[CANCER RESEARCH 60, 467– 473, January 15, 2000]
A Specific Sequence of the Noncollagenous Domain of the ␣3(IV) Chain of Type IV
Collagen Inhibits Expression and Activation of Matrix Metalloproteinases by
Tumor Cells1
Sylvie Pasco, Jing Han, Philippe Gillery, Georges Bellon, François-Xavier Maquart, Jacques P. Borel,
Nicholas A. Kefalides, and Jean Claude Monboisse2
Lab. Biochemistry, IFR 53 Biomolecules, CNRS UPRESA 6021, UFR Medicine, F51095 Reims Cedex, France [S. P., P. G., G. B., F-X. M., J. C. M.]; Department of Medicine and
Connective Tissue Research Institute, University of Pennsylvania, Philadelphia, Pennsylvania 19104 [J. H., N. A. K.]; and 75008 Paris, France [J. P. B.]
ABSTRACT
The invasive properties of melanoma cells correlate with the expression
of matrix metalloproteinases (MMPs) and their physiological modulators
(tissue inhibitors of metalloproteinase and membrane-type MMPs) and
with that of the ␣V␤3 integrin. We investigated the effect of anterior lens
capsule type IV collagen and of the ␣3(IV) collagen chain on the invasive
properties of various tumor cell lines (HT-144 melanoma cells, HT-1080
fibrosarcoma cells). We demonstrated that anterior lens capsule type IV
collagen or specifically the synthetic peptide ␣3(IV) 185–203 inhibited
both the migration of melanoma or fibrosarcoma cells as well as the
activation of membrane-bound MMP-2 by decreasing the expressions of
MT1-MMP and the ␤3 integrin subunit.
INTRODUCTION
Tumor cell invasion is characterized by interdependent steps of
interactions between tumor cells and the extracellular matrix, involving sequential proteolytic degradation of basement membranes, migration through blood vessels, and adhesion to extracellular matrix
proteins (1). The degradation of basement membranes involves various proteolytic enzymes, mainly MMPs3 (2, 3). MMPs are a large
family of at least 18 members of zinc-containing proteinases that
degrade extracellular matrix proteins, such as collagens, proteoglycans, laminins, and fibronectin (4). Among them, the 72-kDa gelatinase (MMP-2) and stromelysin (MMP-3) and the 92 kDa-gelatinase
(MMP-9) have been shown to play an important role in the degradation of basement membranes and in tumor progression. MMPs are
secreted as inactive zymogens, and their activation occurs during
basement membrane crossing as a result of an imbalance between
levels of TIMPs and physiological activators of MMPs, such as
urokinase, plasmin, or MT-MMPs (5, 6). MT-MMPs constitute a new
subgroup of MMPs containing an additional transmembrane domain,
and they have been shown to activate latent MMP-2 (7).
Integrins are ␣␤ heterodimeric cell surface glycoproteins that interact with extracellular matrix proteins and mediate tumor cell adhesion to basement membrane components during tumor progression
(8, 9). A particular role has been demonstrated for the ␣V␤3 integrin
in melanoma cell migration and invasion (10, 11). Up-regulated levels
of the expression of ␣V␤3 integrin are induced in invasive melanoma
cells in an in vitro model in nude mice (12, 13). Recent studies have
Received 6/7/99; accepted 11/12/99.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
1
Supported by grants from the University of Reims Champagne-Ardenne, CNRS
(UPRESA 6021), the Ligue contre le Cancer, and the NIH (AR 20553, HL 29492, and AR
07490) and by a NATO Collaborative Research Grant.
2
To whom requests for reprints should be addressed, at Lab. Biochemistry, CNRS
UPRESA 6021, UFR Medicine, 51 Rue Cognacq Jay, F-51095, Reims Cedex, France.
Phone: (33)326913534; Fax: (33)326918055; E-mail: [email protected].
3
The abbreviations used are: MMP, matrix metalloproteinase; MT-MMP, membranetype MMPs; TIMP, tissue metalloproteinase inhibitor; NC1, noncollagenous; ALC, anterior lens capsule; FBS, fetal bovine serum; 4-hyp, 4-hydroxyproline; RT, reverse
transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; pg, picogram.
also demonstrated the role of the ␣V␤3 integrin that colocalizes with
MMP-2 in a functionally active form on the melanoma cell surface
(14, 15).
Type IV collagen is a major component of basement membranes
(16), and one of its important functions is the ability to promote the
adhesion and motility of various normal or transformed cells. It is a
heterotrimer formed from any of six ␣ chains. The most prominent
molecular species, as well as type IV collagen from EHS tumor, is
composed of two ␣1(IV) and one ␣2(IV) chain (17). The genes for the
additional minor type IV collagen chains, ␣3(IV), ␣4(IV), ␣5(IV),
and ␣6(IV), have been cloned, and their tissue distribution has been
examined (18 –20). The ␣ chains of type IV collagen contain a long
collagenous domain of about 1400 amino acids and a COOH-terminal
NC1 domain of about 230 amino acids. Several studies have ascribed
diverse biological activities to the various domains of the type IV
collagen molecule and have demonstrated the role of specific peptide
sequences from both the helical and the NC1 domains on melanoma
cell adhesion and spreading (21–23).
In recent studies, we have demonstrated that ALC type IV collagen
and a specific sequence comprising residues 185–203 of the NC1
domain of the ␣3(IV) chain were able to prevent oxygen free radical
(O2⫺) production and granule exocytosis in polymorphonuclear leukocytes in response to various stimuli (24, 25). In addition, the ␣3(IV)
185–203 peptide was shown to promote adhesion of melanoma cells
and to inhibit tumor cell proliferation (26). In melanoma cells, the
␣3(IV) collagen chain binds to ␣V␤3 integrin and CD47/integrinassociated protein, which serve as membrane receptors (27), and
triggers an intracellular transduction pathway involving an increase of
cytoplasmic cAMP and cAMP-dependent protein kinases (28). Because of the crucial role of MMPs in tumor cell invasion, we investigated the effect of the ␣3(IV) 185–203 peptide on the activities of
MMPs in tumor cells. In this paper, we present evidence that the
␣3(IV) 185–203 peptide is also able to inhibit tumor cell migration in
an in vitro model. The amount of the inactive form of MMP-2 secreted
into the medium was not altered by the ␣3(IV) 185–203 peptide. In
contrast, the fraction of MMP-2 bound to the plasma membrane of the
tumor cells was markedly decreased. The activation of this MMP-2
fraction was strongly inhibited, and this inhibition coincided with the
inhibition of the expression of both MT1-MMP and ␤3 integrin
subunit.
MATERIALS AND METHODS
Reagents. All of the reagents, unless specifically indicated, were obtained
from Sigma (St. Louis, MO). The reagents for molecular biology were from
Life Technologies (Cergy Pontoise, France). Primers for PCR were synthesized by Eurogentec (Seraing, Belgium) or by Genome Express (Paris, France).
Monoclonal antibody to ␣V␤3 integrin (clone 23C6) was from PharMingen
(San Diego, CA).
