University of Groningen
Physiological functions of biliary lipid secretion
Voshol, Pieter Jacobus
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to
cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date:
2000
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Voshol, P. J. (2000). Physiological functions of biliary lipid secretion s.n.
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the
author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately
and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the
number of authors shown on this cover page is limited to 10 maximum.
Download date: 19-06-2017
CHAPTER 4
INCREASED HEPATIC VLDL PRODUCTION IN
THE ABSENCE OF HEPATOBILIARY LIPID
SECRETION IN MDR2 P-GLYCOPROTEINDEFICIENT MICE
Peter J Voshol, Rick Havinga, Kees Schoonderwoerd#, Lou B Agellon‡, Jobst
†
Greeve , Albert K Groen* and Folkert Kuipers
Groningen University Institute for Drug Exploration, Center for Liver, Digestive and
Metabolic Diseases, University Hospital Groningen, Groningen, The Netherlands,
#
Department of Biochemistry, Erasmus University Rotterdam, The Netherlands,
‡
Department of Biochemistry, University of Alberta, Edmonton, Canada,
†
Medizinische Klinik, Universität-Krankenhaus Eppendorf, Hamburg, Germany and
*Department of Gastrointestinal and Liver Diseases, Academic Medical Center,
Amsterdam, The Netherlands.
Submitted
Chapter 4: Hepatic VLDL secretion in Mdr2 (-/-) mice
ABSTRACT
Background & Aim: It has been postulated that hepatic very low density lipoprotein
(VLDL) production and secretion of phospholipids and cholesterol into bile are
functionally linked processes. The aim of this study was to evaluate the effects of
absence of hepatobiliary lipid flux on hepatic VLDL secretion in vivo in mice.
(-/-)
Methods: Mdr2 P-glycoprotein-deficient (Mdr2 ) mice with no biliary phospholipid
secretion, impaired cholesterol secretion but normal bile salt secretion into bile
and control mice were used to study hepatic VLDL secretion, VLDL composition,
and apoB100/B48 kinetics in vivo using Triton WR1339. Hepatic mRNA levels of
apoB and microsomal triglyceride transfer protein (MTP), and apoB mRNA editing
were assayed by (semi-quantitative) RT-PCR. Hepatic activities of CDP-choline
transferase (CT) and phosphatidylethanolamine N-methyltransferase (PEMT) for
phospholipid synthesis as well as lipoprotein and hepatic lipase activities were
determined. Results: In vivo VLDL triglyceride (+50%), apoB100 (+80%) and B48
(-/-)
compared to control mice.
(+180%) production rates were increased in Mdr2
Fractional turnover rate of apoB48, but not of apoB100, was increased in the
knockouts. No differences in steady state mRNA levels of apoB and MTP, apoB
(-/-)
and
mRNA editing, nor in CT and PEMT activities were found between Mdr2
control mice. Hepatic lipase activity, on the other hand, was significantly higher in
(-/-)
Mdr2 mice, which may contribute to increased clearance of apoB48-containing
particles. Conclusion: Hepatic VLDL production is increased in mice lacking biliary
lipid secretion. This study supports the concept that hepatobiliary lipid secretion
and hepatic VLDL production are reciprocally interrelated.
56
Physiological functions of biliary lipid secretion
INTRODUCTION
Very low density lipoproteins (VLDL) are the triglyceride-rich lipoproteins secreted
by the liver and are the precursors of plasma low density lipoproteins (LDL).
Hepatic overproduction of VLDL, in particular of relatively large particles, is an
important contributor to development of hyperlipidemia in humans [1,2].
Apolipoprotein B (ApoB) is essential for formation and secretion of VLDL particles
by the hepatocytes. In contrast to the situation in humans, rodents produce both
apoB100- and B48- containing VLDL due to the presence of hepatic apoB mRNA
editing activity [3]. In view of its crucial role in the development of hyperlipidemia,
and thus for risk of atherosclerosis [4], the regulation of hepatic VLDL production
has been and still is studied extensively. Insights in the molecular mechanisms
involved has greatly increased in the past couple of years (see [5-8] for review). Yet,
the various factors and their interactions that ultimately determine number and size
of particles produced in the in vivo situation remain poorly understood. It is clear
that the presence of apoB and of microsomal triglyceride transfer protein (MTP)
activity, a protein that controls the initial association of lipids with nascent apoB,
are absolutely essential [8-10]. In addition, several factors have been identified that
modulate hepatic VLDL production acutely, like insulin and catecholamines [8].
Synthesis of lipid constituents, i.e., of cholesterol [11], cholesteryl esters [12-14]
and specific phospholipids [15-18] have been shown to play a regulatory role.
Other factors, such as apolipoprotein E, may have an additional modulatory action
[19,20]. Furthermore, it has been postulated than the flux of lipids destined for
biliary secretion through the liver influences lipid composition and secretion of
VLDL particles [21,22]. This is, at first sight, not surprising in view of the fact that
the liver secretes massive amounts of phosphatidylcholine and cholesterol into
bile [23,24]. Thus, diosgenin feeding in rats leads to a strong increase in biliary
cholesterol secretion while, at the same time, VLDL-cholesterol output is strongly
reduced [21]. Likewise, Rigotti et al. [25] described that in rats fed a bean diet
biliary lipid secretion is increased while plasma VLDL concentration and hepatic
VLDL production are decreased. Our laboratory has previously shown that fish oil
feeding in rats reduces plasma cholesterol and triglyceride levels, an effect that
has been attributed to impaired VLDL formation due to accelerated apoB
degradation [26], and leads to increased biliary cholesterol and phospholipid
secretion [27,28]. It has been suggested that manipulation of a ‘common’ hepatic
cholesterol pool leads to reciprocal effects on biliary cholesterol secretion and
hepatic VLDL secretion [22,29].
