From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
PLATELETS AND THROMBOPOIESIS
The spectrin-based membrane skeleton stabilizes mouse megakaryocyte
membrane systems and is essential for proplatelet and platelet formation
Sunita Patel-Hett,1,2 Hongbei Wang,1 Antonija J. Begonja,1 Jonathan N. Thon,1 Eva C. Alden,2 Nancy J. Wandersee,3,4
Xiuli An,5 Narla Mohandas,5 John H. Hartwig,1 and Joseph E. Italiano Jr1,2
1Translational Medicine Division, Department of Medicine, Brigham & Women’s Hospital, Boston, MA; 2Vascular Biology Program, Department of Surgery,
Children’s Hospital, Boston, MA; 3Department of Pediatrics and Children’s Research Institute, Medical College of Wisconsin, Milwaukee, WI; 4Blood Research
Institute, BloodCenter of Wisconsin, Milwaukee, WI; and 5New York Blood Center, New York, NY
Megakaryocytes generate platelets by remodeling their cytoplasm first into proplatelets and then into preplatelets, which
undergo fission to generate platelets. Although the functions of microtubules and
actin during platelet biogenesis have been
defined, the role of the spectrin cytoskeleton is unknown. We investigated the
function of the spectrin-based membrane
skeleton in proplatelet and platelet production in murine megakaryocytes. Electron microscopy revealed that, like circulating platelets, proplatelets have a dense
membrane skeleton, the main fibrous
component of which is spectrin. Unlike
other cells, megakaryocytes and their
progeny express both erythroid and nonerythroid spectrins. Assembly of spectrin
into tetramers is required for invaginated
membrane system maturation and proplatelet extension, because expression of
a spectrin tetramer–disrupting construct
in megakaryocytes inhibits both processes. Incorporation of this spectrindisrupting fragment into a novel permeabilized proplatelet system rapidly
destabilizes proplatelets, causing blebbing and swelling. Spectrin tetramers also
stabilize the “barbell shapes” of the penultimate stage in platelet production, because addition of the tetramer-disrupting
construct converts these barbell shapes
to spheres, demonstrating that membrane skeletal continuity maintains the
elongated, pre-fission shape. The results
of this study provide evidence for a role
for spectrin in different steps of megakaryocyte development through its participation in the formation of invaginated
membranes and in the maintenance of
proplatelet structure. (Blood. 2011;118(6):
1641-1652)
Introduction
Blood platelets, like erythrocytes, must withstand high shear forces
during circulation. Retaining their discoid shape is critical to
platelets, because their small size and shape cause them to be
propelled by blood flow to the endothelial surface, where they are
positioned to readily sense and respond to vascular damage. To
provide structural support and prevent gross deformations as they
circulate, mature platelets contain a robust membrane skeleton that
is formed by spectrin molecules, adducin, and actin filament barbed
ends.1-3 Two thousand spectrin tetramers, 200-nm-long head-tohead assemblies of ␣␤ heterodimers, compose the bulk of this 2D
network. Although less is known about how the spectrin-actin
network forms and connects to the plasma membrane in platelets
relative to erythrocytes, certain differences between the 2 membrane skeletons have been recognized. First, spectrin strands
comprising the platelet membrane skeleton interconnect on the
ends of long actin filaments originating from the cytoplasm instead
of short actin oligomers.3-5 Therefore, the platelet spectrin lattice
and its associated actin filaments assemble into a continuous
ultrastructure. Second, tropomodulins do not appear to have a
major role in capping actin filament pointed ends, as occurs in
erythrocytes.6,7 Instead, a substantial number of these ends exist
free or are capped by Arp2/3 in the resting platelet. Barbed-end
capping by adducin also serves the function of targeting barbed
ends to the spectrin-based membrane skeleton, because the affinity
of adducin-actin complexes for spectrin is greater than that of either
actin or adducin alone.8,9 In addition, cortical actin filaments are
attached at multiple points along their lengths to the plasma
membrane in platelets by numerous Filamin A-GP1b␣ connections
(25 000/platelet). Whereas our view of the membrane skeleton in
resting platelets is coming into focus, little information is available
concerning when and where these membrane-cytoskeletal linkages
form during the megakaryocyte-platelet transition.
Blood platelets release from the ends of proplatelets, which are
long, pseudopodial extensions produced by megakaryocytes that
transverse through the bone marrow sinusoids into the blood.10
Proplatelet elaboration is preceded by a massive expansion of the
megakaryocyte cytoplasmic volume and an internal membrane
reservoir, originally called the demarcation membrane system
(DMS) and more recently the invaginated membrane system
(IMS). This reservoir supplies membrane for proplatelet formation,
a process driven by a dramatic reorganization of the megakaryocyte
cytoskeleton.11-13 Microtubules and actin filaments have different
roles in proplatelet production.14,15 Cortical microtubules line the
shafts of proplatelets and are slid by cytoplasmic dynein power
sources, thereby elongating the proplatelets.14,16 F-actin, present
throughout proplatelets, forms the assemblies required to bend and
bifurcate proplatelets to amplify proplatelet ends.14,16
Submitted January 13, 2011; accepted April 27, 2011. Prepublished online as
Blood First Edition paper, May 12, 2011; DOI 10.1182/blood-2011-01-330688.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
An Inside Blood analysis of this article appears at the front of this issue.
The online version of this article contains a data supplement.
BLOOD, 11 AUGUST 2011 䡠 VOLUME 118, NUMBER 6
© 2011 by The American Society of Hematology
1641
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1642
BLOOD, 11 AUGUST 2011 䡠 VOLUME 118, NUMBER 6
PATEL-HETT et al
Table 1. Quantitative RT-PCR primer sequences
Primer
Forward sequence
Reverse sequence
␣1 spectrin
AGAAATCCAACACCGAAGAGC
TCCAGGTCATCTGCGTCTCTC
␤1 spectrin
CATCAGCGACCTCTACAAGGA
GAGCCCATGTTTTCCAGGTG
␣2 spectrin
AGGGAGAACCTCCTAGAAGAGC
CTTCCCGGAACAACATGAACTT
␤2 spectrin
ACACAGGAGACAAGTTCCGCTTCT
TCAACAGATGACACATCCCGTGGT
GAPDH
AGGTCGGTGTGAACGGATTTG
TGTAGACCATGTAGTTGAGGTCA
The biogenesis and function of the spectrin cytoskeleton in
megakaryocyte maturation and proplatelet extension have not been
explored. In the present study, biochemical, morphological, and
disruptive approaches were used to understand the function of the
membrane skeleton in proplatelet and platelet formation. Our
objectives were to determine: (1) whether megakaryocytes have a
spectrin-based membrane cytoskeleton and, if so, when is it
assembled; (2) the spectrin composition of this membrane skeleton;
and (3) whether the spectrin cytoskeleton is required for proplatelet
formation and stability. We found that proplatelets have a spectrin
cytoskeleton similar in structure to that of the mature platelet. The
nonerythroid subunits ␣II and ␤II spectrin are predominately
expressed in mouse megakaryocytes, proplatelets, and platelets,
but erythroid ␣I and ␤I spectrin isoforms are also expressed. To
assess the importance of the spectrin-based membrane skeleton in
platelet biogenesis, we used a high-affinity spectrin-binding construct that disrupts spectrin tetramers. Our data indicate that the
formation of spectrin tetramers is critical to the formation of the
megakaryocyte IMS, proplatelet elaboration, and the proplatelet 3 preplatelet 3 platelet transition.
