic acetylcholine receptors (AChR) at the neuromuscular junction 3. Thymic
hyperplasia occurs in 60 % of MG patients with anti-AChR antibodies, is especially found in
young women (< 40 years old) and consists in the formation of germinal centres (GCs) in the
thymus 4. Although GCs are normally found in secondary lymphoid organs
5,6
, ectopic GCs
are described in many autoimmune diseases such as chronic arthritis, Sjogren’s syndrome and
Hashimoto thyroiditis 7-9. In MG disease, there is a clear association between the presence of
GCs and anti-AChR antibody production, since B cells purified from MG thymic hyperplasia
are able to spontaneously produce antibodies to AChR
10
and thymectomy is an efficient
therapy leading to a gradual decrease of anti-AChR antibody titer 11. In addition thymic cells
or fragments grafted in the SCID model produce anti-AChR antibodies accompanied with
several signs of MG
12
. However, the mechanism underlying the abnormal migration of B
cells towards the thymus is so far unknown.
Although progress has been made in developing therapies for MG, this disease is still
incapacitating 13,14. Among the treatments used, anti-cholinesterasic agents have a rapid effect
based on the inhibition of acetylcholine degradation 14, but their action is only symptomatic.
When applied appropriately, glucocorticoids with their anti-inflammatory properties appear to
be effective in most severe cases. However, their therapeutic use is limited by their severe
side-effects, particularly during long-term treatment 15. Thymectomy is often indicated when
the thymus is hyperplastic and is effective in most cases
associated with the surgery
16
14
. However, it involves risks
and the clinical status of the patients can remain unstable not
3
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
only during the postoperative period but also for several months after thymectomy
17
.
Therefore, the existing treatments are far from being satisfactory in MG. Development of
better therapies depends on a greater understanding of the mechanisms underlying thymic
abnormalities, and namely the GC formation in the thymus.
Thus the aim of this study was to identify novel molecules involved in the pathogenic
mechanisms of autoimmune MG that could serve as potential targets for a selective therapy.
Molecules dysregulated in MG patients and normalized by corticosteroids could serve such a
function. Using DNA microarray technology, we identified a high proportion of genes
associated with B cell functions that fulfill these criteria. We focused on CXCL13, since this
molecule is highly attractive for B cells, and is important in GC formation and maintenance
under physiological conditions 18-20. Our results showed an elevated CXCL13 production by
thymic epithelial cells (TEC) during MG, probably responsible for B cell attraction and by the
way for GC formation in the thymus.
Materials and methods
Biological material
Thymic tissues and sera were taken from MG patients during thymectomy and from controls
with healthy thymus during cardiac surgery at the Centre Chirurgical Marie-Lannelongue, Le
Plessis-Robinson, France. Fresh blood was taken from healthy donors. Informed consent was
provided according to the Declaration of Helsinki. These investigations were approved by the
local Ethics Committee, CCPRB (Comité Consultative de Protection des Personnes dans la
Recherche Biomédicale, Kremlin-Bicêtre, France).
All MG patients were females, under 40 years old, receiving anti-cholinesterasic drugs, and
seropositive for anti-AChR antibodies. The severity of MG symptoms was between 3A and
4
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2B according to the MGFA classification 21. All patients in the study underwent thymectomy
in the first 3 years following the onset of the disease and were chosen randomly. Patients with
thymoma were excluded.
MG thymuses were taken from 24 MG patients with thymic hyperplasia not treated with
corticosteroids (called “untreated MG patients”) and 21 MG patients treated with
corticosteroids (called “treated MG patients”). Control thymuses were obtained from 21 ageand sex-matched adults and from 33 newborn girls all undergoing cardiac surgery.
Sera from nine untreated MG patients and nine treated ones were obtained before
thymectomy. For 15 other MG patients, five of them having undergone corticotherapy, sera
were obtained after thymectomy during clinical follow-up. Sera obtained from ten sex- and
age-matched adults were used as controls.
Cell isolation and culture conditions
Thymocytes were extracted mechanically by mincing freshly harvested thymuses in HBBS
(Hank’s Balanced Salts) (Gibco-invitrogen, Cergy-Pontoise, France). TEC were established
as previously described
described
22
22
. To obtain thymic fibroblasts, thymic explants were cultured as
, and after 7 days of culture, cells were submitted to a brief trypsin treatment to
collect the fibroblasts that detach faster than TEC. The isolated cells were then cultured for an
additional 7 days. Myoid immortalized thymic cells (MITC) is a cell line established as
previously described 23. Peripheral blood mononuclear cells (PBMC) were isolated from fresh
blood via Ficoll gradient (CMSMSL01-01, Eurobio, les-Ulis, France).
Different dexamethasone concentrations (0, 0.1, 0.2, 0.3, 0.4 mg/ml) were added for 24 and
48 hours to subcultured TEC22. Supernatants were collected and stored at -80°C for ELISA.
For flow cytometry analysis, TEC were treated for 4 hours with 10 µg/ml of brefeldin-A
5
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
before collection. For real-time RT-PCR, TEC were stored in TRIzol (Gibco-BRL) at –80°C
until RNA isolation.
RNA isolation
RNAs were extracted from thymic tissues or cells in TRIzol according to the manufacturer’s
instructions. The FastPrep apparatus (QBiogen, Illkirch, France) was used for thymus
fragments. RNA concentration and purity were determined spectrophotometrically.
DNA microarray analysis
Sample preparation
RNAs were purified on Qiagen columns (Courtaboeuf, France) and the quality was assessed
using the bioanalyser 2001 from Agilent (Massy, France). Pools were made from equal
amounts of total RNAs from thymuses of the following individuals: four adult controls, five
untreated MG patients and five treated MG patients. These samples from MG patients were
all from females aged from 18 to 25 years and having anti-AChR antibodies. The thymuses
of untreated patients were highly hyperplastic while those of corticosteroid treated patients
were partially atrophic and include less germinal centers. The three RNA pools were tested
against the same RNA reference: a pool of RNAs from 10 thymuses of newborn girls.
