Activation of Anthocyanin Biosynthesis in
Gerbera hybrida (Asteraceae) Suggests Conserved
Protein-Protein and Protein-Promoter
Interactions between the Anciently Diverged
Monocots and Eudicots1
Paula Elomaa*, Anne Uimari2, Merja Mehto3, Victor A. Albert, Roosa A.E. Laitinen, and Teemu H. Teeri
Department of Applied Biology, P.O. Box 27, University of Helsinki, Helsinki FIN–00014, Finland (P.E., A.U.,
M.M., R.A.E.L., T.H.T.); and Natural History Museums and Botanical Garden, University of Oslo, P.O. Box
1172 Blindern, NO–0318 Oslo, Norway (V.A.A.)
We have identified an R2R3-type MYB factor, GMYB10, from Gerbera hybrida (Asteraceae) that shares high sequence
homology to and is phylogenetically grouped together with the previously characterized regulators of anthocyanin
pigmentation in petunia (Petunia hybrida) and Arabidopsis. GMYB10 is able to induce anthocyanin pigmentation in
transgenic tobacco (Nicotiana tabacum), especially in vegetative parts and anthers. In G. hybrida, GMYB10 is involved in
activation of anthocyanin biosynthesis in leaves, floral stems, and flowers. In flowers, its expression is restricted to petal
epidermal cell layers in correlation with the anthocyanin accumulation pattern. We have shown, using yeast (Saccharomyces
cerevisiae) two-hybrid assay, that GMYB10 interacts with the previously isolated bHLH factor GMYC1. Particle bombardment analysis was used to show that GMYB10 is required for activation of a late anthocyanin biosynthetic gene promoter,
PGDFR2. cis-Analysis of the target PGDFR2 revealed a sequence element with a key role in activation by GMYB10/GMYC1.
This element shares high homology with the anthocyanin regulatory elements characterized in maize (Zea mays) anthocyanin
promoters, suggesting that the regulatory mechanisms involved in activation of anthocyanin biosynthesis have been
conserved for over 125 million years not only at the level of transcriptional regulators but also at the level of the biosynthetic
gene promoters.
Anthocyanins are the most common pigments contributing to coloration in higher plants. Their biosynthesis is one of the best studied branches of secondary pathways, and to date, nearly all of the structural
genes of the pathway defined by pigmentation mutants in various species have been isolated (for review, see Mol et al., 1998; Winkel-Shirley, 2001). In
addition to the central pathway, regulatory proteins
needed for activation of anthocyanin biosynthesis
seem to be structurally conserved during evolution
of flowering plants and are often also functionally
interchangeable as shown using either transiently or
stably transformed plants (Lloyd et al., 1992; Quattrocchio et al., 1993, 1998; Mooney et al., 1995; Bradley et al., 1998). Still, the mechanistic complexity of
the regulation has become evident along with the
1
This work was supported by the Academy of Finland (project
no. 41397 to P.E.).
2
Present address: A.I. Virtanen Institute, University of Kuopio,
P.O. Box 1627, 70211 Kuopio, Finland.
3
Present address: Thermolabsystems, Ratastie 2, 01620 Vantaa,
Finland.
*Corresponding author; e-mail [email protected]; fax
358 –9 –19158727.
Article, publication date, and citation information can be found
at http://www.plantphysiol.org/cgi/doi/10.1104/pp.103.026039.
characterization of the regulators in various plant
species and has revealed that our current view of the
regulatory network is still far from clear.
In plants, MYB-like transcription factors are encoded by large gene families (with more than 100
members in Arabidopsis). It is known that these
genes are involved in diverse roles during plant development, but functions for the majority of these
genes have not yet been assigned (Kranz et al., 1998;
Meissner et al., 1999). MYB proteins contain a conserved DNA-binding domain (the MYB domain)
with one to three imperfect repeats (R1–R3) that define their binding specificity to the target gene promoters (Martin and Paz-Ares, 1997). R2R3-type proteins form the largest class of MYB factors in plants
and among them are the factors involved in activation of anthocyanin pigmentation in various plant
species. In maize (Zea mays), genes for the whole
anthocyanin biosynthetic pathway, starting from C2
(encoding chalcone synthase), are simultaneously activated by MYB and bHLH transcription factors encoded by the C1/Pl and the R/B gene families, respectively (Paz-Ares et al., 1987; Ludwig et al., 1989; Cone
et al., 1993). Activation requires representatives of
both types of regulators that interact with each other
as shown in yeast (Saccharomyces cerevisiae) two-hybrid
assays (Goff et al., 1992; Grotewold et al., 2000). How-
Downloaded
on Junewww.plantphysiol.org
18, 2017 - Published by
Plant Physiology, December 2003, Vol.
133, pp. from
1831–1842,
© www.plantphysiol.org
2003 American Society of Plant Biologists
Copyright © 2003 American Society of Plant Biologists. All rights reserved.
1831
Elomaa et al.
ever, direct physical binding to the target gene promoters has been demonstrated only for the C1 protein
(Sainz et al., 1997; Lesnick and Chandler, 1998). Also
in maize, another MYB domain factor, encoded by the
P locus, regulates production of the related phlobaphene pigments by binding to the dihydroflavonol-4reductase-encoding gene (DFR or A1 in case of maize)
promoter, without the requirement of any known
bHLH counterpart (Grotewold et al., 1994).
In petunia (Petunia hybrida), flavonoid biosynthesis
is regulated in at least two separate molecular units
(Quattrocchio et al., 1993). A petunia R2R3-type MYB
factor, AN2, activates the late anthocyanin pathway
genes, beginning with DFR in petal limbs (Quattrocchio et al., 1999). In a transient assay, AN2 can interact with either of two distinct bHLH factors, JAF13 or
AN1, which both share high sequence homology
with the maize R and snapdragon (Antirrhinum majus) DELILA proteins. In addition to anthocyanin
biosynthesis, AN1 has been shown recently to act in
acidification of the vacuoles in petal cells and morphogenesis of the seed coat epidermis (Spelt et al.,
2002). It also has been shown that interaction of these
proteins is required for the activation of the DFR
promoter (Quattrocchio et al., 1998; Spelt et al., 2000).
Stably transformed petunia plants indicate that ectopic expression of AN2 in leaves induces the expression of AN1 mRNA to levels normally found only in
floral tissues, whereas AN2 does not have any effect
on JAF13 expression. This indicates that AN2 functions upstream of AN1 but not of JAF13. In anthers,
AN1 expression depends on AN4, a likely paralog of
AN2 (Spelt et al., 2000). In addition to MYB and
bHLH factors, a cytoplasmic WD40 repeat protein
encoded by the AN11 locus is required for anthocyanin accumulation, probably via posttranslational
regulation of AN2 (deVetten et al., 1997). In summary, anthocyanin accumulation patterning in petunia flowers is determined by tissue-specific expression of R2R3-type MYB genes (AN2 and AN4),
whereas AN1 and AN11 are expressed in all pigmented tissues (Quattrocchio et al., 1993, 1999; Spelt
et al., 2000).
In Arabidopsis, activation tagging led to identification of a bright-purple mutant (pap1-D) in which
overexpression of a MYB factor led to massive accumulation of anthocyanins in the entire plant. The
corresponding gene, PAP1, shows high sequence
similarity with the petunia AN2 and maize C1 genes
(Borevitz et al., 2000). Moreover, in Arabidopsis
TTG1, a WD40 repeat protein similar to the petunia
AN11 is required for activation of the late anthocyanin pathway in leaves and stems (Walker et al., 1999).
Another MYB factor encoded by TT2 is specifically
responsible for activation of late flavonoid metabolism and proanthocyanidin production in seeds and
requires the presence of TT8, a bHLH factor (Nesi et
al., 2000, 2001). However, interactions with other
1832
transcription factors and binding to target promoters
remain to be demonstrated for these proteins.