Methods
In vitro culture of MKs
Murine megakaryocytes (MKs) were harvested from the fetal livers of
mouse embryos at gestational day 13.5 and cultured in the presence of
thrombopoietin, as described previously.17,18 All animal experiments were
performed according to protocols approved by Children’s Hospital Institutional Animal Care and Use Committee.
Electron microscopy
Preparation of samples for electron microscopy and immunogold electron
microscopy was as described previously.3 Membrane skeletal pore sizes
were determined using ImageJ Version 1.37v software by manually
outlining the individual fibers composing the pores of the network and
measuring the areas inside the outlines. For immunoelectron microscopy,
coverslips were covered with 25␮L of primary antibodies (B13 anti–␤1
spectrin rabbit polyclonal antibody and 10D anti–␤2 rabbit polyclonal
antibody) at concentrations of 10 ␮g/mL, incubated for 3 hours at room
temperature, and washed 3 times in PBS with BSA. The IMS was quantified
within a selected region (143.28 ␮m2) by measuring the area of the electron
lucent zones corresponding to the IMS. The area was determined in pixels
using ImageJ software. In each experiment, a total of 10 megakaryocytes
each were analyzed for both control and ␣II spectrin (sp␣2N1)–treated
cells. Experiments were done in triplicate.
Western blot analysis
Purified murine fetal liver cells (FLCs; day 0), MKs (separated by BSA
gradient on days 2, 3, and 4), platelets, 3T3 fibroblasts, and erythrocyte
ghosts were prepared as described previously.19,20 Cells were lysed with
PHEM buffer (60mM PIPES, 25mM HEPES, 10mM EGTA, and 2mM
MgCl2) containing 0.1% Triton X-100 for total and cytoskeleton-associated
and soluble distribution of spectrin isoforms. Lysates, along with protein
ladder, were electrophoresed on 7.5% SDS-PAGE minigels (Lonza). Gels
were transferred to nitrocellulose membrane and blocked in TBS-T
(Tris-buffered saline with 0.2% Tween-20) with 1% BSA for 1 hour and
probed with antibody overnight at 4°C. Primary antibodies used included
G5183 anti–␣I spectrin, B13 anti–␤I spectrin, G5187 anti–sp␣2N1, and
10D anti–␤II spectrin, all rabbit polyclonal antibodies. Blots were washed
3 times in TBS-T and incubated in 1:5000 dilution of HRP-conjugated
secondary antibody for 30 minutes. Blots were washed again 3 times in
TBS-T and developed using SuperSignal ECL substrates (Pierce Biotechnology). For isolation of the cytoskeleton, FLCs, MKs, and platelets were
washed twice in PBS and cells were lysed with 0.1% Triton X-100 in
PHEM buffer containing 10␮M phallacidin. F-actin associated proteins
were collected by centrifugation at 100 000g for 30 minutes at 4°C. Triton
X-100–insoluble (pellet) and -soluble (supernatant) fractions were resolved
by SDS-PAGE.
Quantitative RT-PCR
Total RNA from MKs or platelets from 3 mice was pooled and extracted
using TRIzol reagent (Invitrogen). Residual DNA was removed by treatment with 1U DNAse I (Ambion) for 30 minutes at 37°C. RNA (0.5 ␮g)
was reverse-transcribed with SuperScript III (Invitrogen) using 500 ng of
random hexamers. Real-time PCR was performed using SYBR Green
Master Mix (Applied Biosystems) in a thermocycler workstation (ABI
Prism 9700 Sequence Detection System; Applied Biosystems). Primer
sequences are listed in Table 1. Each sample was run in duplicate and each
experiment included 2 nontemplate control wells. Results are expressed as
means ⫾ SD.
Immunofluorescence microscopy of proplatelets and platelets
Immunofluorescence of MKs or purified platelets was carried out using
methods described previously.21,22 For extraction of proplatelets, proplateletproducing MKs were centrifuged onto poly-L-lysine–coated coverslips.
Cells were treated with extraction buffer (PHEM buffer containing
0.1% Triton X-100, 2␮M phallacidin, 20␮M taxol, and protease inhibitors)
for 2 minutes. Cells were then washed with PHEM buffer containing
0.1␮M phallacidin and 20␮M taxol, and then fixed in PHEM buffer
containing 4% formaldehyde for 15 minutes. Cytoskeletons were washed
briefly in PHEM buffer, incubated in blocking buffer, and immunostained.
For antibody staining, cells were incubated in primary antibody diluted in
blocking buffer for 1.5 hours at room temperature or overnight at 4°C, then
washed in triplicate with PBS. Rabbit polyclonal anti-spectrin antibodies
were used at 1:100 dilutions. All immunofluorescence and electron
microscopy studies were evaluated by a blinded observer.
Expression of a dominant-negative spectrin construct in MKs
A cDNA encoding the NH2-terminal 145 amino acids of sp␣2N1 was
originally cloned into BamHI and EcoRI sites of the pWZL retroviral vector
containing sequences for green fluorescent protein (GFP) such that sp␣2N1
was cloned in-frame to the NH2 terminus of GFP. The construct was
subcloned into a modified pMSCV retroviral vector using SpeI and XhoI
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 11 AUGUST 2011 䡠 VOLUME 118, NUMBER 6
sites. This resultant vector, along with the same vector expressing GFP
alone, was used to generate retroviral supernatants. Cotransfection of the
retroviral plasmid with plasmids encoding gag-pol and VsvG into 50%
confluent 293T cells was performed through calcium phosphate or Fugene
6 (Roche Diagnostics). Six to 8 hours after transfection, the medium was
changed; 48-60 hours later, the supernatant was collected, passed through a
0.45-␮m syringe filter, aliquoted, and stored at ⫺80°C. MKs were infected
on day 1.5-2 of culture, as described previously.16 Infected MKs were
identified by fluorescence microscopy based on the expression of GFP. The
percentage of proplatelet-producing cells was measured by determining the
number of MKs that exhibited at least a single proplatelet (defined as a
pseudopodial extension with a teardrop-shaped tip extending from the MK
cell body) from the population of GFP-positive cells. A minimum of
50 cells were counted in each of 3 independent experiments. Statistical
analysis was done using a paired Student t test.
Thin-section electron microscopy
For correlative light and electron microscopy, we used coverslips with a
finder grating that can be recognized by both light and electron microscopy.
To prepare culture dishes for correlative microscopy, a circular 18-mm hole
was drilled in the bottom of a 35-mm plastic culture dish and a 22 ⫻ 22 mm
glass coverslip was mounted onto the bottom. The coverslip was previously
coated with gold through a locater grid (400 mesh; Ted Pella) to create a
visible pattern. After MKs were visualized by fluorescence and differential
interference contrast (DIC) microscopy, they were fixed with 1.5%
glutaraldehyde in 0.1M cacodylate buffer, pH 7.4, for 8 hours, and
processed for electron microscopy. Cells were examined with a Tecnai
G2 Spirit BioTWIN transmission electron microscope at an accelerating
voltage of 80 kV, and images were recorded with an AMT 2k CCD camera.
The internal reference marks on the coverslip facilitated relocalization of
the same cells that were visualized by fluorescence and DIC microscopy.