Cell Cultures. The human metastatic melanoma cell line HT-144 obtained
from Dr. P. Braquet (Bioinova, France) was grown in McCoy’s 5A medium
(Life Technologies, France) containing 10% FBS. The human fibrosarcoma
467
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2000 American Association for Cancer
Research.
MMPs INHIBITION BY THE ␣3(IV) COLLAGEN CHAIN
cell line HT-1080 was obtained from the American Type Culture Collection A260-nm measurement, and its integrity was checked by 1.5% agarose elec(Rockville, MD), and human normal dermal fibroblasts, used as controls, were trophoresis.
explanted in the laboratory. Both these cell lines were grown in DMEM
cDNA was prepared from 5 ␮g of total cellular RNA by RT at 42°C for 45
supplemented with 10% FBS. All cultures were maintained at 37°C in a min. The 100-␮l reaction volume contained 200 units of murine-Moloney
humidified atmosphere containing 95% air and 5% CO2. Cell proliferation was leukemia virus reverse transcriptase (Life Technologies, France), 2.5 ␮M
evaluated by nuclei staining with crystal violet (29).
random hexamers, 0.8 mM dATP, dCTP, dGTP, and dTTP, 2 units of RNase
Preparation of Collagen Substrates. Native EHS type IV collagen was inhibitor (RNAsin; Promega, France), 10 mM DTT, 5 mM MgCl2, and 50 mM
obtained from Sigma. Native and pepsin-treated ALC type IV collagen and the KCl in 20 mM Tris-HCl buffer (pH 8.4). The RT reaction product (2.5 ␮l) was
NC1 domain from ALC type IV collagen were prepared as previously de- amplified in a 25-␮l PCR mixture containing 0.2 ␮M forward and 0.2 ␮M
scribed (25). Peptides corresponding to the residues 185–203 of the human reverse primers, 200 ␮M dATP, dCTP, dGTP, and dTTP, 0.5 units of Taq DNA
NC1 domains of the ␣1(IV) chain (CNYYANAYSFWLATIERSE) and polymerase (Life Technologies, France), 1.5 mM MgCl , and 50 mM KCl in the
2
␣3(IV) chain (CNYYSNSYSFWLASLNPER), as well as a scrambled peptide, same buffer as above. The PCR reaction was performed in a Hybaid Omnigen
corresponding to the ␣3(IV), (YAPLWNRSSFENSLNYSCY), were prepared thermocycler (Teddington, Middx, United Kingdom), with 32 cycles consistby solid-phase synthesis (26).
ing each of denaturation at 95°C for 20 s, primer annealing at 55°C for 30 s,
Cell Migration Assays. Cell migration assays were performed using modand extension at 72°C for 30 s.
ified Boyden chambers containing polyvinylpyrrolidone-free polycarbonate
Competitive PCR. Internal standards of DNA fragments for MMPs,
membranes (tissue culture-treated, 6.5-mm diameter, 8-␮m pore; Transwell,
TIMPs, MT1-MMP, ␤3 integrin subunit, and GAPDH were prepared in the
Costar, Cambridge, MA). Membranes were coated with different collagen IV
laboratory by generating slightly smaller products than the fragment amplified
forms (native or pepsinized ALC type IV collagen, native EHS type IV
from extracted RNAs. For that purpose, composite primers were constructed as
collagen, NC1 domain of ALC type IV collagen; all at 20 ␮g/membrane).
shown in Table 1. These DNA fragments were purified by a Geneclean kit (Bio
Sterile type IV collagen solubilized in 18 mM acetic acid was deposited onto
5
the membranes and dried under a laminar hood. Cells (10 cells/well) sus- 101, La Jolla, CA), quantified by A260 nm, and used in PCR experiments. The
pended in medium containing 0.2% BSA were deposited onto the upper nature of the amplified fragments were confirmed by restriction enzyme
surface of the membrane. The lower compartment was filled with medium digestion.
As a rule, series of seven dilutions of the internal standards (78 fg to 5 pg
supplemented with 2% BSA and 10% FBS. After a 3-h incubation period,
⬎90% of the cells adhered to the membrane, and the medium of the upper for GAPDH, 7.8 fg to 0.5 pg for MMP-2, 31 fg to 2 pg for TIMP-2, 6 fg to 0.4
compartment was replaced by fresh medium containing 0.2% BSA without pg for MT1-MMP, 6 fg to 0.4 pg for ␤3 integrin subunit) were performed, and
FBS. Migration was measured at 37°C in a humidified atmosphere of 95% air these amounts of internal standards were added as competitors to a constant
amount of cDNA prepared from cellular extracted RNAs. PCR products were
and 5% CO2 for 6 or 72 h depending on the cell lines (HT-1080 or HT-144,
separated by agarose gel electrophoresis and quantified by fluorometric scanrespectively). At the end of the incubation period, the cells remaining at the
upper surface of the membrane were removed with a cotton swab. The ning. The steady-state levels of mRNA were calculated as previously described
membranes were fixed with methanol and stained with crystal violet. The (32).
Evaluation of ␣V␤3 Integrin Expression. The expression of the ␣V␤3
number of cells that migrated into the lower compartment of the chamber was
integrin was investigated by Western blot analysis on HT-144 melanoma cell
estimated by measuring the absorbance at 560 nm.
Collagen IV Degradation. Collagen IV degradation by melanoma cells extracts. Cells were grown on culture dishes coated with the different collagen
was evaluated according to two different procedures to check the involvement IV substrates (native or pepsinized ALC type IV collagen, native EHS type IV
of the adhesion process in the induction of collagenase activity: (a) pepsinized collagen, NC1 domain of ALC type IV collagen; all at 25 ␮g/dish) or in the
type IV collagen (25 ␮g/dish), which was used as a degradation substrate, was presence of the ␣1(IV) or ␣3(IV) peptide (5 ␮g/ml) for 48 h. Cell layers were
added under a soluble form into the incubation medium of HT-144 melanoma washed three times with cold saline solution and lysed with 5 ml of hypotonic
cells cultured on plastic. In addition, the different collagen IV forms used as
solution. Cell ghosts were solubilized with 100 ␮l of electrophoresis sample
effectors were added in the incubation medium, all at 25 ␮g/dish (native or buffer and submitted to SDS-PAGE through a 10% polyacrylamide gel under
pepsinized ALC type IV collagen, native EHS type IV collagen, NC1 domain reducing conditions. Proteins were transferred onto an Immobilon membrane
of ALC type IV collagen, ␣3(IV) 185–203 peptide); (b) cells adhered to and (Millipore, Bedford, MA) and revealed with a monoclonal antibody to ␣V␤3
were grown on pepsinized type IV collagen-coated dishes, and the different integrin (clone 23C6) and with a second antibody to mouse IgG coupled to
forms of type IV collagen, used as effectors, were added into the incubation alkaline phosphatase.
medium. In both cases, melanoma cells and dermal fibroblasts were grown for
Expression of the ␤3 integrin subunit gene was also evaluated by compet48 h in MEM containing 0.5% FBS. At the end of the incubation period, itive RT-PCR as described above.