We previously have investigated genes responsible
for floral anthocyanin patterns in Gerbera hybrida, a
common ornamental plant that belongs to the large
eudicot plant family Asteraceae. We showed that the
expression patterns of both a late gene of the flavonoid pathway encoding G. hybrida DFR (GDFR)
and the bHLH-type regulatory gene (GMYC1) follow
the anthocyanin accumulation patterns at various
anatomical levels in different G. hybrida varieties (Helariutta et al., 1995; Elomaa et al., 1998). In this paper,
we report characterization of a R2R3-type MYB domain transcription factor, GMYB10, a putative ortholog of petunia AN2 and Arabidopsis PAP1/PAP2,
which is able to induce anthocyanin pigmentation in
transgenic tobacco (Nicotiana tabacum). Expression
analysis of GMYB10 suggests that it has a role in
induction of both vegetative and petal pigmentation
in G. hybrida. In a yeast two-hybrid analysis, GMYB10
is able to interact with the previously characterized
bHLH domain factor GMYC1 (Elomaa et al., 1998).
Moreover, deletion analysis of the target GDFR promoter (PGDFR2) using particle bombardment was
performed to define the critical regions of the promoter for activation. We identified a sequence
domain with high similarity to the anthocyanin regulatory elements (AREs) found in maize anthocyanin
promoters and introduced mutations to this element.
Transient analysis of the mutated promoter demonstrates a key role for the ARE in activation by
GMYB10/GMYC1. Our results suggest that the regulatory mechanisms involved in activation of anthocyanin biosynthesis are conserved between the anciently diverged eudicots and monocots not only at
the level of the regulatory proteins but also at the
level of the target promoters.
RESULTS
Isolation of G. hybrida MYB Domain
Transcription Factors
We have isolated seven distinct cDNA clones
encoding R2R3-type MYB domain factors from G. hybrida. First, we used PCR amplification with degenerate primers designed on the basis of conservation
of the DNA-binding domain of the MYB transcription
factors in plants. Three different cDNA fragments
(GMYB1, GMYB8, and GMYB9a) were amplified from
the G. hybrida petal cDNA, and 5⬘-/3⬘-RACE PCR
was applied to isolate the corresponding full-length
cDNAs. Second, high-throughput sequencing of
various G. hybrida cDNA libraries revealed four additional expressed sequence tag (EST) sequences encoding R2R3-type MYB factors (G3-17E04, G1-29D05,
G1-22G06, and G1-9F04).
As observed in BLAST searches against sequence
databases, the three cDNAs obtained from the PCR
approach shared high homology with MYB factors
known to regulate the early steps of the general
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2003 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 133, 2003
Activation of Anthocyanin Biosynthesis in Gerbera hybrida
Figure 1. Sequence analysis of the isolated G. hybrida R2R3-type MYB factors. A, Phylogenetic analysis of a selected set of
R2R3-type MYB factors from various plant species including seven cDNAs isolated from G. hybrida. Parsimony and
parsimony jacknife trees (Farris et al., 1996; see also Helariutta et al., 1996; Yu et al., 1999; Kotilainen et al., 2000) were
produced of the aligned nucleotide sequences of the R2R3 DNA-binding domains. The grouping of GMYB10 in the
single-most parsimonious tree suggests that the gene may function as an anthocyanin regulator. Previously published MYB
gene nucleotide sequences were retrieved from the EMBL or GenBank databases (snapdragon MIXTA [X79108], snapdragon
PHANTASTICA [AJ005586], Arabidopsis GL1 [M79448], Arabidopsis WEREWOLF [AF126399], Arabidopsis MYB101
[AF411970], Arabidopsis MYB113 [AY008378], Arabidopsis MYB12 [AF062864], Arabidopsis TT2 [AJ299452], Arabidopsis
PAP1 [AF325123], Arabidopsis PAP2 [AF325124], petunia AN2 [AF146702], petunia Ph.MYB3 [Z13998], pea [Pisum
sativum] MYB26 [Y11105], maize C1 [M37153], maize P [M73029], maize Pl [L19496], and maize ROUGH SHEATH2
[AF143447]). Maize snapdragon MYB305, MYB306, MYB308, MYB315, MYB330, and MYB440 nucleotide sequences were
obtained from Prof. Cathie Martin (John Innes Centre, Norwich, UK). B, Amino acid comparison of the R2 and R3
DNA-binding regions of GMYB10 with Arabidopsis PAP1, PAP2, and TT2, petunia AN2, and maize C1 and Pl show high
sequence conservation (full sequence identity marked in gray). The amino acid residues shown to be required for interaction
of the maize C1 with a bHLH cofactor R (L77, R80, R83, and L84) are marked with arrows.
phenylpropanoid pathway. However, RNA-blot
analysis showed that their expression pattern did not
correlate with distribution of anthocyanin pigmentation in various G. hybrida tissues (A. Uimari, unpublished data). From the EST sequencing project, one
clone (G3-17E04) was obtained from a cDNA library
made of Botrytis cinerea-infected floral mRNA and
three (G1-29D05, G1-22G06, and G1-9F04) from a
cDNA library covering late stages of petal development. G1-9F04 (renamed GMYB10) shared highest
homology with the AN2 gene of petunia (Fig. 1B;
Quattrocchio et al., 1993, 1999). In our previous studies, we have shown that the G. hybrida bHLH factor
GMYC1 needs a MYB counterpart to activate the
PGDFR2 when bombarded under cauliflower mosaic
virus (CaMV) 35S promoter into G. hybrida leaf tissue
(Elomaa et al., 1998). This was demonstrated using
the petunia AN2, but the corresponding G. hybrida
gene was not identified. Here, we show that activation was also observed when GMYB10 was bombarded together with GMYC1 (see below), whereas
GMYB1, GMYB8, and GMYB9a genes from G. hybrida
Plant Physiol. Vol. 133, 2003
failed to activate the reporter construct (A. Uimari,
unpublished data).
Phylogeny of the G. hybrida R2R3-Type MYB Factors
We performed phylogenetic analysis for a selected
set of R2R3-type MYB regulators from various plant
species to explore the evolutionary relationships of
the G. hybrida genes and ESTs. Nucleotide sequences
encoding the conserved R2R3 domains were aligned,
and parsimony and parsimony jackknife trees (Farris
et al., 1996) were produced (Fig. 1A). Arabidopsis
AtMYB101 was selected as an outgroup among “typical” R2R3 MYB factors after Dias et al. (2003, their
Fig. 1A). The phylogenetic positions of GMYB1,
GMYB9a, and G1-29D05 showed no supported resolution with respect to several other MYB genes; therefore, explicit predictions for their functions cannot be
provided. Nonetheless, the single-most parsimonious tree suggests that GMYB1 could be a ZmP relative, GMYB9a may be an ortholog of snapdragon
MYB306, and G1-29D05 may be an ortholog of AtTT2.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2003 American Society of Plant Biologists. All rights reserved.
1833
Elomaa et al.
The four remaining G. hybrida sequences, however,
group strongly with the functionally characterized
MYB factors. G3-17E04 groups together with snapdragon PHANTASTICA and maize ROUGH
SHEATH2, which are functional orthologs involved
in specification of lateral organ identity in proximodistal axis, in maintenance of meristem activity, and
specifically in snapdragon, in determination of dorsoventral symmetry in leaves, bracts, and petal lobes
(Waites et al., 1998; Timmermans et al., 1999; Tsiantis
et al., 1999). GMYB8 and G1-22G06 group together in
a clade with snapdragon MYB305 and MYB340 and
pea MYB26, which all share similar DNA-binding
properties and are involved in regulation of the general phenylpropanoid pathway (Moyano et al., 1996;
Uimari and Strommer, 1997). The strongly supported
phylogenetic position of GMYB10 with the previously characterized flavonoid MYBs (petunia AN2
and Arabidopsis PAP1 and PAP2) suggests that it
may have a similar function in regulating anthocyanin biosynthesis.
