Itzykson et al., Supplementary Material Supplementary Figures 1-6 Supplementary Table 1 Supplementary Methods Additional References Study Group Supplementary Figures. Supplementary Figure 1. A-B. TaqMan® amplification plots of allele discrimination assay of ASXL1 c.1934dupG -> p.G646WfsX12 for DNA from A. peripheral blood CD14+ cells and B. skin fibroblasts from a representative patient (UPN #632). Green: wildtype allele; Blue: mutant allele. C. Resulting allele discrimination plot: normalized vector signal for the mutant probe plotted against that of the wildtype probe. Supplementary Figure 1 A C Wildtype allele CD14+ B Fibroblasts CD14+ Mutant allele Fibroblasts Supplementary Figure 2. A. Schematic representation of the experimental procedure employed in Figures 1-3 to assess clonal architecture of recurrent mutations in CMML. B. Simplified immunophenotypic steps of human granulomonocytic differentiation employed in the study. The indicated functional properties are illustrated in Supplementary Figure 3E-F. C. Flow cytometry analysis of bone marrow CD34+ cells selected by immunomagnetic separation from representative CMML and age-matched control samples. Left panel: CD34+/CD38- and CD34+/CD38+ gates in the overall CD34+ population. Middle panel: CMP (CD45RA-/CD123+), GMP (CD45RA+/CD123+) and MEP (CD45RA+/CD123+) in the gated CD34+/CD38+ population. Right panel: HSC (CD45RA-/CD90+), MPP (CD45RA-/CD90-), and LMPP (Lymphoid-primed multipotent progenitor; CD45RA+/CD90-, according to Guardon et al.46) in the gated CD34+/CD38- population. PB Sample A BM Sample ± Supplementary Figure 2 B Immunomagnetic Separation 18-genes mutations screen CD34+/CD38CD34+/CD38+ HSC, MPP, CMP, GMP Cell sorting CD34+/CD38- CD34+ CD14+ HSC CD90+ MPP mutation-specific TaqMan® discrimination assays design Serial replating CFU-GM + BFU-E CD90- Cloning Liquid culture with broad cytokine panel CMP C CMML CMP CD38 CD123 CD45RA GMP MPP HSC CD45RA CD90 CD123+ CD45RA- GMP Control CD34 CD34+/CD38+ Collect clones, extract DNA & genotype CFU-GM + BFU-E CD123+ CD45RA+ CFU-GM only Supplementary Figure 3. A-B. Cloning efficacy according to sample’s mutational status. Percentages represent the fraction of wells from 96-well plates (2-3 plates per sample) containing ≥ 4 cells after 12 days of liquid culture in the presence of FBS 10% and cytokines (SCF, FLT3-L, TPO, IL-3, IL-6, G-CSF, GM-CSF, EPO); 39 samples were cultured including 20 from bone marrow and 19 from peripheral blood CD34+/CD38- (A.) or CD34+/CD38+ (B.). Mutations (not mutually exclusive) were present in methylation genes (n=21; all in TET2), signalling genes (n=15; CBL n=4, NRAS n=3, KRAS n=6, JAK2 n=2), splicing genes (n=26, SRSF2 n=21, ZRSR2 n=3, U2AF35 n=1, SF3B1 n=1), and ASXL1 (n=8); bar: median; ns: not significant (Kruskal-Wallis test). C. Proportion of wildtype, single-mutated and double mutated (white, gray and black bars respectively) clones grown in liquid culture for 12 days with FBS 10% and cytokines (SCF, FLT3-L, TPO, IL-3, IL-6, G-CSF, GM-CSF, EPO) or colonies grown in methylcellulose with FBS and cytokines (SCF, IL-3, G-CSF, EPO) for 14 days from sorted HSC, MPP, CMP and GMP from sample UPN#777 (first mutation: CBL W408R, second mutation: TET2 S716X). Figures on top of the bars represent the number of clones or colonies assessed. D. KRAS pyrosequencing of bulk CD34+/CD38- and CD34+/CD38+ cells from UPN #752 harboring a KRAS G12A mutation. E. TET2 targeted resequencing of bulk CMP cells of UPN#632 harboring a TET2 c.3467A>T (p.N1156I) mutation (verified to be somatic by sequencing germline DNA from skin fibroblasts [data not shown]; 353 reads at the mutated position). F. Comparison of the proportion of mutated cells determined by single cell cloning (dark gray; 193, 88 and 38 clones screened for UPN#752 CD34+/CD38-, CD34+/CD38+ and UPN#632 CMP respectively) or bulk DNA sequencing (light gray) for the KRAS and TET2 mutation in E-F. Proportion of mutated cells are the double of proportion of alternative reads since both mutations are heterozygous G. Colonies from purified CMP or GMP from representative control and CMML samples grown in methylcellulose with 30% FBS and cytokines (SCF, IL-3, G-CSF and EPO), showing erythroid and granulomonocytic colonies for CMP, and pure granulomonocytic colonies for GMP (mean and standard deviation [SD] from triplicate). H. Serial replating in methycellulose of individual clones from sorted HSC and MPP. Results are expressed as the percentage of colonies relative to the initial number of clones seeded. Mean and SD from three independent samples. Supplementary Figure 2 A B ns C ns 105 75 117 95 56 66 28 31 80% 60% 40% D E F G KRAS #752 Clones Colonies Clones Colonies 0% Clones Colonies 20% Clones Colonies Percentage 100% HSC MPP CMP GMP H TET2 #632 250 100 60 40 20 150 100 50 control GMP CMP GMP CMP CMP CD34+/CD38+ 80 HSC 60 40 20 MPP 0 0 CD34+/CD38- CMP CD34+/CD38+ CD34+/CD38- 0 Colonies (%) 80 Colonies (%) Mutated cells (%) 100 200 CMML 0 1 2 3 Platings 4 5 Supplementary Figure 4. Architecture of 100 CD34+ clones in a sample (UPN#759) harboring 16 mutations discovered by exome sequencing showing sequential acquisition of mutations in 3 consecutive groups, along with loss of heterozygosity of TET2 variant. Terminal branching of two subclones with wild-type or homozygous KRAS mutation through possible mitotic recombination. Examples of Sanger sequences of the KRAS mutations in representative heterozygous, homozygous and wild-type clones are shown. Top panel: fraction (and standard deviation, by Wald’s method) of alternative (mutated) reads in the mature CD14+ cells by exome sequencing; ns: not significant, chi-square test. Supplementary Figure 4 ns 0.8 0.6 0.4 SH2B3 CTCF 0.0 KRAS ASAP1 ADCY10 ATP2C2 CEP63 HECW2 SMOC2 SIPA1L2 0.2 TET2 U2AF1 BFSP2 TRAPPC6B CTTNBP2 MYLK Mutated clone size in CD14+ cells 1.0 CTCF SH2B3 SMOC2 SIPA1L2 HECW20 CEP63 ATP2C2 ADCY10 ASAP1 MYLK CTTNBP2 TRAPPC6B BFSP2 U2AF35 TET2 homozygous Clone 4 N=7 Clone 1 N =10 Clone 2 N=1 Clone 3 N = 73 Clone 5 N=9 TET2 heterozygous U2AF35 BFSP2 TRAPPC6B CTTNBP2 MYLK TET2 homozygous U2AF35 BFSP2 TRAPPC6B CTTNBP2 MYLK KRAS heterozygous ASAP1 ADCY10 ATP2C2 CEP63 HECW2 SIPA1L2 SMOC2 TET2 homozygous U2AF35 BFSP2 TRAPPC6B CTTNBP2 MYLK KRAS heterozygous ASAP1 ADCY10 ATP2C2 CEP63 HECW2 SIPA1L2 SMOC2 SH2B3 CTCF TET2 homozygous U2AF35 BFSP2 TRAPPC6B CTTNBP2 MYLK KRAS homozygous ASAP1 ADCY10 ATP2C2 CEP63 HECW2 SIPA1L2 SMOC2 SH2B3 CTCF Supplementary Figure 5. Unique somatic mosaicism in patient UPN#752 harboring two independent subclones with NRAS G12D (dark grey) and KRAS G12A (light grey) respectively. A. Unique mosaïcism in clonal architecture of CMML from UPN#752 with respect to NRAS and KRAS genotypes (NRAS G12D: light grey, KRAS G12A: dark grey, WT: wildtype, black). B. Proportion of the corresponding clones in the indicated bone marrow CD34+ fractions of matched samples before and after investigational treatment with a MEK inhibitor (MEKi). The total number of interrogated clones is indicated on top of the bars. **P≤0.001 (Fisher exact test for the relative proportions of KRAS and NRAS mutated clones). Supplementary Figure 5 B 60 MEKi 40 0 CD34+/CD38+ 20 CD34+/CD38- KRAS G12A ** 80 CD34+/CD38+ WT 283 269 100 CD34+/CD38- NRAS G12D 193 88 Percentage of clones A Supplementary Figure 6. A. Cloning efficacy of CMP from 17 CMML and 5 control samples. Percentages represent the fraction of wells from 96-well plates (2-3 plates per sample) containing ≥ 4 cells after 12 days of liquid culture in the presence of FBS 10% and cytokines (SCF, FLT3-L, TPO, IL-3, IL-6, G-CSF, GM-CSF, EPO); bar: median. B. Proportion of clones with granulomonocytic (CD14+ and/or CD15+ and/or CD24+, grey), erythroid (GPA+, white) and mixed (both GPA+ and + and/or CD15+ and/or CD24+ populations, black) phenotype after 12-day liquid culture of single CMP in the presence of 10% FBS and cytokines (SCF, FLT3L, TPO, IL-3, IL-6, G-CSF, GM-CSF, EPO); chi-square test for mean proportions from 7 CMML and 4 controls. C. 5.104 CMP from a representative sample were cultivated in bulk of FBS 10% and cytokines (SCF, FLT3-L, TPO, IL-3, IL-6, G-CSF, GM-CSF, EPO). Cells with a MEP, CMP, and GMP phenotype at day 3 of culture were sorted and seed in triplicate (250 cells/mL) in methylcellulose with FBS 30% and cytokines (SCF, IL-3, G-CSF and EPO). Mean and SD of CFU-GM (grey) and BFU-E (white) colonies for each fraction. D. Gene expression levels (relative to HPRT expression) of CEBPA (left panel) and CEBPB (right panel) in sorted CMP fractions: mean and SEM from 4 control and 5 CMML samples each analyzed in duplicate. Unpaired t tests. Supplementary Figure 6 B 100 ns CMP clones,% 100 80 60 40 80 60 40 20 20 0 Control MEP GMP CMP Number of colonies gene expression (relative to HPRT) D C CMML Control 0 CMML Cloning efficacy,% A CEBPA CEBPB ns ns Healthy CMML Healthy CMML Supplementary Tables: Supplementary Table 1. Characteristics of the 5 patients with paired studies of clonal architecture with or without treatment. INITIAL SAMPLE UPN 507 AGE 70 GENDER M WHO WBC (G/L) MONOCYTES (G/L) HB (g/dL) PLT (G/L) CMML-2 14.9 4.9 10.2 132 PAIRED SAMPLE Tx (IWG response) Interval (months) observation WHO WBC (G/L) MONOCYTES (G/L) HB (g/dL) PLT (G/L) 13.5 CMML-2 20.4 6.1 10.6 90 ESA (HI-E) +5.8 CMML-2 29.2 8.2 12.7 83 516 76 M CMML-1 46.2 7.4 13.7 54 HY (SD) 13.1 CMML-1 10.3 2.3 13.5 87 550 85 M CMML-1 6.8 2.7 11.6 27 HMA x8 cycles (SD) 14.2 CMML-1 6.4 2.1 13.2 21 ICx (PR) 1.4 CMML-1 17.1 12.0 9.4 116 HMA x3 cycles (mCR) +4.4 no blast excess 2.2 0.3 8.1 74 ASCT (relapse) +6.6 RAEB-2 2.1 0.1 10.1 11 MEKi x2 (SD) 2.1 ND 7.4 (2% blasts) 3.1 9.1 67 632 752 64 76 M M CMML-2 CMML-2 26.2 48.1 (7% blasts) 10.0 17.3 11.7 9.2 34 69 HI-E: Hematological improvement of erythroid lineage; SD: stable disease; PR: partial