c Indian Academy of Sciences
RESEARCH NOTE
Identification of a novel SHOX mutation in a Chinese family
with isolated Madelung deformity
LIBIN MEI, YANRU HUANG, QIAN PAN, HAOXIAN LI, DESHENG LIANG and LINGQIAN WU∗
State Key Laboratory of Medical Genetics, Central South University, Changsha, Hunan 410078, People’s Republic of China
[Mei L., Huang Y., Pan Q., Li H., Liang D. and Wu L. 2014 Identification of a novel SHOX mutation in a Chinese family with isolated
Madelung deformity. J. Genet. 93, 809–812]
Introduction
Madelung deformity is a pseudoautosomal dominant hereditary disorder characterized by the lateral and dorsal curvature
of the distal radius, positive ulnar variance and proximal
subsidence of the lunate (Anton et al. 1938; Arora and
Chung 2006). It is frequently associated with Léri–Weill
dyschondrosteosis (LWD) (Leri and Weill 1929), which is
characterized by disproportionate short stature attributable to
mesomelic shortening of the limbs. The Madelung deformity
is a typical characteristic of LWD (Langer 1965; Herdman
et al. 1966); however, the presence of the forearm deformity
without any other clinical characteristics of dyschondrosteosis supports the diagnosis of isolated Madelung deformity (IMD). Individuals with IMD have normal height and
body proportions, and the forearm anomaly is typically
bilateral and symmetrical. IMD is progressive, is usually
observed in adolescence, and occurs more commonly in
females than males (Lichtenstein et al. 1980; Grigelioniene
et al. 2001). IMD is caused by mutations of the short stature
homeobox gene (SHOX, OMIM: 312865) (Ellison et al.
1997; Rao et al. 1997). In addition, mutations in the GNAS
gene have also been reported to cause IMD (Rump et al.
2011). In this study, the clinical and radiographic features of a
Chinese family with IMD is described. Mutation analysis of
the SHOX gene indicated that a novel heterozygous deletion
mutation of SHOX was responsible for the IMD disease in
this family.
Materials and methods
Patients
The IMD family studied here is from the southern Chinese
city of Hangzhou and comprized three generations with three
∗ For correspondence. E-mail: [email protected].
affected members (figure 1a). The proband (III 2) was a
29-year-old female who was 157 cm in height and 45 kg
in weight. She developed bilateral wrist joint pain when she
was 13 years old. At the age of 14, she gradually exhibited symptoms of ulnar and palmar curvature of the distal
radius and a mild limitation of abduction of the wrist joint,
and at this point she was diagnosed with Madelung deformity. Both the proband’s sister (III 1) and father (II 1) were
also patients; her sister was 155 cm in height and presented
with similar clinical manifestations but also exhibited moderately short limbs, while her father was 165 cm in height and
showed relatively mild symptoms of Madelung deformity.
All three affected members showed normal stature and body
proportions (table 1). This study complied completely with
the Tenets of the Declaration of Helsinki, and was approved
by the Ethics Board of the State Key Laboratory of Medical Genetics of China. Informed consent was received by all
members of the family before testing.
Mutation analysis by direct sequencing
Genomic DNA was isolated from the peripheral blood using
standard extraction methods. The entire coding region and
the intron–exon boundaries of the SHOX gene were amplified
by the polymerase chain reaction (PCR). The PCR primers
were designed using Primer5 software (Primer Biosoft International, Vancover, Canada) (table 2). The PCR products
were confirmed by polyacrylamide gel electrophoresis
(PAGE), and directly sequenced using an ABI PRISM
BigDye kit on an ABI3130 DNA sequencer (Applied Biosystems, Carlsbad, USA). Sequences were analysed using
the DNASTAR (Madison, USA) software. The genomic
sequence of the SHOX gene (NM_000451.3) was used as
reference sequence.
The same experiment was carried out on five unaffected
individuals of the family and 200 unrelated normal controls (including 118 males and 82 females aged 12–70 years,
Keywords. isolated Madelung deformity; SHOX gene; c.21delT; mutation analysis.
Journal of Genetics, Vol. 93, No. 3, December 2014
809
Libin Mei et al.