collagen IV degradation was evaluated by measuring 4-hyp-containing pepMeasurement of in Vitro Binding of MMP-2 to Plasma Membrane.
tides liberated into the culture medium. The degradation products of type IV
The inhibitory effect of the ␣3(IV) 185–203 peptide on the binding and
collagen were separated from the nondigested molecules by precipitation with
activation of pro-MMP-2 on the melanoma cell membrane was also inves80% ethanol and quantified in the supernatants obtained by centrifugation at
tigated in an in vitro model. HT-144 melanoma cells were cultured on
10,000 g for 30 min at 4°C. 4-hyp was measured by a fluorometric technique
Biosilon beads (Nunc, Copenhagen, Denmark) in McCoy’s 5A medium
after NBD-Cl derivatization as described elsewhere (30).
without FBS and in the presence of 10 ␮g/ml of the ␣3(IV) 185–203
Collagen IV degradation was also measured under the same experimental
peptide or of its homologous ␣1(IV) 185–203 peptide and were used as a
3
conditions with [ H]-labeled collagen IV as degradation substrate and small
radioactive peptides liberated into the incubation medium were quantified after negative control. Membrane extracts of HT-144 cells covering the culture
beads were obtained by hypo-osmotic lysis, suspended in a 50 mM Tris-HCl
80% ethanol precipitation.
Gelatinase Activity. Gelatinase activity was determined in conditioned buffer containing 0.15 M NaCl and 5 mM CaCl2, and incubated with
media or cell layers by gelatin zymography. Tumor cells were grown on type purified pro-MMP-2 (Calbiochem, Meudon, France; 20 ng/ml) for 2 h at
IV collagen-coated wells in FBS-free medium containing 0.1% BSA for 48 h. 37°C. The beads were then centrifuged at 350 g for 10 min and rinsed twice
The preparation of conditioned media and cell extracts and the determination with cold PBS. The MMP-2 fraction bound to the cell membrane was
desorbed with electrophoresis buffer and analyzed by gelatin zymography
of their gelatinase activity were done as previously described (31).
Evaluation of Expression of Metalloproteinase Genes: RNA Extraction as described above. In several assays, the membrane extracts were previand RT. Cells were grown on collagen IV-coated dishes (native or pepsinized ously incubated for 30 min with an anti-␣V␤3 integrin antibody (clone
ALC type IV collagen, native EHS type IV collagen, NC1 domain of ALC type 23C6; 6 ␮g IgG/ml) before the addition of MMP-2.
Statistical Analyses. Statistical significances were calculated using the
IV collagen; all at 25 ␮g/ml) or in the presence of the ␣1(IV) or ␣3(IV) peptide
(5 ␮g/ml) for 48 h. RNA was extracted with guanidinium/phenol/chloroform Student’s t test. All experiments were done in triplicate, and data represent the
as previously described (32). Total RNA content was measured by an mean ⫾ 1 SD of three different series.
468
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2000 American Association for Cancer
Research.
MMPs INHIBITION BY THE ␣3(IV) COLLAGEN CHAIN
Table 1 Primer pairs of internal standards (competitor) and amplification of GAPDH, MMP-2, TIMP-2, MT1-MMP and ␤3 integrin subunit mRNAs (target)
Protein gene
studied
Amplified
fragment
Size (bp)
Target
452
Competitor
376
Target
629
Competitor
523
Target
382
Competitor
262
Target
365
Competitor
246
Target
701
Competitor
522
Base sequence of the primer
Forward: 5⬘ACCACAGTCCATGCCATCAC3⬘
Reverse: 5⬘TCCACCACCCTGTTGCTGTA3⬘
Forward: 5⬘ACCACAGTCCATGCCATCAC3⬘
Reverse:
5⬘TCCACCACCCTGTTGCTGTAGTGGAGGAGTGGGTGTCGC3⬘
Forward: 5⬘CTGACATTGACCTTGGCACC3⬘
Reverse: 5⬘TAGCCAGTCGGATTTGATGC3⬘
Forward:
5⬘CTGACATTGACCTTGGCACCGGTTCATTTGGCGGACTGTG3⬘
Reverse: 5⬘TAGCCAGTCGGATTTGATGC3⬘
Forward: 5⬘ACATCAAAGTCTGGGAAGGA3⬘
Reverse: 5⬘AGCAGGGAACGCTGGCAGT3⬘
Forward: 5⬘ACATCAAAGTCTGGGAAGGA3⬘
Reverse:
5⬘AGCAGGGAACGCTGGCAGTCCTCCTCGTCCACCTCAATG3⬘
Forward: 5⬘CTCGGCAGTGTGTGGGGTC3⬘
Reverse: 5⬘CGAGAAACTCCTGCTTGGGG3⬘
Forward: 5⬘CTCGGCAGTGTGTGGGGTC3⬘
Reverse:
5⬘CGAGAAACTCCTGCTTGGGGCGGGGAGGAGATGAGCACG3⬘
Forward: 5⬘CGAGTTCCCAGTGAGTGAGG3⬘
Reverse: 5⬘CATGGTAGTGGAGGCAGAGTA3⬘
Forward: 5⬘CGAGTTCCCAGTGAGTGAGG3⬘
Reverse:
5⬘CATGGTAGTGGAGGCAGAGTAACCTCTGGGGCATCTCGGTTC3⬘
GAPDH
MMP-2
MT1-MMP
TIMP-2
␤3 integrin
RESULTS
We have previously demonstrated that a peptide sequence comprising residues 185–203 of the NC1 domain of the ␣3(IV) chain of ALC
type IV collagen supported the attachment of various melanoma cell
lines and inhibited their proliferation (26).
Inhibition of Tumor Cell Migration. Here, using an in vitro
model, we investigated the effect of ALC type IV collagen on HT-144
melanoma and HT-1080 fibrosarcoma cell migration. ALC type IV
collagen induced a 50% inhibition of HT-144 melanoma cell migration, whereas EHS type IV collagen, which does not contain the
␣3(IV) chain, had no effect (Fig. 1). A similar inhibition was noted
with the NC1 domain. Similar results were obtained with HT-1080
cells. When tumor cells were preincubated with a synthetic ␣1(IV)
185–203 peptide arising from a region of the ␣1 chain, similar to that
of the ␣3(IV) chain, tumor cell migration was not inhibited. On the
Fig. 1. Inhibitory effect of ALC type IV collagen or of the ␣3(IV) 185–203 peptide
on HT-144 melanoma cells (hatched bars) or HT-1080 fibrosarcoma cell (gray bars)
migration. Tumor cell migration was measured on Transwell membranes. Polyvinyl
pyrrolidone-free polycarbonate membranes (8 ␮m porosity) were coated with the different
collagen IV forms (20 ␮g/membrane). To test the inhibitory effect of the synthetic
peptides, tumor cells were preincubated for 24 h with the ␣1(IV) or ␣3(IV) synthetic
peptides (5 ␮g/ml) and then deposited onto membranes coated with pepsinized ALC
collagen IV (20 ␮g/membrane). 1, control; 2, native EHS type IV collagen; 3, native ALC
type IV collagen; 4, Pepsinized ALC type IV collagen; 5, NC1 domain from ALC type IV
collagen; 6, ␣1(IV) 185–203 peptide; 7, ␣3(IV) 185–203 peptide. Differences from
control: NS, not significant; ⴱ, P ⬍ 0.01; ⴱⴱ, P ⬍ 0.001.
other hand, preincubation with the ␣3(IV) 185–203 peptide resulted in
50% and 30% inhibition of HT-144 and HT-1080 cell migration,
respectively.
