413
Development 127, 413-424 (2000)
Printed in Great Britain © The Company of Biologists Limited 2000
DEV1499
Lbx1 is required for muscle precursor migration along a lateral pathway into
the limb
Michael K. Gross1,*, Laura Moran-Rivard2,*, Tomoko Velasquez1, Martin N. Nakatsu1, Krzysztof Jagla3
and Martyn Goulding2,‡
1Molecular Neurobiology Laboratory, The Salk Institute, 10010 North Torrey Pines Rd, La Jolla,
2Biology Graduate Program, University of California, San Diego, La Jolla, CA 92093, USA
3INSERM U. 384, 63001 Clermont-Ferrand, France
CA 92037, USA
*These two authors contributed equally to this work
‡Author for correspondence (e-mail: [email protected])
Accepted 5 November; published on WWW 20 December 1999
SUMMARY
In mammalian embryos, myogenic precursor cells emigrate
from the ventral lip of the dermomyotome and colonize the
limbs, tongue and diaphragm where they differentiate and
form skeletal muscle. Previous studies have shown that
Pax3, together with the c-Met receptor tyrosine kinase and
its ligand Scatter Factor (SF) are necessary for the
migration of hypaxial muscle precursors in mice. Lbx1 and
Pax3 are co-expressed in all migrating hypaxial muscle
precursors, raising the possibility that Lbx1 regulates their
migration. To examine the function of Lbx1 in muscle
development, we inactivated the Lbx1 gene by homologous
recombination. Mice lacking Lbx1 exhibit an extensive loss
of limb muscles, although some forelimb and hindlimb
muscles are still present. The pattern of muscle loss suggests
that Lbx1 is not required for the specification of particular
limb muscles, and the muscle defects that occur in Lbx1−/−−
mice can be solely attributed to changes in muscle precursor
migration. c-Met is expressed in Lbx1 mutant mice and
limb muscle precursors delaminate from the ventral
dermomyotome but fail to migrate laterally into the limb.
Muscle precursors still migrate ventrally and give rise to
tongue, diaphragm and some limb muscles, demonstrating
Lbx1 is necessary for the lateral, but not ventral, migration
of hypaxial muscle precursors. These results suggest that
Lbx1 regulates responsiveness to a lateral migration signal
which emanates from the developing limb.
INTRODUCTION
1997). The precursors for hypaxial muscles exhibit markedly
different morphogenetic behaviours at different axial levels of
the embryo. Cells in the ventral dermomyotome at limb and
cervical levels delaminate (Chevallier et al., 1977; Christ et al.,
1977; Christ and Ordahl, 1995; Mackenzie et al., 1998) and
undergo long range migration to form diaphragm, tongue
muscles and appendicular muscles. In contrast, hypaxial muscle
precursors at interlimb levels do not migrate. Instead, they retain
their epithelial morphology, forming a bud that extends ventrally
toward the midline to give rise to ventral body wall muscles
(Parry, 1982; Christ et al., 1983).
A number of genes that control the development and migration
of hypaxial muscles have been identified. Among these are the
paired domain transcription factor Pax3, which is expressed
throughout the dermomyotome, and c-Met, which is expressed
in delaminating hypaxial muscle precursors (Bober et al., 1994;
Goulding et al., 1994; Williams and Ordahl, 1994). Analysis of
Splotch (Sp, Pax3−) mutants shows Pax3 is required for the
normal development of all hypaxial muscles. Appendicular,
tongue and diaphragm muscles are missing from homozygous Sp
embryos, while the ventral body wall muscles are greatly reduced
in size (Franz et al., 1993; Tajbakhsh et al., 1997). The loss of
The somitic mesoderm gives rise to multiple tissues in the
developing embryo including bone, connective tissue and
muscle. Somites form as an epithelial ball of cells that later
segregate into sclerotome and dermomyotome in response to
patterning signals that arise from adjacent tissues (Dietrich et al.,
1993; Pourquie et al., 1993; Goulding et al., 1994; Fan and
Tessier-Lavigne, 1994; Munsterberg and Lassar, 1995). Cells in
the ventral half of the nascent somite undergo a transition from
epithelium to mesenchyme, forming the sclerotome, that
differentiates further to give rise to the axial skeleton. Cells in
the dorsolateral half of the somite retain their epithelial
morphology, forming the dermomyotome, which contains
precursors for both the dermis and for skeletal muscles.