In the present study we studied the effects of absence of biliary lipid
(-/-)
secretion on VLDL production in Mdr2 P-glycoprotein deficient mice (Mdr2 mice).
Mdr2 P-glycoprotein functions as a phospholipid flippase at the canalicular pole of
hepatocytes and appears to be essential for biliary phospholipid secretion [30]:
(-/-)
mice [23,30]. Since biliary
biliary secretion of phospholipids is absent in Mdr2
(-/-)
cholesterol secretion is linked to that of phospholipids, Mdr2 mice also have a
strongly reduced biliary cholesterol secretion [23]. On the other hand, biliary bile
salt secretion is not impaired in the Mdr2 Pgp-deficient mice [23]. Recently, we
(-/-)
mice have strongly reduced plasma High Density
demonstrated that Mdr2
Lipoprotein (HDL) cholesterol levels, but an increased plasma apolipoprotein B
content while plasma triglycerides are not affected or slightly decreased [31].
Furthermore, we found increased activities of acyl coenzyme A:cholesterol
57
Chapter 4: Hepatic VLDL secretion in Mdr2 (-/-) mice
acyltransferase and HMG-CoA reductase, the rate-controlling enzymes of
cholesterol esterification and synthesis, respectively. We now questioned whether
(-/-)
hepatic VLDL secretion is affected in Mdr2 mice. We measured hepatic VLDLtriglyceride and apoB100/B48 secretion in vivo in Triton WR1339-treated [32]
(-/-)
Mdr2 and control animals. We also determined expression levels of apoB and
MTP and determined apoB mRNA editing in both control and knockout mouse.
Furthermore, we checked for potential changes in phospholipid supply by
measuring
the
activities
of
CDP-choline
transferase
(CT)
and
phosphatidylethanolamine N-methyltransferase (PEMT), i.e., the enzymes that
catalyze the rate-controlling steps of both pathways of phosphatidylcholine
synthesis [33,34]. The results of these studies show that hepatic VLDL secretion i s
(-/-)
mice, which supports the concept of interaction
increased in vivo in Mdr2
between processes involved in lipid secretion into blood and into bile.
MATERIALS AND METHODS
Animals: Mice homozygous (Mdr2(-/-)) for disruption of the multidrug resistance
(+/+)
gene-2 (Mdr2) and control (Mdr2 ) mice of the same FVB-background were
obtained from the breeding colony at the Animal Facility of the Academic Medical
Center, Amsterdam. All mice were 2-4 months old and weighed 25-30 grams. Mice
were housed in a light- and temperature-controlled facility and fed standard labchow. Food and water were available ad libitum. All experiments were approved by
the ethical committee on animal testing, University of Groningen, The Netherlands.
In vivo hepatic VLDL-triglyceride production: Hepatic production of VLDL
(-/-)
triglycerides was measured in control and Mdr2 mice after i.v. injection of Triton
WR1339, as described before [32]. Animals were fasted overnight prior to the
experiments and 12.5 mg of Triton WR1339 (Tyloxapol, Sigma Chemical Co. , St
Louis, MO, USA) in 100 µL PBS was injected via the penile vein. Blood samples
(75 µL) were drawn before and after Triton injection at 0.5, 1, 1.5 and 2 hours via
tail bleeding and a final blood sample (1 mL) was collected by cardiac puncture
after five hours. The final blood sample was used for VLDL isolation. Separate
mice were bled after an over-night fast for baseline VLDL particle isolation (see
below).
VLDL isolation and apolipoprotein B production: For isolation of plasma VLDL,
500 µL plasma was covered with 500 µL NaCl/NaBr solution 1.016 g/mL and
centrifuged in a Beckman ultra-centrifuge (Beckman Optima, TLX-100), at 625,000
x g [35]. The VLDL fraction was recovered by tube slicing and protein, free
cholesterol, cholesterol esters, triglycerides and phospholipids composition was
determined as described below. VLDL fractions isolated from basal and five hour
blood samples were used for quantitative SDS-Page electrophoresis [32]. A
standard containing known amounts of human LDL apoB (0.35, 0.70, 1.4 and 2.1
µg ) prepared as previously described [36], was used for quantitative analysis. After
electrophoresis gels were stained with Coomassie Blue and quantified on by
gelscan images using a CCD video camera of the ImageMaster VDS system
(Pharmacia, Upsalla, Sweden). Each run was performed in duplicate.
58
Physiological functions of biliary lipid secretion
Hepatic steady state mRNA levels and apoB mRNA editing: Total RNA was
isolated from liver tissue using a combination of the TRIzol Reagent (GIBCO BRL,
Grand Island, NY) and the SV Total RNA isolation system (Promega, Madison WI,
USA) according to the manufacturer’s instructions. Single stranded cDNA was
synthesized from 4.5 µg RNA and subsequently subjected to polymerase chain
reactions (PCR) using specific primers sets for apolipoprotein B (apoB) (sense
primer:
GACAGTGTCAACAAGGCTTTGTAGTGGGT;
antisense
primer:
GGCAGAGACTATGTGTCCCAGTTTGA), microsomal triglyceride transfer protein
(MTP) (sense
primer:
ATCTGATGTGGACGTTGTGT;
antisense
primer:
CCTCTATCTTGTAGGTAGTG), fatty acid synthase (FAS) (sense primer:
ATGCCATGCTGGAGAACCAG; antisense primer: TCTCGGATGCCTAGGATGTG),
Diacylglycerol
acyl
transferase
(DGAT)
(sense
primer:
GCATACTTAGGATAGGGCTCAAGC;
antisense
primer:
CCTTGCATTACTCAGGATCAGCAT)
and
β-actin
(sense
primer:
AACACCCCAGCCATGTACG; antisense primer: ATGTCACGCACGATTTCCC). The
PCR products were ran on 2.5% agarose gels and stained with ethidium bromide.
