0090-9556/03/3111-1346–1351$7.00
DRUG METABOLISM AND DISPOSITION
Copyright © 2003 by The American Society for Pharmacology and Experimental Therapeutics
DMD 31:1346–1351, 2003
Vol. 31, No. 11
1188/1101142
Printed in U.S.A.
CHARACTERIZATION OF MOUSE SMALL INTESTINAL CYTOCHROME
P450 EXPRESSION
QING-YU ZHANG, DEBBIE DUNBAR,
AND
LAURENCE S. KAMINSKY
New York State Department of Health, Wadsworth Center, Albany, New York
(Received May 30, 2003; accepted July 28, 2003)
This article is available online at http://dmd.aspetjournals.org
ABSTRACT:
The expression of biotransformation enzymes in mouse small intestine is poorly characterized, which limits the utility of transgenic
or knockout mouse models for first-pass drug metabolism studies.
In response, we have systematically examined the composition
and inducibility of cytochrome P450 (P450) protein and mRNA in
mouse small intestinal epithelial cells (enterocytes). RNA-PCR was
conducted to confirm the expression and identity of CYP1A1, 1B1,
2B10, 2B19, 2B20, 2C29, 2C38, 2C40, 2E1, 3A11, 3A13, 3A16, 3A25,
and 3A44 in the enterocytes of untreated mice, but CYP1A2, 2A4/5,
2A12, 2C37, 2C39, and 2F2 were not detected. The inducibility of
CYP2B, 2C, and 3A subfamily forms was determined by real-time
quantitative RNA-PCR. All five CYP3A forms were induced, in a
range from 1.7- to 4.5-fold, by dexamethasone (DEX). Phenobarbital (PB) induced CYP2B9, CYP2B10, and CYP2B20 mRNAs and
suppressed CYP2B19 mRNA levels. PB also induced CYP2C29 and
CYP2C40, but not CYP2C38 mRNA. At the protein level, CYP1A1,
CYP1B1, CYP2B, CYP2C, CYP2E1, and CYP3A were detected in
enterocytes from untreated mice by immunoblot analysis. CYP1A1
was inducible by ␤-naphthoflavone (BNF), CYP2B and CYP2C by
PB, and CYP3A by DEX. CYP2B, 2C, and 3A proteins were all
expressed at high levels proximally, and decreased distally. The
inducibility of CYP1A1 followed a similar pattern. Intestinal P450
expression was compared between C57BL/6 (B6) and 129/sv (129)
mice, strains commonly used in the preparation of transgenic and
knockout mouse models. There was no significant strain difference in constitutive levels or induction patterns for CYP2B, 2C, and
3A protein. However, CYP1A1 was induced to a high level by BNF
in B6 mice, but was not induced in the 129 mice.
Studies during the past 10 years have been increasingly supportive
of a role for the mammalian small intestine as a metabolic organ.
Small intestinal epithelial cells (enterocytes) provide the first site for
metabolism of orally ingested xenobiotics, including therapeutic drugs
(Kaminsky and Fasco, 1992). A variety of phase I and phase II
enzymes are expressed in the small intestine, most prominent of which
are the P450s.1 The expression of the CYP1, 2, and 3 families of this
superfamily of heme proteins in the small intestine provides the
potential for alteration of the efficacy of orally ingested therapeutic
drugs and the toxicity of environmental pollutants.
Considerable recent progress has been made in the identification
and characterization of small intestinal P450s, particularly in rats
(Zhang et al., 1996) and humans (Ding and Kaminsky, 2003). In
contrast, only a few studies on P450 expression profiles in mouse
small intestine have been reported. In the early studies, the presence of mouse small intestinal P450s was inferred from enzyme
activity measurements. Thus, 7,12-dimethyl[a]anthracene hydroxylation (Gentil and Sims, 1971), benzo[a]pyrene hydroxylation (Hietanen and Vainio, 1973;Wiebel et al., 1973), PB-inducible
coumarin dealkylation (Lehrmann et al., 1973), aniline and biphe-
nyl hydroxylations, and ethylmorphine N-demethylation (Chhabra
et al., 1974) were all attributed to P450 activity in mouse enterocytes. Later studies identified P450 expression more specifically in
mouse enterocytes: CYP1A1 was identified following its induction
by BNF (Torronen et al., 1994) and by a polychlorinated biphenyl
mixture, but only in aryl hydrocarbon receptor-positive mice
(Cummings and Schut, 1995); CYP3A was detected in mouse
small intestine by erythromycin and cyclosporine activities and by
Western immunoblots (Berg-Candolfi et al., 1996). Immunoblot
analysis was also used to demonstrate that CYP1A, CYP2B,
CYP2C, and CYP3A subfamilies were induced in mouse small
intestine by a food contaminant, imazalil (Muto et al., 1997);
CYP24 mRNA was induced in mouse small intestine by 1,25dihydroxyvitamin D3 (Yoshimura et al., 1998); and anti-rat
CYP1A, 2C, 2D, 2E1, and 3A antibodies were used in immunoblot
analysis of untreated mouse small intestinal P450 protein expression. Two immunoreactive bands were detected with the CYP3A
antibody, suggesting the expression of two CYP3A forms, but no
positive bands were detected with the other antibodies, possibly
because of inadequate sensitivity (Emoto et al., 2000a). The two
bands apparently corresponded to CYP3A11 and 3A13, based on
subsequent RT-PCR amplification (Sakuma et al., 2000). A mouse
everted sac experimental model of first-pass small intestinal metabolism further confirmed the presence of expressed CYP3A in
the upper and middle sections of mouse small intestine by immunoblot analysis and testosterone 6␤-hydroxylase activities (Emoto
et al., 2000b). In addition, anti-rat CYP2J4 was used to identify
expressed CYP2J in mouse small intestine, and this enzyme was
1
Abbreviations used are: P450, cytochrome P450; B6, C57BL/6; 129, 129/sv;
BNF, ␤-naphthoflavone; RT, reverse transcription; PCR, polymerase chain reaction; DEX, dexamethasone; PB, phenobarbital; Ct, threshold cycle.