Figure 1. (a) Pedigree of the Chinese family with IMD. The filled symbols indicate individuals affected with
IMD. Proband is marked by an arrow. (b) Photographs showing the IMD phenotypic characteristics of the proband.
(c) Radiograph of the forearm(s) of the proband.
with an average age of 30 years) to determine whether the
detected gene variation was a causative mutation or a genetic
polymorphism.
Mutation screening
Direct sequencing of the PCR products amplified from
genomic DNA from the proband (III 2) revealed a singlebase deletion at nucleotide 21 (c.21delT) of the SHOX gene
(figure 2a). This sequence change is predicted to result
in a frameshift at codon 7 with substitution of a leucine
for a phenylalanine and introduction of a putative stop
codon 69 amino acids downstream in the translated protein
(p.Phe7LeufsX69) (figure 2d). Thus, the mutation results in
truncation of 217 N-terminal amino acids of the gene product (74% of the polypeptide), including the homeodomain
(figure 2c). The proband’s father (II 1) and sister (III 1) were
found to be heterozygous for this mutation, which was not
found in the five unaffected pedigree members (I 2, II 2, II 3,
II 4, II 5; figure 2b), indicating that the mutation cosegregates
with IMD in the family. We also investigated this mutation
Results
Clinical findings
Photographs of the proband’s forearm showed a prominence
of the head of the ulna at the back of the wrist and an ulnar
deviation of the hand (figure 1b). An anteroposterior X-ray
of the wrist and carpus showed a ‘triangular’ arrangement of
the carpal bones, ulnar tilt, lunate subsidence and rarefaction
of the medial border of the lower end of the radius. A lateral
X-ray of the wrist exhibited an anterior curve of the radius
and a backward luxation of the head of the ulna (figure 1c).
Table 1. Summary of clinical features of some affected and healthy members.
Gender
Age at test
(years)
Height
(cm)
Madelung deformity
Short limbs
Body proportion
Mutation
M
F
F
58
31
29
165
155
157
Mild
Obvious
Obvious
NA
Mild
NA
Normal
Normal
Normal
c.21delT
c.21delT
c.21delT
Healthy members
I2
F
II 2
F
II 3
M
II 4
F
II 5
F
75
57
56
53
50
155
168
172
160
157
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
Normal
Normal
Normal
Normal
Normal
NA
NA
NA
NA
NA
ID
Patients
II 1
III 1
III 2
M, male; F, female; NA, not available.
810
Journal of Genetics, Vol. 93, No. 3, December 2014
Novel SHOX mutation in Chinese IMD family
Table 2. Primers and PCR conditions used to amplify the genomic segments of SHOX.
Primer
Forward primer (5 –3 )
Reverse primer (5 –3 )
SHOX-2
SHOX-3
SHOX-4-5
SHOX-6
GAGGTCGCCGCGTATAAATAGT
GAAAGCAGCGAGTATCCTCCTC
CATCAGTCACCTCCCAGCTCC
GAAGGAGGAAAGGCGGGTGT
TCGGGTCCACTCCTGCCTT
CGCAATGAACCCATCCTACAG
GATGCGGCAGCAAATAGGG
TCAGGCCTCTTGCAGGAGCT
Annealing temperature (◦ C)
Product size (bp)
61
60
59
60
603
574
470
549
Figure 2. Genetic characterization of the IMD family. (a) Sequencing in proband (III 2) show a novel deletion mutation
(c.21delT) in SHOX. (b) Sequence in an unaffected female member (II 4) in the family. (c) Relative position of mutation
in SHOX. (d) Evolutionary conservation of amino acids: box showing loss of the conserved phenylalanine residue and
truncation of protein in the patient.
in 200 healthy controls by direct sequencing, and found that
this mutation did not exist in any of the 200 unrelated normal
controls. Until now, this variant has not been reported in the
Exome Variant Server, dbSNP135 or 1000 Genome datasets.
These results confirm that the c.21delT mutation in SHOX is
responsible for IMD in this family.