Images were taken using a CCD video camera of the ImageMaster VDS system
(Pharmacia, Upsalla, Sweden).
Editing of apolipoprotein B mRNA was assayed as described previously [3].
In short, total RNA was prepared from liver using tri-Reagent and following the
manufacturer’s protocol (Molecular Research Center Inc.). For RT-PCR of specific
a primer set for apoB ( antisense primer: CAAGCATTTTTAGCTTTTCAATGATT ;
sense primer: TGCCAAAATCAACTTGAATGAAAAAC) were used as described [3].
For every RT-PCR a separate control lacking reverse transcriptase was performed.
The PCR products were purified by microspin-columns (S300, Pharmacia) and
analyzed for editing by primer extension [37]. Quantification of editing was
performed by using a RadiophosphorImager SL as described [37].
CDP-choline
transferase
(CT)
and
phosphatidylethanolamine
Nmethyltransferase (PEMT) activity and protein levels: Hepatic activities of CDPcholine transferase (CT) and phosphatidylethanolamine N-methyltransferase were
assayed in liver homogenates using 50 µg protein of the homogenates was used.
The assays were performed as previous described [38]. The values are presented
as nmol/min.mg protein.
Lipoprotein lipase (LPL) and hepatic lipase (HL) activity: Activities of lipoprotein
lipase (LPL) and hepatic lipase were determined in plasma after intravenous
injection of 100 µL of heparin (2 IE/100 µL) as described [39].
Miscellaneous methods: Total and free cholesterol and triglycerides were
measured using commercially available kits (Boehringer Mannheim, Germany).
Phospholipids were assayed by phosphate determination as described [31].
Protein determination was done according to Lowry et al. [40] with BSA (Sigma, St
Louis, MO, USA) as standard.
Statistical analysis: All results are presented as means ± standard deviations for
(-/-)
mice
the number of animals indicated. Differences between control and Mdr2
were determined by Mann-Whitney, exact 2-tailed U test [41]. Level of significance
for all statistical analyses was set at p < 0.05. Analyses was performed using
59
Chapter 4: Hepatic VLDL secretion in Mdr2 (-/-) mice
SPSS for Windows software (SPSS, Chicago, IL, USA)
RESULTS
Animal characteristics: Body weight did not differ between Mdr2(-/-) and control
(-/-)
mice compared to controls
mice, whereas liver weight was increased in Mdr2
(Table 1) [23,30]. Plasma total cholesterol and cholesteryl ester concentrations
(-/-)
mice compared to control mice as shown previously [31].
were lower in Mdr2
Plasma triglyceride and phospholipid (not shown) levels did not differ between the
two mouse strains. Fasting levels of apolipoprotein B100 were increased by ~70%
in the knockout animals compared to controls, whereas apolipoprotein B48 levels
showed no significant difference.
Table 1: Animal characteristics of Mdr2(-/-) and control (Mdr2(+/+)) mice. The values are given
as mean ± SD for 3-5 animals per group. Statistical significant differences were assessed
using Mann-Whitney exact U-test analysis.
Mouse
body
weight
(g)
Mdr2(+/+)
29.7 ± 3.4
Mdr2(-/-)
31.4 ± 4.1
* significantly different from
Liver
weight
(g)
1.2 ± 0.2
2.2 ± 0.2*
Mdr2(+/+) mice,
plasma
cholesterol
(mM)
3.8 ± 0.6
1.2 ± 0.4*
p < 0.05.
plasma
triglycerides
(mM)
1.8 ± 0.5
1.3 ± 0.6
plasma
ApoB100
(µg/mL)
38.3 ± 2.1
66.2 ± 7.0*
plasma
ApoB48
(µg/mL)
39.7 ± 5.1
32.4 ± 5.8
Table 2: Hepatic triglyceride, apoB100 and apoB48 production rates and fractional turnover
rates of apoB100 and apoB48 in Triton WR1339-treated Mdr2(-/-) and control (Mdr2(+/+)) mice.
Plasma samples were taken by tail bleeding and analyzed as described in the Material and
Method section. The values represent mean ± SD for 3-5 separate animals per group.
Statistical significant differences were determined using Mann-Whitney exact U-test.
Mouse
Mdr2(+/+)
Mdr2(-/-)
TG-PR
ApoB100-PR
µmol/h.100g BW µg/h.100g BW
9.8 ± 1.2
15.5 ± 2.9*
34.3 ± 4.2
61.7 ± 7.3*
* significant different from Mdr2(+/+) mice.