Address correspondence to: Dr. Laurence S. Kaminsky, New York State
Department of Health, Wadsworth Center, P.O. Box 509, Albany, NY 12201-0509.
E-mail: [email protected]
1346
1347
MOUSE SMALL INTESTINAL CYTOCHROME P450
inducible by pyrazole (Xie et al., 2000). CYP2C40 has been
identified as the major member of its subfamily expressed in
mouse intestine (Tsao et al., 2000).
The inconsistencies in the published reports on mouse small intestinal P450 expression profiles are possibly a consequence of the use of
differing mouse strains and procedures for isolation of the enterocytes.
The limited knowledge of mouse small intestinal P450 expression is
an impediment to development of directed knockout and transgenic
models for probing small intestinal metabolic capability. In an effort
to systematically characterize the mouse small intestinal P450s, and to
provide background data for studies with small intestinal transgenic
and knockout mice, we have determined the forms of P450 expressed
constitutively in mouse small intestine and the inducibility of these
P450s. Qualitative RNA-PCR, real-time quantitative RNA-PCR, and
immunoblot analysis were used to identify and quantify the levels of
the expressed P450s. Results from C57BL/6 (B6) and 129/sv (129)
mice were compared. These two strains are commonly used in the
preparation of transgenic and knockout mouse models, and background information on strain-selective P450 expression is essential for
assessments of studies using transgenic and knockout mice.
Materials and Methods
Materials. BNF, DEX, peroxidase-conjugated rabbit anti-goat IgG, peroxidase-conjugated goat anti-rabbit IgG, and protease inhibitors were obtained
from Sigma-Aldrich (St. Louis, MO). PB was purchased from J. T. Baker
(Phillipsburg, NJ), the enhanced chemiluminescence kit (ECL) from Amersham Biosciences Inc. (Piscatway, NJ), the bicinchoninic acid protein assay kit
from Pierce Chemical (Rockford, IL), and the TRI Reagent from Molecular
Research Center, Inc. (Cincinnati, OH). The RNA-PCR kit and other PCR
reagents were from Applied Biosystems (Foster City, CA). LightCyclerFastStart DNA Master SYBR Green I was from Roche Applied Science
(Indianapolis, IN).
Treatment of Animals. B6 (male and female) and 129 (male) mice (8 –10
weeks old, ⬃30 g body weight) were obtained from Charles River Laboratories, Inc. (Wilmington, MA). Animals were acclimated for at least 1 week at
22°C with a 12-h on/12-h off light cycle, and allowed free access to water and
food. For induction studies, mice were treated by i.p. administration (once a
day) of an inducing agent for the indicated times and were killed by CO2
overdose. The inducing agents and the doses used were: BNF, 40 mg/kg body
weight for 3 days (in corn oil); PB, 100 mg/kg for 2 days (in saline); and DEX,
80 mg/kg for 3 days (in saline). All studies with mice were approved by the
Institutional Animal Care and Use Committee of the Wadsworth Center.
Isolation of Intestinal Epithelial Cells and Preparation of Microsomes.
Tissues from three mice were combined for each microsomal preparation
unless otherwise specified in the text. Intestinal epithelial cells were isolated by
a scraping technique as described previously (Emoto et al., 2000a), with
modifications. Immediately after excision of the small intestine, the whole
organ was placed in ice-cold phosphate-buffered saline and cut longitudinally,
and then washed with ice-cold buffered saline to remove contents. The intestine was placed in phosphate-buffered saline, pH 7.2, containing 1.5 mM
EDTA, 3 U/ml heparin, and 0.5 mM dithiothreitol for 20 min to loosen the
mucosa before the cells were scraped free. The scraped cells were placed into
the buffer and pelleted by spinning at 2,000g for 10 min at 4°C. The pelleted
cells were washed twice with a solution containing 5 mM histidine, 0.25 M
sucrose, 0.5 mM EDTA, and 230 ␮M phenylmethylsulfonyl fluoride. Microsomes were prepared from small intestinal epithelial cells as previously reported (Fasco et al., 1993), with the modification of including additional
protease inhibitors [aprotinin (2 ␮g/ml), leupeptin (10 ␮M), pepstatin (1 ␮M),
and L-trans-epoxysuccinyl-leucylamide-(4-guanido)-butane (5 ␮M)] in the
microsome storage buffer. Liver microsomes were prepared as previously
described (Fasco et al., 1993) with use of additional protease inhibitors as
indicated above. Microsomes were stored at ⫺80°C before use. Microsomal
protein concentrations were determined with bovine serum albumin as the
standard. The yield of enterocyte microsomes per mouse was 3 to 5 mg.