Labeling and hybridization
Samples were analyzed on the Human 1 cDNA arrays from Agilent containing 16,200 probe
sets (12 814 unique clones). Twenty μg of total RNA were labeled with cyanine 3 or 5 using
the manufacturer’s direct labeling protocol (Agilent). For each array, RNA reference pool was
crossed with one of the other described RNA pools. Each comparison was repeated 4 or 5
times (14 arrays in total). Labeled cDNAs were hybridized overnight at 65°C and the slides
washed following the manufacturer’s instructions.
6
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Data acquisition
Slides were scanned using the 428 Affimetrix scanner (MWG, Courtaboeuf, France). The
images were analyzed with GenePix proV4.0 (Axon Instruments, Dipsi industrie, Chatillon,
France). For each array, raw data were corrected by a non-linear transformation (Lowess
algorithm) using the TIGR Microarray Data Analysis System (http://www.tigr.org). To
compare the arrays, each condition was centered on the median calculated from the repetitions
and was then normalized by array. For each gene, a log2 ratio of study sample over referencesample was calculated and the distribution by array was centered on zero.
Statistical analysis
To identify differentially expressed genes in thymuses from untreated MG patients compared
to adult controls, the ratios were analyzed with the two-class unpaired algorithm of the
Significance Analysis of Microarrays software (SAM-version 1.21, Stanford University,
USA) 24. The dysregulated genes were selected based on a False Discovery Rate (FDR) < 5%
and an average Fold-Change (FC) > 1.8. Among these genes, very few exhibited a low
fluorescence intensity defined by a threshold corresponding to 1.5 background.
To determine the general effects of corticotherapy during MG, 8 K-Medians clustering
analysis (Euclidean Squared, Log) using Acuity software, version 3.1 (Axon Instruments) was
applied on the median of ratios of the three comparisons (adult controls/reference, untreated
MG patients/reference and treated MG patients/reference) for the genes identified by SAM.
To assign a statistical value to these genes, we compared, using a nonparametric MannWhitney’s test (Test U), the relative gene expression ratio between untreated and treated MG
patients. A gene was considered significantly dysregulated if the P-value was < 0.05.
Expression profiling by real-time PCR
7
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Transcription of RNA and real-time PCR were performed as previously described 25. Primer
sequences were as follows: human CXCL13 (NM_006419): sense 5’ctctgcttctcatgctgctg 3’,
anti-sense
5’tgagggtccacacacacaat
3’,
human
CXCR5
(NM_001716):
sense
5’cctcccagaacacactccat 3’, anti-sense 5’tgcttggtcaagatgactgc 3’, human CD21 (M26004):
sense 5’tggaaccacggtcacttaca 3’, anti-sense 5’ctccaggtgcctctttcttg 3’. Hybridization was
performed at 62°C for 12 seconds for all the primer pairs used. Successful preparation of
cDNA was independently checked by amplification of the 28S gene.
Thymic protein extraction
For ELISA measurements, total thymic proteins were extracted in solution containing 5% Tris
HCl 20mM, pH 7.4, 0.1% Triton X100 and one tablet of protease inhibitor cocktail
(complete-mini Roche-Diagnostics, Meylan, France) using the fast prep apparatus.
CXCL13 ELISA
Capture (MAB801) and detection (BAF801) CXCL13 antibodies (R&D, Lille, France) were
used at 2.5 µg/ml and 0.25 µg/ml respectively. Recombinant human CXCL13 (801-CX-025,
R&D) was used as standard. Thymic proteins were normalized to 1500 µg/ml and sera were
diluted at 1/50 in 0.1% BSA in PBS. Tetramethylbenzedine was used for color development
and plates were read at 450 nm on a MRX reader (DYNEX-technologies commercialized by
ThermoLabsystems, Cergy-pontoise, France). Several samples were tested several times in
the same assay, or in different assays, and the variance was less than 20%.
Chemotaxis assay
To eliminate monocytes and adherent cells, PBMC were cultured 24h prior to the assay in
RPMI containing 0.5% fetal calf serum (FCS). To perform the assay, 24-well plates were
used. PBL were seeded in RPMI containing 0.5% fetal calf serum at 2x106cells/insert
(PI8P01250, Millipore, Saint-Quentin, France). Thymic extracts were prepared by
8
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
mechanically lysing frozen thymic fragments in PBS using a Teflon-glass homogenizer. The
suspension was then centrifuged and the concentration of proteins was analyzed in the
supernatant. Proteins were adjusted to 3 mg/ml in RPMI, 0.5% fetal calf serum to obtain a
final concentration of at least 240ng of CXCL13/ml (80ng of CXCL13/mg of total proteins)
in untreated MG patients which is the optimal concentration for cell migration. For CXCL13
or CCL21 neutralization, MAB801 and MAB366 antibodies from R&D were used,
respectively. After 4 hours, cells were collected from both upper and lower compartments,
stained with anti-CD19 (Dakocytomation) and counted by flow cytometry analysis using a
known concentration of unlabelled beads (340486, Becton Dickinson, Lyon, France). These
analyses gave the total number of B cells in the upper and lower compartments of the
transwell chambers. The percentage of migrating B cells was calculated as follows: B cell
number in the lower chamber/(B cell number in the lower chamber + B cell number in the
upper chamber) X 100. The results are expressed as the percentage of migrating B cells after
subtraction of spontaneous migration obtained by counting B cells in the medium without
thymus extracts.
Flow cytometry analysis
Flow cytometry was carried out on permeabilized TEC as previously described
26
using anti-
CXCL13 MAB801 antibody (R&D) revealed by goat anti-mouse coupled to phycoerythrin
(R0480 Dakocytomation).
Laser Microdissection
Cryostat sections (7 µm) of frozen human thymic tissues were affixed to glass foil slides for
membrane based laser microdissection (Leica, Rueil-Malmaison, France), dried overnight and
stained by hematoxyline-eosin. GCs and mantle zones were isolated by laser capture
microdissection using a Leica laser microdissection microscope. The microdissected regions
were collected in RLT buffer (Qiagen). RNAs were extracted using the Qiagen RNeasy
9
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
microkit following manufacturer’s instructions. Reverse transcription and real-time PCR were
performed on microdissected GCs as described above. The mantle zones were too small to
provide enough material to perform RT-PCR.