Sequence Properties of GMYB10
Comparison of the amino acid sequence of
GMYB10 with the petunia AN2, Arabidopsis PAP1,
PAP2, and TT2, and maize C1 and Pl shows high
sequence similarity especially in the DNA-binding
domains (R2 and R3 regions) of these proteins (Fig.
1B). The C-terminal region of GMYB10 shows very
limited sequence identity outside the R2R3 domain
except for the presence of a motif highly similar to
KPRPR(S/T)F (data not shown), which was previously reported for the subgroup of R2R3 MYBs comprising AN2, AtMYB75 (PAP1), AtMYB90 (PAP2),
and AtMYB113 (Stracke et al., 2001). Grotewold et al.
(2000) identified the key amino acid residues of
maize C1 that are required for the interaction with
the bHLH cofactor R. Modeling of the structure of the
C1 MYB domains indicate that these amino acids
(L77, R80, R83, and L84 located in the R3 repeat) are
solvent exposed and, thus, provide a surface for interaction with R (Grotewold et al., 2000). As shown in
Figure 1B, these residues are highly conserved in the
presented dicot regulators, indicating that their function may involve interaction with other cellular
factors.
Expression Pattern of GMYB10 Supports Its
Involvement in Regulation of Anthocyanin Pigmentation
Expression analysis of GMYB10 provides further
support for its role in activation of anthocyanin biosynthesis. RNA-blot analysis of the var. Regina using
a 233-bp fragment from the 3⬘ end of the GMYB10
cDNA as a probe indicates that expression of
GMYB10 is detected in leaf blade, floral scape, petals,
and petioles (Fig. 2A). In a DNA gel blot included in
the hybridization, the 233-bp probe recognized one
1834
Figure 2. Expression analysis of GMYB10. A, RNA-blot analysis
using a 233-bp 3⬘ fragment of the GMYB10 cDNA as a probe.
Expression of GMYB10 is detected in leaf blade, petals, petioles, and
flower scape; in tissues that are typically anthocyanin pigmented in
the var. Regina. The lower panel shows ethidium bromide-stained
ribosomal RNA bands for controlling the loading of the RNA gel. B,
In situ analysis of petal cross section at stage 5 indicates that
GMYB10 expression is located in epidermal cells. At this stage,
accumulation of anthocyanin pigments is more prominent in adaxial
side of the petal that is indicated by arrows. C, Sense RNA probe for
GMYB10 as a control shows no signal.
band in the var. Regina DNA digested with EcoRI or
BamHI and two bands with HindIII at the washing
stringency used for the RNA blot (data not shown).
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2003 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 133, 2003
Activation of Anthocyanin Biosynthesis in Gerbera hybrida
This suggests that the RNA blot presented in Figure
2A most probably represents the expression pattern
of a single locus and that the two bands found in the
HindIII digestion were due to restriction length polymorphism in the heterozygous cultivar as previously
found for many other G. hybrida genes (e.g. Kotilainen et al., 1999, 2000).
In Regina, petals are bright red and scapes, petioles, and leaves also contain anthocyanins, especially
under stress conditions. Under long exposure, a faint
signal was detected in carpels that are also lightly
anthocyanin pigmented in Regina and in bracts that
may contain anthocyanins (data not shown). During
petal development, the expression of GMYB10 starts
at stage 3 when no pigmentation is observed and,
thus, precedes late biosynthetic gene expression. The
expression level is highest at stage 7, when the petals
are already fully pigmented (data not shown). The
expression of late biosynthetic genes, e.g. for GDFR,
peak at this stage also (Helariutta et al., 1993). In situ
analysis of petal cross sections localizes GMYB10
expression to the epidermal cells (Fig. 2, B and C),
which is in correlation with the anthocyanin accumulation pattern.
RNA-blot analysis using the gene-specific probe of
the differentially pigmented G. hybrida varieties Nero
and Parade (for description, see Helariutta et al.,
1995) reveal similar expression patterns at the flower
organ level. As in var. Regina, GMYB10 expression is
detected in petals that do not contain anthocyanins in
var. Nero. Furthermore, no expression is seen in pappus bristles (sepals) of Nero or in stamens of Parade,
although these organs are strongly anthocyanin pigmented in these varieties (data not shown). This suggests that, in flowers, GMYB10 is required for activation of petal pigmentation but does not alone define
the final phenotype. In pappi and stamens instead,
additional factors than GMYB10 appear to be involved
in determination of the pigmentation phenotype.
Overexpression of GMYB10 in Transgenic
Tobacco and G. hybrida
For functional analysis, we transformed GMYB10
under the control of the CaMV 35S promoter into
tobacco (SR1). Four of 10 transgenic tobacco lines
overexpressing GMYB10 accumulated high levels of
anthocyanins in leaves and stems, which became evident after moving the plantlets into the greenhouse
under high-light intensity (Fig. 3A). In flowers, pigmentation of sepals, anthers, and ovary walls was
highly increased. No clear changes in petal pigmentation were observed (Fig. 3, B and C). To be able to
compare the pigmentation phenotypes, the maize Lc,
encoding a bHLH factor, was also transformed into
tobacco. In these plants, high levels of anthocyanins
accumulated in both petals and anther filaments,
giving an opposite phenotype compared with the
flowers overexpressing GMYB10 (Fig. 3C). No
Plant Physiol. Vol. 133, 2003
Figure 3. Expression of GMYB10 in transgenic tobacco under CaMV
35S promotor. A, Strong enhancement of anthocyanin pigmentation
is detected in leaves and stems of the transgenic line (left) compared
with the untransformed control plant (right). B, Transgenic tobacco
lines accumulate high levels of anthocyanins in sepals (left), but no
changes in petal pigmentation are detected. Right, Untransformed
control. C, Anthers and ovary walls of the GMYB10 overexpressing
line (left) accumulate anthocyanins. In comparison, transgenic lines
overexpressing the maize Lc encoding a bHLH factor show an opposite pattern with pigmented filaments and petal lobes (right). Center, Untransformed control.
changes in vegetative pigmentation were detected in
Lc transgenic plants. Analysis of these transgenic
plants confirms the role of GMYB10 in anthocyanin
pigmentation and demonstrates its ability to induce
pigmentation in distant plant species.
Transformation of GMYB10 under the CaMV 35S
promoter into G. hybrida resulted in formation of
strongly anthocyanin pigmented calli in pieces of
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2003 American Society of Plant Biologists. All rights reserved.
1835
Elomaa et al.