For immunogold electron microscopy of cryosections, MKs were processed, stained, and visualized as described previously.23
Introduction of sp␣2N1 and control peptides into permeabilized
proplatelets
Proplatelets were placed in video chambers formed by mounting a glass
coverslip coated with 3% BSA. Attached cells were washed with platelet
buffer, and then permeabilized using 0.1 vol of n-octyl-b-glucopyranoside
(OG; final concentration of 0.4%) in PEM buffer (60mM PIPES, 10mM
EGTA, and 2mM MgCl2). Cells were washed with PEM buffer and
incubated in PEM buffer containing either 10␮M GST-sp␣2N1 or a GST
control. Preparations were maintained at 37°C and examined on a Zeiss
Axiovert 200 inverted microscope equipped with a 63⫻ DIC objective
(numerical aperture, 1.4). Images were obtained using a Hamamatsu CCD
camera and frames were captured at 1-minute intervals. Videos were
generated using the Metamorph image analysis program (Universal Imaging Corporation, Molecular Devices). To generate the recombinant spectrin
fragment sp␣2N1, the cDNA encoding the N-terminal region of ␣2 spectrin
comprising residues 1-154 was expressed and purified as described
previously.24-26
Results
Structure of the proplatelet membrane skeleton and
identification of spectrin as its major component
We have previously reported on the structure of the membrane
skeleton of resting human platelets and how it is disassembled after
treatment with agonists.3,27,28 To study the development of the
membrane skeleton in MKs and proplatelets, in the present study,
we exposed the cells to detergents in a stabilization buffer
containing fixative. Figure 1 shows representative micrographs of
SPECTRIN MEMBRANE SKELETON IN PLATELET FORMATION
1643
Triton X-100–demembranated mouse proplatelets processed for
electron microscopy by rapid-freezing, freeze-drying, and metal
casting. Figure 1A-B shows that the proplatelet shafts and tips are
composed of dense fibrous cytoskeletal networks of ⬃100-nm ⫻ 510-nm strands. At high magnification and in stereo-paired images
(Figure 1C), the membrane skeleton appears as a flat network that
covers both the tops and bottoms of proplatelet shafts and ends.
Quantification of the lattice structure by morphometry shows its
pores to have average areas of 6033 ⫹ 2772 nm2 (n ⫽ 418 pores),
similar in size to those found in the human platelet membrane
skeleton and the mouse erythrocyte skeleton (supplemental Figure
1, available on the Blood Web site; see the supplemental Materials
link at the top of the online article).3
Elongated spectrin strands cross-linked by actin filaments form
the platelet and erythrocyte membrane skeleton. To begin to
understand the assembly of the membrane skeleton during megakaryocyte development and thrombopoiesis, we first examined
spectrin isotype expression in cultured MKs. Figure 2A depicts
immunoblots of MKs at different states of maturity (days in
culture) and platelets stained for erythroid (␣1 and ␤1) and
nonerythroid spectrin (␣2 and ␤2) isotypes. These cultures start
with FLCs containing both MK and erythroid lineages. By day 2,
the large size of maturing MKs allowed them to be enriched and
collected by centrifugation. Proplatelet formation, the next event of
consequence, began late on culture day 3. Figure 2A shows ␤2
spectrin to be highly expressed in MKs relative to the starting cell
population, a finding confirmed by real-time PCR (Figure 2C). ␣2
spectrin is also strongly expressed (Figure 2A,C), although much
of the native subunit was processed by proteolytic cleavage, as
reported previously in other cells.29,30 Neither nonerythroid spectrin isoform antibody reacted against erythrocyte ghost proteins,
indicating specificity for only the nonerythroid forms. Because
both platelets and erythrocytes derive from a common myeloid
progenitor cell, we also examined proplatelets and platelets for
expression of the erythroid ␣1 and ␤1 spectrins. Both were
abundantly expressed in the initial cell culture, but decreased
dramatically once MKs were separated and enriched, although
some expression of each remained as the megakaryocytes developed proplatelets and platelets. Both erythroid isoforms were also
found in mouse platelets. Furthermore, anti-␣1 immunoblots
detected a strong band in platelet and MK lysates from wild-type
mice that was not present in platelet lysates from mice that lacked
␣1 spectrin (supplemental Figure 2). These results indicate that
MKs, proplatelets, and platelets contain a combination of erythroid
and nonerythroid spectrins.
Spectrin isoforms have distinct distributions during platelet
formation
The erythroid and nonerythroid spectrins have different spatial
distributions within proplatelets (Figure 3). Both anti-␣2 and
anti-␤2 spectrin antibodies labeled proplatelets and proplatelet
cytoskeletons uniformly along their length, including shafts, swellings, and tips, but were excluded from F-actin–enriched protrusions such as filopods and blebs. F-actin was more enriched in
proplatelet swellings than in shafts. Anti-␣1 and ␤1 spectrin
antibodies, on the other hand, decorated proplatelets in a punctate,
speckled pattern, suggestive of vesicular structures (Figure 3A-D).
All spectrin isoform–specific antibodies also labeled mature platelets. ␣2 and ␤2 anti-spectrin antibodies labeled the platelet cortex
and the punctate structures inside them, as reported previously
(supplemental Figure 3).27 ␣1 and ␤1 spectrin labeling in platelets
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1644
PATEL-HETT et al
BLOOD, 11 AUGUST 2011 䡠 VOLUME 118, NUMBER 6
Figure 1. Structure of the proplatelet membrane skeleton.
(A-B) Representative electron micrographs of the detergentinsoluble proplatelet cytoskeleton. Proplatelets were permeabilized with 0.75% Triton X-100, 0.1% glutaraldehyde, and
5␮M phallacidin in PHEM buffer. Examination of the proplatelet
membrane skeleton through electron microscopy reveals an
intact membrane skeleton that laminates the underside and
extends along the entire length of proplatelets. Inset: DIC image
of murine proplatelets. Scale bar indicates 500 nm. (C) Highmagnification, 3D electron micrograph of the proplatelet membrane skeleton showing the lattice-like network of elongated
filamentous strands, which is similar in nature to the spectrinbased meshwork in erythrocytes and platelets. The membrane
skeleton continuously laminates the underside of the proplatelet.
A cytoplasmic bridge is shown (left) connecting to a swelling
(right). Scale bar indicates 200 nm.
was also punctate, as in proplatelets (supplemental Figure 3).
Therefore, erythroid and nonerythroid spectrins reside in different
spatial locations in proplatelets and platelets.
The spectrin isotype staining patterns observed by immunofluorescence microscopy were confirmed by immunogold electron
microscopy. Gold particles indicative of anti-␣2 and anti-␤2
spectrin antibodies preferentially decorate the most cortical regions
of MKs and proplatelets (Figure 4A,C) and the IMS (Figure 4B),
suggestive of a role for spectrin in organizing and remodeling the
IMS. Antibodies against ␣1 and ␤1 spectrin were found on internal
vesicular structures in MKs and proplatelets (Figure 4D-E).
Given the dynamics of proplatelets, we sought to investigate the
nature of the molecular linkages of proteins integrated into the
proplatelet membrane skeleton. We examined the localization and
distribution of spectrin isoforms between cytoskeletal and soluble
cellular fractions. Proplatelets attached to glass coverslips were
permeabilized with 0.1% Triton-X 100 to remove the plasma
membrane and membrane-bound organelles from the cells. The
proplatelets were then washed, fixed, and stained for immunofluorescence microscopy. All 4 spectrin isoforms were retained in the
cytoskeleton and localized as described above in fixed cells (Figure
3E-H). ␣1 and ␤1 spectrins had punctate appearances in detergentextracted cells (Figure 3G-H). In contrast, ␣2 and ␤2 spectrin
isoforms retained their uniform cytoskeletal distribution and colocalized with F-actin (Figure 3E-F). Biochemical evidence also
indicates that spectrin isoforms are associated with the cytoskeleton of MKs and platelets. When platelets and MKs permeabilized
with Triton X-100 were centrifuged at high centrifugal forces
(⬎ 100 000 g), proteins associated with F-actin pellet. As shown in
Figure 2B, all 4 spectrin isoforms sedimented in pellets in
detergent-lysed MKs and platelets. These results indicate that the
spectrin isoforms accumulating within proplatelets were stably
linked to the membrane skeleton.