Immunoblot Analysis. Hepatic and small intestinal microsomal proteins
were separated on NuPAGE Bis-Tris gels (10%) (Invitrogen, Carlsbad, CA).
Proteins were electrophoretically transferred to nitrocellulose membranes
(Towbin et al., 1979), which were then treated with 5% nonfat dry milk in 20
mM Tris-HCl buffer, pH 7.4, containing 0.15 M NaCl and 0.05% Tween 20 for
1 h at room temperature, incubated with a primary antibody in this buffer
containing 5% milk for an additional 1 h or overnight at 4°C, washed with the
buffer, and then incubated with a secondary antibody at 1:10,000 dilution in
the buffer containing 2.5% milk. Primary polyclonal antibodies to rat
CYP1A1/2, CYP2B1, CYP2C6, and CYP3A2, and to human CYP1B1 were
purchased from BD Biosciences-Discovery Labware (Bedford, MA). Polyclonal antibody to human CYP2E1was purchased from Oxford Biomedical
Research (Oxford, MI). These antibodies cross-react with mouse P450s but
have not been characterized for their specificity. Differentiation among these
P450 forms was based on RNA-PCR results. The secondary antibody used was
peroxidase-labeled rabbit anti-goat IgG or goat anti-rabbit IgG, and was
detected with an enhanced chemiluminescence kit. In some experiments, the
optical density of detected bands was determined using a Personal Densitometer SI (Amersham Biosciences Inc.).
RNA Isolation and Qualitative RNA-PCR. Total RNA from mouse small
intestinal epithelial cells was isolated with TRI Reagent according to the
manufacture’s instructions. RNA concentration and purity were determined
spectrally, and the integrity of the RNA samples was assessed by ethidium
bromide staining following agarose gel electrophoresis. RNA-PCR was performed using standard protocols as described in the instructions for the
GeneAmp RNA PCR Core (Applied Biosystems) kit, and with a 9600 thermal
cycler (PerkinElmer Instruments, Norwalk, CT). First-strand cDNA was synthesized with 1 ␮g of total RNA from small intestinal enterocytes and 2.5 ␮M
oligo(dT)16 primer in a total volume of 20 ␮l. The PCR reactions were
performed for 35 cycles with a 15-s denaturation at 94°C, 30 s at an optimal
annealing temperature, which differed for the various P450 forms, and 30-s
extension at 72°C. PCR primers, with either previously published or newly
designed sequences using the Seqweb program, were synthesized by the
Molecular Genetics Core Facility of the Wadsworth Center. Primer sequence
and optimal annealing temperatures are as shown in Table 1. PCR products
were analyzed on an agarose gel, with use of a 100-base pair marker (Invitrogen) for size determination.
Real-Time Quantitative RNA-PCR Analysis. Quantitation of each form
in the CYP3A, 2B, and 2C subfamilies was carried out using the LightCycler
and FastStart DNA Master SYBR Green I kit (Roche Applied Science). RT
was performed as described above. The primers used were the same as
described earlier. PCR was performed according to the kit instructions. PCR
mixtures contained 2 ␮l of FastStart DNA Master SYBR Green I, 4 mM
MgCl2 (except for CYP2B19, where 2 mM MgCl2 was used), an 0.5 ␮M
concentration of each primer, and 4 ␮l of an undiluted or diluted (10- to
1000-fold) RT product in a total volume of 20 ␮l. Reactions were initiated with
a denaturation/Taq activation step at 95°C for 10 min, followed by 45 cycles
of 95°C for 5 s, 60°C for 15 s, and 72°C for 30 s. The specificity of the PCR
products was confirmed by melting-curve analysis and ethidium bromide
staining following agarose gel electrophoresis. Quantification and melting
temperature determination were carried out using the LightCycler data analysis
software (Roche Applied Science). A standard curve was generated by plotting
the threshold cycle (Ct) value versus the log of the amount of input RNA
equivalent (0.1–100 ng calculated from the dilution factor of the RT products).
The fold change in the level of a P450 form (target gene) between induced and
untreated small intestine samples, corrected by the level of ␤-actin, was
determined using the following equation: Fold change ⫽ 2⫺⌬(⌬Ct), where
⌬Ct ⫽ Ct(target) ⫺ Ct(␤-actin) and ⌬(⌬Ct) ⫽ ⌬Ct(induced) ⫺ ⌬Ct(untreated).
Results
The constitutive expression of several P450 forms and their induction
by several known P450 inducers in B6 mouse small intestine were
examined by immunoblot analysis, with antibodies to rat CYP1A1/1A2,
2B1, 2C6, or 3A2, or to human CYP1B1 or CYP2E1. Since the antibodies to CYP2B1, CYP2C6, and CYP3A2 crossreact with different
forms in the same subfamily, the signals detected represent the sum of
several forms of the indicated subfamily. The antibodies to rat CYP1A1/
1A2 react with both mouse CYP1A1 and CYP1A2, which were resolved
on gels. CYP1A1 was expressed at very low levels in mouse small
1348
ZHANG ET AL.