Dermomyotome derived muscle precursors not only generate the
epaxial muscles that attach to the vertebral column, but also the
hypaxial musculature of the limb, tongue, diaphragm and ventral
body wall (Christ and Ordahl, 1995). Whereas the epaxial
muscles arise from cells in the medial dermomyotome, hypaxial
muscles are derived from precursors in the lateral half of the
dermomyotome (Ordahl and Le Douarin, 1992; Denetclaw et al.,
Key words: Lbx1, Pax3, Hypaxial muscles, Cell migration, Mouse
414
M. K. Gross and others
appendicular muscles in Pax3 mutant embryos is primarily due
to a failure of muscle precursors to migrate into the limb (Daston
et al., 1996). However, Pax3 also regulates muscle cell
differentiation (Maroto et al., 1997; Tajbakhsh et al., 1997) and
the dysgenesis of all hypaxial muscles in Sp embryos, including
those that do not migrate, suggests Pax3 may also be required for
the differentiation or survival of hypaxial muscle precursors. The
c-Met receptor tyrosine kinase is also expressed in migratory
muscle precursors, and mice lacking c-Met exhibit a muscle
phenotype that is similar to the Sp muscle phenotype, except that
the ventral body wall muscles are still present (Bladt et al., 1995).
c-Met is expressed in the ventral lip of the dermomyotome as
muscle precursors are delaminating (Daston et al., 1996; Bladt et
al., 1995). In c-Met mutant mice, muscle precursors fail to
delaminate, and the dermomyotomes remain elongated at limb
levels (Dietrich et al., 1999). A similar phenotype is also seen in
mice lacking Scatter Factor (SF), the ligand for c-Met (Bladt et
al., 1995; Dietrich et al., 1999). Thus, c-Met activation is
necessary for cells in the ventrolateral dermomyotome to undergo
an epithelial to mesenchymal transition prior to migration.
Pax3 and c-Met are also expressed in non-migratory
populations of dermomyotomal cells. Pax3 is expressed
throughout the dermomyotome (Goulding et al., 1994; Daston et
al., 1996), while c-Met is expressed in the ventral dermomyotome
at interlimb levels and in cells located at the dorsal tips of the
dermomyotome (Yang et al., 1996). Consequently, factors other
than Pax3 and c-Met must specify and control the migratory
behaviour of hypaxial muscle precursors. The Lbx1 gene is a
candidate for regulating the migratory behaviour of these cells.
Lbx1 encodes a homeodomain transcription factor that is
expressed specifically in hypaxial muscle precursors that are
destined to migrate from the ventrolateral dermomyotome at
limb, cervical and occipital levels (Jagla et al., 1995).
Subsequently, cells expressing Lbx1 leave the ventrolateral
dermomyotomes and migrate into the limb buds and diaphragm
at lower cervical and limb levels, and toward the pharynx at
occipital levels (Mennerich et al., 1998; Dietrich et al., 1999).
Thus, expression of Lbx1 is restricted to hypaxial muscle
precursors that undergo long range cell migration. In addition,
Lbx1 is not expressed in the dermomyotome in Sp embryos,
demonstrating Lbx1 lies downstream of Pax3 and may therefore
contribute to the loss of hypaxial muscles that occurs in Sp
embryos (Mennerich et al., 1998; Dietrich et al., 1999; L. M. and
M. G., unpublished results).
In this study, we show that Pax3 and Lbx1 are coexpressed in
all migrating hypaxial muscle precursors. We have examined the
function of Lbx1 in hypaxial muscle precursors by inactivating
the Lbx1 gene in mice. Homozygous Lbx1−/− mice lack most
appendicular muscles; however, six forelimb flexors and two
hindlimb extensors are still present in mutant newborns. In
addition, diaphragm and tongue muscles still form,
demonstrating Lbx1 is required only for limb muscle
development. The extensive loss of limb muscles in Lbx1−/− mice
results from a cell migration defect. This defect is not due to the
premature differentiation of limb muscle precursors or impaired
cell motility. Rather, the observed changes in cell migration
demonstrate that Lbx1 is required for muscle precursors to
migrate laterally into the limbs. As a result, misplaced muscle
precursors are found at the posterior-ventral and dorsal margins
of the forelimbs and hindlimbs, respectively, thereby generating
the residual hypaxial muscles that are present in Lbx1−/− mice.