Inhibition of Collagen IV Degradation. When HT-144 melanoma cells were grown on noncoated plastic dishes, they failed to
degrade pepsinized type IV collagen added under a soluble form as a
degradation substrate (0.012 ⫾ 0.003 nmol 4-hyp/ml versus
0.011 ⫾ 0.005 for a control without cells). We did not find significant
differences when cells were incubated in the presence of the various
collagen IV forms, added as effectors in the incubation medium. We
obtained similar results by using [3H]-labeled collagen IV as a substrate (data not shown).
We further investigated the degradative potential of HT-144 adhering to pepsinized collagen IV-coated dishes in the absence (control) or
in the presence of the various collagen IV effectors added in the
medium. Under these experimental conditions, HT-144 cells degraded
pepsinized type IV collagen (5.8 ⫾ 0.1 nmol 4-hyp/ml versus
0.020 ⫾ 0.005 for the control without cells). The addition of native
ALC type IV collagen or its NC1 domain or the ␣3(IV) peptide in the
medium elicited a 50% inhibition of the degradative potential of
melanoma cells but had no influence on that of normal dermal
fibroblasts (Fig. 2). Similar results were obtained using radiolabeled
pepsinized type IV collagen as substratum (data not shown). These
results show that a close contact between collagen IV and melanoma
cells is needed to induce collagen IV degradation, suggesting the
involvement of a collagenolytic enzyme associated with the plasma
membrane in the degradation process.
Inhibition of the Gelatinolytic Potential of Tumor Cells. To
correlate the results obtained on collagen IV degradation by tumor
cells with MMP activity, we studied the gelatinolytic activities of
HT-144 melanoma cells and HT-1080 fibrosarcoma cells by gelatin
zymography. Tumor cells were cultured for 48 h in the absence of
FBS on the various collagen IV forms as described above. Under these
various experimental culture conditions, HT-144 melanoma cells only
secreted gelatinase A (MMP-2) in a latent form (Fig. 3Aa), and
MMP-2 secretion was only slightly affected by the presence of ALC
collagen IV or by the ␣3(IV) 185–203 peptide (Fig. 3Ba). No activation of MMP-2 was found in the incubation medium. Identical
469
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2000 American Association for Cancer
Research.
MMPs INHIBITION BY THE ␣3(IV) COLLAGEN CHAIN
Fig. 2. Inhibitory effect of ALC type IV collagen on collagen IV degradation by
HT-144 melanoma cells (hatched bars) or normal dermal fibroblasts (gray bars). Cells
were grown on pepsinized type IV collagen-coated dishes (25 ␮g/dish) for 48 h in MEM
without FBS. Nondigested type IV collagen was removed by precipitation with 80%
ethanol. The amount of 4-hyp contained in the supernatant was evaluated by a fluorometric technique after derivatization with NBD-Cl. 1, control; 2, native EHS type IV
collagen; 3, native ALC type IV collagen; 4, Pepsinized ALC type IV collagen; 5, NC1
domain from ALC type IV collagen; 6, ␣3(IV) 185–203 peptide (all at 25 ␮g/dish).
Differences from controls: NS, not significant; ⴱ, P ⬍ 0.01; ⴱⴱ, P ⬍ 0.001.
results were obtained with HT-1080 fibrosarcoma cells (Fig. 3, Ab and
Bb).
In contrast, we found a strong decrease of the amount of MMP-2
present in the plasma membrane extracts of HT-144 cells cultured in
the presence of ALC type IV collagen, its NC1 domain, or the ␣3(IV)
185–203 peptide (⫺71.2, ⫺73.3, and ⫺81.5% from the control,
respectively; Fig. 3Ac, Lanes 3, 5, and 6). This decrease was not
observed in the presence of EHS type IV collagen or pepsinized ALC
type IV collagen (⫹2.7 and ⫺15.4% from the control, respectively;
Fig. 3Ac, Lanes 2 and 4), as well as when cells have been incubated
in the presence of the ␣1(IV) 185–203 peptide or the scrambled
peptide corresponding to the ␣3(IV) 185–203 peptide (⫺3.7%
and ⫹ 2.7%, respectively; data not shown).
In the membrane extracts from HT-144 cells, MMP-2 was present
as the latent form of 72 kDa and also as the active form of 64 kDa. The
activation of MMP-2 was largely decreased when the cells were
cultured in the presence of either ALC type IV collagen (⫺79.1%;
Fig. 3Ac, Lane 3), NC1 domain from ALC type IV collagen (⫺77.1%;
Fig. 3A, Lane 5), or the ␣3(IV) 185–203 peptide (⫺69.6%; Fig. 3Ac,
Lane 6). In contrast, the presence in the medium of EHS type IV
collagen or pepsinized ALC type IV collagen increased the activation
of MMP-2 bound to the plasma membrane (⫹29.5 and ⫹25.5%,
respectively; Fig. 3Ac, Lanes 2 and 4, respectively). Similar results
were obtained with HT-1080 cells, and the inhibitory effect affected
both the 64-kDa and the 62-kDa active forms (Fig. 3, Ad and Bd).
The inhibitory effect of ALC type IV collagen or of the ␣3(IV)
185–203 peptide seemed not to depend on variations of TIMP secretion, as measured by reverse zymography (data not shown).
Effect of ALC Type IV Collagen and ␣3(IV) 185–203 Peptide
on MMP Gene Expression. Fig. 4, A and B shows that native ALC
type IV collagen or the ␣3(IV) 185–203 peptide did not elicit any
significant changes in MMP-2 and TIMP-2 gene expression, respectively, as evaluated by competitive RT-PCR.
In contrast, ALC type IV collagen or its NC1 domain or the ␣3(IV)
185–203 peptide triggered a strong inhibition of up to 80% in the
expression of the MT1-MMP (Fig. 4C), whereas EHS type IV collagen or pepsinized ALC type IV collagen had no significant effect
compared to the control, as well as the ␣1(IV) 185–203 peptide
(0.38 ⫾ 0.08 versus 0.40 ⫾ 0.07 for the control). The inhibition of the
MT1-MMP gene correlated well with the decrease observed in the
activation of the MMP-2 fraction bound to the plasma membrane.
