University of Pennsylvania
ScholarlyCommons
Publicly Accessible Penn Dissertations
1-1-2015
A Role for Lysosomal PH Dysfunction in
Alzheimer’s Disease and Strategies for its
Restoration
Erin Coffey
University of Pennsylvania, [email protected]
Follow this and additional works at: http://repository.upenn.edu/edissertations
Part of the Cell Biology Commons, Molecular Biology Commons, and the Neuroscience and
Neurobiology Commons
Recommended Citation
Coffey, Erin, "A Role for Lysosomal PH Dysfunction in Alzheimer’s Disease and Strategies for its Restoration" (2015). Publicly
Accessible Penn Dissertations. 1662.
http://repository.upenn.edu/edissertations/1662
This paper is posted at ScholarlyCommons. http://repository.upenn.edu/edissertations/1662
For more information, please contact [email protected].
A Role for Lysosomal PH Dysfunction in Alzheimer’s Disease and
Strategies for its Restoration
Abstract
Alzheimer’s disease (AD) is the most common form of dementia, leading to memory loss progressive
cognitive decline over the course of what can be many years. Mutations in the catalytically active component
of the γ-secretase complex, presenilin 1 (PS1), are the most common cause of familial Alzheimer’s disease
(fAD), a less-prevalent but earlier-onset form of AD. PS1 mutation is associated with more severe lysosomal
and autophagic pathologies than are found in sporadic AD; these pathologies may be a result of lysosomal pH
dysregulation. The goal of this dissertation was to confirm a role for elevated lysosomal pH in cells from
PS1-fAD patients, to investigate the repercussions of this lysosomal dysfunction, and to identify a therapeutic
approach by which to restore both pH and lysosomal pathology to normal. Using human skin fibroblasts
containing the PS1-fAD mutation A246E, the present work identified a small but significant increase in
lysosomal pH in PS1-fAD mutant cells when compared to control fibroblasts. The pH data were supported by
a reduction in mature cathepsin D (Cat D) and Cat D active site availability in PS1-fAD cells, as well as by
substantial accumulation of autophagic substrates and up-regulation of components of the lysosomal and
autophagic degradative systems, both at the mRNA and protein levels. Treatment with cAMP proved
restorative, bringing lysosomal pH in PS1-fAD cells back to baseline while having minimal effect on control
cells. cAMP increased Cat D active site availability, reduced autophagic backlog, and led both to mTOR
phosphorylation and to down-regulation of genes involved in lysosomal function. Interestingly, cAMPinduced pH restoration, as well as Cat D increase and mTOR phosphorylation, was found to be PKAdependent, suggesting a signaling pathway that may serve as a useful target for future treatment, and
implicating PKA in the immediate, upstream response to cAMP treatment, and mTOR and gene expression
modulation in the downstream response. This treatment proved effective in compromised lysosomes from
primary neuronal cultures, as well, supporting the general utility of a cAMP-based approach. Together, these
results identify lysosomal pH elevation as an important factor in AD pathology, and suggest several possible
targets for future therapeutic investigation.
Degree Type
Dissertation
Degree Name
Doctor of Philosophy (PhD)
Graduate Group
Neuroscience
First Advisor
Claire H. Mitchell
Keywords
Alzheimer's disease, cAMP, lysosome, mechanistic target of rapamycin, presenilin, transcription factor EB
This dissertation is available at ScholarlyCommons: http://repository.upenn.edu/edissertations/1662
Subject Categories
Cell Biology | Molecular Biology | Neuroscience and Neurobiology
This dissertation is available at ScholarlyCommons: http://repository.upenn.edu/edissertations/1662
A ROLE FOR LYSOSOMAL PH DYSFUNCTION IN ALZHEIMER’S DISEASE
AND STRATEGIES FOR ITS RESTORATION
Erin E. Coffey
A DISSERTATION
in
Neuroscience
Presented to the Faculties of the University of Pennsylvania
in
Partial Fulfillment of the Requirements for the
Degree of Doctor of Philosophy
2015
Supervisor of Dissertation
________________________
Claire H. Mitchell, Ph.D.
Associate Professor of Anatomy and Cell Biology
Graduate Group Chairperson
________________________
Joshua I. Gold, Ph.D.
Professor of Neuroscience
Dissertation Committee
Chair: Kelly Jordan-Sciutto, Ph.D., Associate Professor of Pathology
Member: Irwin Lucki, Ph.D., Professor of Psychology in Psychiatry
Member: Michael S. Marks, Ph.D., Professor of Pathology and Laboratory Medicine
Member: Eugen Brailoiu, M.D., Adjunct Associate Professor, Temple University Center for
Substance Abuse Research
A ROLE FOR LYSOSOMAL PH DYSFUNCTION IN ALZHEIMER’S DISEASE
AND STRATEGIES FOR ITS RESTORATION
COPYRIGHT
2015
Erin Elizabeth Coffey
Dedication
for Bebe
iii ACKNOWLEDGMENT First and foremost, I thank my adviser, Claire Mitchell, for her instruction in how to “read, write,
and think like a scientist.” It is no small goal, and I’m proud to have achieved it under her tutelage
– though I ask her forgiveness that I still slip the occasional flowery phrase into my writing! I thank
members of the Mitchell laboratory past and present, without whose guidance and patience I
would have stumbled time and again. Thank you for never commenting on my occasional latenight protein extraction dance parties, except to smile and nod. You couldn’t hear the music in my
headphones, but trust that it was good, and that it really did require those 720º spins.
I would be remiss if I did not thank two extraordinary educators, without whose example I might
not have taken the road less traveled: Dr. Joe Wolenski and Mr. Steve Sekula. At two critical
stages in my scientific education, each of you challenged me to know more and to do better. I
hope I can be nearly as effective and inspiring a mentor to my future students as each of you was
to me.
And finally, to my family and my friends: thank you for your unfailing support and love. I couldn’t
have done this without you.
iv
ABSTRACT
A ROLE FOR LYSOSOMAL PH DYSFUNCTION IN ALZHEIMER’S DISEASE
AND STRATEGIES FOR ITS RESTORATION
Erin E. Coffey
Claire H. Mitchell, Ph.D.
Alzheimer’s disease (AD) is the most common form of dementia, leading to memory loss
progressive cognitive decline over the course of what can be many years. Mutations in the
catalytically active component of the γ-secretase complex, presenilin 1 (PS1), are the most
common cause of familial Alzheimer’s disease (fAD), a less-prevalent but earlier-onset form of
AD. PS1 mutation is associated with more severe lysosomal and autophagic pathologies than are
found in sporadic AD; these pathologies may be a result of lysosomal pH dysregulation. The goal
of this dissertation was to confirm a role for elevated lysosomal pH in cells from PS1-fAD patients,
to investigate the repercussions of this lysosomal dysfunction, and to identify a therapeutic
approach by which to restore both pH and lysosomal pathology to normal. Using human skin
fibroblasts containing the PS1-fAD mutation A246E, the present work identified a small but
significant increase in lysosomal pH in PS1-fAD mutant cells when compared to control
fibroblasts. The pH data were supported by a reduction in mature cathepsin D (Cat D) and Cat D
active site availability in PS1-fAD cells, as well as by substantial accumulation of autophagic
substrates and up-regulation of components of the lysosomal and autophagic degradative
systems, both at the mRNA and protein levels. Treatment with cAMP proved restorative, bringing
lysosomal pH in PS1-fAD cells back to baseline while having minimal effect on control cells.
cAMP increased Cat D active site availability, reduced autophagic backlog, and led both to mTOR
phosphorylation and to down-regulation of genes involved in lysosomal function. Interestingly,
cAMP-induced pH restoration, as well as Cat D increase and mTOR phosphorylation, was found
to be PKA-dependent, suggesting a signaling pathway that may serve as a useful target for future
treatment, and implicating PKA in the immediate, upstream response to cAMP treatment, and
v
mTOR and gene expression modulation in the downstream response. This treatment proved
effective in compromised lysosomes from primary neuronal cultures, as well, supporting the
general utility of a cAMP-based approach. Together, these results identify lysosomal pH elevation
as an important factor in AD pathology, and suggest several possible targets for future
therapeutic investigation.
vi
TABLE OF CONTENTS
ABSTRACT .......................................................................................................... V
LIST OF TABLES................................................................................................. X
LIST OF ILLUSTRATIONS ................................................................................. XI
CHAPTER 1: INTRODUCTION...........................................................................1
An introduction to the lysosome................................................................................................. 2
The lysosome in neurodegeneration .......................................................................................... 5
The lysosome in Alzheimer’s disease ........................................................................................ 6
Confirming the role of lysosomal pH in Alzheimer’s disease: technical challenges ........... 14
Figures ......................................................................................................................................... 18
Figure 1.1. Structure of presenilin 1.......................................................................................... 18
CHAPTER 2: LYSOSOMAL ALKALIZATION AND DYSFUNCTION IN
HUMAN FIBROBLASTS WITH THE ALZHEIMER’S DISEASE-LINKED
PRESENILIN 1 A246E MUTATION CAN BE REVERSED WITH CAMP...........19
Abstract ....................................................................................................................................... 20
Graphical abstract ...................................................................................................................... 21
Abbreviations .............................................................................................................................. 21
Introduction ................................................................................................................................. 22
Experimental procedures........................................................................................................... 24
Results ......................................................................................................................................... 29
pHL is elevated in PS1-fAD fibroblasts...................................................................................... 29
Availability of active cathepsin D is reduced in PS1-fAD fibroblasts......................................... 31
Altered levels of key proteins support elevated pHL ................................................................. 32
PS1-fAD mutation results in altered expression of lysosome- and autophagy-associated genes
.................................................................................................................................................. 33
Protein level shifts in PS1-fAD fibroblasts of lysosome- and autophagy-associated proteins
mirror gene expression changes............................................................................................... 33
Intracellular cAMP elevation re-acidifies lysosomes and reduces LC3B accumulation ............ 34
vii
Discussion................................................................................................................................... 35
Elevation of pHL ........................................................................................................................ 36
Re-acidification by cAMP .......................................................................................................... 39
Acknowledgements .................................................................................................................... 40
Tables........................................................................................................................................... 41
Table 2.1. qPCR primers. ......................................................................................................... 41
Figures ......................................................................................................................................... 42
Figure 2.1. PS1-fAD mutation yields elevated pHL in human skin fibroblasts.......................... 42
Figure 2.2. Cathepsin D active site availability and maturation reduced in PS1-fAD fibroblasts.
.................................................................................................................................................. 43
Figure 2.3. Elevated pHL impairs autophagic degradation through the lysosomes. ................. 44
Figure 2.4. PS1-fAD fibroblasts exhibit altered gene expression profile................................... 45
Figure 2.5. PS1-fAD fibroblasts have increased levels of lysosome- and autophagy-associated
proteins. .................................................................................................................................... 46
Figure 2.6. cAMP restores pHL and improves clearance in PS1-fAD fibroblasts...................... 47
CHAPTER 3: CAMP ACTS THROUGH PKA AND MTOR TO RESTORE
LYSOSOMAL PH IN PRESENILIN 1 A246E ALZHEIMER FIBROBLASTS .....48
Abstract ....................................................................................................................................... 49
Introduction ................................................................................................................................. 50
Materials and Methods ............................................................................................................... 52
Results ......................................................................................................................................... 58
cAMP restores lysosomal pH and Cat D active site availability in human fibroblast cultures ... 58
PKI blocks cAMP-induced pH restoration ................................................................................. 59
cAMP increases mTOR phosphorylation in PS1-fAD fibroblasts.............................................. 60
TFEB expression is reduced with cAMP................................................................................... 61
mTOR phosphorylation with cAMP Is blocked by PKI .............................................................. 61
cAMP restores lysosomal pH and Cat D active site availability in rat primary cortical cultures 62
Discussion................................................................................................................................... 62
PKA: an upstream actor in lysosomal re-acidification............................................................... 63
mTOR and TFEB signaling mediate the downstream, sustained response to cAMP............... 64
cAMP signaling as a common mechanism for lysosomal re-acidification................................. 68
Acknowledgements .................................................................................................................... 69
Tables........................................................................................................................................... 70
Table 3.1. qPCR primers. ......................................................................................................... 70
Figures ......................................................................................................................................... 71
Figure 3.1. cAMP restores elevated lysosomal pH. .................................................................. 71
Figure 3.2. PKI blocks restorative effect of cAMP treatment on lysosomal pH......................... 73
Figure 3.3. PS1-fAD fibroblasts have increased p-mTOR with cAMP. ..................................... 74
Figure 3.4. cAMP treatment reduces mRNA expression of TFEB and ATP6V1B2. ................. 75
Figure 3.5. PKI blocks cAMP-induced increase in p-mTOR. .................................................... 76
viii
Figure 3.6. cAMP restores lysosomal pH and Cat D availability in rat primary cortical cultures.
.................................................................................................................................................. 77
Figure 3.7. A mechanistic model for cAMP-induced pH restoration. ........................................ 78
CHAPTER 4: DISCUSSION AND FUTURE DIRECTIONS ...............................80
Expanding upon the mechanisms of lysosomal pH dysfunction and restoration ............... 82
General implications of lysosomal pH dysfunction in Alzheimer’s disease......................... 86
Strategies for pH restoration in Alzheimer’s disease.............................................................. 88
Transmembrane adenylyl cyclases as a potential therapeutic target ....................................... 88
Phosphodiesterase inhibitor therapy......................................................................................... 90
Conclusions ................................................................................................................................ 92
REFERENCES ....................................................................................................93
ix
LIST OF TABLES
Table 2.1. qPCR primers. ............................................................................................................. 41
Table 3.1. qPCR primers. ............................................................................................................. 70
x
LIST OF ILLUSTRATIONS
Figure 1.1. Structure of presenilin 1. ............................................................................................ 18
Figure 2.1. PS1-fAD mutation yields elevated pHL in human skin fibroblasts............................. 42
Figure 2.2. Cathepsin D active site availability and maturation reduced in PS1-fAD fibroblasts. 43
Figure 2.3. Elevated pHL impairs autophagic degradation through the lysosomes...................... 44
Figure 2.4. PS1-fAD fibroblasts exhibit altered gene expression profile. ..................................... 45
Figure 2.5. PS1-fAD fibroblasts have increased levels of lysosome- and autophagy-associated
proteins. ........................................................................................................................................ 46
Figure 2.6. cAMP restores pHL and improves clearance in PS1-fAD fibroblasts. ...................... 47
Figure 3.1. cAMP restores elevated lysosomal pH. ..................................................................... 71
Figure 3.2. PKI blocks restorative effect of cAMP treatment on lysosomal pH. ........................... 73
Figure 3.3. PS1-fAD fibroblasts have increased p-mTOR with cAMP. ........................................ 74
Figure 3.4. cAMP treatment reduces mRNA expression of TFEB and ATP6V1B2. .................... 75
Figure 3.5. PKI blocks cAMP-induced increase in p-mTOR. ....................................................... 76
Figure 3.6. cAMP restores lysosomal pH and Cat D availability in rat primary cortical cultures... 77
Figure 3.7. A mechanistic model for cAMP-induced pH restoration............................................. 78
xi
CHAPTER 1:
Introduction
1 An introduction to the lysosome
The lysosome’s discovery came about, as many scientific discoveries do, as a fortuitous accident.
In the early 1950s, the laboratory of Christian de Duve was devoted primarily to the study of
insulin signaling in the liver, and in particular to the role that acid-preciptatable glucose-6phosphatase might play in modulating insulin’s effects. In attempting to distinguish the activity of
this phosphatase from that of a related hepatic enzyme, acid phosphatase, the group found that,
curiously, acid phosphatase activity seemed to disappear following fractionation, only to reappear
following vigorous homogenization or cold storage. At the time, de Duve and colleagues
reasoned, correctly, that these conditions that might have led to the release of acid phosphatase
from an as-yet-unknown organelle. Only a few years later, they would go on to identify a host of
degradative enzymes with similar acid optima, all of which appeared to be found in membranelimited pockets throughout the cell. De Duve proposed the term “lysosome” to describe these
pockets (De Duve et al., 1955). He suggested that this new organelle might have an important
and multifaceted digestive function, including degradation and recycling of both extracellular and
intracellular materials, protection from bacteria or other toxic agents, cellular differentiation, and
perhaps clearance of dead or dying cells (De Duve et al., 1955, De Duve and Wattiaux, 1966). In
many of these predictions, de Duve would be proven right.
Our understanding of lysosomal functions continues to evolve in the decades since the
organelle’s discovery: we now know that it makes up one part of a dynamic and responsive
intracellular network with many interacting players. It is involved in both endocytic and exocytic
pathways, in cellular signaling, and in the degradation of organelles and bulk cellular material by
way of autophagy, among other roles. This complex system comes complete with sophisticated,
but still-poorly understood, feedback mechanisms by which the lysosome can communicate
information about its internal state – including its catabolic efficiency and its contents – to
cytoplasmic messengers that sit on the lysosomal surface (Zoncu et al., 2011, Cang et al., 2013).
These messengers include mechanistic target of rapamycin (mTOR), a serine/threonine kinase
2
that negatively regulates autophagy, and transcription factor EB (TFEB), a member of the MITF
family of transcription factors and the “master switch” for the co-expressed, lysosomal functionrelated genes that make up the Coordinated Lysosomal Expression And Regulation (CLEAR)
network (Sardiello et al., 2009, Palmieri et al., 2011, Settembre et al., 2011, Roczniak-Ferguson
et al., 2012, Settembre et al., 2013). TFEB phosphorylation blocks its nuclear translocation;
interestingly, TFEB can be phosphorylated by mTOR (Sardiello et al., 2009, Martina et al., 2012,
Roczniak-Ferguson et al., 2012, Settembre et al., 2012), or dephosphorylated by the
phosphatase calcineurin (Medina et al., 2015), at several sites in response to changing cellular
nutrient abundance and lysosomal efficacy. TFEB retention in the cytoplasm therefore leads to
reduced expression of CLEAR genes, including genes for lysosomal degradative enzymes and
genes that promote lysosomal biogenesis. This coordinated regulatory pathway ensures that the
lysosomal degradative system responds quickly to the cell’s current energy needs.
The importance of these feedback mechanisms – which essentially generate an accurate, timely
report on lysosomal function – cannot be overstated. The lysosomal lumen is normally maintained
at an acidic pH range through the combined actions of the v-(H+)ATPase proton pump and a
variety of ion channels and transporters (Mindell, 2012). Degradative enzymes that reside within
the lumen tend to be highly pH-sensitive, both in their activity and, for some enzymes, in their
maturation process. For example, the lysosome’s primary aspartyl protease, Cathepsin D (Cat D),
exhibits pH-dependent maturation and pH-dependent activity (Barrett, 1970, Rosenfeld, 1982),
with an activity maximum around 3.5 and a steep drop-off thereafter. By the time luminal pH
reaches 5.0, Cat D will have lost over 80% of its activity. While Cat D has one of the lower-pH
activity maxima of the lysosomal enzymes, many others are similarly pH sensitive, with pH optima
over a range of acidic values (Barrett, 1973, Schwartz and Bird, 1977, Pentchev et al., 1978,
Santa Cecilia et al., 1991, Ameis et al., 1994). Even the delivery of lysosomal enzymes to the
lysosomal lumen is a pH-dependent process: without an acidic environment, the mannose-6phosphate receptors that shepherd lysosomal enzymes from the Golgi to the lysosomes will not
3
release their cargo (Gonzalez-Noriega et al., 1980, Borden et al., 1990). On the one hand, this pH
specificity helps reduce the risk of cellular damage should the lysosomal membrane rupture and
its catabolic enzymes escape into the cytoplasm. On the other hand, such narrowly tuned
functionality ensures that even very small increases in lysosomal pH can result in substantial loss
of overall activity, and therefore of the lysosome’s ability to degrade its contents, including
proteins, lipids, organelles and cellular structures, and protein aggregates. Lysosomal malfunction
can also be a factor in both apoptotic and necrotic cell death (Zaidi et al., 2001, Boya et al., 2005,
Golstein and Kroemer, 2007), for which the lysosome has gained the rather unfortunate moniker
of “suicide bag” (Turk and Turk, 2009). These connections further underscore the lysosome’s
importance in maintaining cellular health.
Unfortunately, lysosomal function grows less efficient with age. The so-called “aging pigment”
lipofuscin – a dense, autofluorescent residue of incomplete lysosomal degradation – accumulates
in lysosomes with age, and especially in post-mitotic cells, which cannot clear material by diluting
it through cellular division (Terman and Brunk, 1998a, b, Brunk and Terman, 2002a, b, Gray and
Woulfe, 2005). Lipofuscin accumulation and loss of lysosomal efficacy is associated with agerelated macular degeneration, and lipofuscin is even believed to effect cellular damage in its own
right (Brunk and Terman, 2002a). Several studies have also observed increased lysosomal
permeability with age (Brunk and Brun, 1972, Nakamura et al., 1989), which would reduce the
ability of the lysosome to maintain the pH and ion gradients necessary for its efficient function
(Yao and Zhang, 1997, Deng et al., 2009). Lysosomal pH increase has been linked to increased
lipid peroxidation (Guha et al., 2013), which has in turn been linked to increased lysosomal
permeability (Johansson et al., 2010, Pourahmad et al., 2011) and to increased lysosomal
susceptibility to osmotic stress (Zhang and Yao, 1997). As post-mitotic cells like neurons depend
on a high rate of basal autophagy and lysosomal degradation to clear cellular debris (Boland et
al., 2008), any one of these changes would make such cells more susceptible to additional
damage, as well as substantially less capable of managing an increased degradative burden.
4
Lysosomal leakage may also prompt NLRP3 inflammasome activation in response to both
chemical and pathological stimuli (Halle et al., 2008, Hornung et al., 2008), further strengthening
the link between lysosomal health and overall cellular health. Interestingly, chemical treatment to
increase the permeability of lysosomal membranes leads to aggregate formation in cultured
neurons (Micsenyi et al., 2013), suggesting that lysosomal failure and aggregate formation may
result in a “killer cycle” that further impairs lysosomal function. Aggregate formation, both extraand intracellular, also happens to be a pathological hallmark of many neurodegenerative
diseases, including Alzheimer’s disease, Parkinson’s disease, frontotemporal dementia, and
others. The lysosome’s role in many of these diseases is only now beginning to be understood.
The lysosome in neurodegeneration
While the clinical neuropathology of lysosomal disorders was described in the 1880s, their cause
would remain a mystery until the discovery of the lysosome in 1955 (De Duve et al., 1955), and
the subsequent realization that catabolic enzymes with low pH optima might localize to that
organelle. Prior to this discovery, these congenital “storage disorders” were classified only by the
type of material that accumulated inappropriately in cells; most cases presented in early
childhood and were accompanied by at least some central nervous system pathology, including
cognitive and developmental impairment. Less than a decade after the lysosome’s discovery,
however, patient tissue samples from glycogen storage disorder cases – i.e., Pompe’s disease –
were found to be deficient in the activity of an α-glucosidase enzyme (Hers, 1963). This enzyme’s
activity was also shown to have an acidic pH optimum; Hers and colleagues theorized (correctly)
that α-glucosidase might be another lysosome-resident enzyme. This monumental finding proved
to be the first instance in which a primary lysosomal deficit was directly linked to a systemic
disease. Hers’s contemporaries soon realized that each known storage disorder might also be
caused by genetic defect of a lysosomal enzyme and, conversely, that a primary lysosomal deficit
might ultimately lead to storage pathology.
5
The lysosomal storage diseases, or LSDs, represent a diverse group of disorders, each prompted
by a mutation in some sort of lysosome-resident protein. The loss of a single enzyme or scaffold
protein can have devastating effects upon the lysosome. When the primary substrate of a
defective enzyme builds up in quantity inside the lysosome, this accumulation can itself inhibit the
activity of other enzymes that are not defective (Hers, 1963, Walkley and Vanier, 2009, Lamanna
et al., 2011, Prinetti et al., 2011). In the case of mucopolysaccharidosis type IIIC, for example, a
primary defect in the the heparan sulfate catabolism enzyme acetyl–coenzyme A:αglucosaminide N-acetyltransferase, encoded by the gene TMEM76 (Hrebicek et al., 2006), led
not only to secondary storage of dermatan sulfate and gangliosides (Lamanna et al., 2011), but
also to to reduced activity of cathepsins B, H, and L (Kopitz et al., 1993). These findings indicate
that even accumulations unrelated to a specific lysosomal enzyme’s activity may, given sufficient
time, impact overall lysosomal degradative capacity. Therefore, depending on the disorder, a
general build-up of material may lead to broader autophagy dysfunction (Curcio-Morelli et al.,
2010), to depletion of lysosomal calcium stores (Lloyd-Evans et al., 2008), and even to
neurodegeneration, though the most severely affected brain regions and cell populations may
vary with the storage metabolite (Platt et al., 2012). In short, specific disruption of the lysosome
can lead to a host of downstream, systemic defects, and effectively models the most extreme
outcomes of lysosomal failure. Given that neurons rely upon high rates of basal autophagy and
lysosomal degradation as a primary clearance mechanism (Boland et al., 2008), and that
lysosomal dysfunction can lead to cell death (as described above), one might predict that mild,
but persistent, lysosomal dysfunction could recapitulate many of the pathologies observed in
LSDs, including cognitive impairment and a neurodegenerative phenotype.
The lysosome in Alzheimer’s disease
Since the discovery of the amyloid precursor protein nearly thirty years ago, much work in the
Alzheimer’s field has focused on the consequences of specific and pathological protein
accumulations: whether in extracellular “senile plaques,” or in intracellular “neurofibrillary tangles.”
6
Over the past two decades, however, accumulating evidence points toward a pivotal role played
by dysfunctional lysosomes in Alzheimer’s disease. In many ways, the canonical Alzheimer
pathologies resemble certain pathologies of both lysosomal storage disorders (Nixon, 2004,
Lloyd-Evans et al., 2008, Nixon et al., 2008) and age-related retinal degenerative diseases (Isas
et al., 2010, Ding et al., 2011, Kaarniranta et al., 2011, Ohno-Matsui, 2011, Sivak, 2013), which
are also known to have a lysosomal component. Further strengthening this connection, patients
with the LSD Niemann-Pick type C (NPC) have high cerebrospinal fluid levels of the same
pathological proteins found in Alzheimer patients (Mattsson et al., 2011). The following section
will provide a basic introduction to the disease’s clinical and pathological correlates, as well as an
overview of the inherited genetic mutations that essentially guarantee that an individual will
develop Alzheimer’s disease pathology.
A general introduction to Alzheimer’s disease
Alzheimer’s disease (AD) is the single most common form of dementia (Barker et al., 2002) and
the sixth most common cause of death in the United States; it is currently estimated to affect
about one-third of Americans aged 85 and older (Alzheimer's Association, 2015). Only a fraction
of patients with AD develop the disease as a direct consequence of genetic mutation (“familial
AD,” or fAD); the rest of AD cases (“sporadic AD”) are believed to arise from a combination of
genetic and environmental risk factors (Bekris et al., 2010), of which the most prominent risk
factor is increasing age (Lindsay et al., 2002). It is currently believed that by the time a patient
presents with cognitive symptoms, the pathological processes of AD have been underway for
decades (Jack et al., 2009, Villemagne et al., 2013). Clinically, the disease is characterized by
progressive memory loss and increased cognitive deficit, including confusion, mood changes,
impaired judgment, and even loss of basic skills and functions (Alzheimer's Association, 2015).
After what can be many years of decline, AD results in widespread neuronal loss and cortical
atrophy (Mattson, 2004). Advanced AD patients require long-term, ‘round-the-clock care, posing a
considerable emotional and financial burden on caregivers and patients alike. By 2050, the total
7
annual payments made for care of patients with AD and other dementias is projected to rise to $1
trillion or more (Alzheimer's Association, 2015). Unfortunately, current treatments do little more
than temporarily slow the course of the disease (Raschetti et al., 2007, Raina et al., 2008). Even
with treatment, AD patients ultimately succumb to their condition: in the final stages of disease,
patients are typically immobile and more vulnerable to potentially fatal complications, including
pneumonia, swallowing disorders, and malnutrition (Alzheimer's Association, 2015). Given the
predicted increase in prevalence of the disease – both as the baby boomer generation ages, and
as medical advances lead to overall longer life expectancy – Alzheimer’s disease represents not
only a substantial public health issue for the 21st century, but an economic one, as well.
While AD often presents concurrently with other dementias, the most basic cellular pathology of
the disease has been known for over a century. In 1906, German psychiatrist Dr. Alois Alzheimer
was one of the earliest to describe the “characteristic serious disease of the cerebral cortex”
(Maurer et al., 1997); he later went on to extensively detail the disease’s neuropathology.
Alzheimer’s description of both plaques and tangles in the cortex of his patient would come to
define the major pathological hallmarks of AD, although the primary components of each –
aggregate fibrils of amyloid-β peptide in plaques, and hyperphosphorylated, microtubuleassociated protein tau in tangles – would not be identified until decades later (Glenner and Wong,
1984a, b, Kosik et al., 1986, Nukina and Ihara, 1986). Pathology and consequent cell loss is first
observed in the hippocampus, but later progresses beyond this region to affect much of the brain
(Scahill et al., 2002). By the final stages of disease, the most dramatically affected brain regions
may have lost nearly 85% of their neurons and 66% of their volume (Bobinski et al., 1996). While
neurofibrillary pathology appears to be more closely associated with regional atrophy and
cognitive decline in humans (Bobinski et al., 1996), the amyloid-β production pathway is more
immediately relevant to the present work, and will be the primary focus of the paragraphs to
follow. For further information on tau, Hanger et al. recently authored a brief but comprehensive
review of tau and neurodegenerative pathology (Hanger et al., 2014).