TABLE 1
Nucleotide sequences of PCR primers
P450
Form
1A1
1A2
1B1
2B9
2B10
2B19
2B20
2C29
2C37
2C38
2C39
2C40
2E1
2F2
2A4/5
2A12
3A11
3A13
3A16
3A25
3A44
␤-Actin
Sequences (5⬘/3⬘)
Predicted
Product Size
Forward/Reverse
base pairs
°C
356
359
527
311
311
336
319
130
273
214
285
271
529
815
318
318
425
498
429
565
472
513
48
48
54
53
53
56
56
54
54
52
55
56
48
58
50
50
54
55
54
55
56
55
AGATCCAGGAGGAACTAGAC/CTCTCCGATGCACTTTCGCTTGC
AAGATCCATGAGGAGCTGGA/TCCCCAATGCACCGGCGCTTTCC
AGCCTGAACAAAAGAAGCCCTC/CAAATCACCGTCCCAGCCTTAC
TGAAGCTTTTCTGCCCTTCT/GTGTGAGCAGCTACCAATGG
TGAAGCTTTTCTGCCCTTCT/TGGAGACATGCAATAGGAGG
TGCAACCAAAACACCCCCACA/CATGACCCTCCAACACAACAC
TACCAACCCTTGATGACCGCAC/CGGGCAATGCTTTCACCAAGAC
GGGCTCAAAGCCTACTGTCA/AACGCCAAAACCTTTAA
ATACTCTATATTTGGGCAGG/GTTCCTCCACAAGGCAAC
TTGCCTTCTGTAATCCCCC/TCTAACGCAGGAATGGATAAAC
GGAGACAGAGCTGTGGC/TAAAAACAATGCCAAGGCCG
CATTGAACACTGGCAACATTG/GTCACAGGTTACTTCATGCAC
GCGGTTCTTGGCATCACCGT/GCAGGGTGCACAGCCAATCA
GACCCACTGAGCCACTTCAA/CACCTTTGTCACGTCATTCTTT
TCTGTTGCTCATGAAGTACC/TTGTCATCTAGGAAGTGCTT
CCTGCTACTAATGAAGCATC/TTGTCATCCAGGAAGTGCTG
GACAAACAAGCAGGGATGG/AATGTGGGGGACAGCAAAG
GACCTGATCCCAAACTTTTCC/TCCTTCTCCTAATCCCTGCC
TGCAGACAGACAAGCAGAG/AATGTGGGGGACAGCAAAG
ATCCCTGCAAGACTCTCAGC/CCCTTTCTCTTCTTCTCGTCTC
TCACACATACATCTGGAGGGGG/GTGAATGTGGGGGACAGCAAAG
GCCCAGAGCAAGAGAGGTAT/GGCCATCTCCTGCTCGAAGT
intestine (long exposures were required; data not shown), but as shown in
Fig. 1, its expression was markedly induced by BNF. In the liver,
constitutive expression of CYP1A1 and CYP1A2 was also not detectable
(Fig. 1), although CYP1A2 was detected in untreated animals after
extended exposure of the film (data not shown). However, both CYP1A1
and 1A2 were induced by BNF treatment. CYP2B and 2C were abundantly expressed in mouse small intestine and liver, and their expression
was further enhanced by PB in both organs. CYP2B appeared as two
bands in the liver samples, which may represent multiple forms in the
CYP2B subfamily. Only one of these bands was detected in the small
intestine sample. CYP3A was also expressed at relatively high levels that
were further enhanced by DEX, in both small intestine and liver. These
immunoblot analysis results from B6 male mice are summarized in Table
2. As previously indicated, CYP2B, CYP2C, and CYP3A were all readily
detected in the small intestines of untreated and induced animals. CYP1A
and CYP2E1 were detected as weak signals in the small intestine of
untreated mice. All of these P450 forms were also detected in mouse
liver, which was used as a positive control (data not shown). Although the
signals were very weak, CYP1B1was detectable in mouse small intestine,
and could be induced by BNF (data not shown).
To confirm the expression and identity of P450 forms in mouse
small intestine, RNA-PCR experiments were conducted to detect
P450 mRNA in total RNA from intestinal epithelial cells of untreated
B6 male mice. PCR products were analyzed by agarose gel electrophoresis, and the results are summarized in Table 2. Primers specific
for CYP1A1, CYP1B1, CYP2B10, CYP2B19, CYP2B20, CYP2C29,
CYP2C38, CYP2C40, CYP2E1, CYP3A11, CYP3A13, CYP3A16,
CYP3A25, and CYP3A44 all produced bands of the predicted size,
although CYP1A1 and CYP2E1 signals were very weak. In contrast,
mRNAs for CYP1A2, CYP2A4/5, CYP2A12, CYP2C37, CYP2C39,
and CYP2F2 were undetectable by ethidium bromide staining of the
gel. These P450 forms were all detected in RNA samples from mouse
liver under identical conditions, indicating that the primer pairs are
capable of amplifying the specific forms. CYP2B9 mRNA was detected only in PB-induced mouse small intestine samples.
Real-time PCR was performed to quantify the relative mRNA
levels of each form in total RNA samples prepared from untreated and
induced B6 male mouse small intestine, in an effort to determine the
Annealing
Temp
References
Seree et al., 1996
Seree et al., 1996
Damon et al., 1996
Damon et al., 1996
Luo et al., 1998
Luo et al., 1998
Luo et al., 1998
Luo et al., 1998
Seree et al., 1996
Ye et al., 1997
Nakamura et al., 1998
Nakamura et al., 1998
Damon et al., 1996
extent of induction for each form. A linear standard curve was
generated for each primer pair from a serial dilution of the RT
products (as templates) of the RNA samples prepared from the small
intestine of untreated mice. The accuracy of quantitation was assured
by ensuring that the amounts of PCR products detected in the experimental groups fell within the linear range of PCR amplification. The
␤-actin mRNA level, which was also determined in the same fashion
in each RNA sample, was used as an internal control to normalize the
RNA levels from different samples. The extent of induction for each
form was determined as described under Materials and Methods.