Effect of ALC Type IV Collagen and ␣3(IV) 185–203 Peptide
on ␤3 Integrin Gene Expression. To investigate the role of the
␣V␤3 integrin in the binding of MMP-2 to the plasma membrane and
its activation as well as its role in cell migration, we measured the
effect of ALC type IV collagen and the ␣3(IV) 185–203 peptide on
the expression of the ␤3 integrin subunit gene by competitive RTPCR with HT-144 melanoma cells (Fig. 5). We found a significant
inhibition (50%) of the expression of the ␤3 integrin subunit gene
induced by ALC type IV collagen or its NC1 domain and the ␣3(IV)
185–203 peptide, whereas EHS type IV collagen or pepsinized ALC
type IV collagen were without effect. Similar results were obtained by
Northern blot analysis of mRNAs and by evaluating the expression of
the ␤3 integrin subunit by Western blot analyses in membrane extracts
of HT-144 melanoma cells (data not shown).
The inhibitory effect of the ␣3(IV) 185–203 peptide on the binding
and activation of pro-MMP-2 on the plasma membrane was also
investigated in an in vitro model with membrane extracts prepared
from HT-144 melanoma cells cultured on Biosilon beads. When
HT-144 cells have been cultured in the presence of the ␣1(IV)
185–203 peptide, purified pro-MMP-2 bound to membrane extractcoated beads (Fig. 6, Lane 5). In contrast, this binding of pro-MMP-2
was decreased (⫺36%) when cells were cultured in the presence of
the ␣3(IV) 185–203 peptide (Lane 6), suggesting a decrease of potential membrane receptors (MT1-MMP or ␣V␤3 integrin) for
MMP-2 in these extracts. It is likely that a preincubation of membrane
extracts from HT-144 cells with a monoclonal antibody to ␣V␤3
integrin (Lane 8) also induced a large decrease in the binding of
purified pro-MMP-2 (⫺50.7%), reproducing the result obtained with
HT-144 cells cultured in the presence of the ␣3(IV) 185–203 peptide.
DISCUSSION
Modulation of the interactions between the cells and extracellular
matrix involves the action of proteolytic enzymatic systems responsible for hydrolysis of various extracellular matrix components. The
regulation of the integrity and composition of the extracellular matrix
structures by these enzymatic systems controls the signals elicited by
matrix molecules. In the case of tumor cells, matrix molecules modulate cell adhesion, migration, and invasion, as well as their expression of various proteinases. Basement membranes particularly regulate adhesion or migration of tumor cells and their invasive properties
(21). For example, laminin-1 promotes adhesion, spreading, and migration of tumor cells through many short peptide sequences located
along its ␣1 chain (33, 34). Laminin-5 also induces adhesion of
different cell types by binding ␣3␤1 integrin (35, 36). Furthermore,
the cleavage of the laminin-5 molecule by MMP-2 reveals a cryptic
site corresponding to residues 582–593 of the ␥2 chain and induces
cell migration (3). This feature appears to be specific to laminin-5,
which was not known to be a substrate for MMP-2 and is not shared
by type IV collagen, another basement membrane component, which
also modulates cell-matrix interactions. Melanoma cells interact with
different specific peptide sequences located in the triple helix or in the
globular NC1 domain of the ␣1(IV) chain (21, 37, 38). These sequences promote adhesion of tumor cells in a conformation-dependent
manner or depending on a RGDT motif (21, 23, 39). The contact
between tumor cells and type IV collagen involves several integrin
receptors, ␣3␤1 or ␣V␤3, and leads to alterations of the invasive
properties of these cells, usually correlated with changes in the expression of various proteinases and MMPs, such as MMP-1 or
MMP-2 (39 – 41).
We have demonstrated that the peptide sequence corresponding to
residues 185–203 of the ␣3(IV) chain of ALC type IV collagen was
able to inhibit the proliferation of different melanoma, fibrosarcoma,
470
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2000 American Association for Cancer
Research.
MMPs INHIBITION BY THE ␣3(IV) COLLAGEN CHAIN
Fig. 3. Inhibitory effect of ALC type IV collagen and of the ␣3(IV) 185–203 peptide on gelatinase activity of tumor cells. HT-144 melanoma cells
(a and c) and HT-1080 fibrosarcoma cells (b and d)
were grown for 48 h on type IV collagen-coated
dishes (25 ␮g/dish) in the absence of FBS. A,
gelatinolytic activities were evaluated by zymography of incubation media or of membrane extracts
prepared from cell layers. B, the quantification of
the zymograms expressed as a percentage of the
control. 1, plastic; 2, native EHS type IV collagen;
3, native ALC type IV collagen; 4, pepsinized ALC
type IV collagen; 5, NC1 domain from ALC type
IV collagen; 6, ␣3(IV) 185–203 peptide (5 ␮g/ml).
Differences from control significant at: ⴱ,
P ⬍ 0.05; ⴱⴱ, P ⬍ 0.01. f, latent form of MMP-2
(72 kDa). u, active forms of MMP-2 (64 or 62
kDa).
or osteosarcoma cells. This peptide sequence contains an SNS triplet
in position 189 –191, which is unique to the ␣3(IV) chain, and the
replacement of a serine residue by alanine abolishes the inhibitory
activity of this peptide (26). The intact molecule of ALC type IV
collagen shares the same inhibitory activity as the ␣3(IV) 185–203
peptide, whereas EHS type IV collagen, which does not contain the
␣3(IV) chain, has no effect. The fact that the whole molecule shows
the same activity as the synthetic peptide clearly suggests that a
cleavage of the type IV collagen molecule by gelatinases or other
proteinases is not required to reveal the inhibitory activity as it was
described elsewhere for laminin-5 (3). Now, we demonstrate that the
inhibitory activity of native ALC type IV collagen also affects the
invasive potential of HT-144 melanoma cells or HT-1080 fibrosarcoma cells. The ␣3(IV) 185–203 peptide reproduces this inhibition,
whereas the ␣1(IV) 185–203 peptide, which does not contain the SNS
189 –191 triplet, has no effect.
Several MMPs have been implicated in the invasive potential of
melanoma cells and in the degradation of type IV collagen by these
cells (42, 43). The inhibition of type IV collagen degradation by
HT-144 melanoma cells under the influence of ALC type IV collagen
suggests alterations in the secretion or the expression of MMPs by
these cells. This degradative process depends on a cell membranebound fraction of MMP-2, and ALC type IV collagen induces a strong
inhibition of both the amount and the activation of this fraction.
Membrane-bound MMP-2 has been shown to play an important role
in tumor invasion. Pro-MMP-2 binds to the cell membrane through a
complex comprising TIMP-2 and MT1-MMP, in which TIMP-2, via
its COOH-terminal domain, binds to the catalytic domain of MT1MMP (44 – 46). The activation of membrane-bound MMP-2 depends
on MT1-MMP and is regulated by the level of TIMP-2 synthesis
(47– 49). We did not find significant changes in MMP-2 and TIMP-2
secretion into the medium under the influence of ALC type IV
471
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2000 American Association for Cancer
Research.
MMPs INHIBITION BY THE ␣3(IV) COLLAGEN CHAIN
integrin has also been implicated in the tumor progression and cell
migration of various melanoma cells and the tumorigenicity of melanoma
cells correlated with elevated levels of ␣V␤3 integrin expression by these
cells (10, 12). Our results suggest that ALC type IV collagen or the
␣3(IV) 185–203 peptide could regulate melanoma cell migration by
decreasing the expression of the ␤3 integrin subunit.