8
Amyloid-β peptide, which aggregates into oligomers and fibrils that form the primary constituents
of extracellular neuritic plaques, is derived from the transmembrane amyloid precursor protein
(APP). APP undergoes two sequential cleavage events that can generate a variety of peptides
and peptide fragments. The first cleavage event is mediated by either α- or β-secretase – now
known to be the enzymes ADAM10 (Jorissen et al., 2010, Kuhn et al., 2010) and BACE1 (Vassar
et al., 1999), respectively. The second cleavage event is mediated by the catalytically active
component of the γ-secretase enzyme complex: presenilin 1 (Selkoe and Wolfe, 2007). It is
believed that one or both of these sequential APP cleavage events may take place within the
endo-lysosomal system (Tagawa et al., 1992, Koo and Squazzo, 1994, Kawarabayashi et al.,
1997, Pasternak et al., 2004, Yu et al., 2004). Cleavage of APP by β-secretase sets amyloid-β
generation in motion. This form of the amyloid peptide is found as two primary species: amyloidβ40 and amyloid-β42 (Esler and Wolfe, 2001); the latter form appears to be more prone to
aggregation into plaques (Roher et al., 1993). Early work implicated plaque formation in cellular
toxicity; over the past two decades, however, the field has come to focus more upon the soluble
oligomers of amyloid-β peptide (Terry et al., 1991, McLean et al., 1999, Mucke et al., 2000), as
well as on its potential intracellular buildup and toxicity prior to plaque deposition (Zhang et al.,
2002, Gouras et al., 2005, Oddo et al., 2006).
Presenilin: more than just an amyloid machine
While sporadic AD constitutes the majority of AD cases, the etiology of the disease remains
largely unknown. In contrast, the causes of familial AD are better understood and thus provide
useful insights for the study of overall disease progression. In the majority of familial Alzheimer’s
cases, the precipitating event is a mutation in the aspartyl protease presenilin 1 (PS1). PS1 (Fig.
1.1) is a membrane-bound enzyme with nine membrane-spanning domains (Spasic et al., 2006),
and is the catalytically active subunit of the γ-secretase complex, of which the other components
are nicastrin, aph-1, and pen-2 (De Strooper, 2003). To date, more than 150 mutations in PS1
9
have been linked to AD (De Strooper et al., 2012); many of these mutations are found in one of
the transmembrane regions, rather than at the PS1 catalytic site (Dillen and Annaert, 2006, De
Strooper et al., 2012). AD-associated mutations in presenilin are autosomal dominant and
invariably lead to an accelerated, more severe onset of disease (Bateman et al., 2011).
Since its discovery, however, presenilin has been shown to play a role in more than just APP
cleavage and amyloid production. Around the time that PS1 gene mutation was linked to
Alzheimer’s disease (Sherrington et al., 1995), its Caenorhabditis elegans homolog was found to
play a critical role in Notch cleavage and signaling (Levitan and Greenwald, 1995); human PS1
has since been found to cleave numerous type I membrane-spanning proteins, including Notch
(Berezovska et al., 1999, Struhl and Adachi, 2000). The enzyme also interacts with the
transmembrane domains of other proteins, including proteins that are not substrates of γsecretase. PS1 has been shown to interact with the neuron-specific intercellular adhesion
molecule telencephalin (Annaert et al., 2001); this protein accumulates in cells that lack PS1, and
its trafficking appears to be misdirected (Esselens et al., 2004). PS1 may also play a role in the
glycosylation and trafficking of various transmembrane proteins, including TrkB (Naruse et al.,
1998) – the tyrosine kinase receptor for brain-derived neurotrophic factor (BDNF) – and fellow γsecretase component nicastrin (Herreman et al., 2003), as well as APP itself (Kaether et al.,
2002, Cai et al., 2003). In the absence of PS1, TrkB glycosylation was reduced and, if it reached
the cell surface at all, was largely non-functional (Naruse et al., 1998). Given that the loss of TrkB
signaling is linked to spatial memory deficits in AD model mice (Kemppainen et al., 2012), PS1
mutation may prove to play a more substantial role in this aspect of behavioral pathology. More
recently, PS1 deficiency was shown to reduce expression of the neuroprotective cell surface
tyrosine kinase receptor EphB2, presumably through a similar mechanism, and independently of
PS1 γ-secretase activity (Barthet et al., 2013). PS1 may have been identified first for its APP
processing ability, but subsequent studies in both humans and other animals indicate its cellular
function is clearly far more diverse than originally suspected.
10
A role for the lysosome in Alzheimer pathology
A decades-long history of research connects Alzheimer’s disease with lysosomal and autophagic
dysfunction. As early as 1967, Suzuki and Terry observed immunoreactivity of the lysosomal
enzyme acid phosphatase in senile plaques (Suzuki & Terry 1967). Subsequent studies found
that these plaques were also immunoreactive for cathepsins B and D (Cataldo et al., 1990), as
well as other lysosomal hydrolases (Cataldo et al., 1991). The enzyme deposits were shown to
be part of abundant extracellular granules of lipofuscin (Cataldo and Nixon, 1990) and lysosomal
dense bodies (Cataldo et al., 1991), and were not seen in post-mortem tissue from patients with
other neurodegenerative disorders. In other words, an abundance of early data implicated
lysosomal leakage, and perhaps lysosomal exocytosis – a known mechanism by which cells
attempt to clear debris (Medina et al., 2011) – in AD progression. Interestingly, extracellular
hydrolases were found both in actively degenerating brain regions and in regions known to be
affected in AD, but which were not currently degenerating, suggesting that lysosomal dysfunction
might be an early sign of AD.
Other post-mortem data further implicated the lysosome in early disease. Abnormal lysosomal
redistribution from the perikaryon to the axon hillock was observed in pyramidal neurons of the
hippocampus and neocortex in AD brain; this redistribution occurred even in the absence of overt
signs of degeneration, indicating that it may be an early event in disease (Nixon et al., 1992).
These vulnerable regions had increased numbers of acid hydrolase-positive compartments
(Cataldo et al., 1996) and were also characterized by increased expression of Cat D (Cataldo et
al., 1995), neither of which was seen in non-AD brain. Neurons with more advanced degenerative
pathology displayed similarly advanced lysosomal pathology, which persisted in the brain
parenchyma beyond neuronal death (Cataldo et al., 1994). While some lipofuscin and lysosomal
accumulation occurs in neurons in the course of normal aging, this accumulation paled by
comparison to what was observed in AD patient tissue (Nixon et al., 1992, Cataldo et al., 1994).
11
Interestingly, while this lysosomal/autophagic pathology of AD is commonly observed in postmortem AD brain tissue, PS1 mutations are known to exacerbate it (Cataldo et al., 2004).
The observed disruption of lysosome function in AD extends to the autophagic and endosomal
systems, as well, indicating that the entire cellular degradative system is perturbed in AD.
Immuno-electron microscopy has revealed extensive involvement of autophagy in AD, with
autophagosomes at various maturation stages accumulating in abundance in both visually normal
and dystrophic neurites (Nixon et al., 2005). Endosomal enlargement has been observed at early
stages of AD; it was accentuated by inheritance of the known AD risk allele ApoE4 (Corder et al.,
1993), and was specific to AD (Cataldo et al., 2000). Increased expression of several genes
important for endosomal biogenesis and trafficking, including RAB4, RAB5, and RAB7, was
observed in hippocampal CA1 neurons from AD patients; these increases correlated with severity
of cognitive impairment (Ginsberg et al., 2010) and with up-regulated expression of Cat D in both
mild and severe cognitive impairment.
Several non-human experimental models further validate the lysosome’s critical role in AD.
Similarly to what has been seen in patient tissue, up-regulation of the lysosomal system was also
an early event following neuronal injury of cultured rat hippocampal neurons (Adamec et al.,
2000), while lysosomal disruption itself induced axon degeneration in cultured rat ganglia (Zheng
et al., 2010). Selective inhibition of lysosomal proteases induced formation of enlarged neurites
and tangle-like structures in the vulnerable regions of cultured rat entorhinohippocampal slices (Bi
et al., 1999). Neuritic dystrophy following lysosomal proteolysis inhibition was also observed in
cultured mouse primary neurons, and was accompanied by partially disrupted axonal transport
and APP fragment accumulation; lysosomal restoration improved these AD-like phenotypes (Lee
et al., 2011). Similar results were obtained in Drosophila melanogaster, in which Cat D inhibition
was sufficient to promote accumulation of neurotoxic forms of tau that resemble the tau inclusions
of AD (Khurana et al., 2010). Importantly, enhancement of lysosomal function was shown to be a
12
viable therapeutic strategy in several mouse models of AD (Butler et al., 2011, Yang et al., 2011,
Yang et al., 2014), and has been suggested more generally as a strategy for addressing
lysosomal dysfunction in neurodegeneration (Bahr, 2009).
The abundance of data connecting lysosomal dysfunction with AD led in 2010 to the first direct
link between PS1 and lysosomal pH maintenance. In the absence of PS1, Lee et al. observed
reduced glycosylation of the lysosomal proton pump’s V0a1 subunit; consequently, this subunit
did not reliably arrive at the lysosome, leading to elevated lysosomal pH and consequent
proteolytic and degradative deficits (Lee et al., 2010). The authors suggested that, as it does for
other cellular constituents, PS1 might help to scaffold this subunit and to aid in its glycosylation.
Loss or mutation of PS1 might therefore reduce PS1’s ability to interact with other proteins,
including the proton pump, and thereby impair their efficient glycosylation and trafficking. While
the pH deficit they described was only measured directly in PS1-ko mouse blastocysts, the
authors also reported reduced degradative power in a variety of PS1-fAD human skin fibroblast
genotypes. Importantly, treatment with the lysosomotropic weak base NH4Cl (Ohkuma and Poole,
1978), which raises lysosomal pH, reduced starvation-induced proteolysis in control cells, but had
no further impact on degradation in PS1-fAD cells. This finding implied that pH was already
elevated in the PS1-fAD fibroblasts and that proteolysis could not be further impaired by addition
of NH4Cl.
A long history of research points toward a critical role for lysosomal and autophagic dysfunction in
AD, though the magnitude of this dysfunction may vary with the severity and form of the disease.
AD-like pathologies can be induced by lysosomal impairment, and treatments to improve
lysosomal function also improved AD pathology in widely used AD models. The known loss of
lysosomal efficacy in aging, in combination with the striking pathological similarities between the
lysosomal storage disorders and Alzheimer’s disease (Nixon, 2004) lend further credence to the
13
theory that lysosomal failure in AD may lie somewhere in between normal aging and pathological
youth on the spectrum of lysosomal dysfunction (Nixon et al., 2008).
Confirming the role of lysosomal pH in Alzheimer’s disease: technical challenges
Following this discovery of a proton pump trafficking defect in Alzheimer’s disease, several other
groups attempted to replicate the findings with mixed success. Several subsequent studies found
no effect of presenilin on lysosomal pH. Of these, one study found no change in mean vesicle pH
in PS1 cells, failed to find a V0a1 trafficking defect, and saw no effects on Cat D maturation
(Zhang et al., 2012). Presenilin was also shown to be required for efficient proteolysis in a
manner independent of its γ-secretase activity, but again the lysosomal pH defect was not
detected (Neely et al., 2011). Defects in lysosomal calcium storage, but not pH, were proposed to
accompany presenilin loss or mutation (Coen et al., 2012), despite strong evidence that the ability
of the lysosome to buffer and store calcium depends heavily on lysosomal pH (Christensen et al.,
2002).
Over the same period, other investigators have found quite the opposite: that PS1 loss or
mutation does, in fact, lead to lysosomal malfunction through pH deficiency. While the deficit has
not been measured directly by these other groups, strong in vivo evidence has been gathered in
support of AD-linked lysosomal pH failure – including in several transgenic mouse models of AD.
The 5 X FAD mouse is an accelerated amyloid deposition model that recapitulates many of the
behavioral and pathological characteristics of human AD (Oakley et al., 2006). This mouse model
is transgenic for five AD-associated mutations – including mutations in both APP and PS1 – and
is now widely used in the Alzheimer’s field. In a recent study, V0a1 N-glycosylation was shown to
be reduced in this mouse’s brain tissue, similar to what the Nixon laboratory had shown in vitro
(Avrahami et al., 2013). The implicit acidification failure in this mouse was further supported by a
reduction in mature Cat D (Avrahami et al., 2013). Reduced levels of mature Cat D and mature
Cat B were also observed in areas near plaques in the PS1M146L/APP751s1 mouse, although in
14
this case no change was seen in V0a1 N-glycosylation (Torres et al., 2012) – likely due to
incomplete loss of PS1 function (Wolfe et al., 2013). Finally, PS1-associated disruption of Wnt
signaling was recapitulated in wild type cells through nothing more than elevation of lysosomal pH
with chloroquine (Dobrowolski et al., 2012); given the dependence of Wnt signaling on a fully
functional endocytic pathway (Blitzer and Nusse, 2006), these findings further implicate the endolysosomal axis in disease progression.
The apparent controversy regarding the role of lysosomal pH dysfunction in Alzheimer’s disease
may be a primarily technical issue, as obtaining an accurate measure of lysosomal pH proves to
be a complex procedure. The challenges and pitfalls of the various techniques for lysosomal
assessment have been reviewed previously in extensive detail (Wolfe et al., 2013, Guha et al.,
2014). A common and particularly critical point made by these reviews is that great care must be
taken to optimize measurement protocols in each system; if quantitative measurement is desired,
ratiometric dyes ought to be used in a moderately high-throughput context (e.g., a multiwell plate
versus a microscope). Otherwise, any reported lysosomal pH measurements, especially those
made with single-wavelength dyes, may be unreliable.
As an example, other laboratories commonly use the fluorescence of the single-wavelength
LysoTracker Red DND-99 dye (Life Technologies Corp., Grand Island, NY, USA) as a
quantitative measure of lysosomal pH, when in reality its readout ought to be treated as
qualitative. Neely et al. (2011) found no apparent change in lysosomal pH using LysoTracker
Red. Unfortunately, even when ratiometric dyes are used, they are often used incorrectly: Zhang
et al. (2012) performed measurements using a microscope, rather than a microplate reader, and
detected an average vesicular pH of 6.6; at more than two units above healthy lysosomal pH, this
reading can hardly be considered informative for a lysosomal measurement. Similarly, while Coen
et al. (2012) reported no difference in pH using LysoSensor Yellow/Blue DND-160 (Life
Technologies), which is the same dye used in the present work, their group incubated cells with
15
the dye for 10 min or more; previous [unpublished] work from our laboratory indicates that
incubations greater than 5 min quickly lead to a saturation of the signal, and a resulting inability to
detect any pH differences that may exist. These caveats, in combination with possible issues with
overexpression of exogenous of the V0a1 subunit (Wolfe et al., 2013), may contribute to the
mixed findings.
By contrast, our laboratory has devoted years to developing expertise in the use of a primary
ratiometric lysosomal pH assay, and in supplementing these readouts with indirect measures of
lysosomal pH and degradative efficacy (Liu et al., 2008, Baltazar et al., 2012, Guha et al., 2012,
Liu et al., 2012, Guha et al., 2013). Therefore, we were particularly well positioned to provide firm
answers to the lysosomal pH question, as well as to begin to address techniques by which to
restore any elevated lysosomal pH that might be detected. With this technical skill, we produced
one of the first studies to quantitatively and convincingly demonstrate lysosomal pH elevation in
human skin fibroblasts from AD patients, and the first to correlate this specific dysfunction in
human cells with Cat D deficiency and other measures of lysosomal and autophagic pathology.
Unlike other laboratories, we focused our efforts on fibroblasts with the PS1-fAD mutation A246E,
a mutation previously implicated in proteolytic impairment (Lee et al., 2010) and which is located
in the enzyme’s sixth transmembrane region (Fig. 1.1). The use of PS1-fAD human skin
fibroblasts in the present work was preferable to the use of PS1ko or PSdko cells, as reports from
cells that wholly lack PS1 might not be representative of the mechanisms at work, or the degree
of perturbation, in actual patient tissue. Our careful approach also ensured that we were the first
to demonstrate that pH restoration may prove a therapeutically valid strategy in this model of AD;
this finding represents an important step forward in understanding the lysosome’s role in disease.
In sum, the work described in this Introduction implicates lysosomal dysfunction in a complex
array of neurodegenerative phenotypes, and suggests that treatments to restore lysosomal
function may be effective in improving outcomes. While Alzheimer’s disease appears to dovetail
16
with poor lysosomal pH maintenance, this finding has not been widely reported, and is technically
challenging to demonstrate. The following chapters will present studies that quantify a modest
lysosomal pH elevation in human skin fibroblasts from AD patients (Chapter 2); identify certain of
the downstream consequences of this pH problem (Chapter 2); and identify both a potential
treatment to restore lysosomal pH (Chapters 2 and 3) and that treatment’s likely mechanisms of
action (Chapter 3). Although considerable work remains to clarify the exact nature and
chronology of lysosomal distress in Alzheimer’s disease, the work presented in this document
represents a considerable advance in our understanding of lysosomal involvement in the disease
process, and suggests important therapeutic strategies that may be explored in the future.
17
Figures
Figure 1.1. Structure of presenilin 1.
Presenilin 1 (PS1) is the catalytically active subunit of γ-secretase. PS1 was discovered to have
nine transmembrane region topology, with the N terminus in the intracellular space and the C
terminus in the extracellular or luminal space. The scissors represent a site of endoproteolytic
cleavage that, while not explicitly required for enzyme activity, helps PS1 form stable complexes
with the other components of γ-secretase. The active enzyme does, however, require association
of the N-terminal fragment and the C-terminal fragment. Each fragment contributes one of the two
aspartate residues that comprise the active site; the blue circles represent these residues. The
red circle denotes the approximate location of the A246E mutation in transmembrane region VI.
(Dillen and Annaert, 2006, Spasic et al., 2006)
18 CHAPTER 2:
Lysosomal alkalization and dysfunction in human fibroblasts
with the Alzheimer’s disease-linked presenilin 1 A246E mutation
can be reversed with cAMP
a
a
b
E. E. COFFEY , J. M. BECKEL , A. M. LATIES AND C. H. MITCHELL
a,c
a) Department of Anatomy and Cell Biology, University of Pennsylvania, Philadelphia, PA
19104, United States.
b) Department of Ophthalmology, University of Pennsylvania, Philadelphia, PA 19104,
United States.
c) Department of Physiology, University of Pennsylvania, Philadelphia, PA 19104, United
States.
This chapter was originally published in Neuroscience (Coffey et al., 2014), and is accessible at
http://dx.doi.org/10.1016/j.neuroscience.2014.01.001. It is reprinted here with small grammatical
corrections and with a minor modification to the graphical abstract.
19
Abstract
Mutation in presenilin 1 (PS1) is one of the leading causes of familial Alzheimer’s disease (fAD).
PS1 mutation exacerbates the autophagic and lysosomal pathology in AD patients, leading to
accumulation of partially degraded material in bloated lysosomes and autophagosomes – a
pathology that bears some resemblance to other diseases characterized by elevated lysosomal
pH, like age-related macular degeneration. In this study, we examined the effect of the PS1-fAD
mutation A246E on lysosomal pH and lysosomal function, and asked whether restoration of
lysosomal pH could reverse some of these changes. Lysosomal pH was elevated by 0.2–0.3 pH
units in human fibroblasts with the PS1-fAD mutation. The lysosomal alkalization in PS1-fAD
fibroblasts was supported by a reduction in the pH-dependent cleavage of cathepsin D and by a
reduction in binding of boron-dipyrromethene (BODIPY) FL-pepstatin A to the cathepsin D active
site. PS1-fAD cells had increased LC3B-II/-I ratios and p62 levels, consistent with impaired
lysosomal degradation and analogous to changes induced by lysosomal alkalinization with
chloroquine. PS1-fAD fibroblasts had increased expression of ATP6V1B2, ATG5, BECN1, and
TFEB mRNA, and of ATP6V1B2, ATG5 and beclin at the protein level, consistent with chronic
impairment of autophagic and lysosomal functions in the mutant cells. Critically, cyclic adenosine
monophosphate (cAMP) treatment reacidified lysosomal pH in mutant PS1-fAD; cAMP also
increased the availability of active cathepsin D and lowered the LC3B-II/-I ratio. These results
confirm a small elevation in the lysosomal pH of human PS1-fAD fibroblasts, demonstrate that
this lysosomal alkalization is associated with chronic changes in autophagy and degradation, and
suggest that treatment to reacidify the lysosomes with cAMP can reverse these changes.
20
Graphical abstract
The elevation of lysosomal pH associated with mutations in PS1-fAD prevents degradative
enzymes from properly processing cellular waste material, leading to a backlog of autophagic
makers LC3Bll/l and p62, and a compensatory up-regulation of the genes ATP6V1B2, ATG5,
BECN1, and TFEB. Treatment re-acidifies lysosomes and enhances autophagic throughput.
Yellow dots indicate incompletely degraded and aggregate material.
Abbreviations
AD, Alzheimer’s disease; AMD, age-related macular degeneration; ANOVA, analysis of variation;
BODIPY,
boron-dipyrromethene;
cAMP,
cyclic
adenosine
monophosphate;
EDTA,
ethylenediaminetetraacetic acid; fAD, familial Alzheimer’s disease; GAPDH, glyceraldehyde 3phosphate
dehydrogenase;
GSK3,
glycogen
synthase
kin
ase
3;
HEPES,
2-[4-(2-
hydroxyethyl)piperazin-1-yl]ethanesulfonic acid; IBMX, 3-isobutyl-1-methylxanthine; MES, 2-(Nmorpholino)ethanesulfonic acid; PKA, protein kinase A; PS1, presenilin 1; qPCR, quantitative
polymerase chain reaction; RPE, retinal pigmented epithelium.
21
Introduction Intracellular waste products, damaged organelles and other targets of bulk cellular degradation
reach the lysosomes via the process known as macroautophagy (henceforward, simply
“autophagy”). The efficient clearance of this material is of particular importance in post-mitotic
cells such as cortical neurons (Boland et al., 2008). This degradation is highly dependent on
lysosomal pH (pHL): activity of lysosomal enzymes is optimal over a narrow range of acidic levels.
Substantial shifts in pHL, such as those induced by drugs like chloroquine or bafilomycin, can
severely disrupt degradative enzyme activity and block the fusion of autophagosomes with
lysosomes (Yamamoto et al., 1998, Klionsky et al., 2008). However, even an increase of only a
few tenths of a unit is sufficient to depress the activity of key lysosomal proteases and lipases
(Barrett, 1970, 1972, 1973, Schwartz and Bird, 1977, Ameis et al., 1994). These moderate
elevations of pHL can perturb the clearance of cellular waste and lead to a backup of the
autophagic pathway, resulting in a slow accumulation of waste with time.
Though the pH dependence of lysosomal enzyme activity has been recognized for decades, a
role for impaired degradation has only been implicated in neurodegenerative diseases more
recently (Pacheco et al., 2007, Cheung and Ip, 2009, Martinez-Vicente et al., 2010, Winslow et
al., 2010, Elrick and Lieberman, 2013). Alzheimer’s disease (AD) is of importance in this regard,
as fundamental defects in autophagy and autophagic degradation have been observed (Cataldo
and Nixon, 1990, Cataldo et al., 1996, Cataldo et al., 2004, Nixon, 2005, Nixon et al., 2005, Nixon
and Cataldo, 2006, Khurana et al., 2010, Lipinski et al., 2010). Although the canonical
pathologies of AD include tau and amyloid-β deposition, the disease is also associated with the
pathological build-up of partially degraded protein in bloated lysosomes and autophagosomes
(Nixon et al., 2005). While this so-called “autophagic pathology” is observed in multiple forms of
the disease, it is accentuated by mutations in the transmembrane protein presenilin 1 (PS1), the
catalytically active component of the γ-secretase complex (Cataldo et al., 2004). As PS1 mutation
is a common cause of early-onset, inherited, familial Alzheimer’s disease (fAD), these autophagic
22
defects may impact disease progression. The missense mutation A246E, one of the first PS1
mutations to be identified (Sherrington et al., 1995), is of particular relevance. While the protein
with this point mutation is still capable cleaving amyloid precursor protein, it is associated both
with elevated Aβ42/40 ratio (Scheuner et al., 1996, Qian et al., 1998) and with autophagic
pathology (Lee et al., 2010). In addition, mice expressing the human A246E transgene show
increased amyloid beta in the absence of plaques, as well as reduced performance (Lalonde et
al., 2003). However, the mechanistic links between the mutation and these pathologies remain
unclear.
The potential contribution of lysosomal alkalization to this impaired degradation is currently a
matter of considerable interest. It has been suggested that the A246E mutation disrupts the
trafficking of a v-(H+)ATPase subunit to lysosomes and that lysosomal pH is elevated in these
mutant cells (Lee et al., 2010). However, others have been unable to detect a significant change
in lysosomal pH using a variety of approaches (Neely et al., 2011, Coen et al., 2012, Zhang et al.,
2012) or confirm a role for defective lysosomal pH in disease (Bezprozvanny, 2012). Given that
accurate measurement of lysosomal pH is technically challenging, this discrepancy is
understandable. However, we have spent the past decade developing a protocol that can
accurately detect small changes in lysosomal pH. We have demonstrated the effects of elevated
lysosomal pH in retinal pigmented epithelial (RPE) cells associated with age-related macular
degeneration (AMD) and have screened to identify treatments that can reacidify damaged
lysosomes and reverse the accumulation of waste material (Liu et al., 2008, Baltazar et al., 2012,
Guha et al., 2012, Liu et al., 2012, Guha et al., 2013). AD has many parallels with AMD, including
the slow accumulation of incompletely degraded material in the lysosome and in lysosomeassociated organelles of aging post-mitotic cells (Isas et al., 2010, Ding et al., 2011, Kaarniranta
et al., 2011, Ohno-Matsui, 2011, Sivak, 2013). We thus applied our technique for accurate
detection of lysosomal pH to skin fibroblasts from humans with the PS1-fAD mutation and found
an elevation in lysosomal pH, a decrease in pH-dependent processing of cathepsin D and
23
changes in molecular and protein markers.
Experimental procedures
Culture of human skin fibroblast cells
This study used two distinct sets of control (CTRL) and PS1-fAD (A246E) human skin fibroblasts
from the NIA Aging Cell Culture Repository (Coriell, Camden, NJ, USA): cell numbers AG6840
and AG08170 were from two different PS1-fAD donors and termed “PS1-fAD” cells, while
numbers AG07621 and AG07623 were the control cells from unaffected spouses of AD patients
(termed “CTRL” cells). Cells were grown to confluence in 25 cm2 primary culture flasks in
minimum essential Eagle’s medium (Sigma–Aldrich, St. Louis, MO, USA) with 2 mM
GlutaMAX™, 100 U/mL penicillin and 100 µg/ml streptomycin and 15% fetal bovine serum (all
Life Technologies Corp., Grand Island, NY, USA). Cells were incubated at 37 °C in 5.5% CO2 and
sub-cultured by room temperature incubation in 0.53 mM EDTA in Hank’s balanced salt solution
(HBSS) (−Mg2+/−Ca2+), followed by incubation with 0.05% trypsin/0.48 mM EDTA (Life
Technologies) at 37 °C. Culture protocols followed in accordance with those provided by the cell
supplier. Data presented from PS1-fAD fibroblasts represent composite data from both AG08640
and AG08170 lineages; data for CTRL fibroblasts represent composite data from both AG07621
and AG07623 lineages. No clear differences were detected between cells from different lineages
but the same PS1 genotype.
Measurement of pHL from fibroblast cells
Lysosomal pH was measured as described using the dye LysoSensor Yellow/Blue DND-160 (Liu
et al., 2008, Baltazar et al., 2012, Guha et al., 2012, Liu et al., 2012). The use of LysoSensor
Yellow/Blue (Life Technologies) to measure lysosomal pH has the advantage, common to
ratiometric dyes, that the readout is independent of concentration. Because the dye is membranepermeable, readout is also representative of a broader range of lysosomes than those reached by
endocytosis of a dextran-tagged probe. Extensive preliminary trials have optimized key
24
experimental parameters including incubation time, dye concentration, etc. to minimize variation
and give the best signal-to-noise ratio with the lowest concentration of dye (Liu et al., 2008). For
example, all readings used for a given experimental set were performed simultaneously in 96-well
plates. Incubation times were monitored precisely, and all measurements were taken within 12–
14 min of washing off the dye. Calibrations were performed simultaneously in adjacent wells to
ensure the relevance of the measures.
In brief, CTRL and PS1-fAD fibroblasts from unaffected spouse donors were grown to at least
80% confluence in black 96-well plates. Cells were assayed after a minimum of 6 days in culture.