remission; mCR: marrow complete response, all from IWG 2006 criteria1; RAEB: Refractory Anemia with Excess of Blasts (WHO criteria3). ESA: Erythropoiesis Stimulating Agent; HMA: hypomethylating agent, HY: hydroxyurea, ICx: Intensive chemotherapy, ASCT: Allogeneic Stem Cell Transplantation, MEKi: MEK inhibitor, HB: haemoglobin, PLT: platelet count, WHO: World Health Organization, WBC: White Blood Cells count. Tx: Treatment. ND: not done. Supplementary Table 2. Characteristic of patients with TET2-mutated myeloproliferative neoplasm (MPD) or myelodysplastic syndrome (MDS). UPN MPN 001 MPN 004 MPN 005 MPN 020 MPN 035 MPN 096 MPN 099 MPN 120 MDS 028 MDS 003 MDS 009 MDS 664 MDS 541 Sex M M F M M F M F M M M M M WHO PMF PV PV PV ET ET ET PV RCMD-RS RAEB1 RARS-T RAEB1 RA Monocytes (G/L) 1.44 1.35 0.24 0.38 3.93 0.8 1.81 0.28 0.27 0.17 1.0 0.31 0.97 TET2 mutation TET2 defect c.1669C>T c.3707-3713del del(4q24) c.4619del c.1061C>A + c.4075C>T c.5541G>A c.2030del c.1378del c.2131del c.4870c>T c.1973del c.1680_1681ins c.3764dupA p.Q557X (4q24UPD) p.P1237-S1239del (4q24UPD) del(4q24) p.P1540fsX31 p.[S354X]+[R1359Cys] p.W1847X p.L667fs p.S460fs p.E711fs p.E1624X p.H658fs p.K561fs p.Y1255X PMF. Primary myelofibrosis ; PV : polycythemia vera ; ET : Essential thrombocytopenia ; RCMD-RS : Refractory cytopenia with multilineage dysplasia and ring sideroblasts ; RAEB : refractory anemia with excess of blasts. RA; refractory anemia. Supplementary Methods Patients Between Feb 2007 and Jan 2011, thanks to the clinicians of the Groupe Francophone des Myélodysplasies (GFM), we prospectively collected blood and bone marrow samples from patients with CMML included in the PHRC MAD-06 or in the previously published decitabine phase II trial (n=38; EudraCT #2008-000470-21, Braun et al. [9]). UPN #752 received the MEK inhibitor GSK1120212 as a part of a phase I/II study (www.clinicaltrials.gov identifier NCT00920140). All others patients received treatment according to European Medicines Agency’s labeling (eg. Azacitidine, chemotherapy), or French Health Authorities’ (Agence Française de Sécurité Sanitaire des Produits de Santé [AFSSAPS]) ‘temporary treatment program’ for Erythropoiesis Stimulating Agents [ESAs]. CMML diagnosis was defined according to WHO 2008 criteria (1). Response to therapy was classified according to International Working Group revised criteria for myelodysplastic syndromes (2). Control bone marrow samples were obtained from older (age > 50 years) patients undergoing hip replacement surgery without a known diagnosis of malignancy or inflammatory disease. Flow cytometry and cell sorting or cloning Enrichment of blood or bone marrow mononucleated cells for CD34+ cells was performed on the AutoMacs system (CD34 MicroBead Kit, MiltenyiBiotec, Inc.) according to manufacturer’s instructions. For blood samples, the CD34- fraction was then used to purify the CD3+ population, and the CD3- population was used to enrich the CD14+ population as previously described (3). CD34+ from bone marrow samples were stained with FITC anti-CD45RA (clone H100), PE anti-CD123 (clone 7G3), PerCP-Cy5.5 anti-CD38 (clone HIT2), APC antiCD90 (clone 5E10), all from BD Pharmingen, Inc., and PC-7 anti-CD34 (clone 581, Beckman Coulter, Inc.) and sorted with a MoFlo cell sorter (Beckman Coulter) in the following fractions: CD34+CD38-CD90+ (Hematopoietic Stem Cells, HSC), CD34+CD38-CD90- (Multipotent Progenitors, MPP), CD34+CD38+CD45RA-CD123+ (Common Myeloid Progenitors, CMP), CD34+CD38+ + + CD45RA+CD123+ - - (Granulocyte-Monocyte Progenitors, GMP) and + CD34 CD38 CD45RA CD123 (Megakaryocyte-Erythrocyte Progenitors, MEP). CD34 from peripheral blood samples were sorted as CD34+CD38- and CD34+CD38+ fractions. CD34+ sorted fractions were then cloned at one cell per well in 96-well plates. FACS analysis of sorted CD34+ fractions after short-term culture or for cell-cycle analysis was performed with the same panel on a LSR II analyzer (BD Biosciences). FACS analysis of clones at day 12 of culture was performed with FITC anti-CD24, PE anti-CD14 (both from BD), PE-Cy5 anti-GPA (clone CLB-ery-1, Invitrogen) and APC anti-CD15 (Myltenyi). All analyses were performed with FlowJo 9.2 software (TreeStar Inc.,). Liquid Cell culture Short term culture of 5x104 cells from sorted CD34+ populations and single-cell culture of CD34+ clones was performed for 3 and 12 days respectively, in MEM-alpha milieu (Life Technologies) supplemented with 10% fetal bovine serum (FBS, StemCell Technologies, Inc.) and recombinant human cytokines: Stem Cell Factor (SCF, 50 ng/mL, Biovitrum AB, Inc.), FLT3-Ligand (50 ng/mL, Celldex Therapeutics, Inc.), pegylated thrombopoietin (TPO, 10 ng/mL, Kirin Laboratories, Inc.), interleukin-3 (IL-3, 10 ng/mL, Miltenyi Biotec), interleukin6 (IL-6, 10 ng/mL, gift from S. Burstein, Oklahoma City, OK, USA), granulocyte-macrophage colony–stimulating factor (GM-CSF, 5 ng/mL, Peprotech, Inc.), erythropoietin (EPO, 1 IU/mL, Amgen, Inc.) and granulocyte colony–stimulating factor (G-CSF,10 ng/mL, Amgen). Culture of bone marrow CD34+CD38- MPN cells in B, NK lympho-myeloid differentiating conditions was performed as described (4). Gene mutation analysis FLT3 internal tandem duplications (FLT3-ITD) and NPM1 exon 12 mutations were detected by PCR and fragment analysis using a fluorescently labeled forward primer as previously described (5, 6). PCR products were subjected to capillary electrophoresis on denaturing polyacrylamide gel and analysed by the CEQTM 8000 Genetic Analysis System (Beckman Coulter). Data were processed using Genetic Analysis System Software (Beckman Coulter). FLT3 tyrosine kinase domain mutations (FLT3D835/I836) were screened by PCR and EcoRV restriction enzyme digestion, as previously described (7). JAK2V617Fmutation analysis was performed by TaqMan® single nucleotide polymorphism genotyping assay using the JAK2 MutaScreen® kit (Ipsogen, Inc.). Real-time PCR assays were performed on an ABI PRISM® 7900HT (Applied Biosystems). The screening of NRAS, KRAS, and EZH2 mutations was performed by melting curve analysis and suspected mutations were confirmed by direct sequencing as described in (8, 9). Screening for KIT exon 17 and DNMT3A exon 23 mutations was performed as previously described (10, 11). Screening for mutations in: IDH1 at R132, IDH2 at R140 and R172, TET2 exon 3 to 11, c-CBL exon 8 and 9, RUNX1 exon 3 to 8, ASXL1 exon 12, SF3B1 exon 13 to 16, U2AF35 exon 6, ZRSR2 exon 1 to 11 and SRSF2 exon 2 was performed by bi-directional direct sequencing, as described elsewhere (12-17). The complete list of primers is provided at the end of this section. Seqscape (Applied Biosystems) was used to detect sequence variations. Gene abnormalities were numbered according to EMBL nucleotide sequence database. Patients with TET2 nonsense or frameshift or missense variations affecting conserved positions were considered as mutations, according to (4). ASXL1 nonsense or frameshift (but not missense) variations, including the common c.1934dupG;p.Gly646TrpfsX12 variant were considered as mutations. RUNX1 variations outside of the RUNT and transactivation domains were considered non pathogenic. Previously annotated single nucleotide polymorphisms (SNP) (http//www.hapmap.org) were not considered pathogenic. Assessment of mutations in CD3+ cells was performed with the same methods. The complete list of variants identified can be provided upon request. Validation of the cloning strategy by resequencing To validate the cloning strategy, bulk DNA from sorted CD34+ fractions was prepared as in (18). KRAS pyrosequencing was performed as previously described (19). Ion Torrent targeted resequencing of TET2 was performed using Ampliseq® from Life Technologies for PCR multiplexing, One Touch from Life Technologies for emulsion PCR followed by PGM™ sequencing (Ion Torrent Systems). Detailed procedures are available upon request. Statistical analyses Prognostic information from patients was collected at the reference date of December 1st 2011. Overall and progression-free survivals were established by the Kaplan-Meier method and defined as the time between sampling for genotyping and death from any cause (overall survival), or death or AML transformation (progression-free survival). All variables with P<0.05 in univariate analysis were included in a multivariate Cox model, after accounting for interactions. The final model was retained after forward selection. The proportional hazard hypothesis was verified by visual display of the Schönfeld residuals and a limited backward selection was performed to retain significant parameters with P<0.05. Exome sequencing and analysis Primary fibroblasts were obtained from patient skin biopsy by mechanical dislocation followed by culture in F-10 Glutamax® milieu (Gibco) supplemented with 20% FBS (Thermo Scientific, Inc.), 1% penicilline/streptomycine and amphotericin B 750 ng/mL (Gibco). DNA from primary fibroblasts and leukemic CD14+ cells was extracted using commercial kits (Qiagen). Genomic DNA was captured using Agilent in-solution enrichment methodology (SureSelect Human All Exon Kits Version 2, Agilent Technologies, Inc.) with their biotinylated oligonucleotides probes library (Human All Exon v2 – 46 Mb, Agilent Technologies), followed by paired-end 75 bases massively parallel sequencing on a HiSEQ 2000 sequencer (Illumina, Inc.) as described in details in (20). Sequence capture, enrichment and elution were performed according to manufacturer’s instruction and protocols (SureSelect, Agilent Technologies). Briefly, 3 µg of each genomic DNA were fragmented by sonication and purified to yield fragments of 150-200 bp. Pairedend adaptor oligonucleotides from Illumina were ligated on repaired, A-tailed, DNA fragments, then purified and enriched by 4 to 6 PCR cycles. 