ApoB100-FTR
pools/day
6.3 ± 0.7
6.9 ± 0.7
ApoB48-PR
µg/h.100g BW
ApoB48-FTR
pools/day
52.5 ± 8.7
9.6 ± 2.5
148.8
± 29.1 ± 4.3*
26.9*
Figure 1: Plasma increase of triglyceride
concentrations in Mdr2(-/-) (dark circles)
and Control (Mdr2(+/+)) (open circles) mice
after Triton WR1339 injection. Blood
samples were taken by tail bleeding as
described in the Material and Method
section. Data represent mean delta
plasma triglyceride concentrations (in mM)
± SD, n = 5 per group. Differences
between Mdr2(-/-) and control mice was
analyzed using Mann Whitney exact Utest, * p< 0.05.
Hepatic VLDL-triglyceride and apolipoprotein B production in vivo: Fasted
(-/-)
Mdr2 and control animals were injected with Triton WR 1339 and hepatic VLDL(-/-)
mice
triglyceride and apolipoprotein B production was determined. Mdr2
showed a 50% increase in hepatic triglyceride production compared to control
mice (Figure 1). Hepatic VLDL cholesterol production showed a four-fold increase
in knockout animals compared to controls, i.e., 1.7 ± 0.5 versus 0.4 ± 0.2
µmol/h.100g body weight. Hepatic apoB100 and apoB48 production rates and the
60
Physiological functions of biliary lipid secretion
apoB48 fractional turnover rate were significantly increased in Mdr2(-/-) mice
compared to control mice when expressed per 100g body weight (Table 2).
Analysis of the relative lipid composition of the isolated VLDL particles revealed no
change in cholesterol, cholesteryl ester, phospholipid or relative triglyceride
(-/-)
content in VLDL of Mdr2 mice compared to those of control mice (Table 3). The
calculated [42] diameter of the VLDL particles isolated at 5 hours after Triton
WR1339 injected revealed an increased size for VLDL particles isolated from
(-/-)
mice compared to control, i.e., 71.5 ± 2.9 nm versus 71.4 ± 10.4 nm,
Mdr2
respectively.
Table 3: Relative lipid content of isolated VLDL fractions at 5 hours after Triton WR1339
injection in Mdr2(-/-) and control (Mdr2(+/+)) mice. The VLDL fractions were isolated after ultracentrifugation as described in the Material and Method section. The relative content of
triglycerides (TG), phospholipids (PL), cholesterol (C) and cholesteryl ester (CE) are
represented as mean ± SD for 3 animals per group. Statistical significant differences were
assessed by Mann-Whitney exact U-test analysis.
Mouse
TG
PL
C
CE
(% of total lipid) (% of total lipid) (% of total lipid) (% of total lipid)
Mdr2(+/+)
77.5 ± 1.5
14.3 ± 0.4
8.1 ± 1.01
2.9 ± 0.7
Mdr2(-/-)
77.3 ± 2.5
14.6 ± 1.9
8.1 ± 1.2
2.7 ± 0.6
ApoB and MTP mRNA expression levels and apoB editing: To exclude that the
(-/-)
mice was due to altered
observed increased VLDL production in Mdr2
expression of apoB or MTP we determined steady state mRNA levels of these
(-/-)
and control mice (Figure 2). No changes were
proteins in livers of Mdr2
observed in steady state mRNA levels of either apoB or MTP. In addition,
expression of fatty acid synthase (FAS) or diacylglycerol-acyl transferase (DGAT)
were not affected by mdr2 Pgp-deficiency. We also determined the apoB editing [3]
(-/-)
and found no differences between Mdr2 and control mice, i.e., 50.7 ± 0.7% and
(-/-)
and control mice,
56.8 ± 1.3% (n = 4, ns) edited apoB mRNA in Mdr2
respectively.
Figure 2: Steady state mRNA level of
apolipoprotein
B (apoB), microsomal
triglyceride transfer protein (mtp), fatty acid
synthase
(fas),
diacylglycerolLacyl
transferase (dgat) and
ß-actin was
determined by RT-PCR in control (Mdr2(+/+))
and Mdr2(-/-) mice. Data shown are
representative for at least 3 separate RNA
isolations per group.
Lipid supply for VLDL assembly: We have previously shown that activities of HMG(-/-)
CoA reductase (+ 190%) and ACAT (+ 80%) are increased in livers of Mdr2 mice
[31], suggesting increased de novo supply of cholesterol(esters) in these mice. To
(-/investigate whether the supply of phosphatidylcholine may be altered in the Mdr2
)
mice, we determined the activities of CDP-choline transferase (CT) and
phosphatidylethanolamine N-methyltransferase (PEMT) in liver homogenates
(Table 4). No significant differences were detected in hepatic activities of CT and
(-/-)
PEMT between Mdr2 and control mice.
61
Chapter 4: Hepatic VLDL secretion in Mdr2 (-/-) mice
Table 4: Activity of CDP-choline transferase (CT) and phosphatidylethanolamine Nmethyltransferase (PEMT) in liver homogenates of Mdr2(-/-) and control (Mdr2(+/+)) mice.
Mouse
Total CT activity
PEMT activity
(nmol/min/mg protein)
(nmol/min/mg protein)
Mdr2(+/+)
1.56 ± 0.34
1.64 ± 0.28
Mdr2(-/-)
2.24 ± 0.58
1.35 ± 0.24
50 µg of total protein was used in the assays, as described in detail in the Material and Method
section.
Lipoprotein lipase and hepatic lipase activities: To check whether altered lipase
activity in the plasma compartment may be of relevance for the observed
differences in handling of apoB100- and apoB48-containing particles, the activities
of lipoprotein lipase and hepatic lipase were determined. Lipoprotein lipase activity
(-/-)
was not different between Mdr2 and control mice, i.e., 11.0 ± 3.2 versus 20.1 ±
7.8 mU/mL, respectively, whereas hepatic lipase activity was increased by ~110%
(-/-)
in Mdr2 mice compared to controls, i.e., 114.1 ± 22.9 versus 54.5 ± 4.8 mU/mL
(p < 0.04), respectively.