The two cell types were plated in alternating rows to control for any signal variation across the
plate. To begin the assay, culture medium was removed and cells were incubated for 3 min with
2 µM LysoSensor Yellow/Blue in isotonic solution (NaCl, 105 mM; KCl, 5 mM; HEPES-Acid,
6 mM; Na-HEPES, 4 mM; NaHCO3, 5 mM; mannitol, 60 mM; glucose, 5 mM; MgCl2, 0.5 mM;
CaCl2, 1.3 mM; pH, adjusted to 7.4; osmolality, 300 mOsm). Dye loading and incubation steps
were carried out at room temperature and in the dark. After 3 min, cells were rinsed 3× with
isotonic solution and incubated with additional isotonic solution, with a relevant drug, or with pH
calibration buffers. All final drug applications (200 nM bafilomycin A1, 20 mM NH4Cl, 30 µM
tamoxifen, cyclic adenosine monophosphate (cAMP) cocktail (500 µM cpt-cAMP, 100 µM 3isobutyl-1-methylxanthine (IBMX), 10 µM forskolin (forskolin from LC Laboratories, Woburn, MA,
USA)) were made up in isotonic solution. After 10 min, fluorescence was measured with a
Fluoroskan Ascent Microplate Fluorometer and recorded using the ASCENT software package
(both Thermo Scientific, Waltham, MA, USA). Lysosomal pH was determined from the ratio of
light excited at 340 nm over 380 nm (F340nm/F380nm, 527 nm emission). Mean light levels at both
emission wavelengths were integrated over 60 ms and recorded for each well in sequence; this
course was repeated every 30 s for 11 iterations. pH data are the mean levels from 3 to 7
measurements taken 12–14 min after removal of the dye. In certain recordings, absolute pH
levels were obtained by calibrating the lysosomal pH against standards; calibration wells were
25
incubated with 15 µM monensin and 30 µM nigericin, each a proton–cation ionophore that
+
+
permeabilizes the lysosomal membrane to Na and K , respectively. These ionophores were
added in a solution of 20 mM MES (2-(N-morpholino)ethanesulfonic acid), 110 mM KCl and
20 mM NaCl, at pH values of 4.0, 4.5, 5.0, 5.5 and 6.0. It should be noted that while the use of
ionophores to calibrate fluorescent ratios into absolute values is relatively precise when working
with a cytoplasmic readout such as with fura-2 (Grynkiewicz et al., 1985), the complexities of
permeating both the plasma membrane and vesicular membranes can lead to small variations in
the absolute levels. However, our approach of measuring output simultaneously from cells grown
on a single plate, and then calibrating and normalizing to the mean control level for each plate,
ensures that the differences observed between cell types and between treatment conditions are
repeatable and reliable.
Confocal microscopy
CTRL and PS1-fAD fibroblasts were grown to near-confluence on glass coverslips. For
LysoSensor/LysoTracker staining, coverslips were first rinsed 3× in warm isotonic solution, then
co-incubated in fresh growth medium with 2 µM LysoSensor Yellow/Blue and 50 nM LysoTracker
DND-99 for just over 30 min at 37 °C. For boron-dipyrromethene (BODIPY) FL-pepstatin A
staining, coverslips were rinsed and then co-incubated in fresh growth medium with 1 µg/ml
BODIPY FL-pepstatin A (Life Technologies) for 1 h. Following incubation, coverslips were rinsed
3× times and then imaged on a warm stage using a Nikon A1R Laser Scanning Confocal
Microscope and the University of Pennsylvania Live Cell Imaging Core. LysoSensor signal was
excited at 407 nm using the microscope’s 405-nm Diode laser; emission was read at 450 nm. The
LysoTracker signal was excited at 562 nm using the microscope’s diode-pumped solid-state laser
(DPSS) laser; emission was read at 595 nm. The BODIPY FL-pepstatin A signal was excited at
488 nm using the microscope’s Argon laser; emission was read at 525 nm. Image capture and
analysis were performed using Nikon Elements Advanced Research Software package 3.2.
Image capture on live cells was completed within 15 min of completing dye incubation for
26
LysoSensor/LysoTracker staining, and within 30 min of completing dye incubation for BODIPY
FL-pepstatin A.
Immunoblots
CTRL and PS1-fAD fibroblasts were grown to confluence in adjacent wells of 6-well plates, and
assayed after a minimum of 6 days in culture. On the day of protein collection, existing medium
was replaced with one of three media solutions: fresh medium (components as described above:
minimum essential Eagle’s medium, fetal bovine serum, GlutaMAX, penicillin/streptomycin), fresh
medium plus 10 µM chloroquine (CTRL fibroblasts only), or fresh medium plus cAMP cocktail.
Fibroblast cultures were incubated in these solutions for 6 h at 37 °C. Cells were rinsed 3× in
Dulbecco’s phosphate-buffered saline (DPBS) (+Ca2+/+Mg2+) (Life Technologies). Total protein
was extracted from fibroblasts using radio immunoprecipitation assay (RIPA) buffer (Sigma–
Aldrich or made in-house) plus Complete Mini Protease Inhibitor Cocktail Tablets (Roche Applied
Science, Indianapolis, IN, USA) according to standard protocols. Protein concentration in cellular
extracts was quantified on the BioPhotometer spectrophotometer (Eppendorf AG, Hamburg,
Germany) using the Pierce® BCA Protein Assay Kit (ThermoFisher Scientific).
Protein samples were prepared for agarose gel electrophoresis according to standard protocols
and run at 130 V on a 4–15% Mini-PROTEAN® TGX™ Gel with 50 µL well depth (Bio-Rad,
Hercules, CA, USA). Gel-bound samples were then transferred to a polyvinylidene fluoride
(PVDF) membrane (EMD Millipore Corp., Billerica, MA, USA) for immunoblotting. A solution of
5% non-fat milk (Bio-Rad) was used for membrane blocking. To detect p62, the mouse mAb
p62/SQSTM1 (D-3) was used (#sc-28359, Santa Cruz Biotechnology, Santa Cruz, CA, USA). To
detect LC3B, the rabbit mAb LC3B (D11) XP® was used (#3868S, Cell Signaling Technology,
Beverly, MA, USA). To detect vATPaseB2, the rabbit pAb Anti-ATP6V1B2 was used (#ab73404,
Abcam, Cambridge, MA, USA). To detect Atg5, the rabbit mAb Atg5 (D1G9) was used (#8540,
Cell Signaling Technology). To detect Beclin-1, the rabbit mAb Beclin-1 (D40C5) was used
27
(#3495P, Cell Signaling Technology). To detect glyceraldehyde 3-phosphate dehydrogenase
(GAPDH), the rabbit mAb GAPDH (14C10) was used (#2118S, Cell Signaling Technology). The
antibody used to detect cathepsin D was a generous gift from Kathleen Boesze-Battaglia. All
primary Abs were used at a dilution of 1:1000. Secondary Abs were used at a dilution of 1:3000
and consisted of either sheep anti-mouse (GE Healthcare Life Sciences, Amersham, UK) or
donkey anti-rabbit (GE Healthcare Life Sciences) IgG as horseradish peroxidase (HRP)-linked
whole Ab for electrogenerated chemiluminescence (ECL). Visualization and band quantification
were performed on an ImageQuant LAS 4000 biomolecular imaging system (GE Healthcare Life
Sciences, Pittsburgh, PA, USA).
Quantitative polymerase chain reaction (qPCR)
Total RNA was isolated from cultured human skin fibroblast cells using the TRIzol (Life
Technologies) extraction protocol, with glycogen (Life Technologies) added to improve yield. RNA
yield was determined by absorbance at 260 nm, and purity confirmed by measurement of
260 nm/280 nm ratio on Eppendorf Biophotometer Spectrophotometer. One microgram of total
RNA was converted into cDNA using the High Capacity RNA-to-cDNA first strand synthesis kit
(Applied Biosystems). Human primers were purchased from Life Technologies/Sigma–Aldrich
and constructed according to specifications given in Table 2.1. qPCR was performed using the
Power SYBR Green detector (Life Technologies) on a Life Technologies 7300 Real Time PCR
System. Final primer concentration in each well was 1 µM sense and 1 µM antisense primer. The
thermal cycling profile was as follows: Stage 1, 50 °C for 2 min (one cycle); Stage 2, 95 °C for
10 min (one cycle); Stage 3, 95 °C for 15 s followed by 60 °C for 1 min (40 cycles). Expression
levels of genes of interest were normalized internally to each sample’s expression of the
housekeeping gene ACTB (β-actin). ACTB expression did not differ between CTRL and PS1-fAD
fibroblasts across all experimental trials. All runs included a final dissociation stage to confirm the
amplification of only desired products. To control for genomic DNA contamination, PCR was also
performed on samples from reverse transcriptase reactions in which the enzyme was omitted. No
28
products were observed from these samples, indicating that no genomic DNA contaminated our
experimental samples.
Data analysis
All data are given as mean ± standard error of the mean. Significance was defined as p < 0.05
and was determined using a one-way analysis of variation (ANOVA) followed by an appropriate
post hoc test using SigmaPlot statistics software (v11.0, Systat Software, Inc., San Jose, CA,
USA) unless otherwise noted. When data were not normally distributed, ANOVAs were performed
on ranks.
All chemicals and compounds used were from Sigma–Aldrich Corp., St. Louis, MO unless
otherwise indicated.
Results
pHL is elevated in PS1-fAD fibroblasts
Initial experiments established the feasibility of performing reliable measurements of lysosomal
pH from fibroblasts using our protocols. Fibroblasts derived from normal subjects (CTRL) were
plated into black-walled 96-well plates and briefly incubated with different compounds known to
increase pHL through varied mechanisms. These compounds included: 200 nM bafilomycin A1, a
specific inhibitor of v-(H+)ATPase (Bowman et al., 1988); 20 mM NH4Cl, a lysosomotropic weak
base (Ohkuma and Poole, 1978); 30 µM tamoxifen, a tertiary amine whose pHL-elevating activity
is distinct from its estrogen-like activity (Altan et al., 1999); and 10 µM chloroquine, a
lysosomotropic agent that becomes “trapped” in the lysosome following protonation (de Duve et
al., 1974, Chung, 1986). A representative pH measurement is shown to illustrate the strong effect
of each compound upon pHL (Fig. 2.1, panels A–D). Bafilomycin A1 (Fig. 2.1.A), NH4Cl (Fig.
2.1.B), tamoxifen (Fig. 2.1.C), and chloroquine (Fig. 2.1.D) led to a significant rise in lysosomal
pH levels, as expected. While absolute level of baseline pHL varied somewhat, the baselines
29
recorded were comparable to lysosomal pH levels in other cell types, and were well within the
usual acidic range of the lysosomal enzymes. Importantly, the differences found within the same
experimental trial were constant. These findings verified our ability to effectively measure pHL in
these fibroblasts, and showed that the pHL could be manipulated using standard procedures and
compounds.
Subsequent experiments compared the baseline lysosomal pH levels between CTRL and PS1fAD fibroblasts. The fibroblasts examined had the PS1-fAD missense mutation A246E, which is
linked to both perturbed autophagy (Lee et al., 2010) and elevated Aβ42/40 ratio (Scheuner et al.,
1996, Qian et al., 1998). Fig. 2.1.E illustrates a typical experiment, with CTRL fibroblasts at a pH
of from 4.38 ± 0.13 and PS1-fAD fibroblasts at 4.75 ± 0.17. This small but significant elevation in
lysosomal pH was confirmed in numerous trials from both sets of donor pairs. In a total of 26
individual trials, a significant elevation in lysosomal pH was detected in the PS1-fAD cells, as
indicated by an increased emission ratio (Fig. 2.1.F, the ratios were more reliable than calibration
across double membranes – see Methods). This rise corresponds to an increase of
approximately 0.2 pH units. No substantive difference was observed in autofluorescence between
CTRL and PS1-fAD fibroblasts at wavelengths used for the pHL assay.
While fluorescence readings from the plate reader provided the most accurate comparison of
lysosomal pH, it was important to examine the lysosomes microscopically. No major difference in
overall LysoSensor staining patterns or fluorescence output from the two cell types was observed
by confocal imaging (Fig. 2.1.G, H). Similarly, no substantial differences were observed between
CTRL and PS1-fAD cells using LysoTracker dye (Fig. 2.1.I, J). With both dyes, the number and
distribution of fluorescing organelles varied on a cell-to-cell basis. Bafilomycin treatment
completely eliminated LysoTracker fluorescence for both cell types, confirming the readout.
30
Availability of active cathepsin D is reduced in PS1-fAD fibroblasts
Cathepsin D, the primary aspartyl protease of the lysosome, has a particularly acidic pH optimum
(Barrett, 1970) as well as a pH-dependent maturation (Rosenfeld, 1982). It was therefore
reasoned that the enzyme’s sharp tuning would make its activity and availability particularly
sensitive to pH shifts over the range observed in the PS1-fAD fibroblasts. To this end, both CTRL
and PS1-fAD fibroblasts were incubated with BODIPY FL-pepstatin A, which selectively binds to
active cathepsin D (Chen et al., 2000a), and examined under a confocal microscope. PS1-fAD
cells exhibited markedly reduced BODIPY FL-pepstatin A fluorescence when compared to CTRL
fibroblasts (Fig. 2.2.A). When mean fluorescence intensity per cell was calculated for both CTRL
and PS1-fAD fibroblasts, BODIPY FL-pepstatin A fluorescence was significantly reduced by
approximately 50%, indicating a substantial loss in the availability of active cathepsin D with PS1fAD mutation (Fig. 2.2.B).
Having observed a significant reduction in active site availability by BODIPY FL-pepstatin A,
cathepsin D levels in both CTRL and PS1-fAD fibroblasts were next examined by Western blot.
The antibody detected four primary bands: one each at 52 and 47 kDa, corresponding to
immature/intermediate forms of cathepsin D (Gieselmann et al., 1983), and one each at 34 and
28 kDa, corresponding to processed, mature forms of cathepsin D (Fig. 2.2.C) (Erickson et al.,
1981). The ratio of 28-kDa/52-kDa cathepsin D was found to be significantly reduced in PS1-fAD
fibroblasts, indicating impaired maturation of cathepsin D in mutant cells (Fig. 2.2.D). Importantly,
while no significant changes were observed in the relative levels of either the 52- or 47-kDa forms
of cathepsin D (Fig. 2.2E, F), the reduction in levels of mature cathepsin D approached
significance at 34 kDa (Fig. 2.2.G) and was significant at 28 kDa when compared against CTRL
fibroblasts (Fig. 2.2.H). This indicated that the PS1-fAD cells have reduced maturation, and not
initial production, of the protease.
Together, these data support the premise that even a small pH elevation has real consequences
31
for the activity of a major lysosomal enzyme, and suggest that PS1-fAD cells may have impaired
degradation as a consequence of the loss of cathepsin D.
Altered levels of key proteins support elevated pHL
The finding that cathepsin D availability and maturation is markedly reduced in PS1-fAD
fibroblasts (Fig. 2.2) suggested that the autophagic degradative system may be perturbed as a
result of pH elevation, and prompted an examination of autophagic markers. To provide a general
index of autophagic activity, the levels of the proteins LC3B and p62 were determined in control
and mutant cell types. LC3B is normally a cytosolic protein, the accumulation of which is often
used to identify shifts in autophagic flux (Klionsky et al., 2012). Upon initiation of autophagy the
cytosolic, LC3B-I form of the protein is cleaved and conjugated to phosphatidylethanolamine to
form LC3B-II, which associates with autophagosomal membranes. Elevation of lysosomal pH can
lead to a backlog of autophagy and can raise the ratio of LC3B-II to LC3B-I, as previously shown
in LS174 cells exposed to bafilomycin A1 (Bellot et al., 2009). The ratio of LC3B-II/-I was also
elevated in PS1-fAD fibroblasts compared to CTRL (Fig. 2.3.A, B). This increase reflected a
significant elevation in the relative level of LC3B-II in PS1-fAD fibroblasts (Fig. 2.3.A, C).
Chloroquine also induced a rise in LC3B-II/-I in CTRL fibroblasts (Fig. 2.3.D, E) which, as with the
PS1-fAD fibroblasts, reflected a significant change in LC3B-II (Fig. 2.3.F). While qualitatively
similar, the magnitude of this increase in LC3BII/I with chloroquine was considerably greater than
that observed with PS1-fAD cells, consistent with the relative magnitude of lysosomal
alkalinization under the two conditions.
The increased lysosomal pH levels in PS1-fAD cells are also supported by changes in the levels
of the autophagy-associated protein p62, also known as sequestosome-1. p62 itself is primarily
degraded by autophagy (Bjorkoy et al., 2005), and therefore its elevation can be indicative of
impaired autophagic degradation. Levels of p62 were increased more than twofold in PS1-fAD
cells as compared to control (Fig 2.3.G, H). Chloroquine also triggered an increase in p62 levels
32
in control fibroblasts (Fig. 2.3.G, I). Together, elevation of the LC3B-II/-I ratio and of p62 provides
support for an elevated lysosomal pH in PS1-fAD cells on a protein level, and implies functional
consequences consistent with this rise, although the use of these two measures does not rule out
other mechanisms by which autophagic degradation might be inhibited in PS1-fAD fibroblasts,
such as through the mTOR signaling pathway.
PS1-fAD mutation results in altered expression of lysosome- and autophagy-associated
genes
Additional support for a perturbed degradative system in PS1-fAD cells was sought at a molecular
level by examining the expression of genes associated with lysosomal pH and autophagy.
Lysosomal pH is regulated by a complex series of feedback systems, with pH elevation leading to
alterations in mRNA message for certain key genes (Settembre et al., 2012). qPCR demonstrated
that relative expression of the B2 subunit of the v-(H+)ATPase proton pump rose 89% in PS1-fAD
fibroblasts (Fig. 2.4.A). For ATG5, whose gene product is associated with autophagosome
elongation, relative expression rose 87% in PS1-fAD fibroblasts (Fig. 2.4.B). Similarly, expression
of BCN1, whose product beclin is involved in the genesis of autophagosomes, was also
increased by 92% in PS1-fAD fibroblasts (Fig. 2.4.C). Finally, there was a significant increase in
the expression of TFEB, the transcription factor responsible for lysosomal biogenesis, which has
also recently been identified as a link between lysosomal and autophagic processes (Settembre
et al., 2011, Roczniak-Ferguson et al., 2012); relative expression rose 59% in PS1-fAD fibroblasts
(Fig. 2.4.D). All expression data were first normalized internally to the ubiquitously- and highlyexpressed β-actin (ACTB) message prior to comparison, as no difference in ACTB expression
was detected between CTRL and PS1-fAD fibroblasts.
Protein level shifts in PS1-fAD fibroblasts of lysosome- and autophagy-associated
proteins mirror gene expression changes
While disruption of the lysosome- and autophagy-associated genes identified in Fig. 2.4 provided
33
support for perturbed autophagy in PS1-fAD fibroblasts, validation at the protein level was desired
to confirm the functional effect of the increased mRNA levels. To this end, the levels of
vATPaseB2, Atg5, and beclin-1 were evaluated by Western blot. TFEB levels were not examined
at this time, since the primary mechanism of TFEB’s action is through a nuclear translocation
event (Settembre et al., 2012), and not purely through increased expression.
The protein level of vATPaseB2 in CTRL fibroblasts was found to be unaffected by 6-h incubation
with CHQ, but was significantly increased in PS1-fAD fibroblasts when compared against CTRL
cells (Fig. 2.5.A–C). Similar results were observed for the protein level of Atg5 (Fig. 2.5.D–F) and
for the level of beclin-1 (Fig. 2.5.G–I): in these cases, as well, CHQ incubation proved insufficient
to increase protein levels, but PS1-fAD mutation reliably produced this increase. Together, these
data provide further support for a perturbation of the degradative system in PS1-fAD cells, while
also highlighting a possible difference between the effect of acute and chronic lysosomal pH
elevation upon that system.
Intracellular cAMP elevation re-acidifies lysosomes and reduces LC3B accumulation
Since pH measurement, protein level, and gene expression data all support the conclusion that
the lysosomal pH is defective in the PS1-fAD fibroblasts, attempts were made to restore pH using
the intracellular signaling molecule cAMP. Previous work from our laboratory has demonstrated
that intracellular elevation of cAMP can partially restore pHL that has been elevated by either
pathological or by pharmacological means (Liu et al., 2008, Guha et al., 2012). Importantly, cAMP
re-acidified RPE lysosomes in cells from old mice whose lysosomes had been damaged for an
extended time, suggesting the approach might also restore acidity to lysosomes in the PS1-fAD
fibroblasts. cAMP also has been shown to promote acidification in a variety of contexts and
across a range of cell types (Alzamora et al., 2010, Paunescu et al., 2010).
Increased intracellular cAMP levels reduced pHL in PS1-fAD fibroblasts (Fig. 2.6.A). A cAMP-
34
elevating cocktail, composed of cell-permeable cpt-cAMP, IBMX, and forskolin, consistently
restored pHL in the mutant fibroblasts. The cAMP mix led to a small but insignificant drop in the
lysosomal pH of control cells. Interestingly, preliminary data indicate that cAMP induced a larger
acidification of lysosomes from control fibroblasts whose lysosomes had been alkalized either
with NH4Cl or with tamoxifen. The re-acidifying effect of cAMP was also larger in epithelial cells
with alkalized lysosomes (Liu et al., 2012), consistent with the findings in fibroblasts.
To validate the functional implications of lysosomal acidification of PS1-fAD fibroblasts by cAMP,
the consequences of cAMP-induced pHL restoration on both cathepsin D active site availability
and on autophagy were examined. PS1-fAD cells treated with cAMP cocktail had greater
BODIPY FL-pepstatin A fluorescence when compared against untreated PS1-fAD fibroblasts (Fig.
2.6.B). When mean fluorescence intensity per cell was calculated for both treated and untreated
PS1-fAD fibroblasts, BODIPY FL-pepstatin A fluorescence was significantly increased by about
10% in treated fibroblasts, indicating that 6-h cAMP treatment and pH restoration brings about at
least partial recovery of active cathepsin D (Fig. 2.6.C). Still, even partial restoration of enzyme
activity proved sufficient to improve clearance through the autophagosomal degradation pathway;
incubation with the cAMP cocktail reduced the LC3B-II/I ratio by 60% (Fig. 2.6.D, E), and
significantly decreased LC3B-II levels while increasing LC3B-I (Fig. 2.6.D, F). As cAMP interferes
with p62 independently through the ubiquitin–proteasome degradative pathway (Myeku et al.,
2012), an examination of p62 levels was not pursued here.
Discussion
In this study, human skin fibroblasts containing the PS1-fAD mutation A246E were found to
exhibit elevated lysosomal pH (Fig. 2.1), reduced availability of active cathepsin D and reduced
cleavage to the mature form of the enzyme (Fig. 2.2), and also impaired degradation of
autophagic substrates (Fig. 2.3) as compared to levels from control fibroblasts. Substantive
increases in the expression of genes associated with lysosomal and autophagic degradative
35
machineries were also detected in PS1-fAD fibroblasts (Fig. 2.4), with increases mirrored by
protein levels (Fig. 2.5). Finally, lysosomal acidification was restored by elevation of intracellular
cAMP, leading to a partial restoration of cathepsin D active site availability, as well as reduction in
the LC3B-II/-I ratio (Fig. 2.6), Together, these changes indicate a small but significant steadystate dysfunction in lysosomal pH and degradation as a consequence of the A246E PS1-fAD
mutation, and offer some clues as to how to address this problem therapeutically.
Elevation of pHL
The concurrence of effects on pH, cathepsin D, protein and gene levels strongly support the
conclusion that lysosomes in PS1-fAD fibroblasts are alkalized as compared to controls. Our
protocol to measure lysosomal pH enables the accurate detection of small changes in this pH.
While the elevation of lysosomal pH by 0.2 units may appear small, this change occurs across the
sharpest part of the pH/activity curve for many lysosomal enzymes, where even a minimal rise in
pHL is sufficient to depress enzymatic activity and slow down degradation of cellular materials
(Barrett, 1970). A pHL elevation of only 0.2 units was recently shown to impair proteolysis in
macrophage phagosomes (Jiang et al., 2012), confirming that modest alkalizations are capable of
inducing pathological changes. The decreased cleavage of cathepsin D into the mature form and
the reduction in binding of BODIPY FL-pepstatin A to the active site of this major lysosomal
protease are consistent with functional consequences of lysosomal alkalization. This deficit is
likely small enough that most cellular processes can progress unhindered under normal
circumstances. However, the gradual accumulation of improperly processed material may
decrease efficient cellular function over time. This slow accumulation is predicted to be more
severe in active post-mitotic cells like neurons, which rely upon high baseline levels of autophagic
degradation as a primary clearance mechanism (Boland et al., 2008). Given the differences
between acute modulations of autophagy and the chronic changes in PS1-fAD fibroblasts,
however, the situation is likely to be complex, and differences in the magnitude of the LC3
response in PS1 cells compared to control and those treated with CHQ are not unreasonable. Of
36
interest in this regard is a study demonstrating that chronic treatment with chloroquine or NH4Cl,
but not the autophagy induction inhibitor 3-MA, leads to increased p62 and LC3B-ll/l in rat cortical
neurons (Myeku and Figueiredo-Pereira, 2011). Whether that result reflects the short-term
actions of 3-MA (Wu et al., 2010), or merely different feedback systems activated by lysosomal
alkalization, is not clear.
While modest alkalization may have functional consequences over time, the small magnitude of
the change may explain why this difference has been so difficult to detect. Measuring lysosomal
pH is a difficult task under ideal conditions, and single-wavelength assays such as LysoTracker
Red may not be sensitive enough to detect the small changes demonstrated here (Neely et al.,
2011, Coen et al., 2012). Similarly, while the microscopy-based assay for measuring pHL used by
Zhang et al. (2012) may enable specific localization of acidic organelles, its readout of average
vesicular pH apparently yields a value far higher, both in WT- and PS1k/PSdko-ES, than would
be found in functional lysosomes, and therefore the utility of such an approach to address the
question of lysosomal pH is rather unclear. Our assay has been designed to minimize variation
and detect small differences in vesicular pH; the use of a membrane-permeable pH probe may
also enable access to different compartments than dextran-conjugated probes, the readout of
which is necessarily restricted to that lysosomal sub-population undergoing fusion with
endosomes, and thus may not be indicative of compromised lysosomal subpopulations. In
particular, the concordance of our direct pH measurement data with the more indirect BODIPY
FL-pepstatin A data, as well as with the immunoblots showing impaired maturation of cathepsin
D, provides strong support for the accuracy of our approach.
This study does not identify the ultimate source of pHL dysregulation in these fibroblast culture
types. It may indeed result from improper trafficking of v-(H+)ATPase due to a defect in the v0a1
subunit, as the Nixon laboratory has suggested (Lee et al., 2010), or perhaps from some other
underlying defect or defects in the autophagic or endo-lysosomal axes. Our qPCR results
37
indicating an increase in message for the proton pump suggest a compensatory mechanism is
being attempted. It is important to note that our qPCR probes were designed to amplify
ATP6V1B2, the B2 subunit of the proton pump, which is the more ubiquitously expressed variant
of the B subunit of v-(H+)ATPase (Puopolo et al., 1992, van Hille et al., 1994). No trafficking issue
with this subunit has been identified thus far in AD.
The gene expression and protein data are generally consistent with feedback attempts to
compensate for perturbed lysosomal pH. The fact that a relatively short-term incubation with CHQ
is insufficient to induce the protein increases observed in PS1-fAD suggests, too, that these
fibroblasts may initially attempt to manage pH increases by some other means than increased
autophagic initiation. It is possible, however, that sustained, life-long increase in pH, in
comparison to a temporary, pharmacological increase, may differentially affect the degradative
system along the entirety of its axis. Interestingly, BCN1 expression is also increased in
fibroblasts from patients with certain storage diseases (Pacheco et al., 2007), further
substantiating the similarities observed between primary lysosomal disorders and AD (Nixon,
2004, Nixon et al., 2008), and suggesting that up-regulation of autophagy in response to
accumulated material, while perhaps a conserved strategy, may not be effective in all cases. The
small-but-significant up-regulation of TFEB in PS1-fAD fibroblasts is particularly intriguing, given
that Zhang et al. (2012) reported no difference from wild type in the expression of TFEB while
investigating gene expression profiles of PS1ko and PSdko-ES cells, as well as PScdko mice.
The group also saw no change in the expression of ATG5 and BCN1 in any of these PSko
models. These discrepancies suggest that cells containing mutated, but otherwise intact, PS1
exhibit a differential expression profile from cells that lack PS1 and/or PS2 all together; some
caution should therefore be observed in conflating and comparing results obtained through the
use of a variety of models and techniques. Together, the elevated expression and protein levels
of these genes critical for autophagy and lysosomal acidification provide additional evidence for
perturbed lysosomal pH and, moreover, may be indicative of a degradative system attempting to
38
compensate for a chronic defect at the lysosomal pH level.
Regardless, the major difference between control and PS1-fAD fibroblasts is the A246E mutation
in PS1, and as multiple groups have implicated autophagic disruption in AD, the evidence points
toward a basic deficit in cells with the AD-associated PS1 mutation that predisposes the cells
toward a phenotype of accelerated aging, including lysosomal failure and protein buildup.