Melting-curve analysis showed that each primer pair amplified a
single predominant product, which was not detected in the H2O
(no-template) control. The size of the PCR product was confirmed by
agarose gel electrophoresis (data not shown). As shown in Fig. 2, the
mRNA levels of all five forms in the CYP3A subfamily were induced
by DEX treatment, and the extent of induction ranged from 1.7- to
4.5-fold. CYP2B10 and CYP2B20 mRNAs were both induced about
10-fold, whereas the CYP2B19 mRNA level was repressed by about
50-fold after PB treatment (data not shown). CYP2B9 mRNA was
also induced markedly by PB, but the extent of induction could not be
quantified due to the very low constitutive level. CYP2C40 mRNA
was induced about 5-fold by PB treatment, whereas CYP2C38 mRNA
showed no induction. CYP2C29 mRNA was induced over 200-fold
from its very low constitutive level.
To examine the distribution of P450s along the length of the small
intestine, the entire length of the small intestine was divided equally
into six segments, with segment 1 being proximate to the pylorus and
segment 6 proximate to the ileum. Figure 3 shows the immunoblot
analysis of microsomal preparations from the different intestinal segments of untreated B6 male mice or BNF-induced B6 male mice. The
expressed protein levels along the length of the small intestine for
CYP3A, 2B, and 2C were examined using enterocyte microsomes
from untreated mice, whereas CYP1A1 expression was examined
after BNF induction, due to the very low constitutive level of
CYP1A1 in mouse small intestine. The results show that all P450
forms examined occur at high concentrations at the proximal end of
the small intestine and decrease toward the distal end. The induced
1349
MOUSE SMALL INTESTINAL CYTOCHROME P450
TABLE 2
Detection of P450 mRNAs and proteins in mouse small intestine
P450 mRNA expression was detected by RNA-PCR. P450 protein expression was
detected by immunoblotting analysis.
P450
Form
mRNA
(Constitutive)
1A1
1A2
1B1
2A4/5
2A12
2B9b
2B10
2B19
2B20
2C29
2C37
2C38
2C39
2C40
2E1
2F2
3A11
3A13
3A16
3A25
3A44
⫹
⫺
⫹
⫺
⫺
⫹
⫹
⫹
⫹
⫹
⫺
⫹
⫺
⫹
⫹
⫺
⫹
⫹
⫹
⫹
⫹
Protein
Constitutive
Induced
⫹(weak)
⫹⫹⫹a(BNF)
⫹(weak)
⫹ (BNF)
⫹(CYP2B)
⫹⫹ (PB)
⫹(CYP2C)
⫹⫹ (PB)
⫹
ND
⫹(CYP3A)
⫹⫹ (DEX)
⫹, positive detection of DNA fragments of predicted size or P450-immunoreactive band; ⫺,
product of predicted size or immunoreactive band not detected. ND, not determined.
a
⫹, low induction from very low constitutive expression; ⫹⫹, 3- to 5-fold induction; ⫹⫹⫹,
⬎10-fold induction
b
CYP2B9 can only be detected in PB-treated mice.
FIG. 1. Immunoblot analysis of P450 proteins expressed in the liver and small
intestinal epithelial cells of untreated or induced B6 mice.
Induction was by i.p. administration of BNF (40 mg/kg for 3 days), PB (100
mg/kg for 2 days), or DEX (80 mg/kg for 3 days). Microsomal samples from mouse
liver and small intestinal epithelial cells were resolved by electophoresis on NuPAGE Bio-Tris gels, transferred to nitrocellulose membrane, and examined immunochemically with goat antisera to CYP1A1/2 (1:500 dilution), CYP2B, CYP2C,
and CYP3A (1:2,000 dilution), as described under Materials and Methods. Microsomal proteins were applied at 2.5 ␮g per lane (panels A and C) or 5 ␮g per lane
(panels B and D) for liver microsomes, and 10 ␮g per lane (panels B and D) or 25
␮g per lane (panels A and C) for intestinal microsomes. UT indicates samples from
untreated mice. F, female mice; M, male mice.
CYP1A1 expression also occurs at the highest level at the proximal
end and decreases distally.
Since the 129 mouse strain is used extensively as a source of
embryonic stem cells for creating knockout mice, we further examined the strain differences between B6 and 129 mice with respect to
small intestinal P450 expression. There were no marked and consistent differences in the constitutive levels of CYP2B, CYP2C, and
CYP3A in the small intestine between, B6 and 129 male mice (Fig. 4).
B6 mice expressed slightly higher CYP1A1 levels in intestinal microsomes than did 129 mice, whereas 129 mice had slightly higher
CYP1A2 in the liver than did B6 mice (Fig. 5). However, CYP1A1
can be induced to a very high level in B6 small intestine, but was not
induced in the small intestine of 129 mice (Fig. 4). The induction
patterns were very similar in both strains for CYP2B, CYP2C, and
CYP3A (Fig. 4).