MATERIALS AND METHODS
Generation of knock-in mice
The Lbx1 targeting vector was assembled using the pKSloxPNT vector
(provided by A. Joyner) that contains HSV TK and lox-P flanked
Neomycin gene cassettes in a Bluescript KS backbone. Genomic
sequences encompassing the mouse Lbx1 gene were isolated from a
129SV genomic phage library. The coding region of EGFP was cloned
in frame into a NotI site at aa 62 of the mouse Lbx1 protein. A 4.1 kb
XhoI fragment containing EGFP-pA (upstream arm) and a 3.6 kb NotI
fragment (downstream arm) were cloned seperately into pKSloxPNT
to generate the Lbx1 targeting vector. A frameshift in the Lbx1
homeobox was created by filling in the BglII site in exon 2 of the
downstream arm prior to its insertion into the targeting vector.
W9.5 embryonic stem cells were maintained on primary fibroblast
feeder layers supplemented with LIF. 2×107 ES cells were
electroporated with 25 µg of the Lbx1 targeting vector after
linearization with SalI. Fifty clones were screened by Southern
analysis using an upstream external probe (Fig. 1). Two clones with a
recombined Lbx1 allele were identified by Southern analysis and by
PCR analysis using primers for Neo and the Lbx1-EGFP boundary.
Both clones were injected into C57Bl6 blastocysts to generate
chimeras. Germline founders and F1 generations were generated on a
C57Bl6 background. Mice and embryos were genotyped by PCR using
tail or visceral yolk sac DNA. Primers MKG396 (CAGCTGCAGAAGCCAGGACTG; 12 ng/µl), MKG321 (CCGGACACGCTGAACTTGTGG; 12 ng/µl), and MKG333 (ATGACTTCCAAGGAGGACGGCA; 24 ng/µl) were used in a 25 µl reaction containing Taq
buffer (1.6 mM MgCl2, 0.2 mM dNTPs, 10% DMSO) and 1.25 Units
Taq polymerase (Perkin-Elmer). Amplification of mutant and wildtype Lbx1 alleles generated diagnostic bands of 315 and 445 bp,
respectively.
Generation of antibodies to Pax3 and Lbx1
Rat anti-Pax3 and rabbit anti-Lbx1 antibodies were generated against
bacterial fusion proteins containing 122 aa of the Pax3 C terminus and
120 aa of the mouse Lbx1 protein that includes the homeodomain,
respectively. A 365 bp PvuII fragment from the mouse Pax3 C terminus
was inserted into SmaI/XhoI fill in vector pGEX4T-2 to generate
GST/Pax3(CT). A fragment encoding His6-Pax3(CT) was inserted
into the NheI/B cut vector pET11d. A BglII-EarI fragment from exon2
of the downstream mouse genomic clone was inserted into the BglIIEarI sites of the human LBX1 cDNA to create BS-Lbx1(C-mm). An
Ecl136II/Xho fragment of BS-Lbx1(C-mm) was inserted into the
SmaI/XhoI cut vector pGex4T2 to generate GST/Lbx(I120). Soluble
GST fusion proteins were purified from BL21(DE3) bacteria according
to standard methods (Pharmacia). GST/Pax3(CT) was also further
purified from SDS-polyacrylamide gels using UV shadowing and
elutrap (Schleicher and Schuell) elution. H6/Pax3(CT) was purified
from BL21(DE3)plysS bacteria using a denaturing urea procedure
(Qiagen) and was column renatured prior to elution with an imidazole
gradient. Rats (anti-Pax3) were injected and boosted twice with SDStreated GST-Pax3, boosted once with soluble GST/Pax3(CT) and
boosted twice with soluble H6/Pax3(CT). Rabbits (anti-Lbx) were
injected and boosted three times with soluble GST-fusion protein.
High titre sera were pooled and used for affinity purification. Soluble
GST-Pax3(CT) and GST-LbxI120 were coupled to a 1:1 mixture of
Affigel 10 and 15 according to manufacturer’s instructions (Biorad).