Re-acidification by cAMP
Importantly, our data show that re-acidifying lysosomes via elevated intracellular cAMP can help
to restore the lysosomal pH and autophagic turnover associated with the PS1-fAD (A246E)
mutation. The mechanism by which cAMP may do this in these fibroblasts is currently unknown,
though similar acidifying processes have been linked to protein kinase A (PKA) activity in other
cells (Liu et al., 2008, Alzamora et al., 2010, Paunescu et al., 2010) and may involve the
activation of a Cl- channel (Liu et al., 2012). Another intriguing mechanistic possibility for cAMP’s
effect on pHL could involve PKA-mediated inhibition of glycogen synthase kinase 3 (GSK3) (Fang
et al., 2000). While the activity of both the α and β isoforms of GSK3 has been associated with
AD pathology (Cho and Johnson, 2003, Phiel et al., 2003), a number of recent studies have also
identified links between GSK3 and lysosomal dysfunction, whether pharmacologically- or
pathologically-induced (Dobrowolski et al., 2012, Parr et al., 2012, Avrahami et al., 2013). GSK3
inhibition reportedly restores lysosomal acidification defects in both the 5XFAD mouse model and
in cells lacking PS1/2 (Avrahami et al., 2013) and also improves amyloid pathology (Parr et al.,
2012, Avrahami et al., 2013). Interestingly, low PKA activity has been reported in brain tissue
from AD patients (Liang et al., 2007), consistent with a reduction in regulated lysosomal
acidification. Augmenting this system by increasing intracellular cAMP levels and re-acidifying
lysosomes may help to enhance clearance in older neurons and prevent additional consequences
of lysosomal defect, such as perturbed calcium signaling (Christensen et al., 2002). The ability of
cAMP to reverse the rise in LC3B-II/-I ratio seen in the PS1-fAD mutant cells also supports the
39
central role of lysosomal pH in controlling this ratio. In particular, the fact that cAMP
simultaneously increases LC3B-I while decreasing LC3B-II points to its considerable power to
affect autophagy and autophagic clearance, perhaps through some more fundamental effect on
the system than pH alone. Intriguingly, the effect of short-term cAMP treatment apparently
reduces LC3B-II to a level below the control baseline; we suspect that this may be due to
differences between chronic and acute effects on autophagic states. By contrast, the reduction of
baseline pHL observed in control fibroblasts was minimal and not significant. Preliminary results
suggest, however, that cAMP lowers lysosomal pH in control fibroblasts when that pH is artificially
elevated, which is consistent with the idea that the cAMP cocktail proves most effective when pHL
is perturbed from the baseline.
Overall, this study suggests that small deficits in autophagic degradation, linked to improper
maintenance of lysosomal pH, may contribute to pathologic build-up of protein in PS1-fAD
fibroblasts, and that lysosomal re-acidification may offer a strategy by which this accumulation
can be ameliorated. In other words: regardless of whether lysosomal failure is the precipitating
event in disease, or simply a consequence of PS1-mutation-associated phenotypes, reacidification could equalize the cellular playing field.
Acknowledgements
We thank Wennan Lu, Jason Lim, Ann O’Brien Jenkins and Gabriel Baltazar for training and
support, and Kathleen Boesze-Battaglia for help with the cathepsin D immunoblots. These
experiments were supported by the Hearst Foundation Fellowship (EEC), National Institutes of
Health through grants EY013434, EY015537, Vision Research Core Grant EY001583 (C.H.M.,
A.M.L.), Research to Prevent Blindness (A.M.L.), and the Foundation Fighting Blindness (A.M.L.).
This work was presented previously in abstract form (Coffey et al., 2013).
40
Tables
Table 2.1. qPCR primers.
Target
ACTB
NCBI
code
NM_001
101.3
ATP6V1B2
NM_001
693.3
ATG5
NM_004
849.2
BECN1
NM_003
766.3
TFEB
NM_001
167827.2
Primer pair
Sense:
AGAAAATCTGGCACCACACC
Anti-Sense:
GGGGTGTTGAAGGTCTCAAA
Sense:
GAGGGGCAGATCTATGTGGA
Anti-Sense:
GCATGATCCTTCCTGGTCAT
Sense:
GCAAGCCAGACAGGAAAAAG
Anti-Sense:
GACCTTCAGTGGTCCGGTAA
Sense:
AGGTTGAGAAAGGCGAGACA
Anti-Sense:
GCTTTTGTCCACTGCTCCTC
Sense:
GTCCGAGACCTATGGGAACA
Anti-Sense:
CGTCCAGACGCATAATGTTG
41
Tm (°C)
59.97
59.94
Product length
(bp)
142
60.00
59.89
128
59.99
59.97
137
59.99
60.00
139
58.52
57.28
218
Figures
Figure 2.1.
PS1-fAD mutation yields
elevated pHL in human skin fibroblasts.
A–D, Fifteen-minute treatment with pHLelevating compounds significantly increases
lysosomal pH in fibroblasts from controls. A,
Bafilomycin A1 (Baf A1) 200 nM. B, NH4Cl
20 mM. C, Tamoxifen (TMX) 30 µM. D,
Chloroquine (CHQ) 10 µM; for each n = 6–14
wells. E, Lysosomal pH levels in CTRL vs. PS1fAD fibroblasts, n = 10. F, Summary of baseline
lysosomal pH levels across 26 separate
experiments, expressed as uncalibrated ratios
of fluorescence excited at 340 vs. 380 nm –
∼pHL (lysosomal pH). Each experiment from 7
to 10 wells of each genotype, total 222 CNTL
and 224 PS1-fAD. All values normalized to the
mean control for each experimental set. G, H,
Confocal images of 2 µM LysoSensor staining
at ex/em 405/450 nm for CTRL, G, and PS1fAD fibroblasts, H. I, J, Confocal images of
50 nM LysoTracker staining at ex/em
405/450 nm for CTRL, I, and PS1-fAD
fibroblasts, J. Scale bars = 10 µm. Throughout,
“∗” signifies p < 0.05 and CTRL = untreated
control fibroblasts.
42
Figure 2.2. Cathepsin D active site availability and maturation reduced in PS1-fAD
fibroblasts.
A, BODIPY FL-pepstatin A fluorescence is markedly reduced in PS1-fAD fibroblasts when
compared to CTRL. Scale bar = 100 µM. B, Mean intensity per cell analysis of BODIPY FLpepstatin A fluorescence reveals a significant loss in fluorescence; n = 42 CTRL and 40 PS1-fAD
cells. C, A sample Western blot showing reduction of mature cathepsin D in PS1-fAD fibroblasts.
D, The ratio of 28-kDa/52-kDa cathepsin D is reduced in PS1-fAD fibroblasts. E, The level of 52kDa or, in F, 47- kDa cathepsin D, is the same in PS1-fAD and control fibroblasts. The reduction
in the mature 34-kDa band approaches significance in G at p = 0.07, while the mature 28-kDa
band is significantly reduced in PS1-fAD cells, H. For D–H, n = 3. Throughout, “∗” signifies
p < 0.05 and CTRL = untreated control fibroblasts.
43
Figure 2.3. Elevated pHL impairs autophagic degradation through the lysosomes. A, A sample Western blot showing elevation of LC3B-II in PS1-fAD fibroblasts. B, LC3B-II/-I is
elevated in PS1-fAD fibroblasts. C, LC3B-I is unchanged in PS1-fAD fibroblasts, while LC3B-II is
significantly elevated. For B, C, n = 15 CTRL, 16 PS1-fAD, 9 blots total. D, A sample Western blot
showing elevation of LC3B-II in CTRL cells treated with 10 µM chloroquine (CHQ) for 6 h. E,
LC3B-II/-I is elevated in CTRL fibroblasts treated with CHQ. F, LC3B-I is unchanged in CHQtreated fibroblasts, while LC3B-II is significantly elevated. For E, F, n = 5 CTRL, 5 CTRL + CHQ,
5 blots total. G, A sample Western blot showing elevation of p62 in PS1-fAD fibroblasts and in
CTRL cells treated with 10 µM CHQ for 6 h. H, p62 is elevated in PS1-fAD fibroblasts, (n = 13
CTRL, 14 PS1-fAD, 8 blots total). I, p62 is elevated following 6 h chloroquine incubation, n = 5
per condition, 5 blots total. Throughout, “∗” signifies p < 0.05 and CTRL = untreated control
fibroblasts. Protein level of each protein was normalized to GAPDH as an internal control.
44
Figure 2.4. PS1-fAD fibroblasts exhibit altered gene expression profile. Results from quantitative PCR experiments indicating the increased expression of genes in
fibroblasts from the PS1-fAD cells as compared to unaffected controls. A, ATP6V1B2 expression
elevated in PS1-fAD fibroblasts. B, ATG5 expression elevated in PS1-fAD fibroblasts. C, BECN1
expression elevated in PS1-fAD fibroblasts. D, TFEB expression elevated in PS1-fAD fibroblasts.
n = 4 independent trials for each. “∗” signifies p < 0.05 for entire figure. Expression level of each
gene was first normalized to ACTB expression as an internal control.
45
Figure 2.5. PS1-fAD fibroblasts have increased levels of lysosome- and autophagyassociated proteins.
A, A sample Western blot showing elevation of vATPaseB2 (ATP6V1B2) in PS1-fAD fibroblasts,
but not in CTRL cells treated with 10 µM CHQ for 6 h. B, vATPaseB2 is not elevated following 6-h
CHQ incubation; n = 4 CTRL, 4 CHQ, 4 blots total. C, vATPaseB2 is elevated in PS1-fAD
fibroblasts; n = 4 CTRL, 4 PS1-fAD, 4 blots total. D, A sample Western blot showing elevation of
Atg5 in PS1-fAD fibroblasts, but not in CTRL cells treated with 10 µM CHQ for 6 h. E, Atg5 is not
elevated following 6-h CHQ incubation; n = 5 CTRL, 5 CHQ, 5 blots total. F, Atg5 is elevated in
PS1-fAD fibroblasts; n = 7 CTRL, 8 PS1-fAD, 6 blots total. G, A sample Western blot showing
elevation of beclin-1 in PS1-fAD fibroblasts, but not in CTRL cells treated with 10 µM CHQ for
6 h. H, Beclin-1 is not elevated following 6-h CHQ incubation; n = 4 CTRL, 4 CHQ, 4 blots total. I,
Beclin-1 is elevated in PS1-fAD fibroblasts; n = 8 CTRL, 8 PS1-fAD, 6 blots total. Throughout, “*”
signifies p < 0.05 and CTRL = untreated control fibroblasts. Protein level of each protein was
normalized to GAPDH as an internal control.
46
Figure 2.6. cAMP restores pHL and improves clearance in PS1-fAD fibroblasts.
A, Treatment of PS1-fAD cells with cAMP reduced lysosomal pH levels back to control levels.
Treatment of control cells with the cocktail had a minimal effect. LysoSensor ratios normalized to
mean control of each day’s experiment. N = 14 plates with 7–10 wells each. cAMP
cocktail = 500 µM cpt-cAMP + 100 µM IBMX + 10 µM forksolin. ∗p < 0.05 vs control, #p < 0.05 vs
PS1-fAD alone. B, BODIPY FL-pepstatin A fluorescence is increased in PS1-fAD fibroblasts
treated with cAMP cocktail. Scale bar = 100 µM. C, Mean intensity per cell analysis of BODIPY
FL-pepstatin A fluorescence reveals a significant increase in fluorescence; n = 60 PS1-fAD and
81 PS1-fAD cells. D, Western blot showing incubation with cAMP cocktail decreases LC3B-II/-I in
PS1-fAD fibroblasts. E, Summary of six Western blots showing a significant decrease in LC3B-II/I in PS1-fAD fibroblasts treated with the cAMP cocktail. F, LC3B-I is significantly increased in
cAMP-treated fibroblasts, while LC3B-II is significantly reduced. For E, F, n = 11 PS1-fAD, 8 PS1fAD + cAMP, 6 blots total. #p < 0.05 for the entire figure.
47
CHAPTER 3:
cAMP acts through PKA and mTOR to restore lysosomal pH in
presenilin 1 A246E Alzheimer fibroblasts
E. E. COFFEYa, C. H. MITCHELLa,b
a) Department of Anatomy and Cell Biology, University of Pennsylvania, Philadelphia, PA
19104, United States.
b) Department of Physiology, University of Pennsylvania, Philadelphia, PA 19104, United
States.
48
Abstract
Mutations in the transmembrane protein presenilin 1 (PS1) lead to the early-onset, inherited,
familial form of Alzheimer’s disease (fAD). Some PS1 mutations are known to exacerbate the
autophagic and lysosomal pathology of AD, including the A246E mutation. This mutation results
in increased lysosomal pH, and induces a compensatory response from the lysosomal and
autophagic machinery. Defective lysosomes can be acidified by treatment with a cAMP-elevating
cocktail. In this study, we confirmed the beneficial effects of cAMP on lysosomal pH in A246E
mutant fibroblasts, and explored the mechanisms underlying this improvement. Re-acidification
was supported by increased binding of boron-dipyrromethene (BODIPY) FL-pepstatin A to the
cathepsin D active site. cAMP’s beneficial effects on both lysosomal pH and cathepsin D active
site availability were found to be dependent on protein kinase A (PKA) activity. cAMP treatment
increased levels of phosphorylated mTOR; both pH restoration and mTOR phosphorylation were
dependent on PKA. cAMP treatment resulted in dramatically reduced expression of transcription
factor EB after 6 h, and reduced ATP6V1B2 expression after 12 h. cAMP’s ability to restore
lysosomal pH in compromised cells was replicated in primary rat cortical cultures with
pharmacologically-elevated lysosomal pH, thus demonstrating a broader application for cAMP
treatment. Together, these results confirm cAMP’s ability to restore lysosomal pH, implicate PKA
in pH restoration, and indicate that the downstream response to pH restoration is a complex,
PKA-mediated process that engages the mTOR-TFEB signaling pathway.
49
Introduction
Ever since the discovery of the lysosome in 1955, defects in essential lysosomal catabolic
enzymes were hypothesized, and later found, to play a critical role in several storage diseases.
More recently, however, we have come to understand that lysosomal dysfunction is not limited to
these severe, though relatively rare, inherited disorders. Instead, even mild disruptions of the
lysosomal environment have proven to have far wider reach, with lysosomal underperformance
implicated in macular degeneration and in a host of age-related neurodegenerative disorders,
including Alzheimer’s disease (Cataldo and Nixon, 1990, Cataldo et al., 1996, Cataldo et al.,
2004, Nixon, 2005, Nixon et al., 2005, Nixon and Cataldo, 2006, Khurana et al., 2010, Lee et al.,
2010, Lipinski et al., 2010, Avrahami et al., 2013, Coffey et al., 2014).
The neuropathology of Alzheimer’s disease (AD) is traditionally associated with the build-up of
extracellular senile plaques of the peptide fragment amyloid-β, and of intracellular neurofibrillary
tangles associated with hyperphorphorylated tau protein (Glenner and Wong, 1984a, b, Kosik et
al., 1986, Nukina and Ihara, 1986). For some years, however, another pathology has been linked
to disease: the build-up of incompletely degraded material in swollen lysosomes and
autophagosomes (Nixon et al., 2005). Alzheimer’s-associated mutations of the transmembrane
protein presenilin 1 (PS1), a protein that is also responsible for the final cleavage step in amyloidβ production, appear to exacerbate this pathology (Cataldo et al., 2004). Of note, a major
lysosomal protease, Cathepsin D (Cat D) has been identified as a component of senile plaques
(Cataldo and Nixon, 1990), further implicating the lysosomal/autophagic degradative pathway in
the disease.
The role of PS1 mutation in accelerating autophagic pathology in AD has been a subject of much
debate over the past few years. In 2010, PS1 loss, and even its AD-associated mutation, was
linked to increased lysosomal pH – possibly through a failure to glycosylate and target the V0a1
subunit of the lysosomal proton pump, v-(H+)ATPase (Lee et al., 2010) While several other
50
laboratories were unable to confirm this pH elevation (Neely et al., 2011, Coen et al., 2012,
Zhang et al., 2012), this may be due to the considerable technical challenge of in making
accurate measurements of lysosomal pH (Wolfe et al., 2013, Guha et al., 2014). We, and others,
confirmed the link between increased lysosomal pH and PS1 mutation (Avrahami et al., 2013,
Coffey et al., 2014). Our laboratory also demonstrated that elevated cAMP is able to restore pH
and lysosomal function (Coffey et al., 2014), though cAMP’s mechanisms of action and signaling
targets were still uncertain. The observed disruption of autophagy in PS1-fAD fibroblasts,
however, suggests several possible targets of cAMP-induced lysosomal re-acidification.
It has been known for some time that the mechanistic target of rapamycin complex 1 (mTORC1)
negatively regulates mammalian autophagy, but its role in, and response to, lysosomal health and
stability was discovered much more recently. mTORC1 was shown to interact with the lysosomal
“master switch” transcription factor EB, or TFEB, which regulates both autophagy and lysosomal
biogenesis (Sardiello et al., 2009, Palmieri et al., 2011, Settembre et al., 2011). Interestingly,
Settembre and others have shown that TFEB not only positively regulates its own transcription
(Settembre et al., 2013), but that it can be phosphorylated by active mTOR on the lysosomal
membrane in a rapamycin-independent manner (Martina et al., 2012, Roczniak-Ferguson et al.,
2012, Settembre et al., 2012). We have previously found TFEB expression to be itself upregulated in PS1-fAD fibroblasts, along with several other TFEB targets in the Coordinated
Lysosomal Expression and Regulation (CLEAR) network (Coffey et al., 2014), presumably as a
compensatory response to autophagy failure. These findings, in combination with recent work
implicating mTORC1 in both TFEB activity and in the lysosomal response to nutrients (Martina et
al., 2012, Roczniak-Ferguson et al., 2012, Settembre et al., 2012), suggested that both TFEB and
mTOR might mediate cAMP’s effects.
Our previous work validated that human skin fibroblasts containing the familial PS1 mutation
A246E are characterized by increased lysosomal pH, and that this increase results in myriad
51
other problems: in degradative deficiency, lysosomal enzyme loss, and compensatory upregulation of the machinery (Coffey et al., 2014). We also found that elevation of intracellular
cAMP improves both lysosomal pH and reduces autophagic backlog in PS1-fAD fibroblasts. In
this study, we asked how cAMP restores lysosomal pH. We first asked whether protein kinase A,
the activity of which is regulated by cAMP, might mediate cAMP’s action in PS1-fAD fibroblasts.
We also investigated whether mTOR and TFEB, as known mediators of lysosomal and
autophagic responses, might also respond to cAMP treatment, thereby providing a potential
downstream mechanism for cAMP’s action. Here, we demonstrate the general applicability of the
cAMP therapeutic approach, find that cAMP treatment restores lysosomal pH and Cat D
availability, increases mTOR phosphorylation in PS1-fAD cells, and decreases mRNA expression
of both TFEB and ATP6V1B2; these effects appear to depend upon PKA activity.
Materials and Methods
Culture of human fibroblast skin cells
Culture of human skin fibroblast cells was carried out as described (Coffey et al., 2014). Briefly,
human skin fibroblast cultures were purchased from the National Institute of Aging’s Cell Culture
Repository at Coriell Institute of Medical Research (Camden, NJ); catalog numbers AG08170
(PS1-fAD fibroblasts with the A246E mutation) and AG07621 or AG07623 (unaffected spousal
fibroblasts) were used in this study. Cells were cultured in Eagle’s Minimum Essential Medium
supplemented with 15% fetal bovine serum, 1% penicillin/streptomycin (Life Technologies Corp.,
Grand Island, NY, USA), and 1X GlutaMAX (Life Technologies). Cultures were maintained at
37ºC in 5.5% CO2. Cells were cultured a minimum of 6 d before assays were performed, as this
was previously found to affect the development of lysosomal pathology (Coffey et al., 2014).
Culture of rat primary cortical cells
Primary cortical cultures from neonatal Sprague Dawley rats were obtained through the University
52
of Pennsylvania Perelman School of Medicine’s “Neurons R Us” service, which is run by Dr. Marc
Dichter. On the day of isolation, cultures were plated into dishes pre-coated with 0.01% poly-Llysine (Peptide Institute, Osaka, Japan); cultures were then grown in neurobasal medium + B27
supplement (both Life Technologies). Cells were cultured a minimum of 11 d before assays were
performed. Cultures were determined by antibody staining to be primarily neuronal (data not
shown); astrocytes were stained for GFAP, and neurons for Pgp9.5 (see Microscopy section of
Materials and Methods for details). In some experiments, cells were treated with the anti-mitotic
compound β-D-cytosine arabinofuranoside (Ara-C) to halt astrocytic growth and increase the
proportion of neurons; results for these experiments were similar with and without Ara-C.
Measurement of lysosomal pH
Lysosomal pH (pHL) was measured as previously described (Coffey et al., 2014). Briefly,
fibroblast cells or neuronal cultures were plated into black-walled, clear-bottom 96-well plates and
grown for a period of time appropriate to each cell type (see above). On the day of the
experiment, cells were pre-treated in complete growth medium with appropriate drugs; then
medium was removed and cells were incubated for 3 min in 2 µM LysoSensor Yellow/Blue (Life
Technologies). All steps including and following this incubation were performed under foil. Cells
were rinsed 3x in room temperature isotonic solution (NaCl, 105 mM; KCl, 5 mM; HEPES-Acid,
6 mM; Na-HEPES, 4 mM; NaHCO3, 5 mM; mannitol, 60 mM; glucose, 5 mM; MgCl2, 0.5 mM;
CaCl2, 1.3 mM; pH, adjusted to 7.4). Cells were then incubated for 10 min in either isotonic
solution or in isotonic solution containing the relevant drug(s). Final drug concentrations were:
30 µM tamoxifen, cyclic adenosine monophosphate (cAMP) cocktail (500 µM cpt-cAMP, 100 µM
3-isobutyl-1-methylxanthine (IBMX), 10 µM forskolin (forskolin from LC Laboratories, Woburn,
MA, USA)) and 1 µM myristoylated protein kinase inhibitor 14-22 amide, henceforward “PKI”
(Tocris Bioscience, Bristol, UK). The pH assay with γ-secretase inhibitor IX (#565784, EMD
Millipore Corp., Billerica, MA, USA) referenced in the Results section involved a 24-48h
preincubation with the inhibitor; differing incubation times did not impact experiment outcomes.
53
For pH experiment shown in Fig 3.2.A, pH was measured using LysoSensor Yellow/Blue dextran
(Life Technologies). Cells were incubated with 25 µg/ml fluorophore overnight in medium at 37ºC.
The following day, cells were chased for 6 h in fresh medium, with 1 µM PKI added in medium for
the final hour as required. The assay then proceeded as above, although the 3 min LysoSensor
incubation step was omitted.
Microscopy
Live-cell confocal microscopy was carried out as previously described (Coffey et al., 2014).
Briefly, for boron-dipyrromethene (BODIPY) FL-pepstatin A (Life Technologies) staining, cells
were pre-treated for 6 h with fresh medium or with medium plus cAMP cocktail. In the last hour of
incubation, BODIPY FL-pepstatin A was added to each treatment condition to a concentration of
1 µg/ml. Samples were rinsed and imaged in Dulbecco’s Phosphate-Buffered Saline (DPBS)
(+Ca2+/+Mg2+) (Life Technologies) using the University of Pennsylvania Live Cell Imaging Core’s
Nikon A1R Laser Scanning Confocal Microscope (excitation 488 nm/emission 525 nm).
Fluorescence imaging was performed using the Argon laser; images were captured at 60X.
Fixed-cell fluorescent microscopy was carried out using a Nixon Eclipse E600 optical microscope.
Images were captured at 40X magnification. For fibroblasts, cultures were grown to desired
confluence on glass coverslips, then rinsed briefly in DPBS and fixed in 4% paraformaldehyde.
Cells were rinsed with DPBS and permeabilized at room temperature in quenching buffer (20 mM
glycine, 75 mM NH4Cl) + 0.1% Triton X-100 for 8 min, followed by quenching buffer + 0.1% Triton
X-100 + 0.05% SDS for 2 min; coverslips were then rinsed with DPBS. Coverslips were blocked
for 2 h in blocking solution (1.4 cold fish skin gelatin from Sigma, 500 µl 10% w/v saponin stock in
H2O, and 5% normal goat serum, with DPBS to 200 ml). All coverslips were rinsed with DPBS
and incubated with primary antibody in blocking solution overnight at 4ºC. The following day,
coverslips were rinsed first in DPBS and then in blocking solution, and then incubated with
54
secondary antibody in blocking solution for 1 h. Cells were washed in first DPBS, then blocking
solution, then DPBS; fibroblast morphology was then stained by incubating with the beta-actin
dye Alexa Fluor 568 phalloidin (#A12380, Life Technologies) at 5 U/ml for 20 min, followed by a
quick DPBS/blocking solution/DPBS rinse; nuclei were then stained by incubating with 4’, 6diamidino-2-phenylindole dihydrochloride (DAPI) from Life Technologies (#D1306) at 0.5 µg/ml in
DPBS for 1 min. Coverslips were rinsed in DPBS, mounted onto glass slides in Slow Fade Gold
Antifade Mountant (#S36936, Life Technologies), and then sealed for imaging. To detect
lysosomes, the mouse primary antibody for LAMP2 (#ab25631, Abcam, Cambridge, MA) was
used at a dilution of 1:100; the secondary antibody Goat anti-mouse IgG (H+L) Alexa Fluor® 488
(#A11001, Life Technologies) was used at a dilution of 1:500.
For neurons, cultures were grown on glass coverslips, then rinsed briefly in DPBS and fixed in
4% paraformaldehyde. Coverslips were then rinsed in DPBS and permeabilized in 0.1% Triton X100 for 20 min at room temperature. Cells were blocked with 10% goat serum, and incubated with
primary antibodies overnight at 4ºC. The following day, coverslips were rinsed in diluted blocking
buffer at room temperature, incubated with secondary antibodies for 2 h in the dark, rinsed again,
and mounted onto glass slides using SlowFade Gold + DAPI (#S36938, Life Technologies), and
then sealed for imaging. To detect neurons, the rabbit primary antibody for Pgp9.5 (#AB5975,
EMD Millipore Corp.) was used at a dilution of 1:1000; to detect astrocyes, the murine primary
antibody for GFAP (#MAB360, EMD Millipore Corp.) was used at a dilution of 1:400. Secondary
antibodies used were a goat anti-rabbit antibody at 1:1000, and a goat anti-mouse antibody at
1:2000 (Life Technologies #A11006 and #A10035, respectively). Neuronal images were captured
at 20X.
Quantitative measurement of BODIPY FL-pepstatin A fluorescence
For quantitative assessment of BODIPY FL-pepstatin A fluorescence in neuronal cultures, cells
were cultured in clear-bottom, black-walled 96-well plates, using the medium components
55
described above, for a minimum of 11 d. To begin assay, cells were pre-incubated for 1 h with 10
ng/ml BODIPY FL-pepstatin A in complete medium. Medium, along with fluorophore, was
removed, cells were rinsed 3x with isotonic solution, and then 100 µl of the appropriate treatment
condition was added to each well. Cells were assayed after 10 min incubation with drugs, and
fluorescence measured with a Fluoroskan Ascent Microplate Fluorometer and recorded using
ASCENT software (Thermo Scientific, Waltham, MA, USA). Fluorescence was measured at 485
nm excitation/527 nm emission. For measuring BODIPY FL-pepstatin A fluorescence in PS1-fAD
fibroblasts, cells were cultured in 96-well plates as above; cells were grown for at least 6 d and to
confluence. To begin assay, cells were pre-treated with one of 3 conditions: control medium;
cAMP cocktail for 6 h; or PKI for 1h, then PKI + cAMP cocktail for 6h. In the final hour of pretreatment, 1 ug/ml BODIPY FL-pepstatin A (Life Technologies) was added to each treatment
condition. Medium, along with treatment conditions and fluorophore, was removed, cells were
rinsed 3x with isotonic solution, and then 100 ul isotonic solution was added to each well. After a
brief interval (about 5 min), fluorescence was measured as above. Also as above, fluorescence
was measured at 485 nm excitation/527 nm emission.
Immunoblots
Immunoblotting was performed according to standard protocols used previously (Coffey et al.,
2014). Briefly, fibroblasts were grown to confluence in 6-well plates and treated with drug
solutions as required by each experiment. Protein was extracted in radio immunoprecipitation
assay (RIPA) buffer and protein concentration was quantified using the Pierce® BCA Protein
Assay Kit (ThermoFisher Scientific). Samples were prepared for electrophoresis and run on a
pre-cast 4-15% Mini-PROTEAN® TGX™ Gel (Bio-Rad, Hercules, CA, USA). Sample transfer to a
PVDF membrane (EMD Millipore Corp.) was performed according to standard protocols, and
membranes were then blocked for 1 h in 5% non-fat milk solution (powdered milk from
LabScientific, Highlands, NJ). Primary antibody incubations were carried out overnight at 4ºC,
with all primary dilutions at 1:1000. The secondary, an anti-rabbit, horseradish peroxidase (HRP)-
56
conjugated whole antibody (GE Healthcare Life Sciences, Amersham, UK) was diluted at 1:3000
and incubated with the membrane the following day for 1 h. Bands were developed using
electrogenerated chemiluminescence (ECL) and the Amersham ECL Prime Western Blotting
Detection Reagent (GE Healthcare Life Sciences). Development and analysis of membrane
images was performed using the ImageQuant LAS 4000 system (GE Healthcare Life Sciences,
Pittsburgh, PA, USA). Each membrane included an n of 2-3 samples per condition; for analysis,
band volume of the protein of interest was first normalized to the loading control for each lane,
and then normalized across the membrane to the mean band volume of the protein of interest in
the untreated control condition.