DISCUSSION
In this study, we show that hepatic VLDL production is increased in mice with
absent biliary phospholipid and cholesterol secretion due to mdr2 Pgp-deficiency.
Hepatic production rates of VLDL-triglyceride (1.5 times), apoB100 (1.8 times) and
(-/-)
mice compared to controls. The
apoB48 (2.4 times) are increased in Mdr2
(-/-)
enlarged liver of Mdr2 mice could, in theory, contribute to the observed increase
in hepatic VLDL production, yet the enlargement of the liver is mainly accounted for
by bile duct proliferation with fibrosis due to the lipid-free bile formed in mdr2 Pgp
deficient mice [43,44]. There are no indications for an increased number of
(-/-)
mice. As expected, apoB mRNA levels were
hepatocytes in the liver of Mdr2
(-/-)
and control mice. Furthermore, apoB mRNA editing was
similar in Mdr2
(-/-)
mice. Therefore, the increased production of
comparable to controls in Mdr2
apoB48-containing particles relative to apoB100-containing particles must be due
to post-editing events, as has also been observed in fat-laden rat hepatocytes [45].
MTP is suggested to be rate-controlling in the supply of lipid to the nascent apoB
(-/-)
and control mice,
particle. MTP mRNA levels did not differ between Mdr2
although it can obviously not been excluded at this point that increased MTP activity
contributes to the observed differences.
Alterations in the lipid supply for hepatic VLDL secretion may contribute to
(-/-)
mice. The capacity of phosphatidylcholine
altered VLDL production in Mdr2
synthesis, an important determinant of VLDL particle size and production [15-18],
appeared unaffected in the knockouts since the activities of CT and PEMT were
(-/-)
found to be similar in Mdr2 and control mice. Of course, in the in vivo situation
the synthesis of phosphatidylcholine is expected to be decreased since the
(-/-)
mice.
massive biliary phospholipids flux (~14 mg per day) is lacking in Mdr2
(-/-)
Although the cholesterol(ester) content in the liver did not differ between Mdr2
and control mice [31], we showed in an earlier study that the activities of HMG-CoA
(-/-)
mice [31]. Increased activities of
reductase and ACAT are increased in Mdr2
these two rate-controlling enzymes could contribute to increased production of
(-/-)
hepatic VLDL-cholesterol in Mdr2 mice [11-14]. The increased activities of these
62
Physiological functions of biliary lipid secretion
enzymes might in fact be a result of de-repressed cholesterol biosynthesis due to
absence of intestinally derived cholesterol entering the liver via the chylomicron
remnant pathway [46], due to absence biliary cholesterol secretion and impaired
(-/-)
chylomicron formation in Mdr2 mice [47].
The results of these studies are consistent with the notion that VLDL
production may, in part, be regulated via modulation of hepatic lipid precursor
pools, either directly via interference with biliary lipid secretion or indirectly via
regulation of cholesterol biosynthesis by the absence of entry into the liver of
chylomicron remnants. In addition, based on the present data, it can not be
excluded that mdr2 Pgp-deficiency in itself has an affect on VLDL production
independent of its effect on hepatobiliary lipid transport. Studies in cultured
hepatocytes need to be performed to resolve these issues.
Fractional turnover rate of apoB100 was not affected, whereas that of
(-/-)
apoB48 was significantly higher in Mdr2 mice compared to control animals. As a
(-/-)
consequence, fasting apoB48 levels were not elevated in Mdr2 mice in spite of
its increased production by the liver. The difference between the fractional turnover
rates of apoB100 and apoB48 may be related to differential metabolic handling in
the circulation [48], for instance by differential interactions of apoB100- and
apoB48-containing particles with lipases. Lipoprotein lipase activity was not
(-/-)
increased, whereas hepatic lipase activity was doubled in Mdr2 mice. It seems
that large, apoB48-containing chylomicrons are preferred substrates for lipoprotein
lipase [49,50]. ApoB48-containing lipoproteins derived from the intestine are
absent in fasted animals, therefore large apoB48-containing VLDL particles
produced by the liver are probably more efficiently cleared from the circulation. The
increased hepatic lipase activity could, in part, accelerate the clearance of apoB48containing particles by the liver, either by increasing exposure of apolipoprotein E
[51] or via direct binding of apoB48 to hepatic lipase [52] which increases receptormediated uptake [51-53]. Alternatively, changes in receptor-mediated uptake
systems for apolipoprotein B100-containing particles could contribute to these
observations. Previously we showed that hepatic mRNA levels of the LDL-receptor
(-/-)
are not different between control and Mdr2 mice [31]. Other receptors, potentially
involved in apolipoprotein B particle uptake, e.g., LDLR-related protein (LRP),
megalin, the VLDL-receptor (VLDLR) and several others [54-58], have not been
evaluated.
(-/-)
The increased hepatic lipase activity found in Mdr2 mice could, in addition
to impaired chylomicron formation [47], contribute to low levels of HDL found in
these animals [31]: it has recently been demonstrated that hepatic lipase
promotes the selective uptake of HDL-cholesterol via the HDL-receptor, SR-BI
[59,60], thereby reducing plasma HDL levels [61-63]. Furthermore, mice lacking
the hepatic lipase gene show increased plasma HDL-cholesterol levels [64].