To look further into the roles of the erythroid versus nonerythroid spectrins, we labeled proplatelet and platelet cytoskeletons with anti-␤ chain antibodies followed by immunogold
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 11 AUGUST 2011 䡠 VOLUME 118, NUMBER 6
SPECTRIN MEMBRANE SKELETON IN PLATELET FORMATION
1645
Figure 2. Spectrin isoforms in megakaryocytes and
platelets. (A) Immunoblot showing the presence of
erythroid and nonerythroid spectrin isoforms in MKs and
platelet lysates. Isoform-specific antibodies were used
to identify ␣1, ␤1, ␣2, and ␤2 spectrins in MKs at
different stages of maturation and in platelets (Plt).
Accordingly, ␣2 and ␤2 antibodies failed to recognize the
erythroid spectrin isoforms in lysates of erythrocyte
ghosts, whereas ␣1 and ␤1 antibodies identified the
erythroid spectrin isoforms in the erythrocyte ghosts.
Murine fibroblasts (3T3 Swiss) were used as a negative
control for ␣1 and ␤1 spectrins. GAPDH was used as a
loading control. Blots show anti-spectrin isoform labeling
during different days of megakaryocyte culture: FLCs
(day 0) and MKs at different stages: day 2, young MKs;
day 3, MKs just before producing proplatelets; day
4, MKs after producing proplatelets. (B) Immunoblot
analysis showing the distribution of spectrin isoforms in
the pelleted (P) actin cytoskeleton and soluble
(S) fractions of FLCs, MKs, and platelets. A higher
fraction of ␣II and ␤II spectrin isoforms associated with
the cytoskeletons in MKs just before making proplatelets
(day 3), compared with other MK stages. Western blots
from 3 different experiments were quantified by densitometry (supplemental Figure 6). (C) Quantitative PCR. The
relative mRNA expression (compared with GAPDH) of
spectrin isoforms in MKs determined by quantitative
RT-PCR. Nonerythroid spectrins (␣2 and ␤2 spectrins)
were expressed at higher levels than erythroid isoforms
(␣1 and ␤1 spectrins) in MKs.
electron microscopy. Anti-␤2 spectrin immunogold labeled the
strands composing the planar network component of the cytoskel-
eton of proplatelets (Figure 4F) and platelets (Figure 4H), although
anti-␤2 labeling of platelets was more robust than that found in
Figure 3. Localization of spectrin isoforms within proplatelets. Micrographs of immunofluorescence studies performed with spectrin antibodies reveal differential
localizations for spectrin isoforms within proplatelets. The top panels (A-D) show proplatelet-producing MKs that were fixed before staining. The bottom panels (E-H) denoted
“cytoskeleton,” show proplatelets permeabilized in 0.1% Triton-X 100 before fixation to remove soluble and membrane-associated structures. All micrographs are merged
images of cells that were double-labeled with spectrin isoform antibodies (green) and F-actin staining by phalloidin (red). The isotype probed and the fluorophore of the
secondary antibody are indicated in each panel. (A-D) ␣1 and ␤1 spectrins decorate punctate spots distributed throughout the proplatelets. ␣2 and ␤2 spectrins localized
strongly along proplatelet shafts, proplatelet tips, and swellings. Both ␣2 and ␤2 spectrin isoforms colocalized with F-actin. All 4 spectrin isoforms tested were retained in the
cytoskeleton of permeabilized cells (E-H) and displayed a similar localization pattern to nonextracted cells. Spectrin 1 isoforms stained in a punctate pattern throughout
the proplatelet skeleton, whereas spectrin 2 isoforms displayed a more cytoskeletal localization in permeabilized cells. Scale bar indicates 5 ␮m.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1646
PATEL-HETT et al
BLOOD, 11 AUGUST 2011 䡠 VOLUME 118, NUMBER 6
Figure 4. Localization of spectrin isoforms at high
resolution. (A-E) Localization of erythroid and nonerythroid spectrin isoforms in ultrathin sections of mouse
MKs. Immunogold labeling of sections was performed
with anti–␤2 spectrin (A,B), anti–␣2 spectrin (C), anti–␣1
spectrin (D), and anti–␤1 spectrin (E) antibodies. Gold
particles (10-nm) recognizing anti–␤2 spectrin (A-B) are
evident on the plasma membrane and invaginated
membranes of MKs. Gold particles recognizing anti–␣2
spectrin (C) are also found on MK membranes. Gold
particles recognizing anti–␣1 spectrin (D) and anti–␤1
spectrin (E) stained multivesicular bodies of MKs. Scale
bar represents 200 nm. (F-I) Localization of spectrin
isoforms in the detergent-insoluble cytoskeletons of
proplatelets and platelets. Immunoelectron microscopic
studies were used to localize individual spectrin isoforms in the membrane skeletons of proplatelets
(F-G) and platelets (H-I). Preparations were incubated
with affinity-purified anti-␤2 (F,H) and anti–␤1 spectrin
(G,I) antibodies, followed by 10-nm gold particles coated
with secondary antibodies. Scale bar shown in panel
I indicates 100 nm. Proplatelets labeled with anti–␤2
spectrin (F) and anti–␤1 spectrin (G) have similar staining patterns, labeling the strands composing the membrane skeleton. Human platelet cytoskeletons were
labeled with anti–␤2 spectrin (H) and anti–␤1 spectrin
(I). ␤2 spectrin gold labeling was increased, whereas ␤1
was decreased in the platelet cytoskeleton. The gold
particle density per square micrometer of cytoskeleton
preparation was 53 ⫾ 10 for anti–␤2 spectrin of proplatelets (F), 69 ⫾ 8 for anti–␤1 spectrin of proplatelets
(G) 232 ⫾ 25 for anti–␤2 spectrin of platelets (H), and
4 ⫾ 2 for anti–␤1 spectrin of platelets. Data are provided
as means ⫾ SE (n ⫽ 20). Experiments were carried out
in triplicate. Scale bar represents 100 nm.
proplatelets, suggesting increased expression and incorporation of
␤2 in the mature membrane skeleton of the platelet. Anti-␤1
immunogold also labeled along the fine strands that compose the
proplatelet membrane skeleton (Figure 4G), but did so considerably less well than anti-␤2 immunogold. In marked contrast to
␤2 labeling, ␤1 did not label the platelet cytoskeleton (Figure 4I),
which is indicative of a switch from ␤1 to ␤2 in the mature platelet.
Labeling was specific for anti-spectrin antibodies; removal of
anti-spectrin antibody during the labeling procedure resulted in the
absence of gold labeling of membrane skeletal components (data
not shown).