Determination of total GC areas using the microarray scanner
Thymic sections were stained with anti-CD21 antibody (1/20) (555421, Becton-Dickinson),
and anti-keratin antibodies (1/50) (M0717 and M0821, Dakocytomation), then revealed with
Alexa Fluor
594 (Molecular
probes, Cergy-Pontoise, France)
and PE (R0480,
Dakocytomation) coupled antibodies, respectively. Slides were scanned with the 428
Affimetrix scanner using “Jaguar software”. Total GC areas (CD21+) were determined by the
number of Alexa–positive pixels out of the total number of pixels evaluated on the whole
sections, using “Image J software”.
Results
DNA Microarray experiment analysis
To identify genes mediating the effects of glucocorticoid treatments in MG, we first compiled
a list of dysregulated genes in thymuses from untreated MG patients versus adult controls,
and then analyzed the behavior of these genes in the thymus of glucocorticoid treated MG
patients.
Statistical analysis
Using SAM analysis with a FDR<5% and a FC>1.8, we identified 157 genes up-regulated and
227 genes down-regulated in thymuses from untreated MG patients compared to adult
controls. Using K-Medians clustering analysis on these 384 dysregulated genes, we found that
glucocorticoid effects on the dysregulated genes during MG could be divided into four
patterns (Figure 1A). Glucocorticoids totally normalized the expression of 23% (pattern I) of
10
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
these genes, and partially normalized 30% (pattern II) of them. In contrast, they exerted no
effect on the expression of 23% of the dysregulated genes (pattern III) and they accentuated
the dysregulated expression of 23% of them (pattern IV). The lists of these genes are given in
the Supplemental Data 1.
The beneficial effects of glucocorticoids may be due to their action on the genes of patterns I
and II (53 % of the dysregulated genes during MG). Their partial effects on some of the genes
belonging to pattern II, and their lack of effects on genes of pattern III may explain some of
their limits in MG treatment. Finally, the effect of glucocorticoids on the genes of pattern IV
may explain their important side effects, especially during long-term treatment.
Altogether, these analyses indicate that about only half of the dysregulated genes during MG
are normalized by corticotherapy. On the contrary, many genes are even more dysregulated
with corticosteroids, evidencing the side effects of corticosteroids. However and since MG
patients are improved after corticosteroid treatment, we hypothesize that the improvement is
due to genes dyregulated during the pathology and normalized by the treatment.
Gene by gene analysis
To focus more precisely on the genes normalized by glucocorticoids, we carried out a “gene
by gene analysis” on the genes belonging to patterns I and II (shown in Figure 1A) using a
Mann-Whitney test. Figure 1B indicates that among the 227 down-regulated genes during
MG, 52 were normalized by glucocorticoids (the list of these genes is given in supplemental
data 2) and among the 157 up-regulated genes during MG, 36 were normalized by
glucocorticoids (Table 1). Altogether, 88 (36+52) genes were dysregulated in MG thymus and
normalized by corticotherapy. Fifteen out of the 36 genes (42%) were involved in the
immune response and linked to B cell biology. It is noteworthy that CXCL13 is the gene on
which glucocorticoids exert the most significant effect (Table 1 and Figure 2A). Indeed
CXCL13 expression was 2.82 fold higher in MG thymuses, and was completely normalized in
11
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
thymus of glucocorticoid treated patients. We therefore decided to focus our research on the
expression and function of CXCL13 in MG.
CXCL13 is overexpressed in MG thymuses and sera and normalized by corticotherapy
To confirm results obtained by DNA microarray (Figure 2A), we analyzed CXCL13 RNA
and protein expression levels in the thymus. We found that CXCL13 was overexpressed in
MG thymuses when compared to adult and newborn controls and normally expressed in MG
patients treated by corticotherapy (Figures 2B-C). CXCL13 was also overexpressed in sera of
untreated MG patients, while corticosteroid treated patients exhibited normal levels (Figure
2D). A significant correlation was found between thymic and serum CXCL13 expression of
the same MG patients (Figure 2E). Thus CXCL13 expression was higher in MG patients
untreated by corticosteroids in both the thymus and the serum and reduced to normal values in
patients treated by corticotherapy.
The overexpression of CXCL13 in MG thymus contributes to high number of B cells in
MG thymic hyperplasia
We compared the chemoattractive effect of thymic extracts from MG patients and adult
controls on normal B cells. As expected, we found that the thymic extracts from untreated
MG patients exhibited the strongest chemoattractant effect on B cells (Figure 3A). The
chemoattraction was strikingly reduced in thymic extracts from corticosteroid treated patients
(Figure 3A). CXCL13 or CCL21 neutralization using specific antibodies resulted in a greater
inhibition of B cell attraction in the first case than in the latter (Figures 3B). The use of antiCXCR5 antibody also resulted in a partial inhibition of B cell migration (data not shown).
Thus, it is likely that the overexpression of CXCL13 in MG thymus contributes to high
number of B cells in MG thymic hyperplasia.
GC numbers are reduced in MG patients treated with corticosteroids
12
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
CD21 is a GC marker because of its high expression by germinal B cells 27. We analyzed the
number of thymic GCs stained by anti-CD21 by means of an innovative use of the microarray
scanner. As expected, the number of GCs was high in untreated MG patients. For the first
time, we demonstrated that the number of GCs was dramatically reduced in corticosteroid
treated MG patients (Figure 3C). Image analysis of the CD21+ areas indicates a high
significant difference between thymuses from treated and untreated MG patients (Figure 3D).
These results demonstrate that glucocorticoids induce a striking reduction in the thymic GC
formation.
All these results show that CXCL13 expression and function is increased in the thymus of
untreated MG patients in correlation with a high number of GCs, while CXCL13 production
is dramatically reduced in the thymus of MG patients treated with glucocorticoids and
correlates with a low number of GCs.
The increase of CXCL13 in MG thymus is not only due to cells within GCs
CXCL13 is known to be produced by cells within GCs
18 ,28-30
. Therefore the increased
CXCL13 expression in MG patients could be due to the high GC number. We analyzed the
correlation between CXCL13 and CD21 or CXCR5, both normally expressed on B cells27,31
and thus in GCs. While expression of CD21 and CXCR5 was clearly correlated, no
correlation could be found between CXCL13 and CD21 or CXCR5 mRNA levels in MG
patient thymuses (Figure 4A). This suggests that the high levels of CXCL13 found in MG
thymuses are not supplied only from the GCs.