For invading tissues, tumor cells could regulate the expression of
MMPs and their activators as well as the expression of various
integrins through cell-cell interactions (51). In this paper, we provide
evidence that tumor cells could also regulate the expression of these
enzymatic complexes by cell-matrix interactions when they cross
basement membranes and that the ␣3(IV) collagen chain may play a
role in down-regulating the invasive properties of melanoma cells. In
a previous paper, we have shown that newly synthesized ␣3(IV)
chains were expressed in a large number of bronchogenic and alveolar
tumors, whereas they were undetected in normal bronchi. The deposition of type IV collagen has always been associated with a protective
role and correlates with a good prognosis in squamous cell carcinomas
and in peripheral adenocarcinomas in the lung. These observations
have suggested that the deposition of type IV collagen containing the
␣3(IV) chain might reflect a potentially beneficial reaction of the host
to the neoplasm (52). Thus, the presence of the ␣3(IV) chain within a
basement membrane might increase its resistance against degradation
by tumor cells and tumor invasion.
Fig. 4. Effect of ALC type IV collagen or of the ␣3(IV) 185–203 peptide on the
expression of MMP-2 (A), TIMP-2 (B), and MT1-MMP (C) genes. HT-144 melanoma
cells were grown for 48 h on type IV collagen-coated dishes (25 ␮g/dish) or in the
presence of the ␣3(IV) 185–203 peptide (5 ␮g/ml). MMP-2, TIMP-2, and MT1-MMP
mRNAs were evaluated by competitive RT-PCR and expressed as a ratio to GAPDH
mRNA. 1, control; 2, native EHS type IV collagen; 3, native ALC type IV collagen; 4,
Pepsinized ALC type IV collagen; 5, NC1 domain from ALC type IV collagen; 6, Peptide
␣3(IV) 185–203. Differences from control significant at: ⴱ, P ⬍ 0.05; ⴱⴱ, P ⬍ 0.01.
collagen or the ␣3(IV) 185–203 peptide. In contrast, these effectors
induced a large decrease of the expression of the MT1-MMP gene,
whereas EHS type IV collagen had no effect. This result could explain the
significant decrease in the amount of the membrane-bound MMP-2 and
the decrease in its activation in the presence of the peptide. Another
membrane receptor, the ␣V␤3 integrin, has been implicated in the binding of MMP-2 to the melanoma cell membrane (13). This integrin is a
membrane receptor for extracellular matrix proteins, such as vitronectin,
fibronectin, or type IV collagen (50), but might also serve as a MMP-2
receptor in parallel with the complex MT1-MMP-TIMP-2 (48). ALC
type IV collagen or the ␣3(IV) 185–203 peptide triggers a strong inhibition of the expression of the ␤3 integrin subunit, leading to a decrease
in the MMP-2 amount bound to the cell membrane. In addition, the
preincubation of a cell membrane extract from HT-144 melanoma cells
with a monoclonal antibody to ␣V␤3 integrin also prevents the binding
of pro-MMP-2 to cell membrane extract-coated beads and provides
results very similar to that obtained with intact HT-144 melanoma cells
incubated with the ␣3(IV) 185–203 peptide. Furthermore, the ␣V␤3
Fig. 5. Inhibitory effect of ALC type IV collagen or of ␣3(IV) 185–203 peptide on ␤3
integrin subunit expression. HT-144 melanoma cells were grown for 48 h on type IV
collagen-coated dishes (25 ␮g/ml) or in the presence of the ␣1 or ␣3(IV) 185–203 peptide
(5 ␮g/ml). ␤3 subunit integrin mRNA was evaluated by competitive RT-PCR and
expressed as a ratio to GAPDH mRNA. 1, control; 2, native EHS type IV collagen; 3,
native ALC type IV collagen; 4, pepsinized ALC type IV collagen; 5, NC1 domain from
ALC type IV collagen; 6, ␣3(IV) 185–203 peptide; 7, ␣1(IV) 185–203 peptide. Differences from control significant at: ⴱ, P ⬍ 0.05; ⴱⴱ, P ⬍ 0.01.
Fig. 6.: The ␣3(IV) 185–203 peptide or an anti-␤3 integrin subunit monoclonal
antibody inhibits the binding of pro-MMP-2 on the HT-144 cell membrane. HT-144
melanoma cells were cultured on Biosilon beads as described in “Materials and Methods,”
and gelatinase activities were evaluated by gelatin zymography. 1, cell membrane extract
of the HT-144 cell cultured in the presence of the ␣1(IV) 185–203 peptide (5 ␮g/ml); 2,
cell membrane extract of HT-144 cells cultured in the presence of the ␣3(IV) 185–203
peptide (5 ␮g/ml); 3, pro-MMP-2 (control); 4, pro-MMP-2 incubated with the ␣3(IV)
185–203 peptide; 5, cell membrane extract of HT-144 cells cultured in the presence of the
␣1(IV) 185–203 peptide and incubated with pro-MMP-2; 6, cell membrane extract of
HT-144 cells cultured in the presence of the ␣3(IV) 185–203 peptide (5 ␮g/ml) and
incubated with pro-MMP-2; 7, pro-MMP-2 activated with APMA; 8, cell membrane
extract of HT-144 cells cultured in the presence of the ␣1(IV) 185–203 peptide, preincubated with a monoclonal antibody anti-␣V␤3 integrin, and then incubated with proMMP-2; 9, anti-␣V␤3 integrin monoclonal antibody alone.
472
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2000 American Association for Cancer
Research.
MMPs INHIBITION BY THE ␣3(IV) COLLAGEN CHAIN
ACKNOWLEDGMENTS
We thank C. Perreau and M. Decarme for their technical assistance and Dr.
W. Hornebeck and H. Emonard for helpful discussion.
28.
29.
REFERENCES
30.
1. Lester, B. R., and McCarthy, J. B. Tumor cell adhesion to the extracellular matrix and
signal transduction mechanisms implicated in tumor cell motility, invasion and
metastasis. Cancer Metastasis Rev., 11: 31–34, 1992.
2. Stetler-Stevenson, W. G., Liotta, L. A., and Kleiner, D. E., Jr. Extracellular matrix 6:
role of matrix metalloproteinases in tumor invasion and metastasis. FASEB J., 7:
1434 –1441, 1993.
3. Giannelli, G., Marzillier, J. F., Schiraldi, O., Stetler-Stevenson, W. G., and Quaranta,
V. Induction of cell migration by matrix metalloprotease-2 cleavage of laminin-5.
Science (Washington DC), 277: 225–228, 1997.
4. Massova, I., Kotra, L. P., Fridman, R., and Mobashery, S. Matrix metalloproteinases:
structure, evolution and diversification. FASEB J., 12: 1075–1095, 1998.
5. Liotta, L. A., Steeg, P. S., and Stetler-Stevenson, W. G. Tumor invasion and
metastasis: an imbalance of positive and negative regulation. Cell, 64: 327–336, 1991.