Primary antibodies: for phosphorylated mammalian target of rapamycin (p-mTOR), rabbit
polyclonal antibody against the S2448 phosphorylation site was used (#2971, Cell Signaling
Technology, Beverly, MA, USA). For mTOR, rabbit polyclonal antibody was used (#2972, Cell
Signaling Technology). For the loading control glyceraldehyde 3-phosphate dehydrogenase
(GAPDH), rabbit monoclonal antibody GAPDH (14C10) was used (#2118, Cell Signaling
Technology).
Quantitative polymerase chain reaction (qPCR)
Total RNA was isolated from cultured human skin fibroblast cells using the TRIzol (Life
Technologies) extraction protocol, then quantified and converted to cDNA as previously described
(2014). qPCR was also performed as previously described, and expression levels of each gene
were normalized to the expression of housekeeping gene ACTB (β-actin). Human primers were
purchased from Life Technologies/Sigma–Aldrich according to sequences listed in Table 1.
Primer sequences for ACTB, TFEB, and ATP6V1B2 were derived from Primer3.
Data analysis
Data were compiled and analyzed using SigmaPlot statistics software (v11.0, Systat Software,
57
Inc., San Jose, CA, USA) unless otherwise noted. A p-value of p < 0.05 was considered
significant; data were analyzed by ANOVA and then the appropriate post-hoc test. Bar graph
values represent means plus or minus standard error. When the distribution of data was nonnormal, further analysis was performed on ranks.
All materials were purchased from Sigma–Aldrich Corp. in St. Louis, MO, unless otherwise noted.
Results
cAMP restores lysosomal pH and Cat D active site availability in human fibroblast cultures
Lysosomal pH was elevated by about 0.2 pH units in PS1-fAD fibroblasts when compared to nonAlzheimer’s fibroblasts (Coffey et al., 2014); this effect was not dependent upon PS1 activity, as
treatment of CTRL cells with γ-secretase inhibitor IX had no effect upon pH, and treatment of
PS1-fAD cells with the inhibitor had no further effect upon pH [data not shown]. 10 min treatment
with a cAMP-elevating cocktail (consisting of 500 µM cpt-cAMP, 100 µM IBMX, and 10 µM
forskolin), however, partially restored lysosomal pH in CTRL cells treated with tamoxifen [data not
shown] and also lowered lysosomal pH in PS1-fAD cells (Fig. 3.1.A). These data indicated that
cAMP-induced lysosomal pH restoration was rapid and most likely did not depend upon additional
transcription or translation. Next, CTRL, PS1-fAD, and PS1-fAD fibroblasts were treated with 6 h
with cAMP and stained for LAMP2 to detect lysosomes, and for phalloidin to detect basic cellular
morphology. Though cell size and morphology did differ somewhat between CTRL and PS1-fAD
fibroblasts, no substantial differences in lysosome number or distribution were observed following
cAMP treatment; representative images are shown in Fig. 3.1.B. These findings support the
observed cAMP effect in PS1-fAD cells as a product of pH reduction, and not as a product of
changes in lysosome number.
58
Given the potential impact of restoring defective lysosomal pH in cells with PS1 mutations, we
sought to test whether cAMP elevation restores lysosomal proteolytic function, using cathepsin D
activity as a readout. The fluorophore BODIPY-FL-pepstatin A isfluorophore is conjugated to the
highly specific Cat D inhibitor pepstatin A, and therefore offers a measure of Cat D active site
availability (Chen et al., 2000a). The technique allows for an indirect confirmation of lysosomal
pH, as both Cat D function (Barrett, 1970) and maturation (Rosenfeld, 1982) require an acidic
lysosomal milieu. 6 h treatment with cAMP cocktail visibly increased fluorescence of BODIPY FLpepstatin A (Fig. 3.1.C), supporting the ability of cAMP to re-acidify compromised lysosomes and
implying enhanced activity of Cat D.
PKI blocks cAMP-induced pH restoration
Prior work from a number of laboratories, including our own, has linked the activity of protein
kinase A (PKA) to lysosomal acidification (Liu et al., 2008, Alzamora et al., 2010, Paunescu et al.,
2010). We have previously shown that cAMP-induced lysosomal re-acidification in cultured
human retinal pigmented epithelial cells can be blocked when cells are also treated with a cellpermeable, myristoylated protein kinase inhibitor (PKI)14-22 amide (Liu et al., 2008).
Henceforward, this inhibitor will be referred to as “PKI.” The ability of PKI to block cAMP-induced
pH restoration was therefore examined in PS1-fAD fibroblasts, The inhibitor was applied at 1 µM
for all experiments as this concentration of the pseudosubstrate fragment reduces PKA activity in
both rat islet cell extracts and in intact islets (Harris et al., 1997). Cells were pre-incubated with
PKI for approximately 1 h prior to addition of the cAMP cocktail, ensuring minimal access to
endogenous PKA substrate prior to the start of each experiment.
PKI completely and significantly blocked cAMP-induced lysosomal pH restoration in PS1-fAD
fibroblasts (Fig. 3.2.A), indicating the short-term effects of cAMP upon lysosomal pH were
dependent upon PKA activity. When PS1-fAD fibroblasts were treated with both cAMP and PKI
for 6 h, and when this treatment was preceded by 1 h pre-incubation with PKI, the cAMP-induced
59
increase in Cat D active site availability was also completely blocked (Fig. 3.2.B). These data
further implicated PKA in cAMP-induced pH restoration, and in its functional consequences for
Cat D.
cAMP increases mTOR phosphorylation in PS1-fAD fibroblasts
mTOR complex 1 is a known regulator of autophagy. When the mTOR kinase component of this
complex is activated, it initiates a signaling cascade that promotes cellular growth and blocks
autophagy initiation (Ma and Blenis, 2009, Duvel et al., 2010, Kim et al., 2011, Laplante and
Sabatini, 2012). Under conditions of starvation or following exposure to upstream signals or
chemicals like rapamycin, mTOR itself becomes inhibited, and autophagy proceeds as needed
until cellular nutrient balance is restored (Chang et al., 2009). Phosphorylation at residue S2448
has been shown to correlate with mTORC1 activity (Rosner et al., 2010); therefore, given our
earlier observation that autophagy was perturbed in PS1-fAD fibroblasts (Coffey et al., 2014), the
protein level of phosphorylated S2448 (henceforward, “p-mTOR”) was examined in both CTRL
and PS1-fAD fibroblasts. No difference was observed in the protein level of either p-mTOR or
mTOR when comparing CTRL and PS1-fAD fibroblasts (Fig. 3.3.A, B).
mTORC1 is highly responsive to changing nutrient conditions within the cell, and recently was
found to modulate its activity based on the level of free amino acids within the lysosome; this
changing activity depended on the lysosomal proton pump (Zoncu et al., 2011). As cAMP lowers
lysosomal pH and increases Cat D active site availability, it was postulated that the resulting
increase in degradation would lead to changes in mTOR phosphorylation. Therefore, it was
examined whether incubation with cAMP led to increased mTOR phosphorylation in PS1-fAD
fibroblasts. After 6 h treatment with cAMP cocktail, a significant increase in the level of p-mTOR
was observed (Fig. 3.3.C, D). While a lesser increase in mTOR was also observed with cAMP,
regression analysis showed that these increases in p-mTOR and mTOR were not correlated
(data not shown). To probe whether p-mTOR was a cause or an effect of cAMP-mediated pH
60
restoration, PS1-fAD fibroblasts were treated with cAMP for 15 min. At this timescale, no change
in either p-mTOR or mTOR was observed (Fig. 3.3.E, F). If mTOR phosphorylation were directly
mediated by cAMP, one would expect to see the phosphorylation event happening concurrently
with pH restoration. Instead, this timing suggests that lysosomal pH is restored first, and that
mTOR phosphorylation and activation occurs later, once lysosomal degradative activity is back to
normal.
TFEB expression is reduced with cAMP
Having previously observed increased gene expression of transcription factor EB (TFEB) in PS1fAD fibroblasts with elevated lysosomal pH (Coffey et al., 2014), it was hypothesized that cAMPinduced pH restoration would result in a reduction in TFEB expression, as detected by
quantitative real-time polymerase chain reaction (qRT-PCR). After 6 h incubation with the cAMP
cocktail, the level of TFEB transcript in PS1-fAD fibroblasts was reduced by over 80%, though no
decrease in expression of TFEB target genes ATP6V1B2 was observed at this time (Fig. 3.4.A).
After 12 h incubation with cAMP cocktail, however, the expression level of ATP6V1B2 transcript
was also significantly reduced, while expression of TFEB had returned to its approximate
baseline level (Fig. 3.4.B).
mTOR phosphorylation with cAMP Is blocked by PKI
Finally, it was investigated whether, by blocking lysosomal pH elevation via PKI pre-incubation,
the effects of pH restoration on mTOR activation would also be blocked. PS1-fAD fibroblasts
were pre-incubated for 1 h with PKI, and then treated with either fresh medium, cAMP cocktail, or
PKI + cAMP cocktail for 6 h. As in Fig. 3.3, a cAMP-dependent increase in p-mTOR was
observed; preliminary data, while not yet significant, indicate that this increase may be blocked by
PKI (Fig. 3.5.A, B). No changes in mTOR were observed, corroborating the hypothesis that the
short-term, downstream events of cAMP treatment are dependent primarily on mTOR
phosphorylation, and not on any baseline change in mTOR protein expression.
61
cAMP restores lysosomal pH and Cat D active site availability in rat primary cortical
cultures
While the use of human fibroblasts permits study of actual patient tissue, it was also important to
demonstrate that the cAMP approach worked in neurons. Because cAMP treatment is less
effective when lysosomal pH is ideal than when pH is elevated (Coffey et al., 2014), lysosomal pH
first needed to be elevated above healthy baseline. The tertiary amine tamoxifen quickly elevates
lysosomal pH and does so independently of its estrogen-like activity (Altan et al., 1999);
therefore, tamoxifen was an ideal drug to use in this experiment. Importantly, it was found that
aberrant lysosomal pH, induced by tamoxifen, was restored by cAMP cocktail in rat primary
cortical cultures. A representative image of these cultures is shown in Fig. 3.6.A, and shows the
primarily neuronal composition of the cultures. In cortical cultures treated for 10 min with
tamoxifen, treatment with cAMP cocktail lowered lysosomal pH (Fig. 3.6.B). When these same
cultures were assayed using BODIPY FL-pepstatin A, the decreased Cat D active site availability
caused by 10 min tamoxifen exposure could also be reversed by simultaneous treatment with
cAMP (Fig. 3.6.C). Even on this short time scale, cAMP was able to restore lysosomal pH in both
fibroblast and neuronal cell types.
Discussion
In this study, elevating cAMP restored both lysosomal pH and Cat D active site availability in
PS1-fAD (A246E) human skin fibroblasts (Fig. 3.1). Lysosomal pH restoration was found to be
dependent on PKA; without PKA activity, neither pH nor Cat D active site availability was restored
(Fig. 3.2). Persistent pH restoration via cAMP was shown to increase p-mTOR (Fig. 3.3) and to
down-regulate TFEB expression after 6 h, and ATP6V1B2 expression after 12 h (Fig. 3.4). The
mTOR response appears be PKA-dependent and not related to baseline mTOR levels (Fig. 3.5).
Finally, cAMP elevation restored lysosomal pH in rat primary cortical cultures treated with
tamoxifen (Fig. 3.6). Together, the data support the more general applicability of cAMP elevation
62
as a pH-lowering strategy; more specifically, they implicate PKA in the immediate, upstream
response to cAMP, and mTOR and TFEB in the eventual output of treatment.
PKA: an upstream actor in lysosomal re-acidification
The present findings directly linked cAMP’s beneficial actions in PS1-fAD fibroblasts to protein
kinase A activity. cAMP treatment resulted in a PKA-dependent pH restoration; when PKA activity
was blocked with a PKI inhibitor, the downstream effects of cAMP treatment, including increased
Cat D active site availability and mTOR phosphorylation, were also blocked. While ECLTogether,
these data demonstrate the necessity of active PKA for effective cAMP treatment, and suggest
that pH restoration may be required for cAMP’s other positive outcomes. Of note, brain tissue
from AD patients has been reported to exhibit low PKA activity (Liang et al., 2007); based on the
current work, this PKA hypoactivity might considerably disrupt the ability of patient lysosomes to
maintain appropriate pH or to restore pH once elevated, thereby hastening the onset of observed
autophagic and lysosomal phenotypes in AD brain (Nixon et al., 2005).
The finding that cAMP-induced lysosomal acidification in PS1-fAD fibroblasts works through PKA
adds to a growing body of literature linking PKA to acidification mechanisms. PKA mediates
lysosomal acidification in retinal pigmented epithelial cells (Liu et al., 2008), while in kidney, PKA
activity regulates the localization of v-(H+)ATPase on the plasma membrane (Alzamora et al.,
2010, Paunescu et al., 2010). A likely possible mechanism is suggested by studies in yeast, in
which PKA plays a role in the reversible dissociation of the proton pump’s V0 and V1 domains – a
quickly-flipped “on/off” switch for lysosomal acidification (Forgac, 2007, Qi et al., 2007, Bond and
Forgac, 2008). Finally, it is possible that anion conductances, which constitute an important
secondary mechanism for endo- and lysosomal pH regulation after the proton pump (Faundez
and Hartzell, 2004), may be activated by cAMP. Chloride channel activation by cAMP has been
demonstrated in prior work from our laboratory (Liu et al., 2012); given that chloride conductances
are commonly regulated by phosphorylation (Cheng et al., 1991, Miyazaki et al., 2012), chloride
63
channel or transporter may represent another potential target of PKA activity. Investigation of
these various possibilities may be illuminating and further our understanding of the specific
lysosomal deficits and restorative mechanisms in AD.
When considering any of these potential mechanisms, it is important to recall that cAMP was
observed to have minimal effect on lysosomal pH in CTRL fibroblasts (Coffey et al., 2014). This
observation has several implications for further work. First and most importantly, it suggests that
cAMP treatment will not disrupt normal lysosomal pH maintenance in healthy cells, making
cAMP-based treatment options more appealing as a future therapeutic avenue. Second, it is
possible that these proposed mechanisms for PKA-mediated lysosomal pH restoration contribute
most to pH homeostasis when pH is above baseline; therefore, it may be important from a
technical perspective to explore these mechanisms in PS1-fAD cells or in other cell types
characterized by elevated lysosomal pH.
mTOR and TFEB signaling mediate the downstream, sustained response to cAMP
The mechanistic target of rapamycin (mTOR) is a large serine/threonine kinase that is found as
part of two distinct complexes in cells: mTORC1 and mTORC2. While both complexes are known
to play a role in regulating cellular metabolism, the known targets of mTORC2 are still limited to a
small number of processes, such as cytoskeletal organization and cellular proliferation. mTORC1,
on the other hand, is a versatile and ubiquitous cellular player. This complex plays a critical role in
the regulation of cell growth and in the energy balance of catabolic and anabolic processes within
the cell (reviewed in Laplante and Sabatini, 2012). It is responsive to a wide variety of inputs –
both intra- and extracellular – including glucose level, growth factors, stress, and others (reviewed
in Rabinowitz and White, 2010). Recently, both mTORC1 docking on the lysosome and mTORC1
activity have been directly correlated with lysosomal abundance of amino acids (Zoncu et al.,
2011); this relationship implies that nutrient abundance drives mTORC1 to the lysosome, where it
is activated so that further autophagy can be halted.
64
Given the pH sensitivity of the lysosome’s various catabolic enzymes, especially Cat D (Barrett,
1970, Rosenfeld, 1982), and the responsiveness of mTOR to changes in lysosomal contents, we
asked whether pH restoration would lead to an increase in active mTOR, as monitored indirectly
by mTOR phosphorylation. 6 h cAMP treatment did indeed lead to increased mTOR
phosphorylation at S2448, a site whose phosphorylation is positively correlated with mTOR
activity (Rosner et al., 2010), while no baseline changes in mTOR protein levels was observed
with cAMP. Interestingly, although 15 min cAMP treatment is sufficient to restore lysosomal pH,
no change in phosphorylation was observed after 15 min cAMP treatment. These data suggest
that cAMP and PKA do not act directly upon mTOR, but rather that mTOR phosphorylation
increases at a later point, presumably as an effect of or in response to pH restoration. The
inhibitory effect of PKI upon both the immediate- and long-term outcomes of cAMP treatment,
including mTOR phosphorylation and Cat D active site restoration, further supports this proposed
sequence of events.
Active mTORC1 has also been shown to interact with and to phosphorylate transcription factor
EB (TFEB), the “master switch” of lysosomal biogenesis and function (Sardiello et al., 2009,
Palmieri et al., 2011), on the lysosomal surface. Phosphorylation of TFEB prevents its nuclear
translocation (Settembre et al., 2011, Roczniak-Ferguson et al., 2012) and results in downregulated mRNA expression of genes linked to lysosomal biogenesis (Martina et al., 2012,
Roczniak-Ferguson et al., 2012, Settembre et al., 2012), including but not limited to its own
expression (Settembre et al., 2013). The present findings support this connection between mTOR
and TFEB, as phosphorylated and, by extension, activated mTOR is accompanied by a
substantial decrease in TFEB expression. This down-regulation may reflect the action of other
transcription factors upon TFEB expression; it may also be indicative of TFEB auto-regulation.
While TFEB auto-regulation has previously been demonstrated in both the nematode
Caenorhabditis elegans and in a murine system (Settembre et al., 2013), this finding would
65
represent, to our knowledge, one of the earliest observations of possible TFEB auto-regulation in
a human cell type, and may suggest a conserved mechanism for controlling its expression.
Of note, 6 h cAMP treatment was insufficient to cause down-regulation of the TFEB target gene
ATP6V1B2, consistent with other reports demonstrating a lag time of up to 4 h between a change
in nutrient conditions and a change in TFEB localization (Martina et al., 2012) and transcription
(Settembre et al., 2013). By 12 h treatment, however, ATP6V1B2 expression was downregulated, while TFEB mRNA expression had returned to baseline. It is postulated that incubation
with cAMP-elevating drugs of greater half-life than the ones used here would yield even more
persistent down-regulation of relevant genes. These data also support the hypothesis that pH
restoration has an immediate, PKA-mediated effect, followed by a delayed, downstream
response, in which both mTOR and TFEB-mediated changes in gene expression are involved. A
simplified model of how these pathways may interact with potential PKA-mediated acidification
mechanisms is given in Figure 3.7.
While no baseline difference in mTOR phosphorylation was observed between CTRL and PS1fAD fibroblasts, this may be a consequence of using dividing cell types in this study. Post-mitotic
cells like neurons rely on high rates of basal autophagy to clear cellular debris (Boland et al.,
2008), whereas dividing cells can partially dilute lysosomal debris by distributing their lysosomes
among daughter cells (Bergeland et al., 2001). As a consequence, autophagic pathology is likely
to be more severe in a post-mitotic cell type than in a dividing cell type. It is therefore possible
that a difference in baseline mTOR phosphorylation would be detectable in PS1-fAD neurons
where it was undetectable in fibroblasts. Another possibility is that an mTOR-independent
regulatory pathway mediates the baseline disruption of autophagy observed in PS1-fAD
fibroblasts (Coffey et al., 2014). Pharmacological elevation of intracellular calcium, for example, is
known to reduce autophagic flux independently of mTOR activity (Williams et al., 2008, Ganley et
al., 2011). Given that elevated lysosomal pH reduces the lysosome’s ability to buffer calcium
66
(Christensen et al., 2002) and that the lysosomes are the second-largest intracellular calcium
store after the endoplasmic reticulum (Alvarez et al., 1999, Lloyd-Evans and Platt, 2011), the
baseline differences in autophagy between CTRL and PS1-fAD fibroblasts may be due to
changes in this or other mTOR-independent pathways (reviewed in Sarkar, 2013).
Of interest, the data reported in the present study agree with those reported in a recent study by
Avrahami et al. involving the 5 X FAD mouse model of Alzheimer’s disease. Considerable
autophagic and lysosomal pathology was observed in the cortex of the 5 X FAD mouse, including
decreased maturation of Cat D, as observed in PS1-fAD fibroblasts, and reduced mTOR activity
(Avrahami et al., 2013). Upon treatment to improve lysosomal function, increased mTOR activity
was observed; these data agree with our findings that restoring lysosomal pH with cAMP, and
thus improving degradation, leads to increased mTOR phosphorylation. Importantly, the parallels
between the Avrahami study and the present study suggest that mTOR pathway engagement
may prove crucial to successful therapy. While the exact pathological relationship of mTOR to AD
progression is still a subject of some debate, reduced mTOR activation has been observed after
treatment with amyloid-β42, but not amyloid-β40 (Lafay-Chebassier et al., 2005); of these two
forms, amyloid-β42 is considered the more toxic. Reduced mTOR activation has also been linked
to issues with long-term synaptic plasticity and memory storage (Stoica et al., 2011), another
pathological hallmark of AD (reviewed in Pozueta et al., 2013).
Although directly targeting autophagy through mTOR has been proposed previously as a blanket
strategy for neurodegenerative diseases characterized by aberrant accumulation, such an
approach will be inevitably thwarted if the disease in question involves a fundamental dysfunction
of the lysosome (Harris and Rubinsztein, 2012). A better therapeutic approach may therefore be
to fix the lysosome first and, in so doing, address autophagy indirectly. The cAMP-based
approach to lower lysosomal pH, which has been demonstrated to be effective even in aged
lysosomes from pathological mice (Liu et al., 2008), offers a possible solution.
67
cAMP signaling as a common mechanism for lysosomal re-acidification
Our laboratory has now demonstrated that cAMP effectively restores lysosomal pH in a number
of different cell types, including: human retinal pigmented epithelial (RPE) cells (Liu et al., 2008),
murine RPE cells from mice with pathologically damaged lysosomes (Liu et al., 2008), human
skin fibroblasts from Alzheimer patients (Coffey et al., 2014), and rat primary cortical cultures. We
have also demonstrated in epithelial cells, fibroblasts, and neurons that Cat D active site
availability, an important functional outcome of pH restoration, is improved by cAMP treatment.
The neuronal work indicates that even a small, short-term pH elevation significantly affects Cat D
and that, even at this time scale, simultaneous treatment with cAMP restores both pH and the
availability of the enzyme’s active site. At the shorter time scale of the neuronal experiments, Cat
D active site loss more likely reflects reduced activity of existing Cat D than reduced maturation of
precursor Cat D, as pulse-chase experiments in rat hepatocytes do not begin to show mature Cat
D until at least 5 h after labeling (Rosenfeld, 1982). These experiments therefore indicate that
BODIPY FL-pepstatin A can detect both maturation- and activity-dependent changes in Cat D
active site availability. It will be interesting to examine whether prolonged lysosomal pH elevation
in neurons yields similar, or even more dramatic, results to what is observed in fibroblasts, and to
test whether longer-term cAMP treatment is a similarly effective tool to restore both pH and its
downstream outcomes.
Overall, this study suggests that pH restoration, as well as Cat D active site availability and
mTOR phosphorylation, is ultimately dependent upon PKA activity, and that strategies to reacidify the lysosomes may be intimately tied to the functionality of this enzyme. The variety of cell
types, species, and timecourses in which cAMP effectively lowers lysosomal pH suggests that
cAMP may play a universal role in lysosomal pH maintenance, and therefore that cAMPdependent acidification mechanisms should be considered a viable therapeutic target for
Alzheimer’s disease and for other diseases characterized by failing lysosomes.
68
Acknowledgements
We thank Farraj Albalawi for assistance with these experiments. These experiments were
supported by the Hearst Foundation Fellowship (EEC) and by the National Institutes of Health
through grants EY013434 and EY015537 (CHM).
69
Tables
Table 3.1. qPCR primers.
Target
ACTB
NCBI
code
NM_001
101.3
ATP6V1B2
NM_001
693.3
TFEB
NM_001
167827.2
Primer pair
Sense:
AGAAAATCTGGCACCACACC
Anti-Sense:
GGGGTGTTGAAGGTCTCAAA
Sense:
GAGGGGCAGATCTATGTGGA
Anti-Sense:
GCATGATCCTTCCTGGTCAT
Sense:
GTCCGAGACCTATGGGAACA
Anti-Sense:
CGTCCAGACGCATAATGTTG
70
Tm (°C)
59.97
59.94
Product length
(bp)
142
60.00
59.89
128
58.52
57.28
218
Figures
Figure 3.1. cAMP restores elevated lysosomal pH.
A, 10 min treatment with cAMP cocktail significantly decreases lysosomal pH in PS1-fAD
fibroblasts from controls; normalized, representative example shown. cAMP cocktail = 500 µM
cpt-cAMP + 100 µM IBMX + 10 µM forksolin. p = 0.009; n = 7-8 wells per condition. B,
Representative fluorescence micrograph of CTRL fibroblasts, PS1-fAD fibroblasts, and PS1-fAD
fibroblasts + cAMP, stained for actin (red), lysosomal marker LAMP2 (green) and nuclear stain
DAPI (blue). Scale bar = 50 µm. C, 6 h treatment with cAMP cocktail increases availability of Cat
D active site, as visualized by the binding of BODIPY FL-pepstatin A; representative images
shown. Scale bar = 50 µm.
Figure is located on following page.
71
72
Figure 3.2. PKI blocks restorative effect of cAMP treatment on lysosomal pH.
A, 1 h of 1 µM PKI pre-incubation blocks pH restorative effect of 10 min treatment with cAMP
cocktail; n = 25-28 wells per condition from 2 experiments; p = 0.041, PS1-fAD v. PS1-fAD +
cAMP; p = 0.027, PS1-fAD + cAMP v. PS1-fAD + cAMP + PKI. LysoSensor ratios normalized to
mean control of each experiment. B, 1 h of 1 µM PKI pre-incubation blocks restorative effect of 6
h cAMP cocktail treatment on Cat D active site availability, measured with BODIPY FL-pepstatin
A; n = 22-25 wells per condition from 2 experiments; p = 0.005 by ANOVA; p = 0.006, PS1-fAD v
PS1-fAD + cAMP; p = 0.017, PS1-fAD + cAMP v. PS1-fAD + cAMP + PKI.
73
Figure 3.3. PS1-fAD fibroblasts have
increased p-mTOR with cAMP.
A and B, No difference was observed in
either p-mTOR or mTOR between CTRL
and PS1-fAD fibroblasts at baseline
protein levels; n = 3 samples per
genotype. Molecular weight = 289 kDa
for both p-mTOR and mTOR, 37 kDa for
GAPDH. C and D, 6 h cAMP treatment
significantly increases p-mTOR in PS1fAD fibroblasts (n = 20 samples per
condition, p = 0.003), while mTOR does
not incresase significantly (n = 17
samples per condition). E and F, No
significant difference was observed in
either p-mTOR or mTOR when PS1-fAD
cells were treated for 15 min with cAMP
cocktail; n = 3 samples per condition.
74
Figure 3.4. cAMP treatment reduces mRNA expression of TFEB and ATP6V1B2. A, PS1-fAD fibroblasts treated for 6 h with cAMP exhibit significantly reduced expression of TFEB
compared to untreated fibroblasts, as detected by qRT-PCR; ATP6V1B2 expression was
unchanged. n = 6-7 samples per condition, p < 0.001 for TFEB, n.s. for ATP6V1B2. B, PS1-fAD
fibroblasts treated for 12 h with cAMP exhibit no significant change in TFEB expression compared
to untreated fibroblasts; ATP6V1B2 expression was significantly reduced after 12 h treatment. n =
6-7 samples per condition, n.s. for TFEB, p < 0.001 for ATP6V1B2.
75
Figure 3.5. PKI blocks cAMPinduced increase in p-mTOR.
A and B, PKI blocks the
increase in p-mTOR observed
with cAMP; n = 13-14 samples
per condition, p = 0.026 for
PS1-fAD vs. PS1-fAD + cAMP,
n.s. for PS1-fAD vs. PS1-fAD
+cAMP + PKI and n.s. for PS1fAD + cAMP vs. PS1-fAD
+cAMP + PKI. Molecular weight
= 289 kDa for both p-mTOR
and mTOR, 37 kDa for
GAPDH. No significant change
observed in mTOR across all
conditions.
76
Figure 3.6. cAMP restores lysosomal pH and Cat D availability in rat primary cortical
cultures.