To strengthen these results, CXCL13 mRNA expression was determined on thymic GC-free
sections and the corresponding microdissected GC from untreated MG patient thymuses. We
found that MG GC-free sections exhibited a higher CXCL13 mRNA level than total thymic
sections from adult controls. Furthermore, the CXCL13 levels provided by microdissected
13
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
GCs represented 1 to 12% of the total CXCL13 produced by the whole section (Figure 4B).
Thus, GC cells could not explain the higher production of CXCL13 observed in thymus from
untreated MG patients. We next examined which cells are able to produce CXCL13 in the
thymus.
CXCL13 is normally produced by TEC in the thymus
We tested the main thymic populations isolated from normal thymus for CXCL13 production:
TEC, thymocytes, thymic fibroblasts and MITC (Myoid thymic cells). TEC were the only
cells producing CXCL13 (Figure 5A).
CXCL13 concentration in TEC culture supernatants increased from day 2 to 7 of subculture,
suggesting an increase of CXCL13 production during the culture (Figure 5A). However,
CXCL13 mRNA levels remained unchanged throughout the culture period (Figure 5B),
suggesting that the increase of CXCL13 concentration in the culture supernatant is due to an
accumulation of CXCL13 rather than to an increase of its production rate by TEC.
These results show that TEC are the primary source of CXCL13 in the thymus and suggest
that the high levels of CXCL13 in MG may be due to a dysregulated expression in this cell
type.
We then compared the CXCL13 mRNA level in TEC established from MG and control
thymuses. The four TEC samples from MG patients overproduced CXCL13 (Figure 5C),
suggesting a defect in the regulation of CXCL13 production by TEC during MG, leading to
overexpression of this chemokine in the thymus.
Glucocorticoids inhibit CXCL13 production by TEC
We tested the effects of corticosteroids on CXCL13 production in-vitro by normal TEC after
permeabilization. We found that dexamethasone inhibited CXCL13 expression in a dosedependent manner (Figures 6A-C). It is noteworthy that under our culture conditions, the
14
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
cellular viability reached 88% (data not shown), excluding an apoptotic or necrotic effect. No
staining was observed on non-permeabilized TEC, indicating the absence of CXCL13 at
TEC surface. These observations show that CXCL13 expression in normal TEC is
downregulated by corticosteroids in-vitro.
Thymectomy induces a decrease in CXCL13 concentration in patient sera
Since TEC is a major source of CXCL13 production, we should expect a decrease in CXCL13
concentration in the sera of MG patients after thymectomy. Indeed, the serum level of
CXCL13 decreased in all the patients during the first months following thymectomy (Figure
6D). Interestingly, we found a correlation between the decrease of CXCL13 and a clinical
improvement; most patients (groups 2 and 3) improved in the months following thymectomy
and they showed a striking decrease in their CXCL13 serum concentration while patients not
improved after thymectomy (group 1) exhibited the lowest reduction in CXCL13 serum
concentration. Moreover, patients treated with corticoids at the time of thymectomy (group 3)
showed the most rapid decrease in CXCL13 concentration. These results confirm that the
thymus is a significant source of CXCL13 in MG and that CXCL13 is both implicated in MG
pathophysiology and serves as a glucocorticoid target.
Discussion
In the majority of chronic inflammatory diseases such as multiple sclerosis, asthma and
psoriasis, multiple chemokines/receptors are present within lesions
32,33
. For example,
synovial tissue from patients with rheumatoid arthritis expresses chemokines including MCP1, MIP-1α, IL-8 and RANTES, and infiltrating lymphocytes within synovial fluid express the
chemokine receptors CXCR3 and CCR5
34-37
. To date, no clear pathogenic role for a
particular chemokine in the pathogenesis of MG has been shown, except IP10 and its receptor
15
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
(CXCR3) that are increased in MG and EAMG
38
. Our study demonstrates for the first time
the role of the CXCL13 chemokine in the pathophysiology of this disease and its
overexpression in the thymus, the effector organ during MG. A recent work on another
autoimmune disease, Sjögren’s syndrom, reports similar results, indicating that CXCL13 is
expressed in the target organ of almost all patients
39
. Thymic extracts from MG patients
displayed a high chemoattractant effect towards B cells, an effect inhibited by anti-CXCL13
antibody. It is noteworthy that CCL21 neutralization resulted in a lower B cell migration
inhibition than CXCL13 neutralization. Based on our data, we propose the following
hypothesis: a high number of B cells are chemoattracted by the MG thymus overproducing
CXCL13. In contact with the autoantigen present in the thymus
environment described for MG hyperplasia
25
40
, and in the inflammatory
, B cells would be activated, leading in turn to
the formation of GCs typical of thymus from untreated MG patients. When patients are
treated with glucocorticoids, CXCL13 production is strikingly reduced, leading to a reduced
number of chemoattracted B cells in the thymus, and in turn a reduced number of germinal
centers.
In MG patients, the higher production of CXCL13 both in thymus and serum, the correlation
between the thymic and peripheral CXCL13 levels, and the decrease after thymectomy
strongly suggest that the thymus is a major producer of CXCL13. However, CXCL13
concentrations in patient serum remained sometimes higher than the level in controls, even
many years after thymectomy (data not shown) suggesting the possible existence of another
source of CXCL13 in the periphery. The question of the nature of the thymic cells producing
CXCL13 could be raised. From previous reports, it is known that CXCL13 is produced by
FDCs 18,28 and GC specific CD4+ CD57+ T cells
29,30
. However, other data show that mature
macrophages produce CXCL13, indicating that cellular types other than GC cells can be a
16
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
source of this chemokine 41. In this study, we demonstrate that TEC are significant producers
of this chemoattractant molecule.
The causes of the overproduction of CXCL13 by TEC from MG patients are not known.
Several hypotheses could be raised: 1) CXCL13 production could be induced due to the
influence of the thymic environment. The triggering event(s) in MG disease is not known, but
thymic hyperplasia is accompanied with signs of inflammatory activity
25
. However, since
TEC are obtained after several days of culture out of the thymic environment, this hypothesis
is unlikely. Furthermore, treatment of TEC cultures with cytokines involved in GC formation
(TNFα or LTα1β2) did not result in an increase in CXCL13 concentration in the supernatants
(data not shown). 2) A genetic polymorphism of CXCL13 could explain these results.