Figure 4. Transformation of GMYB10 into G.
hybrida under CaMV 35S promoter in sense and
antisense orientation. On kanamycin selection,
transgenic calli are formed at the ends of the
petioles cocultivated with A. tumefaciens. A,
Callus expressing GMYB10 in sense orientation
strongly accumulates anthocyanins. B, Callus
arising from the petioles cocultivated with the
antisense construct shows no signs of anthocyanin accumulation.
petioles that were cocultivated with Agrobacterium
tumefaciens and grown under kanamycin selection
(Fig. 4A). Using the construct with GMYB10 in antisense orientation, the resulting calli were green in
color, and no signs of anthocyanin pigmentation
were detected (Fig. 4B). The first antisense shoots
have been recovered recently, but so far, we have not
been able to regenerate shoots from the red calli
overexpressing GMYB10.
expressed in the binding domain plasmid, indicating
a positive interaction between the MYB domain proteins and GMYC1. We have shown previously that
the G. hybrida PGDFR2 is activated by GMYC1 and an
MYB counterpart (petunia AN2) in particle bombardment assays (Elomaa et al., 1998). Combinations of
GMYC1 together with petunia AN2 and GMYB10
GMYC1 and GMYB10 Interact with Each Other in Yeast
Two-Hybrid Assay
The full-length coding regions of petunia AN2,
GMYB10, and GMYC1 were cloned into yeast twohybrid vectors to study whether these proteins can
interact with each other. Using the CLONTECH
MATCHMAKER GAL4-based system (CLONTECH
Laboratories, Palo Alto, CA), we discovered that either GMYB10 or AN2, when expressed in the binding
domain plasmid, alone activated the transcription of
the LACZ reporter gene (data not shown). This indicates that both MYB proteins contain intrinsic transcriptional activation properties as has been shown
previously for these types of proteins (Paz-Ares et al.,
1987). In the GAL4 system that is based on constitutive expression of the fusion proteins, we could not
see activation of LACZ gene expression in transformants containing the MYB domain proteins (either
GMYB10 or AN2) fused with the activation domain
and with GMYC1 fused with the DNA-binding domain (data not shown). This may be due to harmful
constitutive expression of the MYB domain proteins
and consequent selection of poorly expressing lines
in yeast. Therefore, we used the MATCHMAKER
LexA system (CLONTECH), in which the expression
of the MYB/AD domain plasmids can be controlled
by induction. Figure 5 shows the quantitative results
of the Y2H analysis. Interactions of GMYB10/AD,
AN2/AD, and GMYC1/BD with the corresponding empty plasmids gave no activation of LACZ
reporter above the negative control (measured as
␤-galactosidase activity). However, both GMYB10
and AN2, expressed as activation domain fusions,
gave strong activity in combination with GMYC1
1836
Figure 5. Interaction between GMYB10, AN2, and GMYC1 proteins
in yeast two-hybrid assay (MATCHMAKER LexA system). We observed interaction between both GMYB10 and AN2 as activation
domain (AD) fusion in combination with GMYC1 in binding domain
(BD) fusion as measured in ␤-galactoside activity. For control, we
included each plasmid in combination with the corresponding empty
plasmids (pLexA and pB42). We have omitted the positive control
from the picture since it exceeds the scale.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2003 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 133, 2003
Activation of Anthocyanin Biosynthesis in Gerbera hybrida
from G. hybrida were further used to analyze of the
critical cis-elements of the target PGDFR2.
Deletion Analysis of PGDFR2 Using
Particle Bombardment
We have previously isolated a 1,195-bp promoter
fragment, PGDFR2, and have showed, using stably
transformed plants, that it is functional and contains
all essential elements needed for correct spatial and
temporal regulation of GDFR activity in G. hybrida
var. Regina (Elomaa et al., 1998). In this study, we
performed an analysis of the critical cis-elements of
the PGDFR2 by generating serial deletion constructs
starting from the 5⬘ end using either restriction enzymes or exonuclease treatment (Fig. 6A). Reporter
constructs were made by fusing the full-length promoter (1,195 bp) and each deletion version of the
PGDFR2 with the firefly luciferase (LUC) gene. Because GDFR is expressed only in the epidermal cell
layer of petal (Helariutta et al., 1993), we used the
full-length PGDFR2 (1,195 bp) fused with the RUC
(Renilla luciferase) as an internal control to be able to
optimize the bombardment conditions so as to target
primarily the epidermal cells and to get the control
signal from the same cells that express the reporter
constructs.
Each reporter construct was bombarded into petal
tissue, and luciferase activities were measured after
24 h. The activity (LUC/RUC value) of each deletion
construct was reported as a fraction (percentage) of
the activity given by the full-length promoter. Similarly, each construct was bombarded into leaves but
in combinations with known regulators: either
GMYC1 ⫹ AN2 or GMYC1 ⫹ GMYB10, which were
each co-expressed under the CaMV 35S promoter. As
PGDFR2 is not active in leaf tissue; instead of it, we
used the CaMV 35S-RUC as an internal control to
normalize the individual bombardments. We did not
observe activation of the reporter construct when the
regulators were bombarded alone (data not shown).
The results of the bombardments are summarized
in Figure 6B. Both experimental sets (petal and leaf
bombardments) show that relatively large deletions
from the 5⬘ end of the promoter can be made without
losing the reporter gene activity. Even a 276-bp fragment (from the translation start) of PGDFR2 confers
similar levels of reporter gene activity as the fulllength promoter, and a 200-bp fragment still gives
about 80% of the full-length activity in petal tissue
and 25% to 40% in leaves. Larger deletions clearly
abolish the reporter gene activities in both tissues.
Based on bombardment experiments, we conclude
that the critical region that responds to the MYB/
Figure 6. A, Schematic representation of the
PGDFR2 sequence. The deletion end points are
marked with arrows. Sequence of the 276-bp
fragment of the promoter is shown below the
graph, and the location of the putative ARE (as
defined by Lesnick and Chandler, 1998) is in
bold and underlined. B, Results of the deletion
analysis performed by particle bombardment.
Each deletion construct was bombarded into
petal tissue as such as well into leaf tissue together with the regulatory genes (GMYC1⫹
petunia AN2 or GMYC1⫹GMYB10). The results
indicate that 276 bp of the promoter still confers
almost to the same level of activation as the full
length promoter. The critical regions needed for
activation lie within 200 bp of the translation
start.
Plant Physiol. Vol. 133, 2003
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2003 American Society of Plant Biologists. All rights reserved.
1837
Elomaa et al.
MYC-mediated activation lies within the first 200 bp
of the promoter.
A Putative ARE in PGDFR2
When we compared the sequence of the ⫺200 to
⫺83 region of the PGDFR2 with the sequences of the
previously studied monocot promoters (A2, A1, and
Bz1 of maize), we identified a region with very high
sequence similarity to the putative ARE described
from maize (Tuerck and Fromm, 1994; Lesnick and
Chandler, 1998). Figure 7A shows a comparison of
both previously defined consensus sequences in
maize to the corresponding area found in PGDFR2.
The comparison indicates that 13 of 16 nucleotides in
this region are identical in PGDFR2. In G. hybrida, the
location of the region is underlined in Figure 6A.
Within the region, we identified a sequence that resembles the MYB-binding consensus site (C/TAACG/TG), although it has been shown that C1 of
maize can bind to a variety of sequences (Sainz et al.,
1997; Lesnick and Chandler, 1998). Furthermore, a
site resembling a bHLH-binding site (CANNTG) lies
after this region; however, it is in the complementary
strand (PGDFR2 “reverse” in Fig. 6A). High sequence
similarity with the previously characterized maize
anthocyanin regulatory regions suggests that a similar region may be needed for activation of anthocyanin biosynthetic genes in dicots also.
Specific Mutations to the Putative ARE
The importance of the putative ARE was tested
by mutating this region in the full-length version of
PGDFR2. With help of PCR, we changed three different regions within the consensus sequence as shown
in Figure 7A. Each construct was bombarded into
Regina petal tissue with the non-mutated full-length
PGDFR2-RUC as an internal control. Bombardment
into petals indicated that mutations at the site resembling an MYB-binding site (mb1 and mb2) and at the
regions proximal to it (mc1 and mc2) reduced reporter
gene activities to approximately 20% to 40% of the
full-length promoter. The same decrease is seen in a
construct where both sites are mutated. However, mutation in the putative bHLH motif (md) did not significantly affect reporter gene activity (Fig. 7B).