6. Stetler-Stevenson, W. G., Aznavoorian, S., and Liotta, L. A. Tumor cell interactions
with the extracellular matrix during invasion and metastasis. Annu. Rev. Cell Biol.,
9: 541–573, 1991.
7. Sato, H., Takino, T., Okada, Y., Cao, J., Shinagawa, A., Yamamoto, E., and Seiki, M.
A matrix metalloproteinase expressed on the surface of invasive tumor cells. Nature
(Lond.), 370: 61– 65, 1994.
8. Giancotti, F., and Maimiero, F. Integrin-mediated adhesion and signaling in tumorigenesis. Biochim. Biophys. Acta, 1198: 47– 64, 1994.
9. Vanner, J. A., and Cheresh, D. A. Integrins and cancer. Curr. Opin. Cell Biol., 8:
724 –730, 1996.
10. Seftor, R. E. B., Seftor, E. A., Gehlsen, K. R., Stetler-Stevenson, W. G., Brown, P. D.,
Ruoslathi, E., and Hendrix, M. J. C. Role of the ␣V␤3 integrin in human melanoma
cell adhesion. Proc. Natl. Acad. Sci. USA, 89: 1557–1561, 1992.
11. Filardo, E. J., Brooks, P. C., Deming, S. L., Damsky, C., and Cheresh, D. A.
Requirement of the NPXY motif in the integrin ␤3 subunit cytoplasmic tail for
melanoma cell migration in vitro and in vivo. J. Cell Biol., 130: 441– 450, 1995.
12. Albelda, S. M., Mette, S. A., Elder, D. E., Stewart, R., Damjanovich, L., Herlyn, M.,
and Buck, C. A. Integrin distribution in malignant melanoma: association of ␤3
subunit with tumor progression. Cancer Res., 50: 6757– 6764, 1990.
13. Gouon, V., Tucker, G. C., Kraus-Berthier, L., Atassi, G., and Kieffer, N. Up-regulated
expression of the ␤3 integrin and the 92-kDa gelatinase in human HT-144 melanoma
cell tumors in nude mice. Int. J. Cancer, 68: 650 – 662, 1996.
14. Brooks, P. C., Strömblad, S., Sanders, L. C., Von Schalscha, T. L. Aimes, R. T.,
Stetler-Stevenson, W. G., Quigley, J. P., and Cheresh, D. A. Localization of matrix
metalloproteinase MMP-2 to the surface of invasive cells by interaction with integrin
␣V␤3. Cell, 85: 683– 693, 1996.
15. Brooks, P. C., Silletti, S., Von Schalscha, T. L., Friedlander, M., and Cheresh, D. A.
Disruption of angiogenesis by PEX, a noncatalytic metalloproteinase fragment with
integrin binding activity. Cell, 92: 391– 400, 1998.
16. Wisdom, B. J., Jr., Gunwar, S., Hudson, M. D., Noelken, M. E., and Hudson, B. G.
Type IV collagen of Engelbreth-Holm-Swarm tumor matrix: identification of constituent chains. Connect. Tissue Res., 27: 225–234, 1992.
17. Kefalides, N. A., and Alper, R. Collagen: Chemistry, Biology and Biotechnology.
Boca Raton, FL: CRC Press, 1992.
18. Hudson, B. G., Reeders, S. T., and Tryggvason, K. Type IV collagen: structure, gene
organization and role in human disease. J. Biol. Chem., 268: 20177–20180, 1993.
19. Mariyama, M., Leinonen, A., Mochizuki, T. Tryggvason, K., and Reeders, S. T.
Complete primary structure of the human ␣3(IV) collagen chain. Coexpression of the
␣3(IV) and ␣4(IV) collagen chains in human tissues. J. Biol. Chem., 269: 23013–
23017, 1994.
20. Zhou, J., Ding, M., Zhao, Z., and Reeders, S. T. Complete primary structure of the
sixth chain of human basement membrane collagen, ␣6(IV). Isolation of the cDNAs
for ␣6(IV) and comparison with five other type IV collagen chains. J. Biol. Chem.,
269: 13193–13199, 1994.
21. Chelberg, M. K., Tsilibary, E. C., Hauser, A. R., and McCarthy, J. B. Type IV
collagen-mediated melanoma cell adhesion and migration: involvement of multiple,
distinct domains of the collagen molecule. Cancer Res., 49: 4796 – 4802, 1989.
22. Chelberg, M. K., McCarthy, J. B., Skubitz, A. P. N., Furcht, L. T., and Tsilibary, E. C.
Characterization of a synthetic peptide from type IV collagen that promotes melanoma cell adhesion, spreading, and motility. J. Cell Biol., 111: 262–270, 1990.
23. Miles, A. J., Skubitz, A. P. N., Furcht, L. T., and Fields, G. B. Promotion of cell
adhesion by single-stranded and triple-helical peptide models of basement membrane
collagen ␣1(IV) 531–543. J. Biol. Chem., 269: 30939 –30945, 1994.
24. Monboisse, J. C., Bellon, G., Perreau, C., Garnotel, R., and Borel, J. P. Bovine lens
capsule basement membrane collagen exerts a negative priming on polymorphonuclear neutrophils. FEBS Lett., 294: 129 –132, 1991.
25. Monboisse, J. C., Garnotel, R., Bellon, G., Ohno, N., Perreau, C., Borel, J. P., and
Kefalides, N. A. The ␣3 chain of type IV collagen prevents activation of human
polymorphonuclear leukocytes. J. Biol. Chem., 269: 25475–25482, 1994.
26. Han, J., Ohno, N., Pasco, S., Monboisse, J. C., Borel, J. P., and Kefalides, N. A. A
cell binding domain from the ␣3 chain of type IV collagen inhibits proliferation of
melanoma cells. J. Biol. Chem., 272: 20395–20401, 1997.
27. Shahan, T. A., Ziaie, Z., Pasco, S., Fawzi, A., Bellon, G., Monboisse, J. C., and
Kefalides, N. A. Identification of CD47/Integrin-associated Protein and ␣V␤3 as two
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
receptors for the ␣3(IV) chain of type IV collagen on tumor cells. Cancer Res., 59:
4584 – 4590, 1999.
Shahan, T. A., Ohno, N., Pasco, S., Borel, J. P., Monboisse, J. C., and Kefalides, N. A.
Inhibition of tumor cell proliferation by type IV collagen requires increased levels of
cAMP. Connect. Tissue Res., 40: 221–232, 1999.
Kueng, W., Silber, E., and Eppenberger, V. Quantification of cells cultured on
96-well plates. Anal. Biochem., 182: 16 –19, 1989.
Bellon, G., Randoux, A., and Borel, J. P. A study of collagen metabolism in cell
cultures by fluorometric determination of proline and hydroxyproline. Collagen
Related Res., 5: 423– 435, 1985.