Although there are no data describing such a polymorphism for CXCL13, several high
producer alleles of pro-inflammatory cytokines, such as TNF-α and IL-1, have been
associated with MG
42-44
. Whether a CXCL13 high producer allele is associated with MG
disease needs to be explored. 3) Another possibility is that the natural T regulatory
CD4+CD25+ that are defective in MG thymic hyperplasia
45
could influence the production
of chemokines by stromal cells. This hypothesis deserves further investigation.
The very effective control of inflammation exerted by glucocorticoids is largely mediated by
the inhibition of the transcriptional activity of several genes encoding pro-inflammatory
cytokines such as IL-1β, lymphotoxin-β, IL-1α, IL-8, IFN-α and INF-β 46, chemokines such
as CCL5, CCL3, CCL2, CCL11, adhesion molecules such as ICAM-1, VCAM-1, E-selectin
and mediator-synthesizing enzymes such as i-NOS, COX-2, cytoplasmic PLA2
47
. However,
glucocorticoids induce also many undesirable side effects. Common side effects widely
described
in
the
literature
include
weight
gain,
hypertension,
diabetes,
anxiety/depression/insomnia (“steroid psychosis”), glaucoma, osteoporosis, cataracts,
opportunistic infections, muscle weakness, personality changes, and others48. Early attempts
17
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
to circumvent these side-effects were largely unsuccessful, probably because of the large
panel of genes on which glucocorticoids exert an effect. In this study, we found that
glucocorticoids dysregulate 23% of genes whose expression is normal in MG thymuses.
These findings further highlight the lack of specificity of corticosteroid treatments and
support the need to identify more specific therapeutic targets among the glucocorticoidregulated genes. Our results demonstrate for the first time that CXCL13 gene is a major target
of glucocorticoids. Chemokines and their receptors might be good therapeutic targets in the
treatment of inflammatory diseases. Strategies that have already been used to reduce
chemokine/receptor activity include neutralizing antibodies, peptide antagonists, non peptide
antagonists, and virally derived peptides 49-51. The strategy of blocking the chemokine system
to combat diseases is under investigation for the treatment of several diseases, and several
chemokine receptors have been already targeted in the search for antagonists 51. Therefore the
targeting of CXCL13 in early steps of MG could inhibit B cell chemotaxis, and therefore limit
thymic inflammation. This approach appears realistic, and is expected to be more specific and
to have fewer side-effects than corticosteroids.
In conclusion, this study demonstrates the key role of CXCL13 gene in MG pathophysiology
and its inhibition by glucocorticoids. Based on our data, CXCL13 could represent a future
therapeutic target for this disease.
Acknowledgements
We thank Patrice Nancy for providing RNA from TEC established from MG patients. We
thank Dr Revital Aricha, Dr Neli Boneva, Dr Sylvia Cohen-Kaminsky, Dr Tali Feferman, Pr
Sara Fuchs, Dr Isabelle Petit, Pr Idit Shahar for helpful discussions and critical reading of the
manuscript. We thank Shelley Schwartzbaum for editing the manuscript.
18
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
References
1. Engel AG. Myasthenia gravis and myasthenic syndromes. Ann Neurol.
1984;16:519-534
2. Drachman DB. Myasthenia gravis. N Engl J Med. 1994;330:1797-1810
3. Lindstrom J, Shelton D, Fujii Y. Myasthenia gravis. Adv Immunol. 1988;42:233284
4. Levinson AI, Wheatley LM. The thymus and the pathogenesis of myasthenia
gravis. Clin Immunol Immunopathol. 1996;78:1-5
5. MacLennan IC. Germinal centers. Annu Rev Immunol. 1994;12:117-139
6. Toellner KM, Gulbranson-Judge A, Taylor DR, Sze DM, MacLennan IC.
Immunoglobulin switch transcript production in vivo related to the site and time of antigenspecific B cell activation. J Exp Med. 1996;183:2303-2312
7. Randen I, Mellbye OJ, Forre O, Natvig JB. The identification of germinal centres
and follicular dendritic cell networks in rheumatoid synovial tissue. Scand J Immunol.
1995;41:481-486
8. Salomonsson S, Jonsson MV, Skarstein K, Brokstad KA, Hjelmstrom P, WahrenHerlenius M, Jonsson R. Cellular basis of ectopic germinal center formation and autoantibody
production in the target organ of patients with Sjogren's syndrome. Arthritis Rheum.
2003;48:3187-3201
9. Knecht H, Saremaslani P, Hedinger C. Immunohistological findings in Hashimoto's
thyroiditis, focal lymphocytic thyroiditis and thyroiditis de Quervain. Comparative study.
Virchows Arch A Pathol Anat Histol. 1981;393:215-231
10. Leprince C, Cohen-Kaminsky S, Berrih-Aknin S, Vernet-Der Garabedian B,
Treton D, Galanaud P, Richard Y. Thymic B cells from myasthenia gravis patients are
activated B cells. Phenotypic and functional analysis. J Immunol. 1990;145:2115-2122
11. Papatestas AE, Genkins G, Kornfeld P, Eisenkraft JB, Fagerstrom RP, Pozner J,
Aufses AH, Jr. Effects of thymectomy in myasthenia gravis. Ann Surg. 1987;206:79-88
12. Aissaoui A, Klingel-Schmitt I, Couderc J, Chateau D, Romagne F, Jambou F,
Vincent A, Levasseur P, Eymard B, Maillot MC, Galanaud P, Berrih-Aknin S, CohenKaminsky S. Prevention of autoimmune attack by targeting specific T-cell receptors in a
severe combined immunodeficiency mouse model of myasthenia gravis. Ann Neurol.