500ng of these purified Libraries were hybridized to the SureSelect oligo probe capture library for 24 hr. After hybridization, washing, and elution, the eluted fraction was PCR-amplified with 10 to 12 cycles, purified and quantified by QPCR to obtain sufficient DNA template for downstream applications. Each eluted-enriched DNA sample was then sequenced on an Illumina HiSEQ 2000 as paired-end 75b reads. Image analysis and base calling is performed using Illumina Real Time Analysis (RTA) Pipeline version 1.9 with default parameters. The bioinfomatics analysis of sequencing data was based on the Illumina pipeline (CASAVA1.7). CASAVA performs alignment of the reads to a reference genome (hg19) with the alignment algorithm ELANDv2 (performs multiseed and gapped alignments), then calls the SNPs based on the allele calls and read depth, and detects variants (SNPs&Indels). Only the positions included in the bait coordinates ± 20bp were conserved. Genetic variation annotation was performed using the IntegraGen in-house pipeline, which consists on gene annotation (RefSeq), detection of known polymorphisms (dbSNP 131, 1000Genome) followed by a mutation characterization (exonic, intronic, silent, nonsense….). Clonogenic assays for TET2-mutated MDS and MPN samples Sorted CD34+/CD38- cells were seeded at one cell per well for four to six weeks on a confluent layer of MS-5 cells in 96-well plates in RPMI medium (Invitrogen, Cergy Pontoise, France) supplemented with 10% human serum, 5% FCS, 10 ng/mL IL-3, 50 ng/mL SCF, 50 ng/mL fms-like tyrosine kinase 3 ligand (FLT3-L) (Immunex), 10 ng/mL thrombopoitin (Tpo) (Kyrin laboratories, Tokyo, Japan), 20 ng/mL IL-7, 10 ng/mL IL-15 (Peprotech, London, United Kingdom), and 5 ng/mL IL-2 (Chiron Laboratories, Suresnes, France), with weekly media change, as previously described (18). Sorted CD34+/CD38+ cells were seeded in methylcellulose with FCS and cytokines as described in Methylcellulose colony-forming cell (CFC) assays. Individual colonies were picked on day 14. Sequencing Primers SRSF2 SRSF2_ex1 ZRSR2 ZRSR2_ex1-2 ZRSR2_ex3 ZRSR2_ex4-5 ZRSR2_ex6 ZRSR2_ex7 ZRSR2_ex8 ZRSR2_ex9 ZRSR2_ex10 ZRSR2_ex11 U2AF35 U2AF35_ex2 U2AF35_ex6 SF3B1 SF3B1_ex13-14 SF3B1_ex15-16 KRAS KRAS_ex2 KRAS_ex3 NRAS NRAS_ex2 NRAS_ex3 CBL CBL_ex8 CBL_ex9 RUNX1 RUNX1_ex3 RUNX1_ex4 RUNX1_ex5 RUNX1_ex6 RUNX1_ex7 RUNX1_ex8 EZH2 EZH2_ex2 EZH2_ex3 EZH2_ex4 EZH2_ex5 EZH2_ex6 EZH2_ex7 EZH2_ex8 EZH2_ex9 EZH2_ex10 EZH2_ex11 EZH2_ex12 EZH2_ex13 EZH2_ex14 EZH2_ex15 EZH2_ex16 EZH2_ex17 Forward primer Reverse primer GGCCGCCACTCAGAGCTA ACCTCACAAAGGTCCGCG TCTCGACTCTTAGGCCCGCCCTTT GCTTGTGTTGTACCAAAGAAGG TTTGCTCTCGTGTGTGTGTG TGTTCCACTTGAGATTCTTAACCA CTTGATTGCCTGTTCCAACT ATGCCTGGTCTAAAGCAGTT GCAAGAGTCAGCTAGTATCT GAACTTGGTGGTCCTACAAT AGTGCTGTTTCATCACTGTGC CCTTCTGACACTGGGGCTTCAAG ACAGAAGACTGGTACTGGTTAG CCCAAACTCTGACATGCCTA GATCTAACTAACCTACCACG GTCTGATGACGGACATTTGA TTATAGAGTGCTAGCGTGCC TCCAGTGGAAAAATCCCAGA TCCCCCAAAGAATATCCCTT AACCCATCTGCGTTCATAGC GCTGCTGACATATTCCATGTG AAAGTCTTATTAAAGCGTGGATGG TCTCAGACCTTCCACTGGAAGT CGAACTGTGCTCAGTCACGTC TGATGTGAAAGTGTAGCTTC TGTTGGGGCATAGTTAAAACCT GGCAACATAGTAAGACCCTGT TGTTAGAACCATGAAACATATCCA AAAGGTACTGGTGGAGTATTTGA CAGACTGTGTTTCTCCCTTC CATGAAAATGGTCAGAGAAACC TAAACCCACCTATAATGGTG GGCCGATATTAATCCGGTGT CAAGTGGTTATAGATGGTGAAAC TGGGTAAAGATGATCCGACA CAAATGACTTGCTATTATTGATG GGACCCAGACTAGATGCTTTCT CTGGCTTTTGGGGTTAGGTT GAAAATACATTTCCTAGAGATCAAAAA TCGTTAAGTGTTTTACGGCTTT AGCTGCTTGCTGAAGATCCG CATCCCTGATGTCTGCATTTGTCC TGTTCAGGCCACCAACCTCATTC CCTGCTCCCCACAATAG AATCCCACCCCACTTTACAT TCCGTTCTCTTGCCCGC GCCTGTCCTCCCACCACCCTCTC GTGGGTTTGTTGCCATGAAACG CCCAAGGAATCTGAGACATGGTCC GGTGCAGGAGAGGCGGGCAG CTCAGCTGCAAAGAATGTGT GGCCTGGCGCCTCAGTA GGTGATCATATTCAGGCTGG TTTCTCCTTTCCTCTCCTTCA GGCTACAGCTTAAGGTTGTCCT AAATCTGGAGAACTGGGTAAAGAC AGGCTATGCCTGTTTTGTCC CTGACTGGCATTCCACAGAC CATCAAAAGTAACACATGGAAACC TCCATTAATTGACTTTTCCAGTG TTCTCTTCCATCAAAATGAGTTTTAG GAGTTGTCCTCATCTTTTCGC AAGAATGGTTTGCCTAAATAAGAC TCTTGGCTTTAACGCATTCC TGATCGTTTCCATCTCCCTG GAGAGTCAGTGAGATGCCCAG TTTTTGATGATGTGATTGTGTTTT TTCTGTCAGGCTTGATCACC AAACTTATTGAACTTAGGAGGGG TCCAATAGCATAAACCAAAAGATG CTGTCTTGATTCACCTTGACAAT TCATGCCCTATATGCTTCATAAAC AAAAGAGAAAGAAGAAACTAAGCCC AAGTGTAGTGGCTCATCCGC TTGTAATAAATGATAGCACTCTCCAAG ACCTCCACCAAAGTGCAAAG TCCTCACAACACGAACTTTCAC CCAAGAATTTTCTTTGTTTGGAC CCTTGCCTGCAGTGTCTATC CAAATTGGTTTAACATACAGAAGGC AGGGAGTGCTCCCATGTTC TTTGCCCCAGCTAAATCATC TGGCAATTCATTTCCAATCA CTCGTTTCTGAACACTCGGC EZH2_ex18 EZH2_ex19 EZH2_ex20 ASXL1 ASXL1_ex12_1 ASXL1_ex12_2 ASXL1_ex12_3 ASXL1_ex12_4 ASXL1_ex12_5 ASXL1_ex12_6 DNMT3A DNMT3A_ex23 KIT KIT_ex17 TET2 TET2_fragment1 TET2_fragment2 TET2_fragment3 TET2_fragment4 TET2_fragment5 TET2_fragment6 TET2_fragment7 TET2_fragment8 TET2_fragment9 AGGCAAACCCTGAAGAACTG CCGTCTTCATGCTCACTGAC CTTCAGCAGGCTTTGTTGTG TTCCAATTCTCACGTCAAAGGTA AAAAACCCTCCTTTGTCCAGA GGGGAGGAGGTAGCAGATG AGGTCAGATCACCCAGTCAGTT AGAGGACCTGCCTTCTCTGAGAAA ACTTGAAAACCAAGGCTCTCGT GGTGGACAAGGATGAGAAACCCAA TGGATTCCAAAGAGCAGTTCTCTTC