DISCUSSION
GMYB10 Encodes an R2R3 MYB Domain Protein
Involved in Anthocyanin Biosynthesis
High sequence conservation of GMYB10 with petunia AN2, Arabidopsis PAP1 and PAP2, and maize
C1 together with its phylogenetic position among the
set of R2R3-type MYB factors suggests that GMYB10
may have a role in regulating anthocyanin pigmentation in G. hybrida. In the phylogenetic tree constructed in this study, the monocot factors C1 and Pl
1838
Figure 7. A, Sequence comparison of the putative ARE found from
GDFR2 promoter with the previously characterized Tuerck and
Fromm (1994) consensus sequence and the ARE by Lesnick and
Chandler (1998) indicate high sequence similarity. We introduced
specific mutations (mb1, mb2, mc1, mc2, and md1) to the putative
ARE of GDFR2 promoter to study the role of this region in anthocyanin regulation. B, Mutated full-length PGDFR2 constructs were
bombarded into petals together with an internal control, PGDFR2RUC. Mutations in the site resembling an MYB-binding site (AGTT),
mb1 and mb2, and in a site adjacent to it, mc1 and mc2, reduced
reporter gene activation to approximately 20% to 40% of the activity
of the non-mutated full length promoter. Mutation of resembling the
bHLH binding site (CANNTG in reverse chain), md1, did not affect
the reporter gene activation.
are clustered into a different clade, whereas the (putative) dicot anthocyanin regulators (GMYB10, AN2,
PAP1, PAP2, and Atmyb113) are well supported to
be members of the another lineage. Our observation
is in concordance with the recent results reported by
Dias et al. (2003, their Fig. 1B) that suggest C1 and
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2003 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 133, 2003
Activation of Anthocyanin Biosynthesis in Gerbera hybrida
AN2 (or C1 and GMYB10) to be paralogs that have
retained similar function.
The functional role of GMYB10 in anthocyanin regulation is further supported by its expression, which is
restricted to organs that may become anthocyanin pigmented such as leaves, petals, scapes, and petioles.
Furthermore, in G. hybrida petals, expression is localized to epidermal cells in correlation with the anthocyanin accumulation pattern. Moreover, transgenic tobacco plants overexpressing GMYB10 under control of
the CaMV 35S promoter showed strongly enhanced
leaf and sepal pigmentation. The phenotypes resemble
transgenic tobacco cv xanthi expressing either Arabidopsis PAP1 or PAP2 (Borevitz et al., 2000), with the
exception that GMYB10 did not activate petal pigmentation in cv SR1. This may reflect a genetic difference
between the two cultivars of tobacco or the inability of
GMYB10 to interact with other regulatory factors
needed to activate biosynthesis. Still another possibility for the lack of tobacco petal pigmentation is the use
of the CaMV 35S promoter. Benfey and Chua (1990)
reported that the 35S promoter is not highly active in
all cells of tobacco, and especially in petals, the promoter confers expression principally in vascular tissue
and in trichomes and only weakly in epidermal tissue.
However, further studies are required to distinguish
between these possibilities.
The maize C1 cDNA did not enhance anthocyanin
pigmentation in any tissue when transformed into
tobacco cv xanthi (Lloyd et al., 1992). Neither did the
bHLH-type transcription factors DELILA from snapdragon or Lc from maize induce leaf pigmentation in
tobacco, although they increased flower pigmentation
by activation of DFR expression in petals (Mooney et
al., 1995). Together with this study, these observations
suggest that the absence of an endogenous MYB factor
in tobacco leaves and sepals limits pigment production and that maize C1 is probably too distantly related to be able to activate the tobacco promoters. It is
also possible that GMYB10 may be able to activate the
early genes of the biosynthetic pathway in tobacco
because chalcone synthase expression was not detected in tobacco leaves (Mooney et al., 1995).
In G. hybrida, overexpression of GMYB10 alone activated anthocyanin biosynthesis in callus. However,
strong accumulation of anthocyanins may interfere
with the regeneration step as also previously detected in petunia (Quattrocchio et al., 1993); so far, we
have not been able to produce pigmented transgenic
shoots. Still, the formation of purple calli in transgenic G. hybrida provides further evidence for the
functional role of GMYB10 in regulation of anthocyanin pigmentation.
that under normal greenhouse conditions are only
lightly pigmented in var. Regina. However, typically
under stress or under high light, they become purple.
In our previous studies, we have produced transgenic G. hybrida overexpressing the snapdragon
DELILA cDNA encoding a bHLH transcriptional activator (Goodrich et al., 1992). These plants showed
highly enhanced vegetative pigmentation in leaves,
petioles, and flower scapes (Elomaa and Teeri, 2001).
This indicates that activation of pigmentation in
these organs is dependent of the presence of both
MYB and bHLH domain transcription factors and
that the lack of vegetative pigmentation in G. hybrida,
in contrast to tobacco, is probably due to absence of
the bHLH counterpart. This is further supported by
our observation that in the particle bombardment
assay, GMYB10 alone cannot induce the PGDFR2LUC reporter in leaves but requires the presence of a
bHLH factor (GMYC1). The yeast two-hybrid analysis showed that GMYB10 and GMYC1 are able to
interact with each other. However, we still postulate
that in vivo, GMYC1 is probably not the correct
partner for GMYB10 in leaves because it is not expressed there, and, further, transgenic plants overexpressing GMYC1 did not show increased vegetative
pigmentation (P. Elomaa, unpublished data). Instead,
we hypothesize that in leaves, there is a different
bHLH counterpart (possibly induced under high
light/stress) for GMYB10.
In flowers, GMYB10 expression was invariably detected in petals in differentially pigmented G. hybrida
varieties (data not shown). However, our previous
studies show that the expression of GMYC1 correlates with the spatial distribution of anthocyanin pigmentation and GDFR expression in these varieties
(Elomaa et al., 1998). For example, in the var. Nero,
the absence of anthocyanin pigments correlates to the
highly reduced levels of GMYC1 expression. In light
of this knowledge, we believe that activation of G.
hybrida petal pigmentation requires the presence of
both GMYB10 and GMYC1 and that GMYC1 in particular is the key factor in defining pigmentation
patterns (e.g. in varieties with differentially pigmented petals of various flower types or with spatial
patterns within the petals). In different varieties, pappus (sepal) and stamen pigmentation may also vary.
In these organs, irrespective of their pigmentation
phenotype, we did not detect expression of GMYB10,
and the expression of GMYC1 was also faint and
invariant (Elomaa et al., 1998). Therefore, we conclude that pappus and stamen pigmentation in G.
hybrida is mediated by as-yet unidentified factors.
The Role of GMYB10 in Regulation of G. hybrida
Anthocyanin Pigmentation
Analysis of the PGDFR2 Indicates a High Level of
Conservation of Regulatory Mechanisms at the
Promoter Level
In G. hybrida, GMYB10 is expressed in vegetative
tissues (in the leaf blade, petioles, and flower scapes)
Having isolated two putative anthocyanin regulators, GMYC1 and GMYB10, acting on the late biosyn-
Plant Physiol. Vol. 133, 2003
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2003 American Society of Plant Biologists. All rights reserved.
1839
Elomaa et al.
thetic gene GDFR in G. hybrida, we wanted to define
the critical cis-acting regions of the corresponding
promoter that would be responsible for transcriptional regulation. Deletion analysis indicated that a
relatively small region of the promoter is required for
activation by GMYC1 and GMYB10, as has also been
observed in maize anthocyanin promoters (Tuerck
and Fromm, 1994; Bodeau and Walbot, 1996; Lesnick
and Chandler, 1998). A 276-bp region of the promoter
(counted from the translation start) gave almost similar levels of activation as the full-length promoter
(1,195 bp) both in petals and leaves. Within the
200-bp region of the promoter, we found a highly
conserved region that has been shown to be important in regulation of the maize anthocyanin biosynthetic genes. The putative ARE is similar to the maize
ARE as defined by Lesnick and Chandler (1998) in 13
of 16 nucleotides and contains a site resembling an
MYB-binding (C/TAACG/TG) site and a region resembling a bHLH-binding site (CANNTG). Specific
mutations in the putative MYB-binding site and in a
site just adjacent to it reduced the reporter gene
activation in petals to 20% to 40% when compared
with the non-mutated full-length promoter. However, mutation in the putative bHLH-binding site did
not have any effect. These results clearly suggest that
the ARE is needed for full activation of the late
anthocyanin genes in eudicots and monocots, indicating high conservation of the regulatory mechanisms involved in anthocyanin biosynthesis not only
at the level of regulators but also at promoter level
and over vast evolutionary time (over 125 million
years; Hughes, 1994; Sanderson and Doyle, 2001).