In
conclusion,
these
studies
show
that
impaired
biliary
(-/-)
mice is associated with increased
phospholipid/cholesterol secretion in Mdr2
hepatic triglyceride and apolipoprotein B production. Increased hepatic production
and altered metabolic handling of VLDL contributes to the increased plasma
(-/-)
apolipoprotein B levels found in Mdr2 mice.
References
1. Schaefer EJ, McNamara JR, Genest J, Jr., Ordovas JM. Clinical
hypertriglyceridemia. Semin Thromb Hemost 1988;14:143-148.
significance
of
63
Chapter 4: Hepatic VLDL secretion in Mdr2 (-/-) mice
2. Gianturco SH, Bradley WA. Lipoprotein-mediated cellular mechanisms for atherogenesis i n
hypertriglyceridemia. Semin Thromb Hemost 1988;14:165-169.
3. Greeve J, Altkemper I, Dieterich JH, Greten H, Windler E. Apolipoprotein B mRNA editing i n
12 different mammalian species: hepatic expression is reflected in low concentrations of apoBcontaining plasma lipoproteins. J Lipid Res 1993;34:1367-1383.
4. Hodis HN, Mack WJ. Triglyceride-rich lipoproteins and progression of atherosclerosis. Eur
Heart J 1998;19 Suppl A:A40-4.
5. Yao Z, Mcleod RS. Synthesis and secretion of hepatic apolipoprotein B-containing
lipoproteins. Biochim Biophys Acta 1994;1212:152-166.
6. Dixon JL, Ginsberg HN. Hepatic synthesis of lipoproteins and apolipoproteins. Semin Liver
Dis 1992;12:364-372.
7. Dixon JL, Ginsberg HN. Regulation of hepatic secretion of apolipoprotein B-containing
lipoproteins: information obtained from cultured liver cells. J Lipid Res 1993;34:167-179.
8. Mason TM. The role of factors that regulate the synthesis and secretion of very-low-density
lipoprotein by hepatocytes. Crit Rev Clin Lab Sci 1998;35:461-487.
9. Kannel BW, Castelli WP, Gordon T, McNamara PM. Serum cholesterol, lipoproteins, and the
risk of coronary heart disease. The Framingham study. Ann Intern Med 1971;74:1-12.
10. Castelli WP. Lipids, risk factors and ischaemic heart disease. Atherosclerosis 1996;124
Suppl:S1-9:S1-9.
11. Thompson GR, Naoumova RP, Watts GF. Role of cholesterol in regulating apolipoprotein B
secretion by the liver. J Lipid Res 1996;37:439-447.
12. Musanti R, Giorgini L, Lovisolo P, Pirillo A, Chiari A, Ghiselli G. Inhibition of acylCoA:cholesterol acyltransferase decreases apolipoprotein B-100-containing lipoprotein
secretion from HepG2 cells. J Lipid Res 1996;37:1-14.
13. Avramoglu RK, Cianflone K, Sniderman AD. Role of the neutral lipid accessible pool in the
regulation of secretion of apoB-100 lipoprotein particles by HepG2 cells. J Lipid Res
1995;36:2513-2528.
14. Nervi F, Bronfman M, Allalon W, Depiereux E, Del Pozo R. Regulation of biliary cholesterol
secretion in the rat. Role of hepatic cholesterol esterification. J Clin Invest 1984;74:2226-2237.
15. Fast DG, Vance DE. Nascent VLDL phospholipid composition is altered when
phosphatidylcholine biosynthesis is inhibited: Evidence for a novel mechanism that regulates
VLDL secretion. Bba-Lipid Lipid Metab 1995;1258:159-168.
16. Vermeulen PS, Lingrell S, Yao ZM, Vance DE. Phosphatidylcholine biosynthesis is required
for secretion of truncated apolipoprotein Bs from McArdle RH7777 cells only when a neutral
lipid core is formed. J Lipid Res 1997;38:447-458.
17. Verkade HJ, Fast DG, Rusinol AE, Scraba DG, Vance DE. Impaired biosynthesis of
phosphatidylcholine causes a decrease in the number of very low density lipoprotein particles
in the Golgi but not in the endoplasmic reticulum of rat liver. J Biol Chem 1993;268:2499024996.
18. Vance JE, Vance DE. The role of phosphatidylcholine biosynthesis in the secretion of
lipoproteins from hepatocytes. Can J Biochem Cell Biol 1985;63:870-881.
19. Kuipers F, Jong MC, Lin Y, Van Eck M, Havinga R, Bloks V, Verkade HJ, Hofker MH,
Moshage H, Van Berkel TJC, Vonk RJ, Havekes LM. Impaired secretion of very low density
lipoprotein-triglycerides by apolipoprotein E-deficient mouse hepatocytes. J Clin Invest
1997;100:2915-2922.
20. Mensenkamp AR, Jong MC, van Goor H, van Luyn MJ, Bloks V, Havinga R, Voshol PJ,
Hofker MH, van Dijk KW, Havekes LM, Kuipers F. Apolipoprotein E Participates in the
Regulation of Very Low Density Lipoprotein-Triglyceride Secretion by the Liver. J Biol Chem
1999;274:35711-35718.
21. Nervi F, Marinovic I, Rigotti A, Ulloa N. Regulation of biliary cholesterol secretion.
Functional relationship between the canalicular and sinusoidal cholesterol secretory pathways
in the rat. J Clin Invest 1988;82:1818-1825.