Discussion
Madelung deformity, a rare congenital anomaly of the wrist,
is associated with a SHOX gene defect (Shears et al. 1998;
Clement-Jones et al. 2000). The SHOX gene, which spans
more than 35 kb of genomic DNA and contains six exons,
is located within the pseudoautosomal region (PAR1) of the
X and Y chromosomes (Rao et al. 1997). SHOX encodes a
paired related homeodomain transcription factor, which consists of a homeodomain and a C-terminal OAR (otp aristaless rax) domain. SHOX is mainly expressed in human limb
and pharyngeal arches, with the strongest expression in the
elbow, the distal ulna/radius and the wrist (Rao et al. 1997;
Clement-Jones et al. 2000; Blaschke et al. 2003). A study by
Clement-Jones et al. (2000) indicated that the homeodomain
proteins play critical roles in controlling the embryonic
development in vertebrates, suggesting that mutations to the
SHOX gene may lead to developmental abnormalities.
In this study, we analysed a Chinese family diagnosed with
IMD, which is defined as the presence of the bilateral wrist
deformity without short stature and body disproportion. Phenotypic heterogeneity and intrafamilial variability are regularly observed in patients with SHOX deficiency, and the clinical symptoms of IMD become more apparent with age and
are more severe in females (Schiller et al. 2000; Blaschke
et al. 2003). These conditions were also observed in the
family under study, as three patients developed Madelung
deformity at the onset of puberty and the sisters (III 1 and
III 2) exhibited more severe wrist deformities than their
father (II 1). This demonstrates the necessity of early molecular diagnosis of every member of a family in which IMD is
suspected to provide guidance and early treatment opportunities for patients so as to reduce the harmful effects of skeletal
deformities.
In this study, a single-base deletion mutation (c.21delT) in
the SHOX gene was identified. This mutation cosegregated
with the disease phenotype and was not found in the healthy
Journal of Genetics, Vol. 93, No. 3, December 2014
811
Libin Mei et al.
members of the family or in 200 unrelated control individuals, indicating that the c.21delT mutation of SHOX
is a pathogenic mutation of IMD in the family. Munns
et al. (2003) concluded that SHOX haploinsufficiency leads
to short arms in 92%, bilateral Madelung deformity in
73% and short stature in 54%. SHOX haploinsufficiency
caused by nucleotide deletions has been frequently reported
in dyschondrosteosis individuals, but point mutations are
relatively rare (Shears et al. 1998; Schiller et al. 2000).
Previous studies of LWD families have reported two deletion mutations causing a truncation of the SHOX protein
before the start of the homeodomain: a single-base deletion
(c.272delG) and a two-base pair deletion (c.106–107delCG),
both led to a frameshift and premature translational termination at codons 75 and 77, respectively (Grigelioniene
et al. 2000; Huber et al. 2001). Likewise, the single-base
deletion mutation (c.21delT) identified in this study occurs in
the highly conserved domain and leads to a premature stop
codon 69 amino acids downstream. The resulting premature
termination of translation is expected to yield a nonfunctional protein lacking the homeodomain, leading to SHOX
haploinsufficiency and the disease phenotype. This finding
supports the view that SHOX haploinsufficiency is the most
frequent disease-causing mechanism in dyschondrosteosis
(Grigelioniene et al. 2001; Flanagan et al. 2002).
In conclusion, we have identified a novel heterozygous
deletion mutation in the SHOX gene of an IMD family. This
discovery will help provide the patients’ offspring with accurate and reliable genetic counselling and prenatal diagnosis. Further, our findings broaden the mutation spectrum of
SHOX and understanding of the diverse and variable effects
of SHOX mutations.
Acknowledgements
Authors thank the family members who participated in this study
for their help and support. This study was supported by the research
grant (no. 2012CB944601) from the National Basic Research Programme of China.
References
Anton J. I., Reitz G. B. and Spiegel M. B. 1938 Madelung’s
deformity. Ann. Surg. 108, 411–439.
Arora A. S. and Chung K. C. 2006 Otto W. Madelung and the
recognition of Madelung’s deformity. J. Hand. Surg. 31, 177–
182.