1999;46:559-567
13. Younger DS, Raksadawan N. Medical therapies in myasthenia gravis. Chest Surg
Clin N Am. 2001;11:329-336
14. Richman DP, Agius MA. Treatment of autoimmune myasthenia gravis.
Neurology. 2003;61:1652-1661
15. Warmolts JR, Engel WK. Benefit from alternate-day prednisone in myasthenia
gravis. N Engl J Med. 1972;286:17-20
16. Baraka A. Anaesthesia and myasthenia gravis. Can J Anaesth. 1992;39:476-486
17. Chevalley C, Spiliopoulos A, de Perrot M, Tschopp JM, Licker M. Perioperative
medical management and outcome following thymectomy for myasthenia gravis. Can J
Anaesth. 2001;48:446-451
18. Cyster JG. Chemokines and cell migration in secondary lymphoid organs.
Science. 1999;286:2098-2102
19. Muller G, Hopken UE, Lipp M. The impact of CCR7 and CXCR5 on lymphoid
organ development and systemic immunity. Immunol Rev. 2003;195:117-135
20. Allen CD, Ansel KM, Low C, Lesley R, Tamamura H, Fujii N, Cyster JG.
Germinal center dark and light zone organization is mediated by CXCR4 and CXCR5. Nat
Immunol. 2004;5:943-952
19
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
21. Jaretzki A, 3rd, Barohn RJ, Ernstoff RM, Kaminski HJ, Keesey JC, Penn AS,
Sanders DB. Myasthenia gravis: recommendations for clinical research standards. Task Force
of the Medical Scientific Advisory Board of the Myasthenia Gravis Foundation of America.
Neurology. 2000;55:16-23
22. Berrih S, Arenzana-Seisdedos F, Cohen S, Devos R, Charron D, Virelizier JL.
Interferon-gamma modulates HLA class II antigen expression on cultured human thymic
epithelial cells. J Immunol. 1985;135:1165-1171
23. Wakkach A, Poea S, Chastre E, Gespach C, Lecerf F, De La Porte S, Tzartos S,
Coulombe A, Berrih-Aknin S. Establishment of a human thymic myoid cell line. Phenotypic
and functional characteristics. Am J Pathol. 1999;155:1229-1240
24. Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to
the ionizing radiation response. Proc Natl Acad Sci U S A. 2001;98:5116-5121
25. Poea-Guyon S, Christadoss P, Le Panse R, Guyon T, De Baets M, Wakkach A,
Bidault J, Tzartos S, Berrih-Aknin S. Effects of cytokines on acetylcholine receptor
expression: implications for myasthenia gravis. J Immunol. 2005;174:5941-5949
26. Nancy P, Berrih-Aknin S. Differential estrogen receptor expression in
autoimmune myasthenia gravis. Endocrinology. 2005;146:2345-2353
27. Fearon DT, Wong WW. Complement ligand-receptor interactions that mediate
biological responses. Annu Rev Immunol. 1983;1:243-271
28. Melchers F, Rolink AG, Schaniel C. The role of chemokines in regulating cell
migration during humoral immune responses. Cell. 1999;99:351-354
29. Bowen MB, Butch AW, Parvin CA, Levine A, Nahm MH. Germinal center T
cells are distinct helper-inducer T cells. Hum Immunol. 1991;31:67-75
30. Kim CH, Lim HW, Kim JR, Rott L, Hillsamer P, Butcher EC. Unique gene
expression program of human germinal center T helper cells. Blood. 2004;104:1952-1960
31. Gunn MD, Ngo VN, Ansel KM, Ekland EH, Cyster JG, Williams LT. A B-cellhoming chemokine made in lymphoid follicles activates Burkitt's lymphoma receptor-1.
Nature. 1998;391:799-803
32. Fukuoka M, Ogino Y, Sato H, Ohta T, Komoriya K, Nishioka K, Katayama I.
RANTES expression in psoriatic skin, and regulation of RANTES and IL-8 production in
cultured epidermal keratinocytes by active vitamin D3 (tacalcitol). Br J Dermatol.
1998;138:63-70
33. Lamkhioued B, Renzi PM, Abi-Younes S, Garcia-Zepada EA, Allakhverdi Z,
Ghaffar O, Rothenberg MD, Luster AD, Hamid Q. Increased expression of eotaxin in
bronchoalveolar lavage and airways of asthmatics contributes to the chemotaxis of
eosinophils to the site of inflammation. J Immunol. 1997;159:4593-4601
34. Koch AE, Kunkel SL, Harlow LA, Mazarakis DD, Haines GK, Burdick MD,
Pope RM, Strieter RM. Macrophage inflammatory protein-1 alpha. A novel chemotactic
cytokine for macrophages in rheumatoid arthritis. J Clin Invest. 1994;93:921-928
35. Harigai M, Hara M, Yoshimura T, Leonard EJ, Inoue K, Kashiwazaki S.
Monocyte chemoattractant protein-1 (MCP-1) in inflammatory joint diseases and its
involvement in the cytokine network of rheumatoid synovium. Clin Immunol Immunopathol.
1993;69:83-91
36. Robinson E, Keystone EC, Schall TJ, Gillett N, Fish EN. Chemokine expression
in rheumatoid arthritis (RA): evidence of RANTES and macrophage inflammatory protein
(MIP)-1 beta production by synovial T cells. Clin Exp Immunol. 1995;101:398-407
37. Qin S, Rottman JB, Myers P, Kassam N, Weinblatt M, Loetscher M, Koch AE,
Moser B, Mackay CR. The chemokine receptors CXCR3 and CCR5 mark subsets of T cells
associated with certain inflammatory reactions. J Clin Invest. 1998;101:746-754
20
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
38. Feferman T, Maiti PK, Berrih-Aknin S, Bismuth J, Bidault J, Fuchs S, Souroujon
MC. Interferon-induced protein 10 (IP-10) and its receptor CXCR3 are overexpressed in
myasthenia gravis: new targets for immunotherapy. J Immunol. 2005
39. Hjelmervik TO, Petersen K, Jonassen I, Jonsson R, Bolstad AI. Gene expression
profiling of minor salivary glands clearly distinguishes primary Sjogren's syndrome patients
from healthy control subjects. Arthritis Rheum. 2005;52:1534-1544
40. Wakkach A, Guyon T, Bruand C, Tzartos S, Cohen-Kaminsky S, Berrih-Aknin S.
Expression of acetylcholine receptor genes in human thymic epithelial cells: implications for
myasthenia gravis. J Immunol. 1996;157:3752-3760
41. Carlsen HS, Baekkevold ES, Morton HC, Haraldsen G, Brandtzaeg P. Monocytelike and mature macrophages produce CXCL13 (B cell-attracting chemokine 1) in
inflammatory lesions with lymphoid neogenesis. Blood. 2004;104:3021-3027
42. Sciacca FL, Ferri C, Veglia F, Andreetta F, Mantegazza R, Cornelio F, Franciotta
D, Piccolo G, Cosi V, Batocchi AP, Evoli A, Grimaldi LM. IL-1 genes in myasthenia gravis:
IL-1A -889 polymorphism associated with sex and age of disease onset. J Neuroimmunol.