22. Stone BG, Erickson SK, Craig WY, Cooper AD. Regulation of rat biliary cholesterol secretion
by agents that alter intrahepatic cholesterol metabolism. Evidence for a distinct biliary
precursor pool. J Clin Invest 1985;76:1773-1781.
23. Oude Elferink RP, Ottenhoff R, van Wijland M, Smit JJ, Schinkel AH, Groen AK. Regulation
of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995;95:31-38.
24. Cohen DE. Hepatocellular transport and secretion of biliary lipids. Curr Opin Lipidol
1999;10:295-302.
25. Rigotti A, Marzolo MP, Ulloa N, Gonzalez O, Nervi F. Effect of bean intake on biliary lipid
secretion and on hepatic cholesterol metabolism in the rat. J Lipid Res 1989;30:1041-1048.
26. Wang H, Chen X, Fisher EA. N-3 fatty acids stimulate intracellular degradation of
apoprotein B in rat hepatocytes. J Clin Invest 1993;91:1380-1389.
64
Physiological functions of biliary lipid secretion
27. Smit MJ, Temmerman AM, Wolters H, Kuipers F, Beynen AC, Vonk RJ. Dietary fish oilinduced changes in intrahepatic cholesterol transport and bile acid synthesis in rats. J Clin
Invest 1991;88:943-951.
28. Smit MJ, Verkade HJ, Havinga R, Vonk RJ, Scherphof GL, In 't Veld G, Kuipers F. Dietary
fish oil potentiates bile acid-induced cholesterol secretion into bile in rats. J Lipid Res
1994;35:301-310.
29. Stone BG, Evans CD. Evidence for a common biliary cholesterol and VLDL cholesterol
precursor pool in rat liver. J Lipid Res 1992;33:1665-1675.
30. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L, Mol CA,
Ottenhoff R, van der Lugt NM, van Roon MA, van der Valk MA, Offerhaus GJA, Berns AJM, Borst
P. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete
absence of phospholipid from bile and to liver disease. Cell 1993;75:451-462.
31. Voshol PJ, Havinga R, Wolters H, Ottenhoff R, Princen HMG, Oude Elferink RPJ, Groen AK,
Kuipers F. Reduced plasma cholesterol and increased fecal sterol loss in multidrug resistance
gene 2 P-glycoprotein-deficient mice. Gastroenterology 1998;114:1024-1034.
32. Li X, Catalina F, Grundy SM, Patel S. Method to measure apolipoprotein B-48 and B-100
secretion rates in an individual mouse: evidence for a very rapid turnover of VLDL and
preferential removal of B-48- relative to B-100-containing lipoproteins. J Lipid Res
1996;37:210-220.
33. Pelech SL, Pritchard PH, Brindley DN, Vance DE. Fatty acids promote translocation of
CTP:phosphocholine cytidylyltransferase to the endoplasmic reticulum and stimulate rat
hepatic phosphatidylcholine synthesis. J Biol Chem 1983;258:6782-6788.
34. Ridgway ND, Yao Z, Vance DE. Phosphatidylethanolamine levels and regulation of
phosphatidylethanolamine N-methyltransferase. J Biol Chem 1989;264:1203-1207.
35. Pietzsch J, Subat S, Nitzsche S, Leonhardt W, Schentke KU, Hanefeld M. Very fast
ultracentrifugation of serum lipoproteins: influence on lipoprotein separation and composition.
Biochim Biophys Acta 1995;1254:77-88.
36. Jialal I, Fuller CJ, Huet BA. The effect of a-Tocopherol supplementation on LDL oxidation.
Arterioscler Thromb Vasc Biol 1995;15:190-198.
37. Greeve J, Jona VK, Chowdhury NR, Horwitz MS, Chowdhury JR. Hepatic gene transfer of the
catalytic subunit of the apolipoprotein B mRNA editing enzyme results in a reduction of plasma
LDL levels in normal and watanabe heritable hyperlipidemic rabbits. J Lipid Res 1996;37:20012017.
38. Pelech SL, Power E, Vance DE. Activities of the phosphatidylcholine biosynthetic enzymes
in rat liver during development. Can J Biochem Cell Biol 1983;61:1147-1152.
39. Jansen H, Hop W, van Tol A, Bruschke AV, Birkenhager JC. Hepatic lipase and lipoprotein
lipase are not major determinants of the low density lipoprotein subclass pattern in human
subjects with coronary heart disease. Atherosclerosis 1994;107:45-54.
40. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem
Biophys 1959;37:911-917.(Abstract)
41. Dawson-Saunders B, Trapp RG. Basic and clinical biostatistics. International Ed.
Englewoods Cliffs NJ: Prentice Hall, 1990:
42. Beil UF, Grundy SM. Studies on plasma lipoproteins during absorption of exogenous
lecithin in man. J Lipid Res 1980;21:525-536.
43. Van Nieuwkerk CMJ, Oude Elferink RPJ, Groen AK, Ottenhoff R, Tytgat GNJ, Dingemans
KP, Weerman MAVB, Offerhaus GJA. Effects of ursodeoxycholate and cholate feeding on liver
disease in FVB mice with a disrupted mdr2 P-glycoprotein gene. Gastroenterology
1996;111:165-171.
44. Van Nieuwkerk CMJ, Groen AK, Ottenhoff R, van Wijland M, Weerman MAV, Tytgat GNJ,
Offerhaus JJA, Oude Elferink RPJ. The role of bile salt composition in liver pathology of mdr2 (/-) mice: Differences between males and females. J Hepatol 1997;26:138-145.