FIG. 2. Real-time quantitative RNA-PCR analysis of P450 mRNA levels for
CYP2B, CYP2C, and CYP3A subfamilies in B6 male mouse small intestine.
First-strand cDNA was synthesized from total RNA extracted from mouse small
intestinal epithelial cells. cDNA fragments were amplified and quantitated using a
LightCycler as described under Materials and Methods. Duplicate reactions were
performed for each experiment, and the values presented are the means of two or
three independent experiments.
Discussion
These studies provide an in-depth assessment of which P450 forms
in families 1, 2, and 3 are expressed in the mouse small intestine, and
of their potential for induction. The data provide a foundation for
evaluation of the role of the small intestinal xenobiotic metabolism
machinery in altering the systemic uptake of drugs and in modifying
1350
ZHANG ET AL.
FIG. 3. Distribution of P450 proteins along the length of B6 male mouse small
intestine.
Each segment represents approximately one-sixth of the length of the small
intestine, with segment 1 proximate to the pyloric valve and segment 6 proximate
to the ileum. Microsomes prepared from each intestinal segment from untreated
mice or BNF-treated mice (for CYP1A1 detection) were subjected to immunoblot
analysis with an antiserum to CYP2B, CYP2C, CYP3A, or CYP1A1/2, as described
in the legend to Fig. 1.
the toxicity of orally ingested pollutants. Additionally, the data will
facilitate the development of knockout and transgenic mouse models
for probing these roles and will permit comparisons of the small
intestinal xenobiotic metabolic capacity of the mouse relative to that
of humans and the rat, for application to risk assessments.
The approach of using qualitative RNA-PCR to identify specific
P450 mRNA expression, and real-time RNA-PCR and immunoblot
analysis to quantify P450 mRNA and protein-constitutive and -induced expression, has documented the small intestinal expression of a
total of 15 P450s out of the 21 investigated.
To date, 60 forms of family 1, 2, and 3 P450 genes have been
identified in the mouse genome (http://drnelson.utmem.edu/MOU.html). They comprise three family 1 members in subfamilies a and b;
49 family 2 members in subfamilies a through g, j, r through u, and w;
and eight family 3 members in subfamily a. From this group of P450s,
we selected those 21 forms for our study that have been previously
investigated. We excluded those forms for which sequence data constitute the only available information. Additionally, we excluded the
CYP2J subfamily, which has been previously reported on by our
group (Xie et al., 2000), and CYP2G1, which is not expressed in the
mouse small intestine (Hua et al., 1997).
A large percentage (71%) of the P450 forms investigated in this
study were expressed at the mRNA level in the small intestine.
Because of the lack of specific antibodies for the mouse P450s, we
were unable to identify, by immunoblot analysis, the majority of the
specific forms that were also detectably expressed at the protein level
in the intestine. However, our data do indicate that CYP1A1, 1B1, and
2E1, and members of the CYP2B, 2C, and 3A subfamilies, are all
expressed constitutively at the protein level in the mouse small intestine. In similar studies of human small intestinal P450 mRNA,
CYP1A1, 1B1, 2C, 2D6, 2E1, 3A4, 3A5 (Zhang et al., 1999), 2S1
(Rylander et al., 2001), 4F12 (Hashizume et al., 2001), and 2J2
(Zeldin et al., 1997) were all expressed. However, based on immunoblot and activity assay results, a more limited array of P450 protein
expression in the human small intestine has been reported, including
CYP3A4, 1A1 (Zhang et al., 1999), 2C9, 2C19 (Obach et al., 2001),
FIG. 4. Induction of P450 proteins expressed in small intestinal epithelial cells
of B6 and 129 male mice.
The mice were treated with BNF (40 mg/kg for 3 days), PB (100 mg/kg for 2
days), or DEX (80 mg/kg for 3 days). Microsomes were prepared from mouse small
intestine of either untreated or treated animals and subjected to immunoblot analysis
with an antiserum to CYP2B, CYP2C, CYP3A, or CYP1A1/2, as described in the
legend to Fig. 1. UT, sample from untreated mice; SI, small intestine.
2D6 (Madani et al., 1999), 3A5 (Lin et al., 2002), 2S1 (Rylander et al.,
2001), 4F12 (Hashizume et al., 2001), and 2J2 (Zeldin et al., 1997).
The diminishing levels of constitutive CYP2B, 2C, and 3A subfamily proteins and BNF-induced CYP1A1 protein expression, as a
function of distance along the small intestine, distally from the duodenum to the ileum, is similar to the P450 expression patterns in
humans (Zhang et al., 1999) and rats (Zhang et al., 1996; 1997).
Glutathione S-transferases also exhibit a similar decreasing gradation
of expression profiles along the length of the human small intestine
(Coles et al., 2002). These observations, together with the fact that
total microsomal protein exhibits a similar decreasing concentration
gradient, distally along the length of the human small intestine (Zhang
et al., 1999), suggest that the decreasing expression of the P450s along
the small intestine may be a general phenomenon, at least for proteins
associated with the endoplasmic reticulum.
The increasing use of organ-directed gene knockout and transgenic
mice to address issues of the roles of organ-specific xenobiotic metabolism and toxicity has created a need for the determination of the
expression profiles of relevant genes in the organ of interest. Addi-
MOUSE SMALL INTESTINAL CYTOCHROME P450
FIG. 5. Expression of CYP1A proteins in the liver and small intestinal epithelial
cells of B6 and 129 male mice.