Still, as observed earlier in maize, our results with
transient analyses suggest that the ARE is probably
not the only region conferring DFR activation. First,
the activation is not completely abolished by the
introduced mutations, and second, if we cobombard
the mutated versions of the 276-bp promoter into leaf
together with the constitutively expressed regulators,
we observe full activity of the reporter constructs
(data not shown). This indicates that the introduced
mutations are not severe enough to abolish binding
of the regulators produced in excess, and it is also
possible that there are additional sites within the 276
bp that are responding to the regulators. The latter
conclusion is also supported by the fact that we
observe only very weak activation (hardly above
background) of the reporter construct if we place the
16-bp ARE region four times in front of the 35S
minimal promoter and bombard it into leaves together with the regulators (M. Mehto, unpublished
data). Further experiments are still needed to identify
the other regulatory regions. However, recent in vivo
studies on maize mutant lines with transposon insertions in the A1 ARE emphasize the importance of
ARE in regulation of anthocyanin biosynthetic genes.
These insertions cause striking effects on pigmentation, which is in contrast to previous transient exper1840
iments and in vitro-binding experiments in which no
single cis-element completely abolished A1 activity
when mutated (Pooma et al., 2002). The authors postulate that ARE may be recognized by other cellular
factors or, alternatively, it may participate in maintaining a particular chromatin structure required for
expressional activation (Pooma et al., 2002).
MATERIALS AND METHODS
Plant Material
Gerbera hybrida (Asteraceae) var. Terra Regina, var. Terra Nero, and var.
Terra Parade used in this research were obtained from Terra Nigra B.V. (De
Kwakel, The Netherlands) and grown under standard greenhouse conditions. Developmental stages of the inflorescence are described by Helariutta
et al. (1993) and anthocyanin accumulation patterns of different varieties are
in Helariutta et al. (1995).
Isolation of G. hybrida MYB Factors
We used degenerate primers to amplify MYB domain transcription factors from G. hybrida petal cDNA as reported by Uimari and Strommer
(1997). For PCR, total RNA was isolated using Trizol reagent (Life
Technologies/Gibco-BRL, Cleveland) and mRNA using the PolyATract kit
(Promega, Madison, WI). Three different cDNA fragments (GMYB1,
GMYB8, and GMYB9a) were obtained and amplified as full length using the
5⬘-/3⬘-RACE kit of Roche (Mannheim, Germany). Four R2R3 MYB domain
cDNAs were obtained by EST sequencing the G. hybrida cDNA libraries (M.
Kotilainen and S. Koskela, unpublished data). The cDNAs were chosen for
further analysis based on BLAST search on sequence databases. Accession
numbers for the seven isolated MYB factors are as follows: AJ554697
(GMYB1), AJ554698 (GMYB8), AJ554699 (GMYB9a), AJ554700 (GMYB10),
AJ554701 (G1-29D05), AJ554702 (G1-22G06), and AJ554703 (G3-17E04).
RNA-Blot and in Situ Analysis
For RNA-blot analysis, total RNA was isolated using Trizol reagent (Life
Technologies/Gibco-BRL) from various plant tissues according to the manufacturer’s instructions. Ten micrograms of total RNA was loaded on each
lane, and the ethidium bromide-stained ribosomal bands were used as
standards for equal loading. RNA blots were hybridized using 32P-labeled
probes according to standard protocols (Sambrook et al., 1989). For a genespecific probe, a 233-bp fragment from the 3⬘ end of cDNA was used
(digested with BstX1 and KpnI from the plasmid pGMYB10). The genespecific blots were washed using 0.5⫻ SSC (75 mm NaCl and 7.5 mm
Na3citrate, pH 7.0) and 0.1% (w/v) SDS at 58°C.
For in situ probes, the full-length GMYB10 cDNA was cloned into pBluescript II SK or KS⫹ (Stratagene, La Jolla, CA) in sense and antisense orientations under T7 promoter. Sense and antisense RNA probes were synthesized using T7 polymerase and labeled using the DIG RNA Labeling Kit
(Roche) according to the manufacturer’s instructions. The probe was hydrolyzed chemically in alkaline carbonate buffer to reduce the size, and an
additional ethanol precipitation step was included. Petal samples were
collected from stage 5 (Helariutta et al., 1993), fixed in 50% [v/v] ethanol, 5%
[v/v] acetic acid, and 3.7% [v/v] formaldehyde, dehydrated using ethanol
series, cleared in xylene or Histochoice (Amresco, Solon, Ohio), and finally
embedded in Tissue-tek embedding wax (Sakura, Zoeterwoute, The Netherlands). Seven- to 10-␮m cross sections of the petals were cut using a
microtome and placed on Superfrost plus slides (N: Menzel-Gläser, Braunschweig, Germany). Nonradioactive hybridizations were done essentially as
in Di Laurenzio et al. (1996) except that Proteinase K concentration was 10
mg L⫺1. After detection of the signal, sections were mounted in 50% (v/v)
glycerol.
Plant Transformation
Full-length GMYB10 was cloned under the CaMV 35S promoter in a
plasmid pHTT602 (Elomaa and Teeri, 2001) and conjugated into Agrobacte-
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2003 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 133, 2003
Activation of Anthocyanin Biosynthesis in Gerbera hybrida
rium tumefaciens strain C58C1 (van Larebeke et al., 1974) harboring pGV2260
(Deblaere et al., 1985) using triparental mating (van Haute et al., 1983).
Tobacco (Nicotiana tabacum) SR1 leaf explants were transformed as described
by Horsch et al. (1985) except that we did not use any feeder cells. The
tobacco plantlets were rooted in the presence of 100 mg L⫺1 kanamycin, and
the integration of the transgene was verified using PCR. G. hybrida transformation was done as reported by Elomaa and Teeri (2001).
Yeast (Saccharomyces cerevisiae) Two-Hybrid Analysis
Yeast two-hybrid analysis was performed using the MATCHMAKER
LexA two-hybrid system (CLONTECH) as described by Kotilainen et al.
(2000). The full coding sequences of GMYC1, GMYB10, and petunia (Petunia
hybrida) AN2 were amplified by PCR and cloned into the yeast vectors.
␤-Galactosidase activity was measured using o-nitrophenyl ␤-dgalactopyranoside as substrate for seven to eight individual transformants
for each interaction combination according to the manufacturer’s protocol.