Blaschke R. J., Töpfer C., Marchini A., Steinbeisser H., Janssen
J. W., Rappold G. A. et al. 2003 Transcriptional and translational
regulation of the Leri-Weill and Turner syndrome homeobox
gene SHOX. J. Biol. Chem. 278, 47820–47826.
Clement-Jones M., Schiller S., Paw E., Blaschke R. J., Zuniga A.,
Zeller R. et al. 2000 The short stature homeobox gene SHOX
is involved in skeletal abnormalities in Turner syndrome. Hum.
Mol. Genet. 9, 695–702.
Ellison J. W., Wardak Z., Young M. F., Gehron Robey P., LaigWebster M. and Chiong W. 1997 PHOG, a candidate gene for
involvement in the short stature of Turner syndrome. Hum. Mol.
Genet. 6, 1341–1347.
Flanagan S. F., Munns C. F., Hayes M., Williams B., Berry M.,
Vickers D. et al. 2002 Prevalence of mutations in the short stature
homeobox containing gene (SHOX) in Madelung deformity of
childhood. J. Med. Genet. 39, 758–763.
Grigelioniene G., Eklöf O., Ivarsson S. A., Westphal O., Neumeyer
L., Kedra D. et al. 2000 Mutations in short stature homeobox containing gene (SHOX) in dyschondrosteosis but not in
hypochondroplasia. Hum. Genet. 107, 145–149.
Grigelioniene G., Schoumans J., Neumeyer L., Ivarsson A., Eklöf
O., Enkvist O. et al. 2001 Analysis of short stature homeoboxcontaining gene (SHOX) and auxological phenotype in dyschondrosteosis and isolated Madelung deformity. J. Hum. Genet. 109,
551–558.
Herdman R. C., Langer L. O. and Good R. A 1966 Dyschondrosteosis, the most common cause of Madelung’s deformity. J.
Pediatr. 68, 432–441.
Huber C., Cusin V., Le Merrer M., Mathieu M., Sulmont V.,
Dagoneau N. et al. 2001 SHOX point mutations in dyschondrosteosis. J. Med. Genet. 38, 323.
Langer L. 1965 Dyschondrosteosis,a hereditable bone dysplasia
with characteristic roentographic features. Am. J. Roentgenol. 95,
178–188.
Leri A. and Weill J. 1929 Une affection congenitale et symetrique
du development osseux :la dyschondrosteoste. Bull. Mem. Soc.
Med. Hop. Paris 53, 1491–1494.
Lichtenstein J. R., Sundaram M. and Burdge R. 1980 Sexinfluenced expression of Madelung’s deformity in a family of
dyschondrosteosis. J. Med. Genet. 17, 41–43.
Munns C. F., Glass I. A., Flanagan S., Hayes M., Williams B., Berry
M. et al. 2003 Familial growth and skeletal features associated
with SHOX haploinsufficiency. J. Pediatr. Endocrinol. Metab.
16, 987–996.
Rao E., Weiss B., Fukami M., Rump A., Niesler B., Mertz A. et al.
1997 Pseudoautosomal deletions encompassing a novel homeobox gene cause growth failure in idiopathic short stature and
Turner syndrome. Nat. Genet. 16, 54–63.
Rump P., Jongbloed J. D., Sikkema-Raddatz B., Mundlos S.,
Klopocki E. and van der Luijt R. B. 2011 Madelung deformity in
a girl with a novel and de novo mutation in the GNAS gene. Am.
J. Med. Genet. A. 155, 2566–2570.
Schiller S., Spranger S., Schechinger B., Fukami M., Merker
S., Drop S. L. et al. 2000 Phenotypic variation and genetic
heterogeneity in Leri-Weill syndrome. Eur. J. Hum. Genet. 8, 54–62.
Shears D. J., Vassal H. J., Goodman F. R., Palmer R. W., Reardon
W., Superti-Furga A. et al. 1998 Mutation and deletion of the
pseudoautosomal gene SHOX cause Leri-Weill dyschondrosteosis. Nat. Genet. 19, 70–73.
Received 16 December 2013, in revised form 24 March 2014; accepted 25 April 2014
Unedited version published online: 25 June 2014
Final version published online: 22 September 2014
812
Journal of Genetics, Vol. 93, No. 3, December 2014