Proper assembly of the spectrin-based membrane skeleton is
required for proplatelet formation
Because spectrin is a prominent component of the proplatelet
membrane skeleton, we investigated whether it is required for
proplatelet elaboration from MKs. To disrupt spectrin function, we
expressed the dominant-negative construct sp␣2N1 in MKs. This
construct is composed of the NH2-terminal 154 residues of the ␣2
spectrin chain, and is known to exchange into the heterodimer
self-association site to dissociate tetramers into dimers in red blood
cell ghosts to markedly decrease the mechanical stability of the red
blood cell membrane.24-26 Sp␣2N1 was fused to GFP to facilitate its
identification in retrovirally infected megakaryocytes. GFPpositive cells were imaged using fluorescence optics, and the
number of MKs producing proplatelets was quantified and compared with cells expressing only the GFP tag. Most sp␣2N1-GFP–
expressing MKs failed to generate proplatelets (Figure 5A top), in
marked contrast to the GFP-expressing control cells, in which
proplatelet production was not impeded (Figure 5C). Rare proplatelets observed on the sp␣2N1-GFP–expressing cells were short and
poorly branched (compare Figure 5A and C). Quantification
revealed that only 8% of sp␣2N1-GFP–expressing MKs constructed proplatelets, compared with 44% in cells expressing GFP
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 11 AUGUST 2011 䡠 VOLUME 118, NUMBER 6
SPECTRIN MEMBRANE SKELETON IN PLATELET FORMATION
1647
Figure 5. Expression of sp␣2N1 inhibits proplatelet elaboration by MKs and prevents IMS maturation. (A) The introduction of sp␣2N1-GFP in MKs through retroviral
infection inhibited proplatelet formation. Most MKs expressing sp␣2N1-GFP failed to make proplatelets (A top panel), although a few developed primitive proplatelets (A bottom
panel). Left panels show phase contrast images and right panels show fluorescence images. (B) Control uninfected MKs, identified by lack of green fluorescence, form normal
proplatelets. (C) Fluorescence images of proplatelet formation by control MKs expressing GFP alone. Scale bars indicate 7.5 ␮m. (D) Quantitative analysis of proplatelet
formation in sp␣2N1-GFP–expressing and control, GFP-expressing MKs. sp␣2N1-GFP–expressing MKs show a dramatic reduction in the percentage of proplatelets formed
(8% compared with 44% in control cells). Bars represent the standard deviations. (E-G) Representative electron micrographs of a noninfected MK (E), a MK expressing GFP
alone (F), and a MK expressing sp␣2N1-GFP (G). Control MKs (E-F) show an extensive, open IMS that fills the cell cytoplasm, whereas sp␣2N1-GFP–expressing MKs
(G) do not. Insets show low-magnification views of the corresponding cells. Scale bars indicate 4␮m.
alone (Figure 5D). Infected cells increased in size and ploidy
during the culture period, excluding growth inhibition as a basis for
the arrested proplatelet development. These results indicate that
spectrin tetramer assembly is necessary for proplatelet formation.
Disruption of spectrin tetramers severely diminishes the
maturation of the IMS
To further explore how the disruption of spectrin tetramers affects
proplatelet production, sp␣2N1-GFP–expressing MKs were studied in the electron microscope. Uninfected MKs (Figure 5E) or
those expressing GFP alone (Figure 5F) developed an extensive,
open IMS that penetrated the entire cytoplasm. Although MKs
expressing sp␣2N1-GFP experienced cytoplasmic expansion and
contained normal numbers and distribution of granules, they
displayed a clear defect in the maturation of the IMS (Figure 5G).
These cells lacked the high degree of IMS invagination and
convolution found in control cells: 88% of the control cells
displayed a well-developed IMS, whereas only 3% of the cells
expressing sp␣2N1-GFP displayed an IMS. Image analysis was
used to measure the percent area of the IMS and to determine the
amount of internal membrane. The internal membranes were found
to be 3.8 times smaller by area in sp␣2N1-expressing cells
compared with control cells (supplemental Figure 4). These results
indicate that spectrin tetramer assembly is required to form a
normal IMS, a conclusion supported by our observation that
spectrin associates with the DMS.
Membrane skeletal integrity stabilizes proplatelet architecture
Because MK expression of sp␣2N1 prevented proplatelet elaboration, we were unable to study the role of the spectrin membrane
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1648
PATEL-HETT et al
BLOOD, 11 AUGUST 2011 䡠 VOLUME 118, NUMBER 6
Figure 6. Effect of sp␣2N1 on proplatelets. (A-B) Time-lapse
DIC micrographs of permeabilized (0.4% OG) proplatelets treated
with GST control polypeptide (left panels) and the spectrindisrupting polypeptide sp␣2N1 (right panels) show that proplatelets
treated with control GST maintain their “beads-on-a-string” structure and branches. In contrast, platelet-sized beads on proplatelets
treated with sp␣2N1 blebbed and then underwent extensive
swelling. After treatment with sp␣2N1, barbell-shaped proplatelets
first blebbed and then fused their 2-platelet-sized swellings, forming a preplatelet-sized spheroid. (C-D) Electron micrographs of
representative cytoskeletons from permeabilized proplatelets
treated with either GST-control (C) or sp␣2N1 peptide (D). Scale
bars indicate 5 ␮m. The cytoskeletons of GST-treated cells remain
intact, whereas the cytoskeletons of sp␣2N1-treated cells are
disrupted and aggregated.
skeleton in proplatelet morphogenesis. To circumvent this limitation,
MKs were treated with 0.4% of the detergent OG in PHEM buffer,
an approach that delivers the impermeant sp␣2N1 construct into
the cytoplasm.21 Treatment with 0.4% OG did not alter the general
shape and structure of proplatelets, but did generate small holes
20-100 nm in diameter at the edge of proplatelets (supplemental
Figure 5). Platelet-sized swellings, cytoplasmic bridges, and
branches were maintained for ⬎ 1 hour after OG treatments (data
not shown). Permeabilized proplatelets treated with a control GST
peptide maintained their overall structure, having clearly defined
swellings, bulbous tips, cytoplasmic bridges, and branches (Figure
6A left panel and supplemental Video 1). However, in 11 independent experiments, delivery of the sp␣2N1 peptide into proplatelets
grossly disrupted their morphology, initially causing blebs to
appear on the proplatelets, followed by a massive swelling of their
overall structure by ⬃ 18 minutes (Figure 6A right panel). Time-lapse
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 11 AUGUST 2011 䡠 VOLUME 118, NUMBER 6
video microscopy reveals the details of this disruptive process
(supplemental Video 2). Treatment of unpermeabilized proplatelets
with sp␣2N1 had no effect on proplatelet structure (data not
shown). Disruption of the membrane skeleton affected all stages of
proplatelet development, including the final step of platelet production, when preplatelets, anucleate discoid particles 3-10 ␮m in
diameter, convert to barbell-shaped structures that undergo fission
to generate 2 platelets.31 Figure 6B shows the effect of sp␣2N1 on
this process. Permeabilization alone or permeabilization plus
treatment with a control GST-tagged polypeptide did not alter the
barbell morphology (Figure 6B left panel and supplemental Video
3). After the addition of the sp␣2N1 peptide, blebs appeared at
multiple points, including the cytoplasmic bridge, before the
structure swelled into a spherical shape (Figure 6B right panel and
supplemental Video 4). The effect of OG and sp␣2N1 peptide
treatments on the cytoskeleton of proplatelets was further evaluated
by electron microscopy. Figure 6C shows that the cytoskeleton of
OG-permeabilized proplatelets remained intact when exposed to a
GST control peptide. However, sp␣2N1 exposure caused disruption and a massive aggregation of cytoskeletal elements (Figure
6D). Therefore, the spectrin-based membrane skeleton is crucial
for stabilizing the extended structure of proplatelets and for
preplatelet fission events.