ACAGGAAAGCTACTGGGCATAGTC TAGCCCATCTGTGAGTCCAACTGT TTCGATGGGATGGGTATCCAATGC GCAACCATCCCATCTGTCCTTGTA TGTCCTGTGACATAGCACGGACTT CATGACAAAGGGCATCCCTTCCAA CAAGAGTGCTCCTGCCTAAAGAGT TCCTGCTGTGTGGTTAGACG TTTTTCTCTTCTGGGTGCTGA TGGTGTACTGAATACTTTAAAACAAAA TGCAGGACTGTCAAGCAGAG TGAACTTCCCACATTAGCTGGT CAAAAGGCTAATGGAGAAAGACGTA GCCAGTAAACTAGCTGCAATGCTAA GACCAATGTCAGAACACCTCAA TTGCAACATAAGCCTCATAAACAG GCAACTTGCTCAGCAAAGGTACT ATACTACATATAATACATTCTAATTCCCTCACTG CATTTCTCAGGATGTGGTCATAGAAT AGACTTTATGTATCTTTCATCTAGCTCTGG TET2_fragment10 ATGCCACAGCTTAATACAGAGTTAGAT TET2_fragment11 TET2_fragment12 GATGCTTTATTTAGTAATAAAGGCACCA TGTCATTCCATTTTGTTTCTGGATA TET2_fragment13 TET2_fragment14 TET2_fragment15 TET2_fragment16 TET2_fragment17 IDH1 IDH1-R132 IDH2 IDH2-R140 IDH2-R172 CTGGATCAACTAGGCCACCAAC GCTCTTATCTTTGCTTAATGGGTGT AATGGAAACCTATCAGTGGACAAC CAGAGCTTTCTGGATCCTGACAT TCTAAGCTCAGTCTACCACCCATCCATACA GAAACTGTAGCACCATTAGGCATT GCAGAAAAGGAATCCTTAGTGAACA TGCCTCATTACGTTTTAGATGGG TTGATTTTGAATACTGATTTTCACCA ATTGGCCTGTGCATCTGACTAT TGCTGCCAGACTCAAGATTTAAA TGTTTACTGCTTTGTGTGTGAAGG CCCAATTCTCAGGGTCAGATTTA ACTCTCTTCCTTTCAACCAAAGATT TGTCATATTGTTCACTTCATCTAAGCT AAT TTCAACAATTAAGAGGAAAAGTTAGAA TAATATTT AAATTACCCAGTCTTGCATATGTCTT CCAAAATTAACAATGTTCATTTTACAA TAAGAG TGTACATTTGGTCTAATGGTACAACTG TATATATCTGTTGTAAGGCCCTGTGA GCCCACGTCCATGAGAACTATACTAC TGCTCGCTGTCTGACCAGACCTCATCG GTGGCACGGTCTTCAGAGA TTCATACCTTGCTTAATGGGTGT TGAAAGATGGCGGCTGCAGT AGCCATCATCTGCAAAAC GGGGTGAAGACCATTTTGAA TGTGGCCTTGTACTGCAGAG Mutation-specific Taqman® allele discrimination assays GENE ADCY10 AML1 ASAP1 ASXL1 ASXL1 ASXL1 ASXL1 ATP2C2 BFSP2 CBL CBL CBL CBL CEP63 CTCF CTTNBP2 HECW2 JAK2 KRAS KRAS KRAS KRAS KRAS KRAS MYLK NRAS NRAS RUNX1 RUNX1 SF3B1 SH2B3 SIPA1L2 SMOC2 SRSF2 VARIANT c.3975G>A c.930delC c.1423A>G c.1888_1910del c.3194G>A c.1924G>T c.1900_1922del c.248C->T c.494G_>A c.1219T>C c.1222T>C c.1259G>T c.1211G>A c.644G->A c.1133C->T c.4105G->A c.2121A>T c.1849G>T c.34G>A c.53C>A c.34G>T c.173C>T c.35G>C c.350A>G c.4061G>C c.35G>A c.179C>G c.171_174dupCCAC c.1126dupT c.1756G>C c.10009insT c.2800G>A c.203G>A c.284C>A FORWARD PRIMER ACTGATAATGTCGGTTGGGATTCTG CCGACCTGACAGCGTTCA CCATTTCCCTATGGATGCCAGAA TCGCAGACATTAAAGCCCGT GGACAGATGGGATGGTTGCT AGGTCACCACTGCCATAGAGA ACTGGGCTGTCGGAGTTCT TGTCTCCTTTGGTGTGTGTGATC CCCTGTGGACACCTCATGTG GAGCCCTGTGGACACCTCAT CCCTGTGGACACCTCATGTG GCCCTGTGGACACCTCATG GCCAATCAGAAATTCAACACTTAAGCA ACGTCACATTCGCTCTCATACTG TGTCTTTTCACAGAGGCTCTTGAC CCCACTGGGCACCTGTAC AAGCTTTCTCACAAGCATTTGGTTT TGCTGAAAATGACTGAATATAAACTTGTG TGCTGAAAATGACTGAATATAAACTTGTG TGCTGAAAATGACTGAATATAAACTTGTG GATGGAGAAACCTGTCTCTTGGAT AGGCCTGCTGAAAATGACTGAATAT GAGCCTGTTTTGTGTCTACTGTTCT GATCTCGATGCTGTAGGACTGTAC TGCTGAAAATGACTGAATATAAACTTGTG GGTGAAACCTGTTTGTTGGACATAC GACCGCAGCATGGTGGAG GGGAGGCCCGTTCCAA TTCAGATCCTCGTGGTCATTGAAC TCAGCCCTAGAGCCTAGCA GATGGCGGGAAAATAGAAAACATGT GCATCTGACGGAAGGACCTT GCTGCGGGTGCAAATGG REVERSE PRIMER MUTANT PROBE (FAM) TGGAATTGTTTTCTTCCCAGGCT CCCTTCAGATATGGGCAC GGCGCCTGGATAGTGCAT CAGTTCCCGCGCTGC CACCTGGCTTTCAACCAACTTG TTTGACCTGTGTAGAATG CTCCACCCGGGCCAC AGAGGTCACCACTGCC GGCGGACCGCACATACT CTCAGAGCTAGGTGTCT CGCCGCCACCTCCA CCCCTCAGATGGCA direct sequencing GTTGTCAGCAACAAACTCATTCCA CGCTGCATCACCG GCCGGGCATTTTCCAAGAC CTCTAGGTGGATGAGGCA CAGCCCTGACCTTCTGATTCC CATCCTGTCTTACACCC CAGCCCTGACCTTCTGATTCC TGTCTTACATCCCGGC CGATGGGTTCAGTACCTTTAATTTC CTGTCCTTTCTGCCTAT GTCGCTGTTTAGATCCGTACCT TGCACATCCTATCTTAC CAACTCATTGGCACAGATAGTGTCA ACTGGAGCAGGCTAA GCTGGCATAACTGCACAAACTG ACTGAAACAGACGCTCT GCTGTGGAATGGCGTCATC AGTTCAAGAAACAATATT CGAAGGGTCGCAGGAATCC TGCTGGTTCTTTTCCTGTG AGAAAGGCATTAGAAAGCCTGTAGTT TCCACAGAAACATAC AGCTGTATCGTCAAGGCACTCTT TTGGAGCTAGTGGC GGTCCTGCACCAGTAATATGCA CAAGAGTGACTTGAC AGCTGTATCGTCAAGGCACTCTT TGGAGCTTGTGGCGT GGTCCCTCATTGCACTGTACTC TTGACCTGCTATGTCGAG GCTGTATCGTCAAGGCACTCTT TTGGAGCTGCTGGCGTA GACTCTGAAGATGTACCTATGGTCCTA AGGCAAATCACATCTATTT ACATTCGGAGCTCCTCACTGA CCTGGTATGCCTCCTC AGCTGTATCGTCAAGGCACTCTT TTGGAGCTGATGGC TGGTCTCTCATGGCACTGTACT CTTCTTGTCCACCTGTATC GGGGCTGTCGGTGCG TGGCCGACCCACCCG CGAGGCGCCGTAGTACAG CTCGCCCTCCTACCAC CGGCCTTCCACTCTAGCAT TTGATTGATGAACATTACT CCTAGCTATTGGTTTACCCACCTT CAGCACAGATTTCCCTTAA TCGGTAGACAACTGTGCTGAAG ACATCAGGAAAATTGT GCAGTTTCCTCGATATGCAATCTCT TGTGAATTTCAACATGCCAA ACCGCCCCCGTACCT CCGCCACCCGGACT WT PROBE (VIC) CCTTCAGATGTGGGCAC CAGTTCCCCGCGCTGC ATTTTGACCTGTATAGAATG ACCACTGCCATAGAGAGG CTCAGAGCTGGGTGTCT CCCCCTCCGATGGCA CGCTGCGTCACCG CTCTAGGTGGGTGAGGCA ATCCTGTCTTACATCC CTGTCTTACATCCTGG CTGTCCTTTCTGCCGAT TGCACATCCTGTCTTAC AACTGGAGCGGGCTAA CTGAAACGGACGCTCT AGTTCAAGAAGCAATATT CTGCTGGTTCTTTACCTGTG TCTCCACAGACACATAC TAGTTGGAGCTGGTGGC TAGGCAAGAGTGCCTTG TTGGAGCTGGTGGC TTGACCTGCTGTGTCGAG TTGGAGCTGGTGGCGTA AGGCAAATCACATTTATTT CCTGGTATGGCTCCTC TTGGAGCTGGTGGC CTTCTTGTCCAGCTGTATC TGGCCGACCACCCGGGCG TCGCCCTCCTTACCAC ATTGATTGATGAAGATTACT CAGCACAGATTCCCTTAA ACATCAGGGAAATTGT TTGTGAATTTCAACGTGCCAA CCGCCCCCCGGACT DISEASE CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML PUTATIVE PROTEIN