Brassart, B., Randoux, A., Hornebeck, W., and Emonard, H. Regulation of matrix
metalloproteinase-2 (gelatinase A, MMP-2), membrane-type matrix metalloproteinase-1 (MT1-MMP) and tissue inhibitor of metalloproteinases-2 (TIMP-2) expression
by elastin-derived peptides in human HT-1080 fibrosarcoma cell line. Clin. Exp.
Metastasis, 16: 489 –500, 1998.
Gillery, P., Georges, N., Randoux, A., Lefèvre, F., Maquart, F. X., and Borel, J. P.
Modulation of protein synthesis by extracellular matrix: potential involvement of two
nucleolar proteins, nucleolin and fibrillarin. Biochem. Biophys. Res. Commun., 228:
94 –99, 1996.
Nakahara, H., Nomizu, M., Akiyama, S. K., Yamada, Y., Yeh, Y., and Chen, W. T.
A mechanism for regulation of melanoma invasion. J. Biol. Chem., 271: 27221–
27224, 1996.
Nomizu, M., Kuratomi, Y., Malinda, K. M., Song, S. Y., Miyoshi, K., Otaka, A.,
Powell, S. K., Hoffman, M. P., Kleinman, H. K., and Yamada, Y. Cell binding
sequences in mouse laminin ␣1 chain. J. Biol. Chem., 273: 32491–32499, 1998.
Rousselle, P., Golbik, R., Van der Rest, M., and Aumailley, M. Structural requirement
for cell adhesion to kalinin (laminin 5). J. Biol. Chem., 270: 13766 –13770, 1995.
Dogic, D., Rousselle, P., and Aumailley, M. Cell adhesion to laminin-1 or 5 induces
clustering of integrins and other focal adhesion components. J. Cell Sci., 111:
793– 802, 1998.
Tsilibary, E. C., Reger, L. A., Vogel, A. M., Koliakos, G. G., Anderson, S. S.,
Charonis, A. S., Alegre, J. N., and Furcht, L. T. Identification of a multifunctional,
cell-binding peptide sequence from the ␣1(NC1) domain of type IV collagen. J. Cell
Biol., 111: 1583–1591, 1990.
Mayo, K. H., Parra-Diaz, D., McCarthy, J. B., and Chelberg, M. Cell adhesion
promoting peptide GVKGDKGNPGWPGAP from the collagen type IV triple helix:
cis/trans proline-induced multiple 1H NMR conformations and evidence for a KG/PG
multiple turn repeat motif in the all-trans proline state. Biochemistry, 30: 8251– 8267,
1991.
Lauer, J. L., Gendron, C. M., and Fields, G. B. Effect of ligand conformation on
melanoma cells ␣3 ␤1 integrin-mediated signal transduction events: implications for
a collagen-structural modulation of tumor cell invasion. Biochemistry, 37: 5279 –
5287, 1998.
Aoyama, A., and Chen, W. T. A 170 kDa membrane-bound protease is associated
with the expression of invasiveness by human malignant melanoma cells. Proc. Natl.
Acad. Sci. USA, 87: 8296 – 8300, 1990.
Seftor, R. E. B., Seftor, E. A., Stetler-Stevenson, W. G., and Hendrix, M. J. C. The
72kDa type IV collagenase is modulated via differential expression of ␣V␤3 and
␣5␤1 integrin during human melanoma cell invasion. Cancer Res., 53: 3411–3415,
1993.
Ray, J. M., and Stetler-Stevenson, W. G. Gelatinase A activity directly modulates
melanoma cell adhesion and spreading. EMBO J., 14: 908 –917, 1995.
Itoh, T., Tanioka, M., Yoshida, H., Yoshioka, T., Nishimoto, H., and Itohara, S.
Reduced angiogenesis and tumor progression in gelatinase A-deficient mice. Cancer
Res., 58: 1048 –1051, 1998.
Emonard, H. E., Remacle, A. G., Noël, A. C., Grimaud, J. A., Stetler-Stevenson,
W. G., and Foidart, J. M. Tumor cell surface associated binding for the Mr 72,000
type IV collagenase. Cancer Res., 52: 5845–5848, 1992.
Zucker, S., Drews, M., Conner, C., Foda, H. D., De Clerck, Y. A., Langley, K. E.,
Bahon, W. F., Docherty, A. J. P., and Cao, J. Tissue inhibitor of metalloproteinase-2
(TIMP-2) binds to the catalytic domain of the cell surface receptor, membrane-type
1 matrix metalloproteinase (MT1-MMP). J. Biol. Chem., 273: 1216 –1222, 1998.
Butler, G. S., Butler, M. J., Atkinson, S. J., Will, H., Tamura, T., Van Westrum, S. S.,
Crabbe, T., Clements, J., D’Ortho, M. P., and Murphy, G. The TIMP2-membrane type
1 metalloproteinase receptor regulates the concentration and efficient activation of
progelatinase A. J. Biol. Chem., 273: 871– 880, 1998.
Strongin, A. Y., Collier, Y., Bannikov, G., Marmer, B. L., Grant, G. A., and
Goldberg, G. I. Mechanism of cell surface activation of 72 kDa type IV collagenase.
J. Biol. Chem., 27: 5331–5338, 1995.
Kinoshita, T., Sato, H., Okada, A., Ohuchi, E., Imai, K., Okada, Y., and Seiki, M.
TIMP-2 promotes activation of progelatinase A by membrane-type 1 matrix metalloproteinase immobilized on agarose beads. J. Biol. Chem., 273: 16098 –16103, 1998.
Itoh, Y., Itoh, A., Iwata, K., Tanzawa, K., Mori, Y., and Nagase, H. Plasma membrane
bound tissue inhibitor of metalloproteinases (TIMP)-2 specifically inhibits matrix
metalloproteinase 2 (gelatinase A) activated on the cell surface. J. Biol. Chem., 273:
24360 –24367, 1998.
Hynes, R. O. Integrins: versatility, modulation of signaling in cell adhesion. Cell, 69:
11–25, 1992.
Menashi, S., Dehem, M., Souliac, I., Legrand, Y., and Fridman, R. Density-dependent
regulation of cell-surface association of matrix metalloproteinase-2 (MMP-2) in
breast carcinoma cells. Int. J. Cancer, 75: 259 –265, 1998.
Polette, M., Thiblet, J., Ploton, D., Buisson, A. C., Monboisse, J. C., Tournier, J. M.,
and Birembaut, P. Distribution of ␣1(IV) and ␣3(IV) chains of type IV collagen in
lung tumours. J. Pathol., 182: 185–191, 1997.
473
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2000 American Association for Cancer
Research.
A Specific Sequence of the Noncollagenous Domain of the α
3(IV) Chain of Type IV Collagen Inhibits Expression and
Activation of Matrix Metalloproteinases by Tumor Cells
Sylvie Pasco, Jing Han, Philippe Gillery, et al.
Cancer Res 2000;60:467-473.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/60/2/467
This article cites 50 articles, 26 of which you can access for free at:
http://cancerres.aacrjournals.org/content/60/2/467.full.html#ref-list-1
This article has been cited by 8 HighWire-hosted articles. Access the articles at:
/content/60/2/467.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2000 American Association for Cancer
Research.