Microsomes were prepared from liver and small intestine of untreated mice (n ⫽
4). Samples were subjected to immunoblot analysis with antiserum to CYP1A1/2 as
described in the legend to Fig. 1. Microsomal proteins were applied at 5 ␮g per lane
for liver samples and 15 ␮g per lane for small intestine samples. The intensity of
immunoreactive CYP1A1 (SI) or CYP1A2 (liver) bands (overexposed compared
with Figs. 1 and 4) was quantitated by densitometry to yield the data depicted
graphically in panel B.
tionally, comparisons of wild-type and knockout or transgenic mice
must incorporate potential expression differences in the mouse strains
involved in the production of the knockout mice. We have thus
compared small intestinal P450 expression profiles for B6 and 129
mice. Whereas CYP2B, 2C, and 3A subfamily member expression,
both constitutively and following induction, was similar in the two
mouse strains, constitutive CYP1A1 expression was significantly
lower in 129 mice. The latter observation may be an artifact of the
induction of small intestinal CYP1A1 in B6 mice by dietary factors
(Zhang et al., 1997). More notably, BNF markedly induced small
intestinal CYP1A1 in B6 mice, but it did not induce this form in 129
mice. The mechanism for this difference is associated with a low
affinity aryl hydrocarbon receptor allele in the 129 mice (Poland et al.,
1994). These studies indicate that there are differences in the P450
expression profiles of 129 and B6 mice and that extensive studies
must be undertaken to reveal such differences.
Acknowledgments. We are grateful to Jill Panetta for preparation
of the manuscript. The Molecular Genetics Core of the Wadsworth
Center is acknowledged for the preparation of oligonucleotide primers.
References
Berg-Candolfi M, Candolfi E, and Benet LZ (1996) Suppression of intestinal and hepatic
cytochrome P4503A in murine Toxoplasma infection. Effects of N-acetylcysteine and N(G)monomethyl-L-arginine on the hepatic suppression. Xenobiotica 26:381–394.
Chhabra RS, Pohl RJ, and Fouts JR (1974) A comparative study of xenobiotic-metabolizing
enzymes in liver and intestine of various animal species. Drug Metab Dispos 2:443– 447.
Coles BF, Chen GP, Kadlubar FF, and Radominska-Pandya A (2002) Interindividual variation
and organ-specific patterns of glutathione S-transferase alpha, mu and pi expression in
gastrointestinal tract mucosa of normal individuals. Arch Biochem Biophys 403:270 –276.
Cummings DA and Schut HAJ (1995) Inhibitory effect of dietary 4-ipomeanol on DNA adduct
formation by the food mutagen 2-amino-3-methylimidazo[4,5-F]quinoline (IQ) in male CDF1
mice. Carcinogenesis 16:2523–2529.
1351
Damon M, Fautrel A, Guillouzo A, and Corcos L (1996) Genetic analysis of the phenobarbital
regulation of the cytochrome P-450 2b-9 and aldehyde dehydrogenase type 2 mRNAs in
mouse liver. Biochem J 317:481– 486.
Ding X and Kaminsky LS (2003) Human extrahepatic cytochrome P450: function in xenobiotic
metabolism and tissue-selective chemical toxicity in the respiratory and gastrointestinal tracts.
Annu Rev Pharmacol Toxicol 43:149 –173.
Emoto C, Yamazaki H, Yamasaki S, Shimada N, Nakajima M, and Yokoi T (2000a) Characterization of cytochrome P450 enzymes involved in drug oxidations in mouse intestinal
microsomes. Xenobiotica 30:943–953.
Emoto C, Yamazaki H, Yamasaki S, Shimada N, Nakajima M, and Yokoi T (2000b) Use of
everted sacs of mouse small intestine as enzyme sources for the study of drug oxidation
activities in vitro. Xenobiotica 30:971–982.
Fasco MJ, Silkworth JB, Dunbar DA, and Kaminsky LS (1993) Rat small intestinal cytochromes
P450 probed by warfarin metabolism. Mol Pharmacol 43:226 –233.
Gentil A and Sims P (1971) The metabolism of 7,12-dimethylbenz(a)anthracene by homogenates
of the stomach and small intestine of mice. Cancer Res Clin Oncol 76:223–230.
Hashizume T, Imaoka S, Hiroi T, Terauchi Y, Fujii T, Miyazaki H, Kamataki T, and Funae Y
(2001) CDNA cloning and expression of a novel cytochrome P450 (CYP4F12) from human
small intestine. Biochem Biophys Res Commun 280:1135–1141.
Hietanen E and Vainio H (1973) Interspecies variations in small intestinal and hepatic drug
hydroxylation and glucuronidation. Acta Pharm Toxicol 33:57– 64.
Hua Z, Zhang Q-Y, Su T, Lipinskas TW, and Ding X (1997) cDNA cloning, heterologous
expression and characterization of mouse CYP2G1, an olfactory-specific steroid hydroxylase.
Arch Biochem Biophys 340:208 –214.
Kaminsky LS and Fasco MJ (1992) Small intestinal cytochromes P450. Crit Rev Toxicol
21:407– 422.
Lehrmann C, Ullrich V, and Rummel W (1973) Phenobarbital inducible drug monooxygenase
activity in the small intestine of mice. Naunyn-Schmiedeberg’s Arch Pharmacol 276:89 –98.