2002;122:94-99
43. Huang DR, Pirskanen R, Matell G, Lefvert AK. Tumour necrosis factor-alpha
polymorphism and secretion in myasthenia gravis. J Neuroimmunol. 1999;94:165-171
44. Skeie GO, Pandey JP, Aarli JA, Gilhus NE. TNFA and TNFB polymorphisms in
myasthenia gravis. Arch Neurol. 1999;56:457-461
45. Balandina A, Lecart S, Dartevelle P, Saoudi A, Berrih-Aknin S. Functional defect
of regulatory CD4+CD25+ T cells in the thymus of patients with autoimmune myasthenia
gravis. Blood. 2005;105:735-741
46. Ashwell JD, Lu FW, Vacchio MS. Glucocorticoids in T cell development and
function*. Annu Rev Immunol. 2000;18:309-345
47. Umland SP, Schleimer RP, Johnston SL. Review of the molecular and cellular
mechanisms of action of glucocorticoids for use in asthma. Pulm Pharmacol Ther.
2002;15:35-50
48. Stanbury RM, Graham EM. Systemic corticosteroid therapy--side effects and their
management. Br J Ophthalmol. 1998;82:704-708
49. Ransohoff RM, Bacon KB. Chemokine receptor antagonism as a new therapy for
multiple sclerosis. Expert Opin Investig Drugs. 2000;9:1079-1097
50. Proudfoot AE, Power CA, Wells TN. The strategy of blocking the chemokine
system to combat disease. Immunol Rev. 2000;177:246-256
51. Proudfoot AE, Handel TM, Johnson Z, Lau EK, LiWang P, Clark-Lewis I, Borlat
F, Wells TN, Kosco-Vilbois MH. Glycosaminoglycan binding and oligomerization are
essential for the in vivo activity of certain chemokines. Proc Natl Acad Sci U S A.
2003;100:1885-1890
21
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Figure legends
Figure 1: General effects of glucocorticoids on dysregulated genes during MG.
(A) Eight K-Medians clustering analysis was applied to the median of ratios of the three
comparisons: Adult controls/reference (A ctrl), Untreated MG patients/reference (MG) and
treated MG patients/reference (MG-t) for the 384 dysregulated genes in MG extracted with
SAM with a FDR<5% and a FC>1.8. The white circles represent average expression levels.
(B) Numbers of dyregulated genes obtained in the microarray analysis data.
Figure 2: CXCL13 expression in thymus and sera during MG
(A)
Microarray ratios corresponding to CXCL13 expression level in thymuses of adult
controls (A ctrl), untreated MG patients (MG) and MG patients treated by corticotherapy
(MG-t) compared to the RNA reference obtained for each array. The y-axis shows the log 2
ratio centered on zero. Each dot corresponds to one comparison to the RNA reference. (B)
Amplification by real-time PCR of CXCL13 gene in thymic samples from newborn girl
controls (N ctrl), A ctrl, MG and MG-t patients. Each dot represents the mean value of 3
different determinations. (C) Determination by ELISA of CXCL13 level expression in thymic
samples from N ctrl, A ctrl, MG and MG-t patients. Each dot represents the mean value of
duplicates. (D) Determination by ELISA of CXCL13 level expression in sera samples from A
ctrl, MG and MG-t patients. Each dot represents the mean value of duplicates. In (A), (B), (C)
and (D), the bar represents the median value and the p values were obtained by the non
parametric one way analysis of variance (Kruswal-Wallis test). (E) Correlation of CXCL13
expression determined by ELISA in thymic extracts and sera from MG untreated patients. The
R2 and p value were obtained by the non-parametric correlation test (Spearman test).
22
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Figure 3: Effect of glucocorticoids on GCs
(A)
Specific chemoattraction of normal B cells by thymus extracts from adult controls (A
ctrl), MG untreated (MG) and MG glucocorticoid treated patients (MG-t). Each dot represents
one sample after subtracting the spontaneous migration. (B) Four thymic extracts from MG
patients used in A were incubated alone or with addition of anti-CXCL13, anti-CCL21 or
mouse control antibody. The results are expressed as the mean values ± SEM. (C)
Immunohistochemical analysis on thymic sections from A ctrl, MG, MG-t patients. In red,
epithelial network stained with anti-keratin antibody, in green, FDC and B cells stained with
anti-CD21 antibody. The whole sections were scanned using a microarrray scanner. (D)
Quantification of CD21 expression in the thymus of A ctrl, MG and MG-t patients. The p
value was obtained by the non parametric one way analysis of variance (Kruswal-Wallis test).
The bars in (A) and (D) represent the median value.
Figure 4: Source of CXCL13 in the thymus of MG patients
(A) Correlation between CXCR5 and CD21 mRNA levels (upper panel), CXCL13 and CD21
mRNA levels (middle panel) and CXCL13 and CXCR5 mRNA levels (lower panel) in
samples from MG untreated patient thymuses. The R2 and p value were obtained by the nonparametric correlation test (Spearman test). (B) Amplification of CXCL13 gene by real-time
RT-PCR on total sections from six adult controls (Ctl1-6), five thymic GC-free sections from
untreated MG patients (MG1-5) and their corresponding microdissected GCs.
Figure 5: CXCL13 is produced by TEC and is overproduced by TEC from MG patients
(A) Determination by ELISA of CXCL13 concentration in the culture supernatants of
subcultured TEC (at days 2, 4 and 7), thymocytes, MITC (Myoid thymic cells) and thymic
23
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
fibroblasts. Each histogram represents the mean value of 3 different experiments + SEM. (B)
CXCL13 gene amplification by real-time RT-PCR on RNAs isolated from TEC obtained at
days 3, 6 and 7 of primary cultures and days 2, 4 and 7 of subcultures. Each histogram
represents the mean value of 2 different experiments + SEM. (C) Amplification by real-time
PCR of CXCL13 gene on RNAs isolated from TEC prepared from four patient thymuses
(MG1-4), one adult control (Actrl) and three newborn controls (Nctrl1-3). Each histogram
represents the mean value of 2 different experiments + SEM.