A, Representative picture of rat primary cortical cultures, stained for neuronal marker Pgp9.5
(green), astrocyte marker GFAP (red) and DAPI (blue), with cultures estimated to be about 90%
neuronal. Scale bar = 100 µm. B, 10 min treatment with cAMP cocktail significantly decreases
lysosomal pH in rat primary mixed cortical cultures also treated with tamoxifen (TMX) 30 µM. n =
39-42 wells per condition from 3 experiments; p < 0.001, CTRL v. TMX; p = 0.013, TMX v. TMX +
cAMP. LysoSensor ratios normalized to mean control of each day’s experiment. C, 6 h cAMP
treatment significantly increases availability of Cat D active site in rat primary mixed cortical
cultures treated with TMX 30 µM, as measured with BODIPY FL-pepstatin A. n = 10 wells per
condition; significant to p = 0.007 by ANOVA; in post-hoc pairwise comparisons, p = 0.017, t-test,
CTRL v. TMX; p = 0.006, Mann-Whitney Rank-Sum test, TMX v. TMX + cAMP; CTRL v. TMX +
cAMP, not significant.
77
Figure 3.7. A mechanistic model for cAMP-induced pH restoration.
A, PS1-fAD cells are characterized by elevated lysosomal pH and reduced levels of Cat D active
site availability; these pathologies correlate with lesser mTOR phosphorylation and increased
transcription of TFEB and ATP6V1B2 (from this work and work published in Coffey et al., 2014).
B, cAMP re-acidifies lysosomes and restores Cat D active site availability; these events are PKAdependent and re-acidification is proposed to occur through one of two potential mechanisms:
through increased insertion of v-(H+)ATPase into the lysosomal membrane, or through increased
activation of lysosomal chloride channels. Lysosomal re-acidification leads to increased mTOR
phosphorylation and reduced transcription of TFEB and ATP6V1B2 at 6 and 12 h cAMP
treatment, respectively. These transcriptional changes may be due to retention of phosphorylated
TFEB in the cytoplasm.
Figure is located on following page.
78
79
CHAPTER 4:
Discussion and Future Directions
80
Adult-onset neurodegenerative disease represents a substantial public health problem for the
industrialized world. Of this multitude of diseases, Alzheimer’s disease (AD) has the greatest
prevalence and is among the most devastating, progressively and inevitably stripping patients of
their cognitive ability over the course of decades, and ultimately resulting in death (Alzheimer's
Association, 2015). Only a handful of approved treatments are available to patients, and none of
these does more than temporarily slow the course of disease (Raschetti et al., 2007, Raina et al.,
2008). This paucity of therapeutic options exists in part because the precipitating event (or
events) in Alzheimer’s disease is still largely unknown; by the time a patient develops cognitive
symptoms, the pathological processes underlying disease have been underway for decades
(Jack et al., 2009, Villemagne et al., 2013). Better understanding of these disease mechanisms
will enable the development of better, and earlier, treatment options for AD patients. The goal of
this dissertation work, therefore, was to investigate the role played by elevated lysosomal pH in a
cell culture model of Alzheimer’s disease, and to determine whether the pathologies observed in
this model could be reversed through pH restoration.
The work described in the preceding chapters supports a critical role for lysosomal pH
maintenance in the pathology of disease. Here, we have presented evidence that lysosomal pH is
significantly elevated in human skin fibroblasts from familial Alzheimer (fAD) patients with the
presenilin 1 (PS1) mutation A246E (Chapter 2). The work demonstrated that this pH elevation,
though small, has a profound impact on the level of mature, active Cathepsin D (Cat D) present in
the lysosomal lumen, reducing the availability of a critical catabolic enzyme. This degradative
failure leads to a build-up of autophagosomes, as indicated by a rise in the levels of LC3B-II and
p62 in PS1-fAD fibroblasts. Several genes critical to autophagy and lysosomal degradation are
also up-regulated as a compensatory response to the PS1-fAD degradative backlog, with a
consequent increase in the expression of their respective proteins. It was also shown that
treatment with a cAMP-elevating cocktail not only lowers lysosomal pH, but increases the
availability of Cat D and improves degradation through the autophagic-lysosomal pathway
81
(Chapter 2). Extended treatment with this cocktail ultimately leads to an increase in mechanistic
target of rapamycin (mTOR) phosphorylation and in decreased expression of both transcription
factor EB (TFEB) and one of its targets, ATP6V1B2 – the gene for the B2 subunit of the v(H+)ATPase proton pump (Chapter 3). Both the immediate effects of cAMP on lysosomal pH and
its downstream effects on Cat D active site restoration and mTOR phosphorylation appear to be
mediated by protein kinase A (PKA) activity (Chapter 3). Together, these data strongly implicate
pH dysfunction in certain AD-associated phenotypes, and suggest that treatment to improve
lysosomal pH may be a therapeutic approach worth further investigation in an AD context.
Expanding upon the mechanisms of lysosomal pH dysfunction and restoration
While the findings presented in this dissertation represent an important step forward in our
understanding of the lysosome’s importance in Alzheimer’s disease, much work remains to be
done. At the end of Chapter 3, several possible mechanisms were proposed by which cAMPinduced PKA activation may directly mediate lysosomal re-acidification in PS1-fAD cells, including
through v-(H+)ATPase membrane insertion, v-(H+)ATPase domain assembly, and chloride
channel or transporter activation – or possibly by some combination of the above. Of these
mechanisms, the most likely possibility, and one for which strong precedent exists, is that cAMP
induces increased association of the v-(H+)ATPase v1 and v0 functional domains at the lysosomal
membrane. cAMP/PKA-induced activation of lysosomal chloride conductance has also been
widely observed in lysosomal systems and seems the next most likely mechanistic possibility,
while insertion of v-(H+)ATPase from an existing pool, though intriguing and not without parallels
in other cell types, remains a primarily speculative mechanism. Several technical approaches
exist that could help clarify which of these possible mechanisms may be at work in the fibroblast
model.
In dendritic cells of the immune system, increased assembly of the lysosomal proton pump’s v1
and v0 domains may occur in response to various maturation signals (Trombetta et al., 2003). A
82
similar phenomenon has been reported in yeast in response to glucose and is both rapid (Parra
and Kane, 1998) and promoted by PKA (Bond and Forgac, 2008). This assembly event may take
as little as 5 min (Parra and Kane, 1998), which would be consistent with the 10 min reacidification observed with cAMP (Chapters 2 and 3). These findings suggest that the rapid, PKAdependent lysosomal re-acidification reported in Chapter 3 may occur via a similar reversible
association mechanism. To determine whether or not cAMP treatment promotes increased
assembly of the v1 and v0 domains, immunohistochemistry could be used to detect increased colocalization of one of the peripheral v1 subunits, such as the A or B subunit, with one of the v0
integral membrane subunits, such as the c subunit (Forgac, 2007). A protocol for v1-targeted
immunoprecipitation of the v0 domain has also been described (Bond and Forgac, 2008) and
would serve as an excellent additional measure of association. Lysosomal localization could then
be confirmed by staining for lysosomal markers such as LAMP1 or LAMP2. While this last
experiment was in fact attempted and the data suggested increased association of the peripheral
v-(H+)ATPase subunit B2 with the lysosomal markers LAMP1 and LAMP2, the v-(H+)ATPase
antibody used proved insufficiently specific to yield conclusive results [data not shown]. It is also
possible that these initial results indicate that cAMP leads increased insertion of existing v(H+)ATPase into the lysosomal membrane. A cAMP/PKA-linked proton pump cycling mechanism
has a physiological precedent in kidney cells (Alzamora et al., 2010, Paunescu et al., 2010) and
would also enable rapid lysosomal acidification without requiring new transcription or translation;
however, this mechanism has not previously been demonstrated to be at work in lysosomes, and
as such is primarily speculative.
As an alternative and to provide confirmation of these initial findings, v-(H+)ATPase domain
association and/or association with the lysosomal membrane could be assessed by isolating
lysosomes from cAMP-treated and untreated PS1-fAD cells, and then by probing for v(H+)ATPase subunit content via Western blot or ELISA. Various differential centrifugation
protocols would permit crude isolation of the lysosomal fraction, but may be complicated by the
83
fact that lysosomes containing incompletely degraded and aggregate material may have different
densities from their healthy counterparts, and therefore might not fractionate appropriately without
specialized isolation techniques (Diettrich et al., 1998). More recently, however, the Lloyd-Evans
laboratory successfully used superparamagnetic ferrofluids for high-yield, ultrapure lysosomal
isolation in multiple cell types, including those with a storage disorder phenotype (Walker and
Lloyd-Evans, 2015). This technique may prove useful in future work.
Another mechanistic possibility worth exploring is the potential activation of lysosomal chloride
currents by cAMP/PKA, as phosphorylation events commonly regulate chloride channel and
transporter activity (Cheng et al., 1991, Miyazaki et al., 2012). A previous study demonstrated
that the cAMP re-acidification treatment used in this work also activates lysosomal chloride
channel conductance (Liu et al., 2012). The cystic fibrosis transmembrane conductance regulator
(CFTR), for example, can be phosphorylated and activated by PKA at four separate serine
residues; mutation of these residues, however, completely blocked CFTR activity (Cheng et al.,
1991). PKA-dependent acidification improved the ability of microglia, which have an abnormally
high baseline lysosomal pH, to degrade fibrillar amyloid-β (Majumdar et al., 2007); efficient
degradation was later shown to require the delivery of the chloride transporter ClC-7 to the
lysosomal membrane (Majumdar et al., 2011). Phosphorylation status of CFTR and other
lysosomal chloride channels or transporters could therefore be investigated via Western blot to
indirectly assess PKA-induced chloride channel activity. Anionic currents could also be measured
directly via the lysosomal patch-clamping technique that, though unquestionably challenging, has
been previously described (Cang et al., 2013). Together, these approaches will increase
understanding of PKA’s specific role in lysosomal pH maintenance as suggested by Chapter 3;
these findings may also prove informative to the general study of lysosomal homeostatic
regulation, as well as to the more specific study of lysosomal dysfunction and recovery in AD.
84
The importance of studying a cell-based, living model of Alzheimer’s disease cannot be
overstated, as many of the techniques used in this dissertation work – including direct pH
measurement and fluorescent visualization of Cat D active site availability – would be impossible
to perform in post-mortem tissue. Even for murine AD models characterized by apparent
lysosomal pH dysfunction, such as the 5 X FAD mouse (Avrahami et al., 2013), direct
measurement of lysosomal pH from isolated regions of interest would prove extremely
challenging. The fibroblast model used in this dissertation, on the other hand, enabled side-byside, live-cell comparison of actual patient tissue with unaffected tissue (Chapter 2), and
permitted evaluation of immediate, short-term, and long-term responses to drug treatment
(Chapters 2 and 3), including Western blotting and expression analysis via qPCR. The absence
of other physiological systems and cell types in this culture model also reduced possible
confounds resulting from the interaction of different cell types. In future studies, the fibroblast
approach could therefore be used to detect lysosomal pH deficiency in patient fibroblasts
containing other PS1-fAD mutations than the A246E mutation examined here. The work
presented in this dissertation, in combination with the known association between PS1-fAD
mutation and severity of lysosomal pathology (Cataldo et al., 2004), suggests that such
investigations may find pH elevation to be a common phenomenon in familial AD with PS1
mutation. Given that average age of onset is known for many fAD-causing PS1 mutations, it will
be especially important to determine how early the pH deficit arises in fAD progression. This
knowledge may then inform future treatment, or perhaps even contribute to the development of
preventive strategies based on lysosomal pH restoration.
In Chapter 3, it was demonstrated that lysosomal pH can be pharmacologically elevated in rat
primary neuronal cultures, that the pH elevation corresponds with loss of Cat D active site
availability, and that cAMP treatment corrects these failures. Most importantly, these data indicate
that lysosomal pH changes are measurable in living neurons, and that at least some of the
consequences of these pH changes recapitulated what was observed in the fibroblast culture
85
model. It would therefore be of great interest to determine whether the pH elevation detected in
PS1-fAD mutant fibroblasts can also be detected in PS1-fAD patient neurons. Given the practical
and ethical concerns associated with the use of living adult human neural tissue, however, a
particularly appealing future direction for this work would be to study lysosomal dysfunction in
induced pluripotent stem (iPS) cells derived from both the CTRL and the PS1-fAD fibroblasts
used in this study. iPS cells, which can be generated from human skin fibroblasts and other cell
types, have been used successfully to model both familial (Yagi et al., 2011, Israel et al., 2012,
Kondo et al., 2013) and sporadic AD (Israel et al., 2012, Hossini et al., 2015), so a strong
precedent exists for using this approach.
General implications of lysosomal pH dysfunction in Alzheimer’s disease
While the autophagic and lysosomal pathologies of Alzheimer’s disease may be worsened by
PS1 mutation (Cataldo et al., 2004), they are nevertheless present in post-mortem brain tissue
from sporadic AD patients (Nixon et al., 2005). The simplest explanation for these remarkably
similar pathologies is that lysosomal pH is elevated in both familial and sporadic AD. A
concerning corollary of possible vesicular pH dysfunction is that poor acidification would interfere
with neurotransmitter loading into synaptic vesicles in Alzheimer neurons, thereby further
contributing to observed synaptic dysfunctions in AD (Roseth et al., 1995, Zhou et al., 2000,
Pozueta et al., 2013). In fAD, pH rises as a result of a PS1 mutation that directly impacts
lysosomal acidification (Lee et al., 2010, Coffey et al., 2014), as reported in Chapter 2; in sporadic
AD, pH may be elevated through an indirect mechanism. For example, although individuals
accumulate amyloid-β (Funato et al., 1998, Morishima-Kawashima et al., 2000) as a normal
consequence of aging, amyloid-β is known to perturb membrane fluidity and permeability on its
own (Soreghan et al., 1994, Kanfer et al., 1999, Lin et al., 2001, Wood and Igbavboa, 2003, Quist
et al., 2005, Yang et al., 2010). At sufficiently high concentration, it can even induce complete
lysosomal membrane permeabilization (Yang et al., 1998, Ditaranto et al., 2001). Over time, the
sum of such aging-related insults to the lysosome may interfere with its ability to maintain pH,
86
leading to AD lysosomal pathology. It will be informative to determine whether pH increases
correlate with lysosomal permeabilization in both the PS1-fAD fibroblasts used in this work, and
also in tissue samples from patients diagnosed with probable sporadic AD. Lysosomal pH and its
effect on (im)permeability could then be assessed with the endocytosed, membrane-impermeable
dye Lucifer yellow (Page et al., 1994, Burdick et al., 1997), yielding important insights about the
resting stability of Alzheimer lysosomes. When used in conjunction with BODIPY FL-pepstatin A
for Cat D active site assessment (Chen et al., 2000a), these experiments could even enable
determination of whether long-term in vitro treatment with physiologically relevant cerebrospinal
fluid levels of amyloid-β peptide – i.e. in the 1-10 nM range (Pearson and Peers, 2006) –
substantially affects lysosomal membrane stability and lysosomal function.
Another possible mechanistic link between the lysosomal pathology of fAD presented in this
dissertation and the lysosomal pathology of sporadic AD is suggested by a report that PKA
activity is significantly down-regulated in Alzheimer brain (Liang et al., 2007). In Chapter 3 of the
present work, it was reported that PKA activity is necessary for both cAMP-induced pH
restoration and its longer-term consequences of Cat D active site restoration and mTOR
phosphorylation. Should PKA play a general role in lysosomal pH maintenance, progressive loss
of PKA in AD could contribute to lysosomal acidification defects and subsequent reduction in Cat
D activity. Of note in this respect, Cat D is known to degrade amyloid-β (McDermott and Gibson,
1996), linking lysosomal defects with canonical Alzheimer pathologies; Cat D is also thought to
preferentially degrade the more toxic, aggregation-prone amyloid-β42 species over the shorter
amyloid-β40 (Saido and Leissring, 2012). Once impaired by even mild pH elevation (Barrett,
1970), reduced Cat D activity could contribute to a lysosomal dysfunction snowball effect, and
even to the development of further AD pathology. PKA down-regulation would also compromise
the aging lysosome’s ability to restore pH once elevated. Therefore, depending on the level of
pre-existing lysosomal damage an individual sustains over the natural course of aging, further
lysosomal distress from any source might serve as a precipitating event in AD.
87
Strategies for pH restoration in Alzheimer’s disease
Whether or not elevated lysosomal pH proves to be a universal mechanism in AD progression,
the ability to effectively treat even a fraction of AD patients would be a considerable step forward.
Chapters 2 and 3 of this dissertation presented evidence that lysosomal pH restoration via cAMP
treatment proved effective in ameliorating lysosomal pathology, both in PS1-fAD fibroblasts and
in pharmacologically compromised lysosomes from rat primary neuronal cultures. In the following
section, the therapeutic implications of these findings will be examined in greater detail, and
several strategies for lysosomal pH restoration will be explored. From a practical perspective, the
next logical step is to focus on endogenous targets whose activation or inhibition leads to cAMP
elevation. The efficacy of the cAMP cocktail used in the present work suggests two initial targets:
adenylyl cyclase and phosphodiesterase, each of which was targeted by a component of the
cocktail (forskolin and 3-isobutyl-1-methylxanthine (IBMX), respectively). While clearly effective,
neither forskolin nor IMBX is selective in its activity. Therefore, it behooves us to identify drugs
that act in a more targeted fashion to increase intracellular cAMP in the brain.
Transmembrane adenylyl cyclases as a potential therapeutic target
Adenylyl cyclases in mammalian tissue come in many isoforms, but belong to two major families:
the membrane-associated transmembrane adenylyl cyclases (tmACs) and the soluble adenylyl
cyclases (sACs). While both families produce cAMP once activated, their cellular localization and
triggers for activation are markedly different. tmACs are linked to Gαs-coupled G protein-coupled
receptors (GPCRs) (May et al., 1985) and primarily act at the plasma membrane; this association
between tmACs and GPCRs facilitates the intracellular response to extracellular cues. sACs, on
the other hand, are distributed throughout the cytoplasm and also associated with specific
organelles (Zippin et al., 2003, Bundey and Insel, 2004), creating microdomains of cAMP
signaling (Bitterman et al., 2013, Rahman et al., 2013, Wertheimer et al., 2013). Such local
control of cAMP generation would limit the reach of the ubiquitous cAMP/PKA and mTOR
88
signaling pathways and make sACs an appealing target for therapeutic purposes; however, the
sACs are activated only by increased local levels of calcium and bicarbonate (Chen et al., 2000b,
Jaiswal and Conti, 2003, Litvin et al., 2003), and are insensitive to modulation by G proteins or
forskolin (Buck et al., 1999). This unresponsiveness to forskolin makes the sACs unlikely to be
targeted by the cocktail used in Chapters 2 and 3 of this work. Therefore, until a specific
pharmacological activator of the sACs is developed, future pharmacological efforts involving ACs
should instead be focused on tmACs and their associated GPCRs.
While forskolin is membrane-permeable and is well-known to activate tmACs in isolation, it may
also be able to act upon Gαs-coupled GPCRs and enhance adenylyl cyclase activation in that
way (Jasper et al., 1990). It is therefore possible that both direct and indirect adenylyl cyclase
activation contribute to increased intracellular cAMP and its beneficial effects for the PS1-fAD
cells, as reported in the present work. Consequently, focusing on Gαs–coupled GPCRs may
serve as a useful strategy for elevating cAMP in AD. Interestingly, a deficit in GPCR-associated
tmAC activity was observed in AD brain as early as the 1990s (Ross et al., 1993, Schnecko et al.,
1994, Bonkale et al., 1996, Yamamoto et al., 1997), further supporting the importance of targeting
cAMP production as a therapeutic approach. A potentially interesting target in this respect is
pituitary adenylate cyclase 1 receptor (PAC1R), for which the endogenous ligand is the pituitary
adenylate cyclase activating polypeptide (PACAP). PACAP levels in brain have been shown to
inversely correlate with the severity of cognitive decline in AD (Han et al., 2015), while treatment
to increase PACAP levels, and thereby increase cAMP production, improved pathology (Rat et
al., 2011, Han et al., 2014). The exact mechanism by which PACAP-induced cAMP production
achieved these beneficial outcomes, however, remains somewhat unclear. Given that human skin
is known to express PAC1R (Steinhoff et al., 1999), it would be interesting to test PACAP on the
PS1-fAD cells used in this work and to determine whether sustained PACAP treatment to
increase intracellular cAMP also restores lysosomal pH. Importantly, PACAP was found to readily
cross the blood-brain barrier (Nonaka et al., 2002), and was also efficacious when delivered
89
intranasally (Rat et al., 2011); therefore, targeting tmACs using PACAP may prove a viable
therapeutic strategy. Prior to a clinical trial, however, global and local effects of this neuropeptide
should be carefully assessed in rodents to ensure that the peptide does not lead to unexpected or
unacceptable adverse outcomes in “off-target” brain regions.
Phosphodiesterase inhibitor therapy
When considering endogenous cAMP-elevating enzymes, the phophodiesterases (PDEs) may
also prove to be an ideal target. The phosphodiesterase family includes 11 subtypes of enzyme,
as well as a host of different splice variants for each subtype (Bender and Beavo, 2006). While
these subtypes may have a variable distribution based upon tissue and cell type, all perform the
same function: breaking apart the ester bond that cyclizes the mononucleotides AMP and GMP
(Bender and Beavo, 2006). Depending on subtype, a PDE may be specific for either cAMP or
cGMP, or have some affinity for both substrates. We have already demonstrated the efficacy of
this approach in vitro: a critical component of the cAMP cocktail used in Chapters 2 and 3 is 3isobutyl-1-methylxanthine (IBMX), a general PDE inhibitor. Many PDE inhibitors are orally
bioavailable (Garcia-Osta et al., 2012), as they have been used successfully to treat a range of
unrelated disorders, including erectile dysfunction (Fusco et al., 2010). Many PDE inhibitors are
also predicted to cross the blood-brain barrier with high probability based on structure – a critical
first step in testing PDE inhibitors in a therapeutic context for neurodegenerative disease.
However, given the sheer number of PDE isozymes in the brain, as well as their variable
distributions and expression levels (Lakics et al., 2010), careful screening would be necessary in
order to ensure that the appropriate PDE(s) is/are targeted. For example, PDE-3 is ubiquitously
expressed at low levels throughout most brain regions, while PDE-4 isoforms are among the
more highly expressed in hippocampus (Lakics et al., 2010). Even a single cell may express
multiple PDE subtypes in order to better regulate local cyclic nucleotide signaling (Bender and
Beavo, 2006), raising the possibility that at least one of these PDE subtypes might have a
lysosomal localization and thus make an ideal target. The complexity of this signaling network
90
underscores the importance of choosing specific targets and delivery systems (e.g., intranasal
delivery to more directly target the brain). Such refinements will ensure maximum treatment
efficacy while simultaneously limiting the reach of the therapeutic agent(s) to desired systems and
cell types.
While certain of these compounds have been tested previously and successfully against
Alzheimer’s disease in murine models, their exact mechanisms of action remain unclear. Most
hypothesized benefits of PDE inhibitors in AD are related to the demonstrated, general role of
cyclic nucleotides in neuroplasticity (Jancic et al., 2009) and neuroprotection (Paintlia et al.,
2009), and not necessarily to disease-specific mechanisms (Comery et al., 2005). For example,
treatment with the PDE-4 inhibitor rolipram improved performance of not only AD model mice in a
contextual conditioning task, but also of control mice (Comery et al., 2005). These improvements
may have been due to increased cAMP-response element binding protein (CREB)
phosphorylation with rolipram, leading to increased expression of genes critical for learning and
memory, and consequent enhancement of long-term memory formation (Cheng et al., 2010). By
contrast, we have observed minimal effects of cAMP treatment on fibroblasts with normal
lysosomal pH (Chapter 2). It will be particularly interesting to test inhibitors with some prior
success against AD pathology in our PS1-fAD fibroblast model, and to then determine which of
these various compounds most effectively lowers lysosomal pH while also having minimal effect
on CTRL cells. Promising results have been reported thus far for PDE-3 (Hiramatsu et al., 2010,
Park et al., 2011, Lee et al., 2014), PDE-4 (Gong et al., 2004, Sierksma et al., 2014), and PDE-5
inhibitors (Puzzo et al., 2009, Cuadrado-Tejedor et al., 2011, Garcia-Barroso et al., 2013), so
these PDE subtypes may prove useful as initial targets; to the best of our knowledge, however,
no PDE inhibitor has yet completed a Phase III clinical trial. Given that most PDE-4 inhibitors
tested so far have severe emetic side effects (Bender and Beavo, 2006), it will also be useful to
determine whether lower concentrations of these PDE inhibitors are required to restore lysosomal
pH than are required to effect neuroplastic change. Less concentrated dosing might reduce some
91
of the PDE inhibitors’ observed side effects, making them a more reasonable option for early
treatment of AD.
Conclusions
Alzheimer’s disease is a complex and heterogeneous disorder; the work in this dissertation
represents an important step forward in understanding certain of the subcellular mechanisms that
may play into disease development and progression. Evidence was presented that PS1-fAD
mutation leads to lysosomal pH dysfunction, as well as to deficits in lysosomal Cat D maturation
and active site availability. This chronic pH dysfunction correlates with a perturbation in the
autophagic degradative system at both at the mRNA and protein levels. Treatment with cAMP
results in a PKA-dependent restoration of many of these pathologies, including lowered
lysosomal pH, increased Cat D availability, and reduced autophagic backlog. cAMP treatment
ultimately promotes sustained responses through mTOR phosphorylation and through
transcriptional changes in TFEB and one of its targets, ATP6V1B2. The work presented here
proposes an important place for lysosomal dysfunction in AD chronology, and suggests several
treatment possibilities that may prove fruitful in the future. Critically, this dissertation work further
emphasizes the importance of investigating malfunctions in basic cellular systems like the
lysosome that may contribute to neurodegenerative pathology and its progression. This merger
between translational efforts and basic science has the potential to offer novel therapeutic
approaches and creative new ways of thinking about neurodegenerative disease. While many
years undoubtedly remain before the entire picture of AD becomes clear, it will be exciting to see
how critical consideration of the once-lowly lysosome informs the solution.
92
REFERENCES
Adamec E, Mohan PS, Cataldo AM, Vonsattel JP, Nixon RA (2000) Up-regulation of the
lysosomal system in experimental models of neuronal injury: implications for Alzheimer's
disease. Neuroscience 100:663-675.
Altan N, Chen Y, Schindler M, Simon SM (1999) Tamoxifen inhibits acidification in cells
independent of the estrogen receptor. Proceedings of the National Academy of Sciences
of the United States of America 96:4432-4437.
Alvarez J, Montero M, Garcia-Sancho J (1999) Subcellular Ca(2+) Dynamics. News Physiol Sci
14:161-168.
Alzamora R, Thali RF, Gong F, Smolak C, Li H, et al. (2010) PKA regulates vacuolar H+-ATPase
localization and activity via direct phosphorylation of the a subunit in kidney cells. The
Journal of biological chemistry 285:24676-24685.
Alzheimer's Association (2015) 2015 Alzheimer's disease facts and figures. Alzheimers Dement
11:332-384.
Ameis D, Merkel M, Eckerskorn C, Greten H (1994) Purification, characterization and molecular
cloning of human hepatic lysosomal acid lipase. European journal of biochemistry / FEBS
219:905-914.
Annaert WG, Esselens C, Baert V, Boeve C, Snellings G, et al. (2001) Interaction with
telencephalin and the amyloid precursor protein predicts a ring structure for presenilins.
Neuron 32:579-589.
Avrahami L, Farfara D, Shaham-Kol M, Vassar R, Frenkel D, et al. (2013) Inhibition of glycogen
synthase kinase-3 ameliorates beta-amyloid pathology and restores lysosomal
acidification and mammalian target of rapamycin activity in the Alzheimer disease mouse
model: in vivo and in vitro studies. The Journal of biological chemistry 288:1295-1306.
Bahr BA (2009) Lysosomal modulatory drugs for a broad strategy against protein accumulation
disorders. Curr Alzheimer Res 6:438-445.
Baltazar GC, Guha S, Lu W, Lim J, Boesze-Battaglia K, et al. (2012) Acidic nanoparticles are
trafficked to lysosomes and restore an acidic lysosomal pH and degradative function to
compromised ARPE-19 cells. PloS one 7:e49635.
Barker WW, Luis CA, Kashuba A, Luis M, Harwood DG, et al. (2002) Relative frequencies of
Alzheimer disease, Lewy body, vascular and frontotemporal dementia, and hippocampal
sclerosis in the State of Florida Brain Bank. Alzheimer Dis Assoc Disord 16:203-212.
Barrett AJ (1970) Cathepsin D. Purification of isoenzymes from human and chicken liver. The
Biochemical journal 117:601-607.
Barrett AJ (1972) A new assay for cathepsin B1 and other thiol proteinases. Analytical
biochemistry 47:280-293.
Barrett AJ (1973) Human cathepsin B1. Purification and some properties of the enzyme. The
Biochemical journal 131:809-822.
Barthet G, Dunys J, Shao Z, Xuan Z, Ren Y, et al. (2013) Presenilin mediates neuroprotective
functions of ephrinB and brain-derived neurotrophic factor and regulates ligand-induced
internalization and metabolism of EphB2 and TrkB receptors. Neurobiology of aging
34:499-510.