45. Coussons PJ, Bourgeois CS, Wiggins D, Gibbons GF. Selective recruitment of ApoB-48 for
the assembly of VLDL in rat triacylglycerol-enriched hepatocytes. Arterioscler Thromb Vasc Biol
1996;16:889-897.
46. Nervi FO, Dietschy JM. The mechanisms of and the interrelationship between bile acid and
chylomicron-mediated regulation of hepatic cholesterol synthesis in the liver of the rat. J Clin
Invest 1978;61:895-909.
47. Voshol PJ, Minich DM, Havinga R, Oude Elferink RPJ, Verkade HJ, Groen AK, Kuipers F.
Postprandial Chylomicron Formation and Fat Absorption in Multidrug Resistance Gene-2 PGlycoprotein-Deficient Mice. Gastroenterology 2000;118:173-182.
48. Beisiegel U. Lipoprotein metabolism. Eur Heart J 1998;19 Suppl A:A20-3.
49. Karpe F, Humphreys SM, Samra JS, Summers LKM, Frayn KN. Clearance of lipoprotein
remnant particles in adipose tissue and muscle in humans. J Lipid Res 1997;38:2335-2343.
65
Chapter 4: Hepatic VLDL secretion in Mdr2 (-/-) mice
50. van Beek AP, van Barlingen HH, de Ruijter-Heijstek FC, Jansen H, Erkelens DW, DallingaThie GM, de Bruin TW. Preferential clearance of apoB-48-containing lipoproteins after
heparin-induced lipolysis is modulated by lipoprotein lipase activity. J Lipid Res 1998;39:322332.
51. Brasaemle DL, Cornely-Moss K, Bensadoun A. Hepatic lipase treatment of chylomicron
remnants increases exposure of apolipoprotein E. J Lipid Res 1993;34:455-465.
52. Choi SY, Goldberg IJ, Curtiss LK, Cooper AD. Interaction between ApoB and Hepatic Lipase
Mediates the Uptake of ApoB- containing Lipoproteins. The Journal of Biological chemistry
1998;273:20456-20462.
53. Krapp A, Ahle S, Kersting S, Hua Y, Kneser K, Nielsen M, Gliemann J, Beisiegel U. Hepatic
lipase mediates the uptake of chylomicrons and beta-VLDL into cells via the LDL receptorrelated protein (LRP). J Lipid Res 1996;37:926-936.
54. Herz J, Hamann U, Rogne S, Myklebost O, Gausepohl H, Stanley KK. Surface location and
high affinity for calcium of a 500-kd liver membrane protein closely related to the LDL-receptor
suggest a physiological role as lipoprotein receptor. EMBO J 1988;7:4119-4127.
55. Saito A, Pietromonaco S, Loo AK, Farquhar MG. Complete cloning and sequencing of rat
gp330/"megalin," a distinctive member of the low density lipoprotein receptor gene family.
Proc Natl Acad Sci U S A 1994;91:9725-9729.
56. Takahashi S, Kawarabayasi Y, Nakai T, Sakai J, Yamamoto T. Rabbit very low density
lipoprotein receptor: a low density lipoprotein receptor-like protein with distinct ligand
specificity. Proc Natl Acad Sci U S A 1992;89:9252-9256.
57. Novak S, Hiesberger T, Schneider WJ, Nimpf J. A new low density lipoprotein receptor
homologue with 8 ligand binding repeats in brain of chicken and mouse [published erratum
appears in J Biol Chem 1996 Oct 25;271(43):27188]. J Biol Chem 1996;271:11732-11736.
58. Kim DH, Iijima H, Goto K, Sakai J, Ishii H, Kim HJ, Suzuki H, Kondo H, Saeki S, Yamamoto
T. Human apolipoprotein E receptor 2. A novel lipoprotein receptor of the low density
lipoprotein receptor family predominantly expressed in brain. J Biol Chem 1996;271:83738380.
59. Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M. Identification of scavenger
receptor SR-BI as a high density lipoprotein receptor [see comments]. Science 1996;271:518520.
60. Kozarsky KF, Donahee MH, Rigotti A, Iqbal SN, Edelman ER, Krieger M. Overexpression of
the HDL receptor SR-BI alters plasma HDL and bile cholesterol levels. Nature 1997;387:414417.
61. Dichek HL, Brecht W, Fan J, Ji ZS, McCormick SP, Akeefe H, Conzo L, Sanan DA,
Weisgraber KH, Young SG, Taylor JM, Mahley RW. Overexpression of hepatic lipase i n
transgenic mice decreases apolipoprotein B-containing and high density lipoproteins.
Evidence that hepatic lipase acts as a ligand for lipoprotein uptake. J Biol Chem
1998;273:1896-1903.
62. Hill SA, McQueen MJ. Reverse cholesterol transport--a review of the process and its clinical
implications. Clin Biochem 1997;30:517-525.
63. Lambert G, Chase M, Dugi KA, Bensadoun A, Bryan Brewer Jr. H, Santamarina Fojo S.
Hepatic lipase promotes the selective uptake of high density lipoprotein-cholesteryl esters via
the scavenger receptor B1. J Lipid Res 1999;40:1294-1303.
64. Homanics GE, de Silva H, Osada J, Zhang SH, Wong H, Borensztajn J, Maeda N. Mild
dyslipidemia in mice following targeted inactivation of the hepatic lipase gene. J Biol Chem
1995;270:2974-2980.
66