Construction of Serial Deletions and Mutated
Versions of the PGDFR2
The deletion constructs of the PGDFR2 were done either by PCR, restriction enzyme digestions, or exonuclease treatment using standard protocols
and cloned in front of the firefly LUC gene encoding luciferase (Ow et al.,
1986). In front of the LUC gene, the tobacco mosaic virus leader ⍀ was used
as a translational enhancer (Gallie et al., 1987). All constructs were verified
by sequencing. D-485 was amplified from the full-length PGDFR2 using
primers 5⬘GAAGGTACCACATGTATGTATACTCAG3⬘ and 5⬘GTCCTGCAGGTTTTATTTGGTGGGTATTA3⬘. D-349 was done by deleting a KpnI ⫹
BstXI fragment of the full-length PGDFR2-LUC construct. D-276, D-200, and
D-83 were obtained by exonuclease treatment of D-349 plasmid, and the
deletion endpoints were verified by sequencing. D-169 was amplified using
primers 5⬘CAGACAAGCTTCACCCGATTCCCTCTTC 3⬘ and 5⬘GTCCTGCAGGTTTTATTTGGTGGGTATTA3⬘. Specific mutations were introduced
to the putative ARE by PCR. The mutations were designed into a primer
containing the PmaCI site, and another primer contained the BstXI site. This
fragment was replaced in the full-length PGDFR2 by the amplified mutated
fragment and verified by sequencing. The mutations were further introduced to the D-276 versions by replacing a XcaI ⫹ ClaI fragment of the
constructs.
Transient Expression Analysis
For particle bombardment, Bio-Rad PDS-1000/He equipment (Bio-Rad
Laboratories, Hercules, CA) was used. The conditions for gold particle
preparation and bombardment were as previously reported (Elomaa et al.,
1998). The plant material for petal bombardments was taken from flowering
plants (var. Regina) from standard greenhouse conditions. For petal bombardments, the developmental stage 7 was used (Helariutta et al., 1993).
Leaf material was obtained from in vitro plantlets. At minimum, five petals
or leaves were bombarded with each construct. Firefly luciferase and Renilla
luciferase activities were measured with the Promega Dual Luciferase kit
with modifications reported earlier (Elomaa et al., 1998). LUC/RUC values
were calculated to normalize the bombardment conditions.
ACKNOWLEDGMENTS
We thank Dr. Francesca Quattrocchio for the petunia AN2 plasmid and
Prof. Susan Wessler for the maize Lc cDNA. Prof. Cathie Martin is thanked
for providing sequence data for the phylogenetic analysis. We also thank Dr.
James S. Farris for permission to use the XAC parsimony jackknifing application. Eija Takala and Anu Rokkanen are thanked for their excellent
technical assistance throughout the project and Sanna Peltola for taking care
of the plants in the greenhouse. V.A.A. acknowledges support from US
National Science Foundation grant DBI-0115684.
Received April 26, 2003; returned for revision May 20, 2003; accepted
September 7, 2003.
Plant Physiol. Vol. 133, 2003
LITERATURE CITED
Benfey PN, Chua N-H (1990) The cauliflower mosaic virus 35S promoter:
combinatorial regulation of transcription in plants. Science 250: 959–966
Bodeau JP, Walbot V (1996) Structure and regulation of the maize Bronze2
promoter. Plant Mol Biol 32: 599–609
Borevitz JO, Xia Y, Blount J, Dixon RA, Lamb C (2000) Activation tagging
identifies a conserved MYB regulator of phenylpropanoid biosynthesis.
Plant Cell 12: 2383–2393
Bradley JM, Davies KM, Delores SC, Bloor SJ, Lewis DH (1998) The maize
Lc regulatory gene up-regulates the flavonoid biosynthetic pathway of
Petunia. Plant J 13: 381–392
Cone KC, Cocciolone SM, Burr FA, Burr B (1993) Maize anthocyanin
regulatory gene Pl is a duplicate of C1 that functions in the plant. Plant
Cell 5: 1795–1805
Deblaere R, Bytebier B, De Greve H, Deboeck F, Schell J, Van Montagu M,
Leemans J (1985) Efficient octopine Ti plasmid-derived vectors for
Agrobacterium-mediated gene transfer to plants. Nucleic Acids Res 13:
4777–4788
deVetten N, Quattrocchio F, Mol J, Koes R (1997) The an11 locus controlling flower pigmentation in petunia encodes a novel WD-repeat protein
conserved in yeast, plants, and animals. Genes Dev 11: 1422–1434
Dias AP, Braun EL, McMullen MD, Grotewold E (2003) Recently duplicated maize R2R3 myb genes provide evidence for distinct mechanisms of
evolutionary divergence after duplication. Plant Physiol 131: 610–620
Di Laurenzio L, Wysocka-Diller J, Malamy JE, Pysh L, Helariutta Y,
Freshour G, Hahn MG, Feldmann KA, Benfey PN (1996) The SCARECROW gene regulates an asymmetric cell division that is essential for
generating the radial organization of the Arabidopsis root. Cell 86:
423–433
Elomaa P, Mehto M, Kotilainen M, Helariutta Y, Nevalainen L, Teeri TH
(1998) A bHLH transcription factor mediates organ, region and flower
type specific signals on dihydroflavonol-4-reductase (dfr) gene expression in the inflorescence of Gerbera hybrida (Asteraceae). Plant J 16: 93–99
Elomaa P, Teeri TH (2001) Transgenic Gerbera. In YPS Bajaj, ed, Biotechnology in Agriculture and Forestry, Transgenic Crops III, Vol 48. SpringerVerlag, Berlin, pp 139–154
Farris JS, Albert VA, Källersjö M, Lipscomb D, Kluge AG (1996) Parsimony jackknifing outperforms neighbor joining. Cladistics 12: 99–124
Gallie DR, Sleat DE, Watts JW, Turner PC, Wilson TMA (1987) The
5⬘-leader sequence of tobacco mosaic virus RNA enhances the expression
of foreign gene transcripts in vitro and in vivo. Nucleic Acids Res 15:
3257–3273
Goff SA, Cone KC, Chandler VL (1992) Functional analysis of the transcriptional activator encoded by the maize B gene: evidence for a direct
functional interaction between two classes of regulatory proteins. Genes
Dev 6: 864–875
Goodrich J, Carpenter R, Coen ES (1992) A common gene regulates pigmentation pattern in diverse plant species. Cell 68: 955–964
Grotewold E, Drummond BJ, Bowen B, Peterson T (1994) The mybhomologous P gene controls phlobaphene pigmentation in maize floral
organs by directly activating a flavonoid biosynthetic gene subset. Cell
76: 543–553
Grotewold E, Sainz MB, Tagliani L, Hernandez JM, Bowen B, Chandler
VL (2000) Identification of the residues in the Myb domain of maize C1
that specify the interaction with the bHLH cofactor R. Proc Natl Acad Sci
USA 97: 13579–13584
Helariutta Y, Elomaa P, Kotilainen M, Seppänen P, Teeri TH (1993)
Cloning of cDNA coding for dihydroflavonol-4-reductase (DFR) and
characterization of dfr expression in the corollas of Gerbera hybrida var.
Regina (Compositae). Plant Mol Biol 22: 183–193
Helariutta Y, Kotilainen M, Elomaa P, Teeri TH (1995) Gerbera hybrida
(Asteraceae) imposes regulation at several anatomical levels during inflorescence development on the gene for dihydroflavonol-4-reductase.
Plant Mol Biol 28: 935–941
Helariutta Y, Kotilainen M, Elomaa P, Kalkkinen N, Bremer K, Teeri TH,
Albert VA (1996) Duplication and functional divergence in the chalcone
synthase gene family of Asteraceae: Evolution with substrate change and
catalytic simplification. Proc Natl Acad Sci USA 93: 9033–9038
Horsch RB, Fry JE, Hoffmann NL, Eichholtz D, Rogers SG, Fraley RT
(1985) A simple and general method for transferring genes into plants.
Science 227: 1229–1231
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2003 American Society of Plant Biologists. All rights reserved.
1841
Elomaa et al.