Discussion
To assemble and release platelets, MKs follow a maturation
program that converts the bulk of their cytoplasm into multiple
long proplatelets. Central in this morphogenesis is the remodeling
and evagination of MK membranes to form large pseudopodia that
subsequently elongate, thin, bend, and branch. These proplatelet
extensions can detach from the MK body and generate platelet-size
particles at their ends that are linked by thin cytoplasmic bridges.
Remodeling of the microtubule and actin cytoskeletons drives
these shape changes. In the present study, we investigated the role
of the spectrin cytoskeleton in this morphogenetic process. We first
characterized the spectrin-based membrane skeleton of MKs and
proplatelets. Both erythroid and nonerythroid spectrin assembled
into a 2D lattice that underlay and stabilized the IMS in MKs, and
the MK and proplatelet plasma membranes. Second, we demonstrated that the spectrin membrane skeleton is critical in establishing and maintaining proplatelets during platelet biogenesis.
Both erythroid and nonerythroid spectrin isoforms accumulate
in MKs and platelets. To date, ␣1 spectrin has remained unique to
erythrocytes, whereas ␤1 spectrin variants have been found in
muscle and in certain subsets of neurons.32-34 ␣2 and ␤2 spectrins,
which are absent from the erythrocyte membrane skeleton, are the
major spectrin isoforms of nonerythroid cells and are abundantly
expressed in MKs and platelets.3 Maintenance of erythroid spectrins in MKs and platelets is therefore surprising. In erythrocytes,
the affinity of ␣1-␤1 tetramerization site confers a dynamic
element to the membrane skeleton, because membranes are subjected to shear forces in the blood. In contrast, the high affinity of
␣2-␤2 tetramerization in nonerythroid cells promotes stable complexes. It is tempting to speculate that the mixture of erythroid and
nonerythroid spectrins in MKs and proplatelets contributes to the
membrane elasticity required for proplatelet production.
The distinct localizations of the different spectrins within MKs
suggest unique roles in platelet formation. The erythroid isoforms
exhibit a more punctate localization in proplatelets and MKs,
SPECTRIN MEMBRANE SKELETON IN PLATELET FORMATION
1649
whereas the nonerythroid isoforms have a cytoskeletal localization
that is enriched with F-actin at the cell periphery. In immunoelectron studies, both erythroid (␤1) and nonerythroid (␤2) spectrin
antibodies colabeled the proplatelet membrane skeleton. ␤1 spectrin antibody labeling of the platelet membrane skeleton, however,
was reduced compared with proplatelets, whereas the labeling of
␤2 spectrin was robust. Given these results, we favor a model in
which both pairs of spectrin isoforms incorporate into the MK and
proplatelet membrane skeleton, resulting, at least temporally, in a
hybrid ␣1␤1-␣2␤2 spectrin skeleton. As the maturation process
continues, nonerythroid spectrin is likely to assume the dominant
role in stabilizing the plasma membrane of platelets. The reduction
of erythroid spectrin staining in mature platelets versus proplatelets
suggests that spectrin isoform interactions and dynamics are
important in forming platelets, but that once platelets are released,
nonerythroid spectrins are sufficient to maintain their structure in
circulation. In addition to the spectrin isoforms examined in these
studies, 3 other ␤ spectrin variants (␤III, ␤IV, and ␤V) have been
identified in mice and humans. Whether these isoforms are
expressed within MKs and platelets and their functions in these
cells remain to be determined.
Our data indicate that not only is spectrin expressed in
proplatelets, but its assembly into tetramers is also required for
proplatelet elaboration. Proplatelet production was markedly reduced when MKs expressed the dominant-negative spectrin peptide fused to GFP (sp␣2N1-GFP). sp␣2N1-GFP–expressing MKs
had ⬎ 5-fold fewer proplatelets compared with control cells, and
the few residual proplatelets found on these MKs were short and
unbranched. Sp␣2N1 consists of the N-terminal 154 amino acids of
␣2 spectrin, including the spectrin self-association domain.24,35
This region of ␣ spectrin generates the head-to-head interaction
between ␣␤ spectrin dimers that form tetramers.36 During tetramer
formation, the N-terminal end of ␣ spectrin forms a helix that
interacts with 2 helices from the C-terminus of ␤ spectrin, resulting
in a triple helix that links the dimers. The sp␣2N1-GFP polypeptide
binds to ␤ spectrin, preventing tetramer formation.
Proplatelet and therefore platelet formation is dependent on the
generation of a large membrane reservoir connected to the plasma
membrane (the IMS) in MKs.11 Despite the importance of the IMS
in MK development, very little is known about the mechanisms
that control its assembly and reorganization during platelet production. Initially, it was thought that the DMS defined platelet units
within the MK, which were released after a generalized fragmentation of MKs along DMS fracture lines. Recent studies, however,
indicate that this IMS is more likely a membrane reservoir that
regurgitates to cover the surface of the many proplatelets extended
by a single MK.12,13 Platelet formation was severely restricted in
MKs expressing sp␣2N1-GFP. Expression of sp␣2N1-GFP in MKs
blunted IMS development, suggesting that the membrane skeleton
is intimately involved in either the assembly or stabilization of this
extensive and highly dynamic membrane system. Therefore, disruption of spectrin tetramers results in an underdeveloped IMS with
insufficient membrane to form proplatelets. A link between an
underdeveloped IMS and platelet production has also been suggested in studies of the morphology of MKs from genetically
engineered mouse strains such as NF-E2–deficient, GATA1deficient, and GPIb␣-deficient mice.37-40
In addition to contributing to the formation and stabilization of
the IMS, the membrane skeleton acquires additional roles during
the later stages of thrombopoiesis. MKs and proplatelets have a 2D
membrane skeletal lattice composed of spectrin strands that
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1650
PATEL-HETT et al
BLOOD, 11 AUGUST 2011 䡠 VOLUME 118, NUMBER 6
Figure 7. Model of platelet production as suggested by present data and previous studies. As MKs transition from immature cells (A) to released platelets (D), a
systematic series of events occurs. (A) MKs develop a highly IMS as they mature. Assembly of the spectrin-based membrane skeleton is involved in the formation of the IMS,
providing a membrane reservoir for future formation of proplatelets. (B) Proplatelet production begins with the extension of large pseudopodia that use unique cortical bundles
of microtubules to elongate and form thin proplatelet processes with bulbous ends. Proplatelet membranes are lined with a spectrin undercoat. Proplatelet termini contain a
bundle of microtubules that loop on themselves. (C) Proplatelet elongation requires the sliding of microtubules past one another, driven by the molecular motor cytoplasmic
dynein. As proplatelets elongate, expansion of the membrane surface area requires the outflow of the IMS, a process that likely requires remodeling of the membrane skeleton.