M1325I A311RfsX256 I475V E635RfsX15 W1065X G642X E635RfsX15 T83M G165D S407P W408R R420L C404Y R215Q P378L A1369T L707F V617F G12S A18D G12C T58I G12A K117R G1354A G12D A59G G60PfsX52 Y376LfsX197 D586H S337FfsX2 E934K R68H P95H Mutation-specific Taqman® allele discrimination assays (continued) GENE VARIANT FORWARD PRIMER REVERSE PRIMER MUTANT PROBE (FAM) SRSF2 c.284C>T GCTGCGGGTGCAAATGG ACCGCCCCCGTACCT CCGCCTCCCGGACT SRSF2 c.284C>G GCTGCGGGTGCAAATGG ACCGCCCCCGTACCT CGCCGCCCGGACT TET2 c.2428 C>T AAGCGAGTTCGAGACTCATAATGTC TGCACTTGATTTCATGGTCTGACT CGATTTATATTCTATACTTCC TET2 c.2554G>T CAAACAATACACACCTAGTTTCAGAGAA TGGGTCTTGTTTCCTGCAAAA CAGACTACACATCCTTAA TET2 c.2268_2269insA GCAACAGCAGCAAAAATTACAAAT TGCTGATCATTGTTGCTTTGG AAGAATAAAGAGGAAATAACTCCAG TET2 c.2407C>T CAAAATCAAGCGAGTTCGAGACT GAAACCTGTATTTTGCATGCACTT ATAATGTCCAAATGGG TET2 c.4855delC TCATCTCAAGCTGCAGGTTCA TGATATGATGGATATTGGGTATTCTGA GAACCCTTACCTGGGCT TET2 c.2147C>G GAATCAACAGGCTTCAGAGACTGA GTGCTGCCTGTTTATGAGGCTTA ATTTTCAAACTGACACCTT TET2 c.1348A>T CCCAACCAAAGTAACACAACACTT ATGGATTAGGACTCTGGGAAGGT TAAGGGAAGTGTAAATAG TET2 c.4573_4574insA GCGACTTTCAGGACCAGTCAT TGTGGTGGCTGCTTCTGTAG AGCAGTACCCAGCAGC direct sequencing TET2 c.5104C>T TET2 c.4889C>A ACCCTGGGCTTTTGAATCAGAATAC GGGAGAATAGGAACCCAGATATGG CATTGCATTGATATTATGGAT TET2 c.3467A>T GAGCAAATTATTGAAAAAGATGAAGGTCCTT TTCTGTCCAAACCTTTCTTCCATGA AGCAGGTCCTATTGTGGCA TET2 c.4360delG AGTGGTGCCATTCAGGTACTG CAAGTCTTGACTGGCTCTGCTAA CATCCTGATTTTCG TET2 c.3723delT CCTGGTGTGGGAAGGAATCC CTCAGCGTCTCGGTAAGCT TCTCTGGCGACAAAC TET2 c.3139_40delAC GTTTCACGCCAAGTCGTTATTTGA TGGCCCTGACATTTCAACTTTTACT CCATAAGGCTCTTTCTCAA direct sequencing TET2 c.2976_2977insGT TET2 c.3569_3582del GCAGCAGTGAAGAGAAGCTACT ACAATCACTGCAGCCTCACA TTTGGTGCAGGAGCGA TET2 c.3641G>A GCTATTAGGATTGAAAGAGTCATCTATACTGG AATGCCCAAGATTTAAGACCAAAG GGCAAAAGTTATTGCTAAGTGGG TET2 c.3764dupA CTGACAAACTCTACTCGGAGCTTAC GCACACCGGCGATTGG CGTGCCGTATTTC direct sequencing TET2 c.1680_16781insTCAT direct sequencing TET2 c.1669C>T direct sequencing TET2 c.3707-3713del direct sequencing TET2 c.4619del direct sequencing TET2 c.1061C>A direct sequencing TET2 c.5541G>A direct sequencing TET2 c.2030del direct sequencing TET2 c.1378del direct sequencing TET2 c.2131del direct sequencing TET2 c.4870c>T direct sequencing TET2 c.1973del TRAPPC6B c.149G>A CCTACCTGCAAGAAAATTTTCAAATCCA GTTTCGAGTGGGACAAGGATTGA CCTGCTCACTTTTCTA U2AF35 c.470A->G CCGTGACGGACTTCAGAGAA ACTGGCCACTCCTCACTCA TGCCGTCGGTATGAG ZRSR2 498 GTCAGCTGCAATTTGGAACCT AAATCAGGAAGACATCCACAAGCA CAGTACCAGTCATAAGTAT WT PROBE (VIC) CCGCCCCCCGGACT CCGCCCCCCGGACT ACGATTTATATTCTGTACTTCC CAGACTACACATCCTGAA AAGAATAAAGAGGAAATACTCC ATAATGTCTAAATGGGACTGG CATGAACCCTTACCCTG CAAACTCACACCTTTT AGGGAAGTGAAAATA GCAGTCCCAGCAGCC CATTGCATTGATATGATGGAT AGCAGGTCCTAATGTGGCA CATCCTGACTTTTCG TCTCTGGCTGACAAAC CCATAAGGCTCTTACTCTCAA TTTGGTGCGGGAGCGA GTTCTCAGGGATGTCCTATTGC CGTGCCGTTATTTC CCTGCTCACCTTTCTA CTGCCGTCAGTATGAG CAGTACCAGTCGTAAGTAT DISEASE CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML CMML MDS MDS MDS MDS MPN MPN MPN MPN MPN MPN MPN MPN CMML CMML CMML PUTATIVE PROTEIN P95L P95R Q810X E852X L757TfsX12 Q803X P1619LfsX4 S716X K450X S1525YfsX53 Q1702X S1630X N1156I V1454SfsX4 D1242TfsX11 T1047SfsX9 M993VfsX15 S1190YfsX3 R1214Q Y1255X K561HfsX6 p.Q557X p.P1237-S1239del p.P1540fsX31 p.S354X p.W1847X p.L667fs p.S460fs p.E711fs p.E1624X p.H658fs R50K Q157R splice n+1 exon 9 Primer list for variants identified in whole-exome sequencing GENE ADCY10 ASAP1 ATP2C2 BFSP2 CEP63 CTCF CTTNBP2 HECW2 KRAS MYLK SH2B3 SIPA1L2 SMOC2 TET2 TRAPPC6B U2AF35 FORWARD PRIMER GAACCCAGAATACTCAATAATACGG GAAATATGAACCCCCATTTCC GGGAGTCTGTACCCTGTTGC CTCCCAGTGACCTTGTCTCC TAGGCTCAGCTTGTCAATCG TTTTGTGCCTAACCTACTGTGC TTCACAAGGGTGTGAATTTCC CTCCTGGTCAGGTACAGTGG AAGAAACCAAAGCCAAAAGC CACGCACATTTGTTTCAAGC ACCTGCCCAGATCCTTAACC TGGTATAATCATGGTAGCAGTTCC GCAGCCTTCTGTTTTCTGC GCAACTTGCTCAGCAAAGGTACT TTTTCAAATCCAACCTGCTC AAAGTCTTATTAAAGCGTGGATGG REVERSE PRIMER TGGGACATGAGGATACAAGG TGTTTTAGCTTCCTCTGTAGTTGG GCAAAGAATGACACCTCTGG GGCTCCAGAACAGCATTATCC CAAGTCATTGACCCTCATGG AATACAGTAAGGAGTGGAGAAGTCC TGCTCCTAAGGGATGAATCG TTCTCAGGAGGAGGAAGACG TGACAAAAGTTGTGGACAGG TGCAATTCTGGAAAGTGTGG CCAGAAGACAATGGCCTAGC GTGATTGGGTGGACATCTGG GATGGATGTACCCATCTTTGG TGCTGCCAGACTCAAGATTTAAA ACAATTTCTGAATACTAACATCCTAGC CGAACTGTGCTCAGTCACGTC Additional References 1. Vardiman JW, Thiele J, Arber DA, Brunning RD, Borowitz MJ, Porwit A, et al. The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes. Blood. 2009 Jul 30;114(5):937-51. 2. Cheson BD, Greenberg PL, Bennett JM, Lowenberg B, Wijermans PW, Nimer SD, et al. Clinical application and proposal for modification of the International Working Group (IWG) response criteria in myelodysplasia. Blood. 2006 Jul 15;108(2):419-25. 3. Droin N, Jacquel A, Hendra JB, Racoeur C, Truntzer C, Pecqueur D, et al. Alpha- defensins secreted by dysplastic granulocytes inhibit the differentiation of monocytes in chronic myelomonocytic leukemia. Blood. 