Bateman RJ, Aisen PS, De Strooper B, Fox NC, Lemere CA, et al. (2011) Autosomal-dominant
Alzheimer's disease: a review and proposal for the prevention of Alzheimer's disease.
Alzheimers Res Ther 3:1.
Bekris LM, Yu CE, Bird TD, Tsuang DW (2010) Genetics of Alzheimer disease. J Geriatr
Psychiatry Neurol 23:213-227.
Bellot G, Garcia-Medina R, Gounon P, Chiche J, Roux D, et al. (2009) Hypoxia-induced
autophagy is mediated through hypoxia-inducible factor induction of BNIP3 and BNIP3L
via their BH3 domains. Molecular and cellular biology 29:2570-2581.
93
Bender AT, Beavo JA (2006) Cyclic nucleotide phosphodiesterases: molecular regulation to
clinical use. Pharmacol Rev 58:488-520.
Berezovska O, Frosch M, McLean P, Knowles R, Koo E, et al. (1999) The Alzheimer-related gene
presenilin 1 facilitates notch 1 in primary mammalian neurons. Brain Res Mol Brain Res
69:273-280.
Bergeland T, Widerberg J, Bakke O, Nordeng TW (2001) Mitotic partitioning of endosomes and
lysosomes. Curr Biol 11:644-651.
Bezprozvanny I (2012) Presenilins: a novel link between intracellular calcium signaling and
lysosomal function? The Journal of cell biology 198:7-10.
Bi X, Zhou J, Lynch G (1999) Lysosomal protease inhibitors induce meganeurites and tangle-like
structures in entorhinohippocampal regions vulnerable to Alzheimer's disease. Exp
Neurol 158:312-327.
Bitterman JL, Ramos-Espiritu L, Diaz A, Levin LR, Buck J (2013) Pharmacological distinction
between soluble and transmembrane adenylyl cyclases. J Pharmacol Exp Ther 347:589598.
Bjorkoy G, Lamark T, Brech A, Outzen H, Perander M, et al. (2005) p62/SQSTM1 forms protein
aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell
death. The Journal of cell biology 171:603-614.
Blitzer JT, Nusse R (2006) A critical role for endocytosis in Wnt signaling. BMC Cell Biol 7:28.
Bobinski M, Wegiel J, Wisniewski HM, Tarnawski M, Bobinski M, et al. (1996) Neurofibrillary
pathology--correlation with hippocampal formation atrophy in Alzheimer disease.
Neurobiology of aging 17:909-919.
Boland B, Kumar A, Lee S, Platt FM, Wegiel J, et al. (2008) Autophagy induction and
autophagosome clearance in neurons: relationship to autophagic pathology in
Alzheimer's disease. The Journal of neuroscience : the official journal of the Society for
Neuroscience 28:6926-6937.
Bond S, Forgac M (2008) The Ras/cAMP/protein kinase A pathway regulates glucose-dependent
assembly of the vacuolar (H+)-ATPase in yeast. The Journal of biological chemistry
283:36513-36521.
Bonkale WL, Fastbom J, Wiehager B, Ravid R, Winblad B, et al. (1996) Impaired G-proteinstimulated adenylyl cyclase activity in Alzheimer's disease brain is not accompanied by
reduced cyclic-AMP-dependent protein kinase A activity. Brain Res 737:155-161.
Borden LA, Einstein R, Gabel CA, Maxfield FR (1990) Acidification-dependent dissociation of
endocytosed insulin precedes that of endocytosed proteins bearing the mannose 6phosphate recognition marker. The Journal of biological chemistry 265:8497-8504.
Bowman EJ, Siebers A, Altendorf K (1988) Bafilomycins: a class of inhibitors of membrane
ATPases from microorganisms, animal cells, and plant cells. Proceedings of the National
Academy of Sciences of the United States of America 85:7972-7976.
Boya P, Gonzalez-Polo RA, Casares N, Perfettini JL, Dessen P, et al. (2005) Inhibition of
macroautophagy triggers apoptosis. Molecular and cellular biology 25:1025-1040.
Brunk U, Brun A (1972) The effect of aging on lysosomal permeability in nerve cells of the central
nervous system. An enzyme histochemical study in rat. Histochemie 30:315-324.
Brunk UT, Terman A (2002a) Lipofuscin: mechanisms of age-related accumulation and influence
on cell function. Free Radic Biol Med 33:611-619.
Brunk UT, Terman A (2002b) The mitochondrial-lysosomal axis theory of aging: accumulation of
damaged mitochondria as a result of imperfect autophagocytosis. European journal of
biochemistry / FEBS 269:1996-2002.
Buck J, Sinclair ML, Schapal L, Cann MJ, Levin LR (1999) Cytosolic adenylyl cyclase defines a
unique signaling molecule in mammals. Proceedings of the National Academy of
Sciences of the United States of America 96:79-84.
Bundey RA, Insel PA (2004) Discrete intracellular signaling domains of soluble adenylyl cyclase:
camps of cAMP? Sci STKE 2004:pe19.
94
Burdick D, Kosmoski J, Knauer MF, Glabe CG (1997) Preferential adsorption, internalization and
resistance to degradation of the major isoform of the Alzheimer's amyloid peptide, A beta
1-42, in differentiated PC12 cells. Brain Res 746:275-284.
Butler D, Hwang J, Estick C, Nishiyama A, Kumar SS, et al. (2011) Protective effects of positive
lysosomal modulation in Alzheimer's disease transgenic mouse models. PloS one
6:e20501.
Cai D, Leem JY, Greenfield JP, Wang P, Kim BS, et al. (2003) Presenilin-1 regulates intracellular
trafficking and cell surface delivery of beta-amyloid precursor protein. The Journal of
biological chemistry 278:3446-3454.
Cang C, Zhou Y, Navarro B, Seo YJ, Aranda K, et al. (2013) mTOR regulates lysosomal ATPsensitive two-pore Na(+) channels to adapt to metabolic state. Cell 152:778-790.
Cataldo AM, Barnett JL, Berman SA, Li J, Quarless S, et al. (1995) Gene expression and cellular
content of cathepsin D in Alzheimer's disease brain: evidence for early up-regulation of
the endosomal-lysosomal system. Neuron 14:671-680.
Cataldo AM, Hamilton DJ, Barnett JL, Paskevich PA, Nixon RA (1996) Properties of the
endosomal-lysosomal system in the human central nervous system: disturbances mark
most neurons in populations at risk to degenerate in Alzheimer's disease. The Journal of
neuroscience : the official journal of the Society for Neuroscience 16:186-199.
Cataldo AM, Hamilton DJ, Nixon RA (1994) Lysosomal abnormalities in degenerating neurons
link neuronal compromise to senile plaque development in Alzheimer disease. Brain Res
640:68-80.
Cataldo AM, Nixon RA (1990) Enzymatically active lysosomal proteases are associated with
amyloid deposits in Alzheimer brain. Proceedings of the National Academy of Sciences of
the United States of America 87:3861-3865.
Cataldo AM, Paskevich PA, Kominami E, Nixon RA (1991) Lysosomal hydrolases of different
classes are abnormally distributed in brains of patients with Alzheimer disease.
Proceedings of the National Academy of Sciences of the United States of America
88:10998-11002.
Cataldo AM, Peterhoff CM, Schmidt SD, Terio NB, Duff K, et al. (2004) Presenilin mutations in
familial Alzheimer disease and transgenic mouse models accelerate neuronal lysosomal
pathology. Journal of neuropathology and experimental neurology 63:821-830.
Cataldo AM, Peterhoff CM, Troncoso JC, Gomez-Isla T, Hyman BT, et al. (2000) Endocytic
pathway abnormalities precede amyloid beta deposition in sporadic Alzheimer's disease
and Down syndrome: differential effects of APOE genotype and presenilin mutations. The
American journal of pathology 157:277-286.
Cataldo AM, Thayer CY, Bird ED, Wheelock TR, Nixon RA (1990) Lysosomal proteinase antigens
are prominently localized within senile plaques of Alzheimer's disease: evidence for a
neuronal origin. Brain Res 513:181-192.
Chang YY, Juhasz G, Goraksha-Hicks P, Arsham AM, Mallin DR, et al. (2009) Nutrientdependent regulation of autophagy through the target of rapamycin pathway. Biochem
Soc Trans 37:232-236.
Chen C-S, Chen W-NU, Zhou M, Arttamangkul S, Haugland RP (2000a) Probing the cathepsin D
using a BODIPY FL–pepstatin A: applications in fluorescence polarization and
microscopy. Journal of Biochemical and Biophysical Methods 42:137-151.
Chen Y, Cann MJ, Litvin TN, Iourgenko V, Sinclair ML, et al. (2000b) Soluble adenylyl cyclase as
an evolutionarily conserved bicarbonate sensor. Science 289:625-628.
Cheng SH, Rich DP, Marshall J, Gregory RJ, Welsh MJ, et al. (1991) Phosphorylation of the R
domain by cAMP-dependent protein kinase regulates the CFTR chloride channel. Cell
66:1027-1036.
Cheng YF, Wang C, Lin HB, Li YF, Huang Y, et al. (2010) Inhibition of phosphodiesterase-4
reverses memory deficits produced by Abeta25-35 or Abeta1-40 peptide in rats.
Psychopharmacology (Berl) 212:181-191.
Cheung ZH, Ip NY (2009) The emerging role of autophagy in Parkinson's disease. Molecular
brain 2:29.
95
Cho JH, Johnson GV (2003) Glycogen synthase kinase 3beta phosphorylates tau at both primed
and unprimed sites. Differential impact on microtubule binding. The Journal of biological
chemistry 278:187-193.
Christensen KA, Myers JT, Swanson JA (2002) pH-dependent regulation of lysosomal calcium in
macrophages. Journal of cell science 115:599-607.
Chung CH (1986) pH-Dependent Inhibition of Cathepsin B1 by Chloroquine. Korean Biochem J
19:93-98.
Coen K, Flannagan RS, Baron S, Carraro-Lacroix LR, Wang D, et al. (2012) Lysosomal calcium
homeostasis defects, not proton pump defects, cause endo-lysosomal dysfunction in
PSEN-deficient cells. The Journal of cell biology 198:23-35.
Coffey EE, Beckel JM, Laties AM, Mitchell CH (2013) Elevated lysosomal pH and autophagy
dysfunction in human fibroblasts bearing the Alzheimer's- associated presenilin 1 A246E
mutation can be ameliorated with cAMP. In: Society for Neuroscience San Diego, CA,
USA.
Coffey EE, Beckel JM, Laties AM, Mitchell CH (2014) Lysosomal alkalization and dysfunction in
human fibroblasts with the Alzheimer's disease-linked presenilin 1 A246E mutation can
be reversed with cAMP. Neuroscience 263:111-124.
Comery TA, Martone RL, Aschmies S, Atchison KP, Diamantidis G, et al. (2005) Acute gammasecretase inhibition improves contextual fear conditioning in the Tg2576 mouse model of
Alzheimer's disease. The Journal of neuroscience : the official journal of the Society for
Neuroscience 25:8898-8902.
Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC, et al. (1993) Gene dose
of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families.
Science 261:921-923.
Cuadrado-Tejedor M, Hervias I, Ricobaraza A, Puerta E, Perez-Roldan JM, et al. (2011)
Sildenafil restores cognitive function without affecting beta-amyloid burden in a mouse
model of Alzheimer's disease. Br J Pharmacol 164:2029-2041.
Curcio-Morelli C, Charles FA, Micsenyi MC, Cao Y, Venugopal B, et al. (2010) Macroautophagy
is defective in mucolipin-1-deficient mouse neurons. Neurobiol Dis 40:370-377.
de Duve C, de Barsy T, Poole B, Trouet A, Tulkens P, et al. (1974) Commentary. Lysosomotropic
agents. Biochemical pharmacology 23:2495-2531.
De Duve C, Pressman BC, Gianetto R, Wattiaux R, Appelmans F (1955) Tissue fractionation
studies. 6. Intracellular distribution patterns of enzymes in rat-liver tissue. The
Biochemical journal 60:604-617.
De Duve C, Wattiaux R (1966) Functions of lysosomes. Annu Rev Physiol 28:435-492.
De Strooper B (2003) Aph-1, Pen-2, and Nicastrin with Presenilin generate an active gammaSecretase complex. Neuron 38:9-12.
De Strooper B, Iwatsubo T, Wolfe MS (2012) Presenilins and gamma-secretase: structure,
function, and role in Alzheimer Disease. Cold Spring Harb Perspect Med 2:a006304.
Deng D, Jiang N, Hao SJ, Sun H, Zhang GJ (2009) Loss of membrane cholesterol influences
lysosomal permeability to potassium ions and protons. Biochim Biophys Acta 1788:470476.
Diettrich O, Mills K, Johnson AW, Hasilik A, Winchester BG (1998) Application of magnetic
chromatography to the isolation of lysosomes from fibroblasts of patients with lysosomal
storage disorders. FEBS Lett 441:369-372.
Dillen K, Annaert W (2006) A two decade contribution of molecular cell biology to the centennial
of Alzheimer's disease: are we progressing toward therapy? Int Rev Cytol 254:215-300.
Ding JD, Johnson LV, Herrmann R, Farsiu S, Smith SG, et al. (2011) Anti-amyloid therapy
protects against retinal pigmented epithelium damage and vision loss in a model of agerelated macular degeneration. Proceedings of the National Academy of Sciences of the
United States of America 108:E279-287.
Ditaranto K, Tekirian TL, Yang AJ (2001) Lysosomal membrane damage in soluble Abetamediated cell death in Alzheimer's disease. Neurobiol Dis 8:19-31.
96
Dobrowolski R, Vick P, Ploper D, Gumper I, Snitkin H, et al. (2012) Presenilin deficiency or
lysosomal inhibition enhances Wnt signaling through relocalization of GSK3 to the lateendosomal compartment. Cell reports 2:1316-1328.
Duvel K, Yecies JL, Menon S, Raman P, Lipovsky AI, et al. (2010) Activation of a metabolic gene
regulatory network downstream of mTOR complex 1. Mol Cell 39:171-183.
Elrick MJ, Lieberman AP (2013) Autophagic dysfunction in a lysosomal storage disorder due to
impaired proteolysis. Autophagy 9:234-235.
Erickson AH, Conner GE, Blobel G (1981) Biosynthesis of a lysosomal enzyme. Partial structure
of two transient and functionally distinct NH2-terminal sequences in cathepsin D. The
Journal of biological chemistry 256:11224-11231.
Esler WP, Wolfe MS (2001) A portrait of Alzheimer secretases--new features and familiar faces.
Science 293:1449-1454.
Esselens C, Oorschot V, Baert V, Raemaekers T, Spittaels K, et al. (2004) Presenilin 1 mediates
the turnover of telencephalin in hippocampal neurons via an autophagic degradative
pathway. The Journal of cell biology 166:1041-1054.
Fang X, Yu SX, Lu Y, Bast RC, Jr., Woodgett JR, et al. (2000) Phosphorylation and inactivation of
glycogen synthase kinase 3 by protein kinase A. Proceedings of the National Academy of
Sciences of the United States of America 97:11960-11965.
Faundez V, Hartzell HC (2004) Intracellular chloride channels: determinants of function in the
endosomal pathway. Sci STKE 2004:re8.
Forgac M (2007) Vacuolar ATPases: rotary proton pumps in physiology and pathophysiology. Nat
Rev Mol Cell Biol 8:917-929.
Funato H, Yoshimura M, Kusui K, Tamaoka A, Ishikawa K, et al. (1998) Quantitation of amyloid
beta-protein (A beta) in the cortex during aging and in Alzheimer's disease. The
American journal of pathology 152:1633-1640.
Fusco F, Razzoli E, Imbimbo C, Rossi A, Verze P, et al. (2010) A new era in the treatment of
erectile dysfunction: chronic phosphodiesterase type 5 inhibition. BJU Int 105:1634-1639.
Ganley IG, Wong PM, Gammoh N, Jiang X (2011) Distinct autophagosomal-lysosomal fusion
mechanism revealed by thapsigargin-induced autophagy arrest. Mol Cell 42:731-743.
Garcia-Barroso C, Ricobaraza A, Pascual-Lucas M, Unceta N, Rico AJ, et al. (2013) Tadalafil
crosses the blood-brain barrier and reverses cognitive dysfunction in a mouse model of
AD. Neuropharmacology 64:114-123.
Garcia-Osta A, Cuadrado-Tejedor M, Garcia-Barroso C, Oyarzabal J, Franco R (2012)
Phosphodiesterases as therapeutic targets for Alzheimer's disease. ACS Chem Neurosci
3:832-844.
Gieselmann V, Pohlmann R, Hasilik A, Von Figura K (1983) Biosynthesis and transport of
cathepsin D in cultured human fibroblasts. The Journal of cell biology 97:1-5.
Ginsberg SD, Mufson EJ, Counts SE, Wuu J, Alldred MJ, et al. (2010) Regional selectivity of rab5
and rab7 protein upregulation in mild cognitive impairment and Alzheimer's disease.
Journal of Alzheimer's disease : JAD 22:631-639.
Glenner GG, Wong CW (1984a) Alzheimer's disease and Down's syndrome: sharing of a unique
cerebrovascular amyloid fibril protein. Biochem Biophys Res Commun 122:1131-1135.
Glenner GG, Wong CW (1984b) Alzheimer's disease: initial report of the purification and
characterization of a novel cerebrovascular amyloid protein. Biochem Biophys Res
Commun 120:885-890.
Golstein P, Kroemer G (2007) Cell death by necrosis: towards a molecular definition. Trends
Biochem Sci 32:37-43.
Gong B, Vitolo OV, Trinchese F, Liu S, Shelanski M, et al. (2004) Persistent improvement in
synaptic and cognitive functions in an Alzheimer mouse model after rolipram treatment. J
Clin Invest 114:1624-1634.
Gonzalez-Noriega A, Grubb JH, Talkad V, Sly WS (1980) Chloroquine inhibits lysosomal enzyme
pinocytosis and enhances lysosomal enzyme secretion by impairing receptor recycling.
The Journal of cell biology 85:839-852.
97
Gouras GK, Almeida CG, Takahashi RH (2005) Intraneuronal Abeta accumulation and origin of
plaques in Alzheimer's disease. Neurobiology of aging 26:1235-1244.
Gray DA, Woulfe J (2005) Lipofuscin and aging: a matter of toxic waste. Sci Aging Knowledge
Environ 2005:re1.
Grynkiewicz G, Poenie M, Tsien RY (1985) A new generation of Ca2+ indicators with greatly
improved fluorescence properties. The Journal of biological chemistry 260:3440-3450.
Guha S, Baltazar GC, Coffey EE, Tu LA, Lim JC, et al. (2013) Lysosomal alkalinization, lipid
oxidation, and reduced phagosome clearance triggered by activation of the P2X7
receptor. FASEB journal : official publication of the Federation of American Societies for
Experimental Biology 27:4500-4509.
Guha S, Baltazar GC, Tu LA, Liu J, Lim JC, et al. (2012) Stimulation of the D5 dopamine receptor
acidifies the lysosomal pH of retinal pigmented epithelial cells and decreases
accumulation of autofluorescent photoreceptor debris. Journal of neurochemistry
122:823-833.
Guha S, Coffey EE, Lu W, Lim JC, Beckel JM, et al. (2014) Approaches for detecting lysosomal
alkalinization and impaired degradation in fresh and cultured RPE cells: evidence for a
role in retinal degenerations. Exp Eye Res 126:68-76.
Halle A, Hornung V, Petzold GC, Stewart CR, Monks BG, et al. (2008) The NALP3
inflammasome is involved in the innate immune response to amyloid-beta. Nat Immunol
9:857-865.
Han P, Caselli RJ, Baxter L, Serrano G, Yin J, et al. (2015) Association of pituitary adenylate
cyclase-activating polypeptide with cognitive decline in mild cognitive impairment due to
Alzheimer disease. JAMA Neurol 72:333-339.
Han P, Tang Z, Yin J, Maalouf M, Beach TG, et al. (2014) Pituitary adenylate cyclase-activating
polypeptide protects against beta-amyloid toxicity. Neurobiology of aging 35:2064-2071.
Hanger DP, Lau DH, Phillips EC, Bondulich MK, Guo T, et al. (2014) Intracellular and
extracellular roles for tau in neurodegenerative disease. Journal of Alzheimer's disease :
JAD 40 Suppl 1:S37-45.
Harris H, Rubinsztein DC (2012) Control of autophagy as a therapy for neurodegenerative
disease. Nat Rev Neurol 8:108-117.
Harris TE, Persaud SJ, Jones PM (1997) Pseudosubstrate inhibition of cyclic AMP-dependent
protein kinase in intact pancreatic islets: effects on cyclic AMP-dependent and glucosedependent insulin secretion. Biochem Biophys Res Commun 232:648-651.
Herreman A, Van Gassen G, Bentahir M, Nyabi O, Craessaerts K, et al. (2003) gammaSecretase activity requires the presenilin-dependent trafficking of nicastrin through the
Golgi apparatus but not its complex glycosylation. Journal of cell science 116:1127-1136.
Hers HG (1963) alpha-Glucosidase deficiency in generalized glycogenstorage disease (Pompe's
disease). The Biochemical journal 86:11-16.
Hiramatsu M, Takiguchi O, Nishiyama A, Mori H (2010) Cilostazol prevents amyloid beta
peptide(25-35)-induced memory impairment and oxidative stress in mice. Br J Pharmacol
161:1899-1912.
Hornung V, Bauernfeind F, Halle A, Samstad EO, Kono H, et al. (2008) Silica crystals and
aluminum salts activate the NALP3 inflammasome through phagosomal destabilization.
Nat Immunol 9:847-856.
Hossini AM, Megges M, Prigione A, Lichtner B, Toliat MR, et al. (2015) Induced pluripotent stem
cell-derived neuronal cells from a sporadic Alzheimer's disease donor as a model for
investigating AD-associated gene regulatory networks. BMC Genomics 16:84.
Hrebicek M, Mrazova L, Seyrantepe V, Durand S, Roslin NM, et al. (2006) Mutations in TMEM76*
cause mucopolysaccharidosis IIIC (Sanfilippo C syndrome). Am J Hum Genet 79:807819.
Isas JM, Luibl V, Johnson LV, Kayed R, Wetzel R, et al. (2010) Soluble and mature amyloid fibrils
in drusen deposits. Investigative ophthalmology & visual science 51:1304-1310.
Israel MA, Yuan SH, Bardy C, Reyna SM, Mu Y, et al. (2012) Probing sporadic and familial
Alzheimer's disease using induced pluripotent stem cells. Nature 482:216-220.
98
Jack CR, Jr., Lowe VJ, Weigand SD, Wiste HJ, Senjem ML, et al. (2009) Serial PIB and MRI in
normal, mild cognitive impairment and Alzheimer's disease: implications for sequence of
pathological events in Alzheimer's disease. Brain 132:1355-1365.
Jaiswal BS, Conti M (2003) Calcium regulation of the soluble adenylyl cyclase expressed in
mammalian spermatozoa. Proceedings of the National Academy of Sciences of the
United States of America 100:10676-10681.
Jancic D, Lopez de Armentia M, Valor LM, Olivares R, Barco A (2009) Inhibition of cAMP
response element-binding protein reduces neuronal excitability and plasticity, and
triggers neurodegeneration. Cereb Cortex 19:2535-2547.
Jasper JR, Michel MC, Insel PA (1990) Amplification of cyclic AMP generation reveals agonistic
effects of certain beta-adrenergic antagonists. Mol Pharmacol 37:44-49.
Jiang L, Salao K, Li H, Rybicka JM, Yates RM, et al. (2012) Intracellular chloride channel protein
CLIC1 regulates macrophage function through modulation of phagosomal acidification.
Journal of cell science 125:5479-5488.
Johansson AC, Appelqvist H, Nilsson C, Kagedal K, Roberg K, et al. (2010) Regulation of
apoptosis-associated lysosomal membrane permeabilization. Apoptosis 15:527-540.
Jorissen E, Prox J, Bernreuther C, Weber S, Schwanbeck R, et al. (2010) The
disintegrin/metalloproteinase ADAM10 is essential for the establishment of the brain
cortex. The Journal of neuroscience : the official journal of the Society for Neuroscience
30:4833-4844.
Kaarniranta K, Salminen A, Haapasalo A, Soininen H, Hiltunen M (2011) Age-related macular
degeneration (AMD): Alzheimer's disease in the eye? Journal of Alzheimer's disease :
JAD 24:615-631.
Kaether C, Lammich S, Edbauer D, Ertl M, Rietdorf J, et al. (2002) Presenilin-1 affects trafficking
and processing of betaAPP and is targeted in a complex with nicastrin to the plasma
membrane. The Journal of cell biology 158:551-561.
Kanfer JN, Sorrentino G, Sitar DS (1999) Amyloid beta peptide membrane perturbation is the
basis for its biological effects. Neurochem Res 24:1621-1630.
Kawarabayashi T, Igeta Y, Sato M, Sasaki A, Matsubara E, et al. (1997) Lysosomal generation of
amyloid beta protein species in transgenic mice. Brain Res 765:343-348.
Kemppainen S, Rantamaki T, Jeronimo-Santos A, Lavasseur G, Autio H, et al. (2012) Impaired
TrkB receptor signaling contributes to memory impairment in APP/PS1 mice.
Neurobiology of aging 33:1122 e1123-1139.
Khurana V, Elson-Schwab I, Fulga TA, Sharp KA, Loewen CA, et al. (2010) Lysosomal
dysfunction promotes cleavage and neurotoxicity of tau in vivo. PLoS Genet 6:e1001026.
Kim J, Kundu M, Viollet B, Guan KL (2011) AMPK and mTOR regulate autophagy through direct
phosphorylation of Ulk1. Nat Cell Biol 13:132-141.
Klionsky DJ, Abdalla FC, Abeliovich H, Abraham RT, Acevedo-Arozena A, et al. (2012)
Guidelines for the use and interpretation of assays for monitoring autophagy. Autophagy
8:445-544.
Klionsky DJ, Elazar Z, Seglen PO, Rubinsztein DC (2008) Does bafilomycin A1 block the fusion
of autophagosomes with lysosomes? Autophagy 4:849-950.
Kondo T, Asai M, Tsukita K, Kutoku Y, Ohsawa Y, et al. (2013) Modeling Alzheimer's disease
with iPSCs reveals stress phenotypes associated with intracellular Abeta and differential
drug responsiveness. Cell Stem Cell 12:487-496.
Koo EH, Squazzo SL (1994) Evidence that production and release of amyloid beta-protein
involves the endocytic pathway. The Journal of biological chemistry 269:17386-17389.
Kopitz J, Arnold A, Meissner T, Cantz M (1993) Protein catabolism in fibroblasts cultured from
patients with mucolipidosis II and other lysosomal disorders. The Biochemical journal 295
( Pt 2):577-580.
Kosik KS, Joachim CL, Selkoe DJ (1986) Microtubule-associated protein tau (tau) is a major
antigenic component of paired helical filaments in Alzheimer disease. Proceedings of the
National Academy of Sciences of the United States of America 83:4044-4048.
99
Kuhn PH, Wang H, Dislich B, Colombo A, Zeitschel U, et al. (2010) ADAM10 is the
physiologically relevant, constitutive alpha-secretase of the amyloid precursor protein in
primary neurons. The EMBO journal 29:3020-3032.
Lafay-Chebassier C, Paccalin M, Page G, Barc-Pain S, Perault-Pochat MC, et al. (2005)
mTOR/p70S6k signalling alteration by Abeta exposure as well as in APP-PS1 transgenic
models and in patients with Alzheimer's disease. Journal of neurochemistry 94:215-225.
Lakics V, Karran EH, Boess FG (2010) Quantitative comparison of phosphodiesterase mRNA
distribution in human brain and peripheral tissues. Neuropharmacology 59:367-374.
Lalonde R, Qian S, Strazielle C (2003) Transgenic mice expressing the PS1-A246E mutation:
effects on spatial learning, exploration, anxiety, and motor coordination. Behavioural
brain research 138:71-79.
Lamanna WC, Lawrence R, Sarrazin S, Esko JD (2011) Secondary storage of dermatan sulfate
in Sanfilippo disease. The Journal of biological chemistry 286:6955-6962.
Laplante M, Sabatini DM (2012) mTOR signaling in growth control and disease. Cell 149:274293.
Lee HR, Shin HK, Park SY, Kim HY, Lee WS, et al. (2014) Attenuation of beta-amyloid-induced
tauopathy via activation of CK2alpha/SIRT1: targeting for cilostazol. J Neurosci Res
92:206-217.
Lee JH, Yu WH, Kumar A, Lee S, Mohan PS, et al. (2010) Lysosomal proteolysis and autophagy
require presenilin 1 and are disrupted by Alzheimer-related PS1 mutations. Cell
141:1146-1158.
Lee S, Sato Y, Nixon RA (2011) Lysosomal proteolysis inhibition selectively disrupts axonal
transport of degradative organelles and causes an Alzheimer's-like axonal dystrophy.
The Journal of neuroscience : the official journal of the Society for Neuroscience
31:7817-7830.
Levitan D, Greenwald I (1995) Facilitation of lin-12-mediated signalling by sel-12, a
Caenorhabditis elegans S182 Alzheimer's disease gene. Nature 377:351-354.