Microtubules function as the highways on which mitochondria and granules traffic to the tips of proplatelets. Actin promotes the branching and amplification of proplatelet tips,
representing a mechanism to increase the numbers of proplatelet ends, and ultimately, platelets. (D) The entire MK cytoplasm is converted into a mass of proplatelets and
preplatelets (anucleate discoid particles 2-10 ␮m across), which are released from the cell. Preplatelets reversibly convert into barbell proplatelets, a process that is driven by
twisting microtubule-based forces. The membrane skeleton stabilizes this barbell form. Platelets release from proplatelet ends after the final fission event. The nucleus is
eventually extruded from the mass of proplatelets.
localizes just beneath the plasma membrane and appears to be
continuous from the MK cell body throughout the proplatelet
length.2,3 Proplatelet elongation from MKs occurs at a rate of
approximately 1␮m/min primarily using a cytoplasmic dyneindriven microtubule-sliding mechanism.41 Given this speed of
elongation and the finding that the membrane skeleton is intact
along proplatelets, we favor a model that first coats the IMS
membranes and then flows outward as the proplatelets extend. To
assess spectrin function in proplatelets, we treated OGpermeabilized proplatelets with sp␣2N1, which resulted in rapid
and striking blebbing, followed by swelling and rounding of
proplatelet processes. It has been demonstrated previously that this
fragment of ␣2 spectrin interacts with ␣1␤1 heterodimers with
high affinity, disrupting tetramerization and destabilizing the
erythrocyte membrane.24,25 Whether this disruptive interaction
occurs only with the erythroid spectrins in platelets, or if it also
occurs with the nonerythroid spectrins, remains to be determined.
Our findings also suggest an essential function for spectrin in
the final stages of platelet production.31 We recently identified a
new intermediate stage in platelet production called the preplatelet.
Preplatelets, which are abundantly present in megakaryocyte
cultures, are anucleate discoid particles 3-10 ␮m across that
convert reversibly into barbell structures by twisting, microtubulebased forces. Barbell proplatelets undergo fission to release 2 or
more individual platelets from their ends. The addition of sp␣2N1
to permeabilized barbell-shaped proplatelets converts them into
spheres, suggesting that the spectrin undercoat stabilizes the
cytoplasmic bridge between 2 platelet-sized ends.
In conclusion, our analysis now allows us to incorporate all
3 cytoskeletal systems into a model for platelet formation (Figure
7). Our collective findings bring forth a new role for spectrin in
thrombopoiesis. We found a continuous and homogeneous, spectrinbased membrane skeleton spanning from the MK cell body to the
nascent platelets assembled within proplatelet tips. Our data also
strongly suggest that spectrin assembly is a critical factor in platelet
formation, most likely due to the association, reorganization, and
stabilization of IMS membranes fated for proplatelets. Although
these findings address certain questions regarding the role of
spectrin during platelet formation, they also lead to further inquiry,
including examination of the precise structure and function of
platelets in the face of spectrin defects and insufficiencies. Mutations in spectrins result in hemolytic anemias, including hereditary
spherocytosis, hereditary elliptocytosis, and hereditary pyropoikilocytosis.32,42 Defects in erythrocyte form and fragility are common
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 11 AUGUST 2011 䡠 VOLUME 118, NUMBER 6
SPECTRIN MEMBRANE SKELETON IN PLATELET FORMATION
to these hemolytic anemias. In mouse models of spectrin deficiencies, indications of effects that may be tied to abnormal platelet
function also exist, including stroke and thrombus formation.43,44
Careful examination of these events may lead to further insights
into spectrin function in platelets.
Acknowledgments
The authors thank Erik Hett for critical review of the manuscript,
Jon Morrow for spectrin antibodies, and Gretchen Jones and Jason
Barnett for help in designing the model of platelet production.
This study was supported by National Institutes of Health grant
HL068130 to J.E.I. and HL56949 to J.H.H. J.E.I. is an American
Society of Hematology Junior Scholar. N.J.W. was supported by
American Heart Association grant 0530073N and by the Midwest
Athletes Against Childhood Cancer (MACC) Fund.
1651
Authorship
Contribution: S.P.-H., H.W., A.J.B., and J.N.T. designed, performed, and analyzed experiments and results; E.C.A. designed
and performed experiments and assisted with manuscript preparation; N.J.W. assisted with experimental design, sample preparation,
and analysis; X.A. and N.M. provided reagents and assisted with
experimental design and interpretation; J.H.H. designed experiments, interpreted results, and assisted with manuscript preparation and
editing; and J.E.I. designed experiments, interpreted results, formulated
discussions, and assisted in manuscript preparation and editing.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: Joseph E. Italiano, Jr, Hematology Division,
Brigham & Women’s Hospital, 1 Blackfan Circle, Karp Bldg,
6th Fl, Rm 214, Boston, MA 02115; e-mail: [email protected].
harvard.edu.
References
1. Fox J, Boyles J, Berndt M, Steffen P, Anderson L.
Identification of a membrane skeleton in platelets.
J Cell Biol. 1988;106(5):1525-1538.
Blood platelets are assembled principally at the
ends of proplatelet processes produced by differentiated megakaryocytes. J Cell Biol. 1999;
147(6):1299-1312.
2. Fox J, Reynolds C, Morrow J, Phillips D. Spectrin
is associated with membrane-bound actin filaments in platelets and is hydrolyzed by the Ca2⫹dependent protease during platelet activation.
Blood. 1987;69(2):537-545.
15. Tablin F, Castro M, Leven R. Blood platelet formation in vitro. The role of the cytoskeleton in megakaryocyte fragmentation. J Cell Sci. 1990;97
(pt 1):59-70.
3. Hartwig J, DeSisto M. The cytoskeleton of the
resting human blood platelet: Structure of the
membrane skeleton and its attachment to actin
filaments. J Cell Biol. 1991;112(3):407-425.
16. Patel SR, Richardson JL, Schulze H, et al. Differential roles of microtubule assembly and sliding in
proplatelet formation by megakaryocytes. Blood.
2005;106(13):4076-4085.
4. Byers TJ, Branton D. Visualization of the protein
associations in the erythrocyte membrane skeleton. Proc Nat Acad Sci U S A. 1985;82(18):
6153-6157.
17. Shivdasani RA and Schulze H. Culture, expansion, and differentiation of murine megakaryocytes. Curr Protoc Immunol. 2005;chapter 22:
unit 22F.6.
5. Fox J, Aggerbeck L, Berndt M. Structure of the
glycoprotein Ib-IX complex from platelet membranes. J Biol Chem. 1988;263(10):4882-4890.
18. Lecine P, Villeval JL, Vyas P, Swencki B, Xu Y,
Shivdasani RA. Mice lacking transcription factor
NF-E2 provide in vivo validation of the proplatelet
model of thrombocytopoiesis and show a platelet
production defect that is intrinsic to megakaryocytes. Blood. 1998;92(5):1608-1616.
6. Fowler VM. Tropomodulin: a cytoskeletal protein
that binds to the end of erythrocyte tropomyosin
and inhibits tropomyosin binding to actin. J Cell
Biol. 1990;111(2):471-482.
7. Fowler VM. Regulation of actin filament length in
erythrocytes and striated muscle. Curr Opin Cell
Biol. 1996;8(1):86-96.
8. Barkalow KL, Italiano JE, Jr., Chou DE, Matsuoka
Y, Bennett V, Hartwig JH. Alpha-adducin dissociates from F-actin and spectrin during platelet activation. J Cell Biol. 2003;161(3):557-570.
9. Gilligan DM, Sarid R, Weese J. Adducin in platelets: activation-induced phosphorylation by PKC
and proteolysis by calpain. Blood. 2002;99(7):
2418-2426.
10. Becker RP, DeBruyn PP. The transmural passage
of blood cells into myeloid sinusoids and the entry
of platelets into the sinusoidal circulation: a scanning electron microscopic investigation. Am J
Anat. 1976;145(2):183-205.
11. Mahaut-Smith MP, Thomas D, Higham AB, et al.
Properties of the demarcation membrane system
in living rat megakaryocytes. Biophys J. 2003;
84(4):2646-2654.