2010 Jan 7;115(1):78-88. 4. Delhommeau F, Dupont S, Della Valle V, James C, Trannoy S, Masse A, et al. Mutation in TET2 in myeloid cancers. N Engl J Med. 2009 May 28;360(22):2289-301. 5. Boissel N, Renneville A, Biggio V, Philippe N, Thomas X, Cayuela JM, et al. Prevalence, clinical profile, and prognosis of NPM mutations in AML with normal karyotype. Blood. 2005 Nov 15;106(10):3618-20. 6. Kiyoi H, Naoe T, Yokota S, Nakao M, Minami S, Kuriyama K, et al. Internal tandem duplication of FLT3 associated with leukocytosis in acute promyelocytic leukemia. Leukemia Study Group of the Ministry of Health and Welfare (Kohseisho). Leukemia. 1997 Sep;11(9):1447-52. 7. Abu-Duhier FM, Goodeve AC, Wilson GA, Care RS, Peake IR, Reilly JT. Identification of novel FLT-3 Asp835 mutations in adult acute myeloid leukaemia. Br J Haematol. 2001 Jun;113(4):983-8. 8. Braun T, Itzykson R, Renneville A, de Renzis B, Dreyfus F, Laribi K, et al. Molecular predictors of response to decitabine in advanced chronic myelomonocytic leukemia: a phase 2 trial. Blood. 2011 Oct 6;118(14):3824-31. 9. Ernst T, Chase AJ, Score J, Hidalgo-Curtis CE, Bryant C, Jones AV, et al. Inactivating mutations of the histone methyltransferase gene EZH2 in myeloid disorders. Nat Genet. 2010 Aug;42(8):722-6. 10. Boissel N, Leroy H, Brethon B, Philippe N, de Botton S, Auvrignon A, et al. Incidence and prognostic impact of c-Kit, FLT3, and Ras gene mutations in core binding factor acute myeloid leukemia (CBF-AML). Leukemia. 2006 Jun;20(6):965-70. 11. Renneville A, Boissel N, Nibourel O, Berthon C, Helevaut N, Gardin C, et al. Prognostic significance of DNA methyltransferase 3A mutations in cytogenetically normal acute myeloid leukemia: a study by the Acute Leukemia French Association. Leukemia. 2012 Jan 13. 12. Damm F, Kosmider O, Gelsi-Boyer V, Renneville A, Carbuccia N, Hidalgo-Curtis C, et al. Mutations affecting mRNA splicing define distinct clinical phenotypes and correlate with patient outcome in myelodysplastic syndromes. Blood. 2012 Feb 17. 13. Gelsi-Boyer V, Trouplin V, Roquain J, Adelaide J, Carbuccia N, Esterni B, et al. ASXL1 mutation is associated with poor prognosis and acute transformation in chronic myelomonocytic leukaemia. Br J Haematol. 2010 Nov;151(4):365-75. 14. Grossmann V, Kohlmann A, Eder C, Haferlach C, Kern W, Cross NC, et al. Molecular profiling of chronic myelomonocytic leukemia reveals diverse mutations in >80% of patients with TET2 and EZH2 being of high prognostic relevance. Leukemia. 2011 May;25(5):877-9. 15. Kuo MC, Liang DC, Huang CF, Shih YS, Wu JH, Lin TL, et al. RUNX1 mutations are frequent in chronic myelomonocytic leukemia and mutations at the C-terminal region might predict acute myeloid leukemia transformation. Leukemia. 2009 Aug;23(8):1426-31. 16. Boissel N, Nibourel O, Renneville A, Huchette P, Dombret H, Preudhomme C. Differential prognosis impact of IDH2 mutations in cytogenetically normal acute myeloid leukemia. Blood. 2011 Mar 31;117(13):3696-7. 17. Boissel N, Nibourel O, Renneville A, Gardin C, Reman O, Contentin N, et al. Prognostic impact of isocitrate dehydrogenase enzyme isoforms 1 and 2 mutations in acute myeloid leukemia: a study by the Acute Leukemia French Association group. J Clin Oncol. 2010 Aug 10;28(23):3717-23. 18. Dupont S, Masse A, James C, Teyssandier I, Lecluse Y, Larbret F, et al. The JAK2 617V>F mutation triggers erythropoietin hypersensitivity and terminal erythroid amplification in primary cells from patients with polycythemia vera. Blood. 2007 Aug 1;110(3):1013-21. 19. Ramalingam SS, Lee JW, Belani CP, Aisner SC, Kolesar J, Howe C, et al. Cetuximab for the treatment of advanced bronchioloalveolar carcinoma (BAC): an Eastern Cooperative Oncology Group phase II study (ECOG 1504). J Clin Oncol. 2011 May 1;29(13):1709-14. 20. Gnirke A, Melnikov A, Maguire J, Rogov P, LeProust EM, Brockman W, et al. Solution hybrid selection with ultra-long oligonucleotides for massively parallel targeted sequencing. Nat Biotechnol. 2009 Feb;27(2):182-9. Study group: Daniel Re (Antibes), Mathilde Hunault-Berger (Angers), Borhane Slama (Avignon), Lionel Adès, Thorsten Braun, Claude Gardin (Bobigny), Krimo Bouabdallah (Bordeaux), Benoit de Renzis (Clermont-Ferrand), François Dreyfus, Didier Bouscary, Jerome Tamburini (Cochin, Paris), Bertrand Joly (Corbeil-Essonnes), Andrea Toma (Créteil), Bernard Bonotte, JeanNoël Bastie (Dijon), Jean Gutnecht (Fréjus), Gérard Tertian (Le Kremlin-Bicêtre), Kamel Laribi (Le Mans), Thomas Prébet, Norbert Vey (Marseille), Agnès Guerci (Nancy), Laurence Legros (Nice), Eric Jourdan (Nimes), Laurence Sahnes (Perpignan), Aspasia Stamatoullas (Rouen), Anne Vekhoff, Sandra Malak (Saint-Antoine, Paris), Bertrand Arnulf, Nicolas Boissel, Emmanuel Raffoux (Saint-Louis, Paris), Odile Beyne-Rauzy, Christian Recher (Toulouse), Stéphane de Botton (Villejuif), included patients.
© Copyright 2024 Paperzz