Lin SY, Dowling AL, Quigley SD, Farin FM, Zhang J, Lamba J, Schuetz EG, and Thummel KE
(2002) Co-regulation of CYP3A4 and CYP3A5 and contribution to hepatic and intestinal
midazolam metabolism. Mol Pharmacol 62:162–172.
Luo G, Zeldin DC, Blaisdell JA, Hodgson E, and Goldstein JA (1998) Cloning and expression
of murine CYP2Cs and their ability to metabolize arachidonic acid. Arch Biochem Biophys
357:45–57.
Madani S, Paine MF, Lewis L, Thummel KE, and Shen DD (1999) Comparison of CYP2D6
content and metoprolol oxidation between microsomes isolated from human livers and small
intestines. Pharm Res (NY) 16:1199 –1205.
Muto N, Hirai H, Tanaka T, Itoh N, and Tanaka K (1997) Induction and inhibition of cytochrome
P450 isoforms by imazalil, a food contaminant, in mouse small intestine and liver. Xenobiotica
27:1215–1223.
Nakamura M, Imaoka S, Amano F, and Funae Y (1998) P450 isoforms in a murine macrophage
cell line, RAW264.7 and changes in the levels of P450 isoforms by treatment of cells with
lipopolysaccharide and interferon-gamma. Biochim Biophys Acta 1385:101–106.
Obach RS, Zhang QY, Dunbar D, and Kaminsky LS (2001) Metabolic characterization of the
major human small intestinal cytochrome P450s. Drug Metab Dispos 29:347–352.
Poland A, Palen D, and Glover E (1994) Analysis of the four alleles of the murine aryl
hydrocarbon receptor. Mol Pharmacol 46:915–921.
Rylander T, Neve EP, Ingelman-Sundberg M, and Oscarson M (2001) Identification and tissue
distribution of the novel human cytochrome P450 2S1 (CYP2S1). Biochem Biophys Res
Commun 281:529 –535.
Sakuma T, Takai M, Endo Y, Kuroiwa M, Ohara A, Jarukamjorn K, Honma R, and Nemoto N
(2000) A novel female-specific member of the CYP3A gene subfamily in the mouse liver.
Arch Biochem Biophys 377:153–162.
Seree EM, Villard PH, Re JL, De Meo M, Lacarelle B, Attolini L, Dumenil G, Catalin J, Durand
A, and Barra Y (1996) High inducibility of mouse renal CYP2E1 gene by tobacco smoke and
its possible effect on DNA single strand breaks. Biochem Biophys Res Commun 219:429 – 434.
Torronen R, Karenlampi S, and Pelkonen K (1994) Hepa-1 enzyme induction assay as an in vitro
indicator of the CYP1A1-inducing potencies of laboratory rodent diets in vivo. Life Sci
55:1945–1954.
Towbin H, Staehelin T, and Gordon J (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci
USA 76:4350 – 4354.
Tsao CC, Foley J, Coulter SJ, Maronpot R, Zeldin DC, and Goldstein JA (2000) CYP2C40, a
unique arachidonic acid 16-hydroxylase, is the major CYP2C in murine intestinal tract. Mol
Pharmacol 58:279 –287.
Wiebel FJ, Leutz JC, and Gelboin HV (1973) Aryl hydrocarbon (benzo(a)pyrene) hydroxylase:
inducible in extrahepatic tissues of mouse strains not inducible in liver. Arch Biochem Biophys
154:292–294.
Xie Q, Zhang QY, Zhang Y, Su T, Gu J, Kaminsky LS, and Ding X (2000) Induction of mouse
CYP2J by pyrazole in the eye, kidney, liver, lung, olfactory mucosa and small intestine, but
not in the heart. Drug Metab Dispos 28:1311–1316.
Ye X, Lu L, and Gill SS (1997) Suppression of cytochrome P450 Cyp2f2 mRNA levels in mice
by the peroxisome proliferator diethylhexylphthalate. Biochem Biophys Res Commun 239:
660 – 665.
Yoshimura T, Itoh S, Tsujikawa K, Yamada E, Ishii T, Iemura O, Kameda Y, Mimura T, and
Kohama Y (1998) Effect of 26,26,26,27,27,27-hexafluoro-1,25-dihydroxyvitamin D3 on the
expression of vitamin D-responsive genes in vitamin-D-deficient mice. Pharmacology 57:
286 –294.
Zeldin DC, Foley J, Goldsworthy SM, Cook ME, Boyle JE, Ma JX, Moomaw CR, Tomer KB,
Steenbergen C, and Wu S (1997) CYP2J subfamily cytochrome P450s in the gastrointestinal
tract: expression, localization and potential functional significance. Mol Pharmacol 51:931–
943.
Zhang QY, Dunbar D, Ostrowska A, Zeisloft S, Yang J, and Kaminsky LS (1999) Characterization of human small intestinal cytochromes P-450. Drug Metab Dispos 27:804 – 809.
Zhang QY, Wikoff J, Dunbar D, Fasco M, and Kaminsky L (1997) Regulation of cytochrome
P4501A1 expression in rat small intestine. Drug Metab Dispos 25:21–26.
Zhang QY, Wikoff J, Dunbar D, and Kaminsky L (1996) Characterization of rat small intestinal
cytochrome P450 composition and inducibility. Drug Metab Dispos 24:322–328.