Liang Z, Liu F, Grundke-Iqbal I, Iqbal K, Gong CX (2007) Down-regulation of cAMP-dependent
protein kinase by over-activated calpain in Alzheimer disease brain. Journal of
neurochemistry 103:2462-2470.
Lin H, Bhatia R, Lal R (2001) Amyloid beta protein forms ion channels: implications for
Alzheimer's disease pathophysiology. FASEB journal : official publication of the
Federation of American Societies for Experimental Biology 15:2433-2444.
Lindsay J, Laurin D, Verreault R, Hebert R, Helliwell B, et al. (2002) Risk factors for Alzheimer's
disease: a prospective analysis from the Canadian Study of Health and Aging. Am J
Epidemiol 156:445-453.
Lipinski MM, Zheng B, Lu T, Yan Z, Py BF, et al. (2010) Genome-wide analysis reveals
mechanisms modulating autophagy in normal brain aging and in Alzheimer's disease.
Proceedings of the National Academy of Sciences of the United States of America
107:14164-14169.
Litvin TN, Kamenetsky M, Zarifyan A, Buck J, Levin LR (2003) Kinetic properties of "soluble"
adenylyl cyclase. Synergism between calcium and bicarbonate. The Journal of biological
chemistry 278:15922-15926.
Liu J, Lu W, Guha S, Baltazar GC, Coffey EE, et al. (2012) Cystic fibrosis transmembrane
conductance regulator contributes to reacidification of alkalinized lysosomes in RPE cells.
American journal of physiology Cell physiology 303:C160-169.
Liu J, Lu W, Reigada D, Nguyen J, Laties AM, et al. (2008) Restoration of lysosomal pH in RPE
cells from cultured human and ABCA4(-/-) mice: pharmacologic approaches and
functional recovery. Investigative ophthalmology & visual science 49:772-780.
Lloyd-Evans E, Morgan AJ, He X, Smith DA, Elliot-Smith E, et al. (2008) Niemann-Pick disease
type C1 is a sphingosine storage disease that causes deregulation of lysosomal calcium.
Nature medicine 14:1247-1255.
Lloyd-Evans E, Platt FM (2011) Lysosomal Ca(2+) homeostasis: role in pathogenesis of
lysosomal storage diseases. Cell Calcium 50:200-205.
100
Ma XM, Blenis J (2009) Molecular mechanisms of mTOR-mediated translational control. Nat Rev
Mol Cell Biol 10:307-318.
Majumdar A, Capetillo-Zarate E, Cruz D, Gouras GK, Maxfield FR (2011) Degradation of
Alzheimer's amyloid fibrils by microglia requires delivery of ClC-7 to lysosomes. Mol Biol
Cell 22:1664-1676.
Majumdar A, Cruz D, Asamoah N, Buxbaum A, Sohar I, et al. (2007) Activation of microglia
acidifies lysosomes and leads to degradation of Alzheimer amyloid fibrils. Mol Biol Cell
18:1490-1496.
Martina JA, Chen Y, Gucek M, Puertollano R (2012) MTORC1 functions as a transcriptional
regulator of autophagy by preventing nuclear transport of TFEB. Autophagy 8:903-914.
Martinez-Vicente M, Talloczy Z, Wong E, Tang G, Koga H, et al. (2010) Cargo recognition failure
is responsible for inefficient autophagy in Huntington's disease. Nature neuroscience
13:567-576.
Mattson MP (2004) Pathways towards and away from Alzheimer's disease. Nature 430:631-639.
Mattsson N, Zetterberg H, Bianconi S, Yanjanin NM, Fu R, et al. (2011) Gamma-secretasedependent amyloid-beta is increased in Niemann-Pick type C: a cross-sectional study.
Neurology 76:366-372.
Maurer K, Volk S, Gerbaldo H (1997) Auguste D and Alzheimer's disease. Lancet 349:15461549.
May DC, Ross EM, Gilman AG, Smigel MD (1985) Reconstitution of catecholamine-stimulated
adenylate cyclase activity using three purified proteins. The Journal of biological
chemistry 260:15829-15833.
McDermott JR, Gibson AM (1996) Degradation of Alzheimer's beta-amyloid protein by human
cathepsin D. Neuroreport 7:2163-2166.
McLean CA, Cherny RA, Fraser FW, Fuller SJ, Smith MJ, et al. (1999) Soluble pool of Abeta
amyloid as a determinant of severity of neurodegeneration in Alzheimer's disease. Ann
Neurol 46:860-866.
Medina DL, Di Paola S, Peluso I, Armani A, De Stefani D, et al. (2015) Lysosomal calcium
signalling regulates autophagy through calcineurin and TFEB. Nat Cell Biol 17:288-299.
Medina DL, Fraldi A, Bouche V, Annunziata F, Mansueto G, et al. (2011) Transcriptional
activation of lysosomal exocytosis promotes cellular clearance. Dev Cell 21:421-430.
Micsenyi MC, Sikora J, Stephney G, Dobrenis K, Walkley SU (2013) Lysosomal membrane
permeability stimulates protein aggregate formation in neurons of a lysosomal disease.
The Journal of neuroscience : the official journal of the Society for Neuroscience
33:10815-10827.
Mindell JA (2012) Lysosomal acidification mechanisms. Annu Rev Physiol 74:69-86.
Miyazaki H, Yamada T, Parton A, Morrison R, Kim S, et al. (2012) CLC anion channel regulatory
phosphorylation and conserved signal transduction domains. Biophys J 103:1706-1718.
Morishima-Kawashima M, Oshima N, Ogata H, Yamaguchi H, Yoshimura M, et al. (2000) Effect
of apolipoprotein E allele epsilon4 on the initial phase of amyloid beta-protein
accumulation in the human brain. The American journal of pathology 157:2093-2099.
Mucke L, Masliah E, Yu GQ, Mallory M, Rockenstein EM, et al. (2000) High-level neuronal
expression of abeta 1-42 in wild-type human amyloid protein precursor transgenic mice:
synaptotoxicity without plaque formation. The Journal of neuroscience : the official journal
of the Society for Neuroscience 20:4050-4058.
Myeku N, Figueiredo-Pereira ME (2011) Dynamics of the degradation of ubiquitinated proteins by
proteasomes and autophagy: association with sequestosome 1/p62. The Journal of
biological chemistry 286:22426-22440.
Myeku N, Wang H, Figueiredo-Pereira ME (2012) cAMP stimulates the ubiquitin/proteasome
pathway in rat spinal cord neurons. Neuroscience letters 527:126-131.
Nakamura Y, Takeda M, Suzuki H, Morita H, Tada K, et al. (1989) Lysosome instability in aged
rat brain. Neuroscience letters 97:215-220.
Naruse S, Thinakaran G, Luo JJ, Kusiak JW, Tomita T, et al. (1998) Effects of PS1 deficiency on
membrane protein trafficking in neurons. Neuron 21:1213-1221.
101
Neely KM, Green KN, LaFerla FM (2011) Presenilin is necessary for efficient proteolysis through
the autophagy-lysosome system in a gamma-secretase-independent manner. The
Journal of neuroscience : the official journal of the Society for Neuroscience 31:27812791.
Nixon RA (2004) Niemann-Pick Type C disease and Alzheimer's disease: the APP-endosome
connection fattens up. The American journal of pathology 164:757-761.
Nixon RA (2005) Endosome function and dysfunction in Alzheimer's disease and other
neurodegenerative diseases. Neurobiology of aging 26:373-382.
Nixon RA, Cataldo AM (2006) Lysosomal system pathways: genes to neurodegeneration in
Alzheimer's disease. Journal of Alzheimer's disease : JAD 9:277-289.
Nixon RA, Cataldo AM, Paskevich PA, Hamilton DJ, Wheelock TR, et al. (1992) The lysosomal
system in neurons. Involvement at multiple stages of Alzheimer's disease pathogenesis.
Ann N Y Acad Sci 674:65-88.
Nixon RA, Wegiel J, Kumar A, Yu WH, Peterhoff C, et al. (2005) Extensive involvement of
autophagy in Alzheimer disease: an immuno-electron microscopy study. Journal of
neuropathology and experimental neurology 64:113-122.
Nixon RA, Yang DS, Lee JH (2008) Neurodegenerative lysosomal disorders: a continuum from
development to late age. Autophagy 4:590-599.
Nonaka N, Banks WA, Mizushima H, Shioda S, Morley JE (2002) Regional differences in PACAP
transport across the blood-brain barrier in mice: a possible influence of strain, amyloid
beta protein, and age. Peptides 23:2197-2202.
Nukina N, Ihara Y (1986) One of the antigenic determinants of paired helical filaments is related
to tau protein. J Biochem 99:1541-1544.
Oakley H, Cole SL, Logan S, Maus E, Shao P, et al. (2006) Intraneuronal beta-amyloid
aggregates, neurodegeneration, and neuron loss in transgenic mice with five familial
Alzheimer's disease mutations: potential factors in amyloid plaque formation. The Journal
of neuroscience : the official journal of the Society for Neuroscience 26:10129-10140.
Oddo S, Caccamo A, Smith IF, Green KN, LaFerla FM (2006) A dynamic relationship between
intracellular and extracellular pools of Abeta. The American journal of pathology 168:184194.
Ohkuma S, Poole B (1978) Fluorescence probe measurement of the intralysosomal pH in living
cells and the perturbation of pH by various agents. Proceedings of the National Academy
of Sciences of the United States of America 75:3327-3331.
Ohno-Matsui K (2011) Parallel findings in age-related macular degeneration and Alzheimer's
disease. Progress in retinal and eye research 30:217-238.
Pacheco CD, Kunkel R, Lieberman AP (2007) Autophagy in Niemann-Pick C disease is
dependent upon Beclin-1 and responsive to lipid trafficking defects. Human molecular
genetics 16:1495-1503.
Page E, Goings GE, Upshaw-Earley J, Hanck DA (1994) Endocytosis and uptake of lucifer yellow
by cultured atrial myocytes and isolated intact atria from adult rats. Regulation and
subcellular localization. Circ Res 75:335-346.
Paintlia AS, Paintlia MK, Singh I, Skoff RB, Singh AK (2009) Combination therapy of lovastatin
and rolipram provides neuroprotection and promotes neurorepair in inflammatory
demyelination model of multiple sclerosis. Glia 57:182-193.
Palmieri M, Impey S, Kang H, di Ronza A, Pelz C, et al. (2011) Characterization of the CLEAR
network reveals an integrated control of cellular clearance pathways. Human molecular
genetics 20:3852-3866.
Park SH, Kim JH, Bae SS, Hong KW, Lee DS, et al. (2011) Protective effect of the
phosphodiesterase III inhibitor cilostazol on amyloid beta-induced cognitive deficits
associated with decreased amyloid beta accumulation. Biochem Biophys Res Commun
408:602-608.
Parr C, Carzaniga R, Gentleman SM, Van Leuven F, Walter J, et al. (2012) Glycogen synthase
kinase 3 inhibition promotes lysosomal biogenesis and autophagic degradation of the
amyloid-beta precursor protein. Molecular and cellular biology 32:4410-4418.
102
Parra KJ, Kane PM (1998) Reversible association between the V1 and V0 domains of yeast
vacuolar H+-ATPase is an unconventional glucose-induced effect. Molecular and cellular
biology 18:7064-7074.
Pasternak SH, Callahan JW, Mahuran DJ (2004) The role of the endosomal/lysosomal system in
amyloid-beta production and the pathophysiology of Alzheimer's disease: reexamining
the spatial paradox from a lysosomal perspective. Journal of Alzheimer's disease : JAD
6:53-65.
Paunescu TG, Ljubojevic M, Russo LM, Winter C, McLaughlin MM, et al. (2010) cAMP stimulates
apical V-ATPase accumulation, microvillar elongation, and proton extrusion in kidney
collecting duct A-intercalated cells. American journal of physiology Renal physiology
298:F643-654.
Pearson HA, Peers C (2006) Physiological roles for amyloid beta peptides. J Physiol 575:5-10.
Pentchev PG, Brady RO, Blair HE, Britton DE, Sorrell SH (1978) Gaucher disease: isolation and
comparison of normal and mutant glucocerebrosidase from human spleen tissue.
Proceedings of the National Academy of Sciences of the United States of America
75:3970-3973.
Phiel CJ, Wilson CA, Lee VM, Klein PS (2003) GSK-3alpha regulates production of Alzheimer's
disease amyloid-beta peptides. Nature 423:435-439.
Platt FM, Boland B, van der Spoel AC (2012) The cell biology of disease: lysosomal storage
disorders: the cellular impact of lysosomal dysfunction. The Journal of cell biology
199:723-734.
Pourahmad J, Mortada Y, Eskandari MR, Shahraki J (2011) Involvement of Lysosomal
Labilisation and Lysosomal/mitochondrial Cross-Talk in Diclofenac Induced
Hepatotoxicity. Iran J Pharm Res 10:877-887.
Pozueta J, Lefort R, Shelanski ML (2013) Synaptic changes in Alzheimer's disease and its
models. Neuroscience 251:51-65.
Prinetti A, Prioni S, Chiricozzi E, Schuchman EH, Chigorno V, et al. (2011) Secondary alterations
of sphingolipid metabolism in lysosomal storage diseases. Neurochem Res 36:16541668.
Puopolo K, Kumamoto C, Adachi I, Magner R, Forgac M (1992) Differential expression of the "B"
subunit of the vacuolar H(+)-ATPase in bovine tissues. The Journal of biological
chemistry 267:3696-3706.
Puzzo D, Staniszewski A, Deng SX, Privitera L, Leznik E, et al. (2009) Phosphodiesterase 5
inhibition improves synaptic function, memory, and amyloid-beta load in an Alzheimer's
disease mouse model. The Journal of neuroscience : the official journal of the Society for
Neuroscience 29:8075-8086.
Qi J, Wang Y, Forgac M (2007) The vacuolar (H+)-ATPase: subunit arrangement and in vivo
regulation. J Bioenerg Biomembr 39:423-426.
Qian S, Jiang P, Guan XM, Singh G, Trumbauer ME, et al. (1998) Mutant human presenilin 1
protects presenilin 1 null mouse against embryonic lethality and elevates Abeta1-42/43
expression. Neuron 20:611-617.
Quist A, Doudevski I, Lin H, Azimova R, Ng D, et al. (2005) Amyloid ion channels: a common
structural link for protein-misfolding disease. Proceedings of the National Academy of
Sciences of the United States of America 102:10427-10432.
Rabinowitz JD, White E (2010) Autophagy and metabolism. Science 330:1344-1348.
Rahman N, Buck J, Levin LR (2013) pH sensing via bicarbonate-regulated "soluble" adenylyl
cyclase (sAC). Front Physiol 4:343.
Raina P, Santaguida P, Ismaila A, Patterson C, Cowan D, et al. (2008) Effectiveness of
cholinesterase inhibitors and memantine for treating dementia: evidence review for a
clinical practice guideline. Ann Intern Med 148:379-397.
Raschetti R, Albanese E, Vanacore N, Maggini M (2007) Cholinesterase inhibitors in mild
cognitive impairment: a systematic review of randomised trials. PLoS Med 4:e338.
Rat D, Schmitt U, Tippmann F, Dewachter I, Theunis C, et al. (2011) Neuropeptide pituitary
adenylate cyclase-activating polypeptide (PACAP) slows down Alzheimer's disease-like
103
pathology in amyloid precursor protein-transgenic mice. FASEB journal : official
publication of the Federation of American Societies for Experimental Biology 25:32083218.
Roczniak-Ferguson A, Petit CS, Froehlich F, Qian S, Ky J, et al. (2012) The transcription factor
TFEB links mTORC1 signaling to transcriptional control of lysosome homeostasis.
Science signaling 5:ra42.
Roher AE, Lowenson JD, Clarke S, Woods AS, Cotter RJ, et al. (1993) beta-Amyloid-(1-42) is a
major component of cerebrovascular amyloid deposits: implications for the pathology of
Alzheimer disease. Proceedings of the National Academy of Sciences of the United
States of America 90:10836-10840.
Rosenfeld MG, Kreibich G, Popov D, Kato K, Sabatini DD (1982) Biosynthesis of lysosomal
hydrolases: their synthesis in bound polysomes and the role of co- and post-translational
processing in determining their subcellular distribution. The Journal of cell biology
93:135-143.
Roseth S, Fykse EM, Fonnum F (1995) Uptake of L-glutamate into rat brain synaptic vesicles:
effect of inhibitors that bind specifically to the glutamate transporter. Journal of
neurochemistry 65:96-103.
Rosner M, Siegel N, Valli A, Fuchs C, Hengstschlager M (2010) mTOR phosphorylated at S2448
binds to raptor and rictor. Amino Acids 38:223-228.
Ross BM, McLaughlin M, Roberts M, Milligan G, McCulloch J, et al. (1993) Alterations in the
activity of adenylate cyclase and high affinity GTPase in Alzheimer's disease. Brain Res
622:35-42.
Saido T, Leissring MA (2012) Proteolytic degradation of amyloid beta-protein. Cold Spring Harb
Perspect Med 2:a006379.
Santa Cecilia AJ, Chinchetru MA, Calvo P (1991) Purification and characterization of different
"acid" beta-galactosidases from sheep kidney. Comp Biochem Physiol B 99:373-379.
Sardiello M, Palmieri M, di Ronza A, Medina DL, Valenza M, et al. (2009) A gene network
regulating lysosomal biogenesis and function. Science 325:473-477.
Sarkar S (2013) Regulation of autophagy by mTOR-dependent and mTOR-independent
pathways: autophagy dysfunction in neurodegenerative diseases and therapeutic
application of autophagy enhancers. Biochem Soc Trans 41:1103-1130.
Scahill RI, Schott JM, Stevens JM, Rossor MN, Fox NC (2002) Mapping the evolution of regional
atrophy in Alzheimer's disease: unbiased analysis of fluid-registered serial MRI.
Proceedings of the National Academy of Sciences of the United States of America
99:4703-4707.
Scheuner D, Eckman C, Jensen M, Song X, Citron M, et al. (1996) Secreted amyloid beta-protein
similar to that in the senile plaques of Alzheimer's disease is increased in vivo by the
presenilin 1 and 2 and APP mutations linked to familial Alzheimer's disease. Nature
medicine 2:864-870.
Schnecko A, Witte K, Bohl J, Ohm T, Lemmer B (1994) Adenylyl cyclase activity in Alzheimer's
disease brain: stimulatory and inhibitory signal transduction pathways are differently
affected. Brain Res 644:291-296.
Schwartz W, Bird JW (1977) Degradation of myofibrillar proteins by cathepsins B and D. The
Biochemical journal 167:811-820.
Selkoe DJ, Wolfe MS (2007) Presenilin: running with scissors in the membrane. Cell 131:215221.
Settembre C, De Cegli R, Mansueto G, Saha PK, Vetrini F, et al. (2013) TFEB controls cellular
lipid metabolism through a starvation-induced autoregulatory loop. Nat Cell Biol 15:647658.
Settembre C, Di Malta C, Polito VA, Garcia Arencibia M, Vetrini F, et al. (2011) TFEB links
autophagy to lysosomal biogenesis. Science 332:1429-1433.
Settembre C, Zoncu R, Medina DL, Vetrini F, Erdin S, et al. (2012) A lysosome-to-nucleus
signalling mechanism senses and regulates the lysosome via mTOR and TFEB. The
EMBO journal 31:1095-1108.
104
Sherrington R, Rogaev EI, Liang Y, Rogaeva EA, Levesque G, et al. (1995) Cloning of a gene
bearing missense mutations in early-onset familial Alzheimer's disease. Nature 375:754760.
Sierksma AS, van den Hove DL, Pfau F, Philippens M, Bruno O, et al. (2014) Improvement of
spatial memory function in APPswe/PS1dE9 mice after chronic inhibition of
phosphodiesterase type 4D. Neuropharmacology 77:120-130.
Sivak JM (2013) The aging eye: common degenerative mechanisms between the Alzheimer's
brain and retinal disease. Investigative ophthalmology & visual science 54:871-880.
Soreghan B, Kosmoski J, Glabe C (1994) Surfactant properties of Alzheimer's A beta peptides
and the mechanism of amyloid aggregation. The Journal of biological chemistry
269:28551-28554.
Spasic D, Tolia A, Dillen K, Baert V, De Strooper B, et al. (2006) Presenilin-1 maintains a ninetransmembrane topology throughout the secretory pathway. The Journal of biological
chemistry 281:26569-26577.
Steinhoff M, McGregor GP, Radleff-Schlimme A, Steinhoff A, Jarry H, et al. (1999) Identification
of pituitary adenylate cyclase activating polypeptide (PACAP) and PACAP type 1
receptor in human skin: expression of PACAP-38 is increased in patients with psoriasis.
Regul Pept 80:49-55.
Stoica L, Zhu PJ, Huang W, Zhou H, Kozma SC, et al. (2011) Selective pharmacogenetic
inhibition of mammalian target of Rapamycin complex I (mTORC1) blocks long-term
synaptic plasticity and memory storage. Proceedings of the National Academy of
Sciences of the United States of America 108:3791-3796.
Struhl G, Adachi A (2000) Requirements for presenilin-dependent cleavage of notch and other
transmembrane proteins. Mol Cell 6:625-636.
Tagawa K, Maruyama K, Ishiura S (1992) Amyloid beta/A4 precursor protein (APP) processing in
lysosomes. Ann N Y Acad Sci 674:129-137.
Terman A, Brunk UT (1998a) Ceroid/lipofuscin formation in cultured human fibroblasts: the role of
oxidative stress and lysosomal proteolysis. Mech Ageing Dev 104:277-291.
Terman A, Brunk UT (1998b) Lipofuscin: mechanisms of formation and increase with age. APMIS
106:265-276.
Terry RD, Masliah E, Salmon DP, Butters N, DeTeresa R, et al. (1991) Physical basis of cognitive
alterations in Alzheimer's disease: synapse loss is the major correlate of cognitive
impairment. Ann Neurol 30:572-580.
Torres M, Jimenez S, Sanchez-Varo R, Navarro V, Trujillo-Estrada L, et al. (2012) Defective
lysosomal proteolysis and axonal transport are early pathogenic events that worsen with
age leading to increased APP metabolism and synaptic Abeta in transgenic APP/PS1
hippocampus. Mol Neurodegener 7:59.
Trombetta ES, Ebersold M, Garrett W, Pypaert M, Mellman I (2003) Activation of lysosomal
function during dendritic cell maturation. Science 299:1400-1403.
Turk B, Turk V (2009) Lysosomes as "suicide bags" in cell death: myth or reality? The Journal of
biological chemistry 284:21783-21787.
van Hille B, Richener H, Schmid P, Puettner I, Green JR, et al. (1994) Heterogeneity of vacuolar
H(+)-ATPase: differential expression of two human subunit B isoforms. The Biochemical
journal 303 ( Pt 1):191-198.
Vassar R, Bennett BD, Babu-Khan S, Kahn S, Mendiaz EA, et al. (1999) Beta-secretase
cleavage of Alzheimer's amyloid precursor protein by the transmembrane aspartic
protease BACE. Science 286:735-741.
Villemagne VL, Burnham S, Bourgeat P, Brown B, Ellis KA, et al. (2013) Amyloid beta deposition,
neurodegeneration, and cognitive decline in sporadic Alzheimer's disease: a prospective
cohort study. Lancet Neurol 12:357-367.
Walker MW, Lloyd-Evans E (2015) A rapid method for the preparation of ultrapure, functional
lysosomes using functionalized superparamagnetic iron oxide nanoparticles. Methods
Cell Biol 126:21-43.
105
Walkley SU, Vanier MT (2009) Secondary lipid accumulation in lysosomal disease. Biochim
Biophys Acta 1793:726-736.
Wertheimer E, Krapf D, de la Vega-Beltran JL, Sanchez-Cardenas C, Navarrete F, et al. (2013)
Compartmentalization of distinct cAMP signaling pathways in mammalian sperm. The
Journal of biological chemistry 288:35307-35320.
Williams A, Sarkar S, Cuddon P, Ttofi EK, Saiki S, et al. (2008) Novel targets for Huntington's
disease in an mTOR-independent autophagy pathway. Nat Chem Biol 4:295-305.
Winslow AR, Chen CW, Corrochano S, Acevedo-Arozena A, Gordon DE, et al. (2010) alphaSynuclein impairs macroautophagy: implications for Parkinson's disease. The Journal of
cell biology 190:1023-1037.
Wolfe DM, Lee JH, Kumar A, Lee S, Orenstein SJ, et al. (2013) Autophagy failure in Alzheimer's
disease and the role of defective lysosomal acidification. Eur J Neurosci 37:1949-1961.
Wood WG, Igbavboa U (2003) Cholesterol trafficking and amyloid beta peptides.
Pharmacopsychiatry 36 Suppl 2:S144-148.
Wu YT, Tan HL, Shui G, Bauvy C, Huang Q, et al. (2010) Dual role of 3-methyladenine in
modulation of autophagy via different temporal patterns of inhibition on class I and III
phosphoinositide 3-kinase. The Journal of biological chemistry 285:10850-10861.
Yagi T, Ito D, Okada Y, Akamatsu W, Nihei Y, et al. (2011) Modeling familial Alzheimer's disease
with induced pluripotent stem cells. Human molecular genetics 20:4530-4539.
Yamamoto A, Tagawa Y, Yoshimori T, Moriyama Y, Masaki R, et al. (1998) Bafilomycin A1
prevents maturation of autophagic vacuoles by inhibiting fusion between
autophagosomes and lysosomes in rat hepatoma cell line, H-4-II-E cells. Cell structure
and function 23:33-42.
Yamamoto M, Ozawa H, Saito T, Hatta S, Riederer P, et al. (1997) Ca2+/CaM-sensitive adenylyl
cyclase activity is decreased in the Alzheimer's brain: possible relation to type I adenylyl
cyclase. J Neural Transm 104:721-732.
Yang AJ, Chandswangbhuvana D, Margol L, Glabe CG (1998) Loss of endosomal/lysosomal
membrane impermeability is an early event in amyloid Abeta1-42 pathogenesis. J
Neurosci Res 52:691-698.
Yang DS, Stavrides P, Mohan PS, Kaushik S, Kumar A, et al. (2011) Reversal of autophagy
dysfunction in the TgCRND8 mouse model of Alzheimer's disease ameliorates amyloid
pathologies and memory deficits. Brain 134:258-277.
Yang DS, Stavrides P, Saito M, Kumar A, Rodriguez-Navarro JA, et al. (2014) Defective
macroautophagic turnover of brain lipids in the TgCRND8 Alzheimer mouse model:
prevention by correcting lysosomal proteolytic deficits. Brain 137:3300-3318.
Yang X, Askarova S, Lee JC (2010) Membrane biophysics and mechanics in Alzheimer's
disease. Mol Neurobiol 41:138-148.
Yao J, Zhang GJ (1997) Lysosomal destabilization via increased potassium ion permeability
following photodamage. Biochim Biophys Acta 1323:334-342.
Yu WH, Kumar A, Peterhoff C, Shapiro Kulnane L, Uchiyama Y, et al. (2004) Autophagic
vacuoles are enriched in amyloid precursor protein-secretase activities: implications for
beta-amyloid peptide over-production and localization in Alzheimer's disease. Int J
Biochem Cell Biol 36:2531-2540.
Zaidi AU, McDonough JS, Klocke BJ, Latham CB, Korsmeyer SJ, et al. (2001) Chloroquineinduced neuronal cell death is p53 and Bcl-2 family-dependent but caspase-independent.
Journal of neuropathology and experimental neurology 60:937-945.
Zhang GJ, Yao J (1997) The direct cause of photodamage-induced lysosomal destabilization.
Biochim Biophys Acta 1326:75-82.
Zhang X, Garbett K, Veeraraghavalu K, Wilburn B, Gilmore R, et al. (2012) A role for presenilins
in autophagy revisited: normal acidification of lysosomes in cells lacking PSEN1 and
PSEN2. The Journal of neuroscience : the official journal of the Society for Neuroscience
32:8633-8648.
106
Zhang Y, McLaughlin R, Goodyer C, LeBlanc A (2002) Selective cytotoxicity of intracellular
amyloid beta peptide1-42 through p53 and Bax in cultured primary human neurons. The
Journal of cell biology 156:519-529.
Zheng J, Yan T, Feng Y, Zhai Q (2010) Involvement of lysosomes in the early stages of axon
degeneration. Neurochem Int 56:516-521.
Zhou Q, Petersen CC, Nicoll RA (2000) Effects of reduced vesicular filling on synaptic
transmission in rat hippocampal neurones. J Physiol 525 Pt 1:195-206.
Zippin JH, Chen Y, Nahirney P, Kamenetsky M, Wuttke MS, et al. (2003) Compartmentalization
of bicarbonate-sensitive adenylyl cyclase in distinct signaling microdomains. FASEB
journal : official publication of the Federation of American Societies for Experimental
Biology 17:82-84.
Zoncu R, Bar-Peled L, Efeyan A, Wang S, Sancak Y, et al. (2011) mTORC1 senses lysosomal
amino acids through an inside-out mechanism that requires the vacuolar H(+)-ATPase.
Science 334:678-683.
107