Hughes NF (1994) The enigma of angiosperm origins. Cambridge University Press, Cambridge, UK
Kotilainen M, Elomaa P, Uimari A, Albert VA, Yu D, Teeri TH (2000)
GRCD1, an AGL2-like MADS box gene, participates in the C function
during stamen development in Gerbera hybrida. Plant Cell 12: 1893–1902
Kotilainen M, Helariutta Y, Mehto M, Pöllönen E, Albert VA, Elomaa P,
Teeri TH (1999) GEG participates in the regulation of cell and organ
shape during corolla and carpel development in Gerbera hybrida. Plant
Cell 11: 1093–1104
Kranz HD, Denekamp M, Greco R, Jin H, Leyva A, Meissner RC, Petroni
K, Urzainqui A, Bevan M, Martin C et al. (1998) Towards functional
characterization of the members of the R2R3-MYB gene family from
Arabidopsis thaliana. Plant J 16: 263–276
Lesnick ML, Chandler VL (1998) Activation of the maize anthocyanin gene
a2 is mediated by an element conserved in many anthocyanin promoters.
Plant Physiol 117: 437–445
Lloyd AM, Walbot V, Davis RW (1992) Arabidopsis and Nicotiana anthocyanin production activated by maize regulators R and C1. Science 258:
1773–1775
Ludwig SR, Habera LF, Dellaporta SL, Wessler SR (1989) Lc, a member of
the maize R gene family responsible for tissue-specific anthocyanin production, encodes a protein similar to transcriptional activators and contains the myc-homology region. Proc Natl Acad Sci USA 86: 7092–7096
Martin C, Paz-Ares J (1997) MYB transcription factors in plants. TIG 13:
67–73
Meissner RC, Jin H, Cominelli E, Denekamp M, Fuertes A, Greco R, Kranz
HD, Penfield S, Petroni K, Urzainqui A et al. (1999) Function search in
a large transcription factor gene family in Arabidopsis: assessing the
potential of reverse genetics to identify insertional mutations in R2R3
MYB genes. Plant Cell 11: 1827–1840
Mol J, Grotewold E, Koes R (1998) How genes paint flowers and seeds.
Trends Plant Sci 3: 212–217
Mooney M, Desnos T, Harrison K, Jones J, Carpenter R, Coen E (1995)
Altered regulation of tomato and tobacco pigmentation genes caused by
the delila gene of Antirrhinum. Plant J 7: 333–339
Moyano E, Martinez-Garcia JF, Martin C (1996) Apparent redundancy in
myb gene function provides gearing for the control of flavonoid biosynthesis in Antirrhinum flowers. Plant Cell 8: 1519–1532
Nesi N, Debeaujon I, Jond C, Pelletier G, Caboche M, Lepiniec L (2000)
The TT8 gene encodes a basic helix-loop-helix domain protein required
for expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell
12: 1863–1878
Nesi N, Jond C, Debeaujon I, Caboche M, Lepiniec L (2001) The Arabidopsis
TT2 gene encodes an R2R3 MYB domain protein that acts as a key
determinant for proanthocyanidin accumulation in developing seed.
Plant Cell 13: 2099–2114
Ow DW, Wood KV, DeLuca M, De Wet JR, Helinski DR, Howell SH
(1986) Transient and stable expression of the firefly luciferase gene in
plant cells and transgenic plants. Science 234: 856–859
Paz-Ares J, Ghosal D, Wienand U, Peterson PA, Saedler H (1987) The
regulatory C1 locus of Zea mays encodes a protein with homology to myb
proto-oncogene products and with structural similarities to transcriptional activators. EMBO J 6: 3553–3558
Pooma W, Gersos C, Grotewold E (2002) Transposon insertions in the
promoter of the Zea mays a1 gene differentially affect transcription by the
Myb factors P and C1. Genetics 161: 793–801
Quattrocchio F, Wing JF, Leppen HTC, Mol JNM, Koes RE (1993) Regulatory genes controlling anthocyanin pigmentation are functionally con-
1842
served among plant species and have distinct set of target genes. Plant
Cell 5: 1497–1512
Quattrocchio F, Wing JF, van der Woute K, Mol JNM, Koes R (1998)
Analysis of bHLH and MYB domain proteins: species-specific regulatory
differences are caused by divergent evolution of target anthocyanin
genes. Plant J 13: 475–488
Quattrocchio F, Wing J, van der Woute K, Souer E, de Vetten N, Mol J,
Koes R (1999) Molecular analysis of the anthocyanin2 gene of petunia and
its role in the evolution of flower color. Plant Cell 11: 1433–1444
Sainz MB, Grotewold E, Chandler VL (1997) Evidence for direct activation
of an anthocyanin promoter by the maize C1 protein and comparison of
DNA binding by related myb domain proteins. Plant Cell 9: 611–625
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
Sanderson MJ, Doyle JA (2001) Sources of error and confidence intervals in
estimating the age of angiosperms from rbcL and 18S rDNA data. Am J
Bot 88: 1499–1516
Spelt C, Quattrocchio F, Mol JNM, Koes R (2000) anthocyanin1 of petunia
encodes a basic helix-loop-helix protein that directly activates transcription of structural anthocyanin genes. Plant Cell 12: 1619–1631
Spelt C, Quattrocchio F, Mol JNM, Koes R (2002) ANTHOCYANIN1 of
petunia controls pigment synthesis, vacuolar pH, and seed coat development by genetically distinct mechanisms. Plant Cell 14: 2121–2135
Stracke R, Werber M, Weisshaar B (2001) The R2R3-MYB gene family in
Arabidopsis thaliana. Curr Opin Plant Biol 4: 447–456
Timmermans MCP, Hudson A, Becraft PW, Nelson T (1999) ROUGH
SHEATH2: a myb protein that represses knox homeobox genes in maize
lateral organ primordia. Science 284: 151–153
Tsiantis M, Schneeberger R, Golz JF, Freeling M, Langdale JA (1999) The
maize rough sheath2 gene and leaf development programs in monocot and
dicot plants. Science 284: 154–156
Tuerck JA, Fromm ME (1994) Elements of the maize A1 promoter required
for transactivation by the anthocyanin B/C1 or phlobaphene P regulatory
genes. Plant Cell 6: 1655–1663
Uimari A, Strommer J (1997) Myb26: a MYB-like protein of pea flowers with
affinity for promoters of phenylpropanoid genes. Plant J 12: 1273–1284
van Haute E, Joos H, Maes M, Warren G, van Montagu M, Schell J (1983)
Intergeneric transfer and exchange recombination of restriction fragments cloned in pBR322: a novel strategy for the reversed genetics of the
Ti plasmids of Agrobacterium tumefaciens. EMBO J 2: 411–417
van Larebeke N, Engler G, Holsters M, van der Esacker S, Schilperoort
RA, Schell J (1974) Large plasmid in Agrobacterium tumefaciens essential
for crown gall-inducing ability. Nature 252: 169–170
Waites R, Selvadurai HRN, Oliver IR, Hudson A (1998) The PHANTASTICA gene encodes a MYB transcription factor involved in growth and
dorsoventrality of lateral organs in Antirrhinum. Cell 93: 779–789
Walker AR, Davison PA, Bolognesi-Winfield AC, James CM, Srinivasan
N, Blundell TL, Esch JJ, Marks MD, Grey JC (1999) The TRANSPARENT
TESTA GLABRA1 locus, which regulates trichome differentiation and
anthocyanin biosynthesis in Arabidopsis, encodes a WD40 repeat protein. Plant Cell 11: 1337–1349
Winkel-Shirley B (2001) It takes a garden. How work on diverse plant
species has contributed to an understanding of flavonoid metabolism.
Plant Physiol 127: 1399–1404
Yu D, Kotilainen M, Pöllänen E, Mehto M, Elomaa P, Helariutta Y, Albert
VA, Teeri TH (1999) Organ identity genes and modified patterns of
flower development in Gerbera hybrida (Asteraceae). Plant J 17: 51–62
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2003 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 133, 2003