12. Radley JM, Haller CJ. The demarcation membrane system of the megakaryocyte: a misnomer? Blood. 1982;60(1):213-219.
13. Schulze H, Korpal M, Hurov J, et al. Characterization of the megakaryocyte demarcation membrane system and its role in thrombopoiesis.
Blood. 2006;107(10):3868-3875.
14. Italiano JE Jr, Lecine P, Shivdasani RA, Hartwig JH.
19. Lecine P, Italiano JE Jr, Kim SW, Villeval JL,
Shivdasani RA. Hematopoietic-specific B1 tubulin
participates in a pathway of platelet biogenesis
dependent on the transcription factor NF-E2.
Blood. 2000;96(4):1366-1373.
20. Schwer HD, Lecine P, Tiwari S, Italiano JE Jr,
Hartwig JH, Shivdasani RA. A lineage-restricted
and divergent b tubulin isoform is essential for the
biogenesis, structure and function of mammalian
blood platelets. Curr Biol. 2001;11(8):579-586.
21. Hartwig J, Bokoch G, Carpenter C, et al. Thrombin receptor ligation and activated Rac uncap actin filament barbed ends through phosphoinositide synthesis in permeabilized human platelets.
Cell. 1995;82(4):643-653.
22. Patel-Hett S, Richardson JL, Schulze H, et al.
Visualization of microtubule growth in living platelets reveals a dynamic marginal band with multiple microtubules. Blood. 2008;111(9):46054616.
23. Italiano JE, Jr., Richardson JL, Patel-Hett S, et al.
Angiogenesis is regulated by a novel mechanism:
pro- and antiangiogenic proteins are organized
into separate platelet alpha granules and differentially released. Blood. 2008;111(3):1227-1233.
24. An X, Lecomte MC, Chasis JA, Mohandas N,
Gratzer W. Shear-response of the spectrin dimertetramer equilibrium in the red blood cell membrane. J Biol Chem. 2002;277(35):31796-31800.
25. Bignone PA, Baines AJ. Spectrin alpha II and
beta II isoforms interact with high affinity at the
tetramerization site. Biochem J. 2003;374(pt 3):
613-624.
26. Salomao M, An X, Guo X, Gratzer WB, Mohandas N,
Baines AJ. Mammalian alpha I-spectrin is a neofunctionalized polypeptide adapted to small
highly deformable erythrocytes. Proc Natl Acad
Sci U S A. 2006;103(3):643-648.
27. Barkalow K, Italiano Jr J, Matsuoka Y, Bennett V,
Hartwig J. a-Adducin dissociates from F-actin filaments and spectrin during platelet activation.
J Cell Biol. 2003;161(3):557-570.
28. Hartwig J. An ultrastructural approach to understanding the cytoskeleton. In: Carraway K, Carraway C, eds. The Cytoskeleton: A Practical Approach. Oxford, UK: Oxford University Press;
1992:23-45.
29. Glantz SB, Cianci CD, Iyer R, Pradhan D, Wang KK,
Morrow JS. Sequential degradation of alphaII and
betaII spectrin by calpain in glutamate or maitotoxin-stimulated cells. Biochemistry. 2007;
46(2):502-513.
30. Huh GY, Glantz SB, Je S, Morrow JS, Kim JH.
Calpain proteolysis of alpha II-spectrin in the normal adult human brain. Neurosci Lett. 2001;
316(1):41-44.
31. Thon JN, Montalvo A, Patel-Hett S, et al. Cytoskeletal mechanics of proplatelet maturation and
platelet release. J Cell Biol. 2010;191(4):861-874.
32. Bennett V, Baines AJ. Spectrin and ankyrin-based
pathways: metazoan inventions for integrating
cells into tissues. Physiol Rev. 2001;81(3):13531392.
33. Morrow JS. Spectrins. In: Kreis T, Vale R, eds.
Guidebook to the cytoskeletal and motor proteins.
Oxford: Oxford University Press; 1999:138-140.
34. Blikstad I, Nelson WJ, Moon RT, Lazarides E.
Synthesis and assembly of spectrin during avian
erythropoiesis: stoichiometric assembly but unequal synthesis of alpha and beta spectrin. Cell.
1983;32(4):1081-1091.
35. Nicolas G, Pedroni S, Fournier C, et al. Spectrin
self-association site: characterization and study
of beta-spectrin mutations associated with hereditary elliptocytosis. Biochem J. 1998;332
(pt 1):81-89.
36. Speicher D, Weglarz L, DeSilvia T. Properties of
human red cell spectrin heterodimer (side-toside) assembly and identification of an essential
nucleation site. J Biol Chem. 1992;267(21):
14775-14782.
37. Poujol C, Ware J, Nieswandt B, Nurden AT,
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1652
BLOOD, 11 AUGUST 2011 䡠 VOLUME 118, NUMBER 6
PATEL-HETT et al
Nurden P. Absence of GPIbalpha is responsible
for aberrant membrane development during
megakaryocyte maturation: ultrastructural study
using a transgenic model. Exp Hematol. 2002;
30(4):352-360.
38. Shivdasani RA, Fujiwara Y, McDevitt MA, Orkin SH.
A lineage-selective knockout establishes the critical role of transcription factor GATA-1 in megakaryocyte growth and platelet development.
EMBO J. 1997;16(13):3965-3973.
39. Shivdasani RA, Rosenblatt MF, Zucker-Franklin D,
et al. Transcription factor NF-E2 is required for
platelet formation independent of the actions of
thrombopoietin/MGDF in megakaryocyte development. Cell. 1995;81(5):695-704.
40. Ware J, Russell S, Ruggeri Z. Generation and
rescue of a murine model of platelet dysfunction:
the Bernard-Soulier syndrome. Proc Natl Acad
Sci U S A. 2000;97(6):2803-2808.
41. Patel S, Richardson J, Schulze H, et al. Differential roles of microtubule assembly and sliding in
proplatelet formation by megakaryocytes. Blood.
2005;106(13):4076-4085.
42. Bennett V, Healy J. Organizing the fluid membrane bilayer: diseases linked to spectrin
and ankyrin. Trends Mol Med. 2008;14(1):
28-36.
43. Kaysser TM, Wandersee NJ, Bronson RT,
Barker JE. Thrombosis and secondary hemochromatosis play major roles in the pathogenesis
of jaundiced and spherocytic mice, murine models for hereditary spherocytosis. Blood. 1997;
90(11):4610-4619.
44. Wandersee NJ, Lee JC, Kaysser TM, Bronson RT,
Barker JE. Hematopoietic cells from spectrindeficient mice are sufficient to induce thrombotic
events in hematopoietically ablated recipients.
Blood. 1998;92(12):4856-4863.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2011 118: 1641-1652
doi:10.1182/blood-2011-01-330688 originally published
online May 12, 2011
The spectrin-based membrane skeleton stabilizes mouse
megakaryocyte membrane systems and is essential for proplatelet and
platelet formation
Sunita Patel-Hett, Hongbei Wang, Antonija J. Begonja, Jonathan N. Thon, Eva C. Alden, Nancy J.
Wandersee, Xiuli An, Narla Mohandas, John H. Hartwig and Joseph E. Italiano, Jr
Updated information and services can be found at:
http://www.bloodjournal.org/content/118/6/1641.full.html
Articles on similar topics can be found in the following Blood collections
Platelets and Thrombopoiesis (732 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.