Figure 6: Effects of treatments on CXCL13 expression
(A)
Subcultures of normal TEC were treated with dexamethasone for 24 and 48 hours and
CXCL13 levels were measured by ELISA in the culture supernatant. Results are expressed as
the mean ± SEM of three different experiments. (B) Fluorescence intensities were determined
on TEC treated with dexamethasone by flow cytometry analysis. A representative experiment
out of two is shown. (C) Representative experiment (one out of three) of flow cytometry
analysis. As dexamethasone concentration increases, the positive peak (thin line) is shifted to
negative values (large line). (D) CXCL13 concentrations were determined by ELISA in sera
obtained at the time of thymectomy (time 0) and at different times after thymectomy in 15
MG patients followed-up after surgery. Results are expressed as mean of percentage + SEM
for each group. The CXCL13 serum level at the time of thymectomy is defined as 100%.
Group 1: three MG patients who never underwent corticotherapy and did not improve after
thymectomy; group 2: seven MG patients who never underwent corticotherapy and improved
after thymectomy; group 3: five MG patients who underwent corticotherapy and improved
after thymectomy.
24
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
MG/A ctrl
GenBank
Gene Name
MG-t/MG
FC
FC
P-value
Classification
AF044197
CXCL13
2,82
-2,76
0,0159
B cell-related
J03565
Complement component receptor 2 (CD21)
3,00
-2,18
0,0159
B cell-related
AI634950
Immunoglobulin heavy constant mu
5,06
-2,15
0,0159
B cell-related
AF296673
Toll-like receptor 10
2,09
-2,08
0,0317
B cell-related
AL543515
CD74 antigen (invariant polypeptide of MHC, class II)
1,84
-2,07
0,0159
B cell-related
M31732
B-cell CLL/lymphoma 3
1,92
-1,92
0,0317
B cell-related
X12830
Interleukin 6 receptor
2,77
-1,90
0,0159
B cell-related
X66079
Spi-B transcription factor (Spi-1/PU.1 related)
2,06
-1,73
0,0005
B cell-related
AF062733
Immunoglobulin superfamily, member 4B *
4,43
-1,68
0,0159
B cell-related
M80461
CD79B antigen (immunoglobulin-associated beta)
1,96
-1,68
0,0062
B cell-related
BG822701
CD44 antigen
1,80
-1,54
0,0159
B cell-related
BC001609
Linker for B cell activation
1,86
-1,38
0,0159
B cell-related
X02882
MHC class II alpha chain gene DZ-alpha
2,04
-1,36
0,0159
B cell-related
BG176768
MHC class II, DO beta
2,43
-1,29
0,0317
B cell-related
BG757974
T-cell leukemia/lymphoma 1A
2,84
-2,16
0,0002
Transcriptional regulation
AJ000052
Splicing factor SF1
1,85
-1,91
0,0159
Transcriptional regulation
U66615
SWI/SNF complex 155kDa subunit
1,89
-1,82
0,0317
Transcriptional regulation
AW964220
Interferon consensus sequence binding protein 1
2,16
-1,57
0,0159
Transcriptional regulation
S57551
Guanylate cyclase 2C
2,03
-1,93
0,0317
Intracellular signaling
BF026359
Carnitine palmitoyltransferase II
1,80
-1,88
0,0159
Intracellular signaling
NM_002053
Guanylate binding protein 1 (interferon-inducible)
2,50
-1,86
0,0317
Intracellular signaling
BG108304
v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
1,81
-1,66
0,0317
Intracellular signaling
X63128
Activin A receptor, type II
1,85
-1,64
0,0317
Intracellular signaling
BE148534
Serpin B13
1,91
-1,63
0,0159
Intracellular signaling
NM_006849
Protein disulfide isomerase
1,91
-1,59
0,0159
Intracellular signaling
U95367
GABA-A receptor pi subunit
1,86
-1,88
0,0317
Cell signaling
X51985
Lymphocyte-activation gene 3
2,34
-1,63
0,0155
Cell signaling
AB036063
Ribonucleotide reductase M2 B (TP53 inducible)
2,21
-1,87
0,0159
Catalytic activity
BC000562
2',5'-oligoadenylate synthetase 1
2,20
-1,67
0,0014
Catalytic activity
NM_005058
RNA binding motif protein, Y chromosome, family 1, member A1
2,08
-1,59
0,0159
Catalytic activity
BG567810
Serpin A3 *
2,32
-1,41
0,0317
Catalytic activity
AB006629
Cytoplasmic linker 2
2,12
-1,71
0,0159
Cytoskeleton
AK022147
TBC1 domain family, member 15
1,83
-1,99
0,0317
Unknown
AK025023
KIAA0284 protein
2,58
-1,97
0,0317
Unknown
25
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
CAC21785
Unnamed protein
2,20
-1,94
0,0159
Unknown
AB023187
Fibronectin type III domain containing 3
2,02
-1,70
0,0159
Unknown
Table 1: List of genes upregulated in MG thymus and significantly decreased in the thymus of
corticosteroid treated patients
Among the 157 up-regulated genes during MG, 36 are significantly down-regulated by
glucocorticoids. Genes were identified by Mann-Whitney’s test on the normalized and
centered ratios between MG patients treated by glucocorticoids and untreated MG patients
(MG-t/MG). These genes were ranked according to the FC calculated between MG-t and MG
and to their function. *: genes exhibiting low intensity.
26
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
27
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
28
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
29
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
30
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
31
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
32
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Prepublished online March 16, 2006;
doi:10.1182/blood-2005-06-2383
The chemokine CXCL13 is a key molecule in autoimmune Myasthenia
Gravis
Amel Meraouna, Geraldine Cizeron-Clairac, Rozen Le Panse, Jacky Bismuth, Frederique Truffault,
Chantal Tallaksen and Sonia Berrih-Aknin
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Advance online articles have been peer reviewed and accepted for publication but have not yet
appeared in the paper journal (edited, typeset versions may be posted when available prior to
final publication). Advance online articles are citable and establish publication priority; they are
indexed by PubMed from initial publication. Citations to Advance online articles must include
digital object identifier (DOIs) and date of initial publication.
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.