Antibody was affinity purified according to the method of Harlow and
Lane (1988), concentrated by ultrafiltration, adjusted to 10% glycerol
and 1 mg/ml BSA then pre-absorbed with GST-whole cell extract
beads, which were generated by coupling whole bacterial extracts of
GST overproducing bacteria (Pharmacia) to Affigel 10 and 15.
Antibody staining
Embryos were rinsed for 1-5 hours in PBS (4°C), fixed for 1 hour in
4% paraformaldehyde (4°C), and then rinsed overnight in PBS before
Lbx1 controls limb muscle precursor migration
being equilibrated in 25-30% sucrose (4°C) prior to embedding in
OCT (Tissue-Tek). Cryostat sections (12-20 µm) were dried and
treated as follows: PBS at room temperature (RT), 3× 5 minutes;
methanol (−20°C), 5 minutes; air dry; 3SB (PBS, 0.3% BM blocker
(Boehringer Mannheim) heat inactivated sera: 5% fetal calf, 5% goat,
1% chick) with 0.2% Triton X-100, 1 hour; primary antibody (rabbit
anti-EGFP and rabbit anti-MyoD (Santa Cruz Biotechnology), mouse
anti-Pax7 and mouse anti-Myogenin (Developmental Studies
Hybridoma Bank) in 3SB/0.1-0.2% Triton X-100, overnight (4°C);
PBST (PBS, 0.1% Tween 20), 3× 10 minutes (RT); secondary
antibodies (Cy2-donkey anti-rat and Cy3-goat anti-rabbit (Jackson
Laboratories), biotinylated goat anti-mouse (Vector Laboratories) in
3SB/0.1-0.2% triton, 2-3 hours (RT); PBST, 3× 10 minutes (RT);
streptavidin-Cy5 (Jackson Laboratories) in PBST, 1-2 hours (RT);
PBST, 3× 10 minutes (RT). Sections were dehydrated in an
ethanol/xylene series before mounting with DPX (BDH). Images were
recorded as three single tracks (red, blue, green) using a Zeiss LSM
510 laser scanning microscope. All figures were assembled using
Adobe Photoshop.
415
At forelimb levels in E9.5-E10 embryos, Lbx1 staining was
observed in the ventral lip of the dermomyotome, in cells that
are delaminating (Fig. 1A). Large numbers of Pax3+/Lbx1+
cells were scattered throughout the proximal region of the limb,
confirming that Lbx1 is expressed in presumptive migrating
limb muscle precursors (Fig. 1B). All Lbx1+ muscle precursors
coexpressed Pax3 and all migratory Pax3+ cells expressed
Lbx1. Pax3+/Lbx1+ cells were seen in both the ventral and
dorsal muscle masses of the limb (Fig. 1B). Complete coexpression of Lbx1 and Pax3 was also seen in hypaxial muscle
precursors that migrate ventrally into the diaphragm and
tongue (Fig. 7, data not shown). Thus, co-expression of Pax3
and Lbx1 was observed in all migrating muscle precursors.
Myogenin expression was examined in sections through
the forelimb that had been stained with antibodies to Pax3
and Lbx1 to determine at the cellular level whether limb
myoblasts express Lbx1 and Pax3. Although Myogenin+
Histological and anatomical analysis of
newborn mice
Fixed newborns were dissected and muscle connections
to bones were traced to identify muscles according to
Gilbert (1968) and Gray’s Anatomy (Williams et al.,
1989). For histology, newborn pups were killed and cut
open along the abdominal midline and fixed for at least
2 days in 4% paraformaldehyde prior to dehydration in
an ethanol series (8-12 hours each step). Embryos were
transfered to Histoclear (8-12 hours) and then paraffin (2
hours and 12 hours) prior to embedding. 6 µm sections
collected at regular intervals were stained with
hematoxylin and eosin prior to mounting.
RESULTS
Lbx1 and Pax3 are coexpressed in all
migrating limb muscle precursors
Previous RNA in situ analyses of Lbx1 expression
during embryogenesis show Lbx1 is expressed in
the ventral dermomyotome at cervical and limb
levels in presumptive migratory muscle precursors
and later in the tongue, diaphragm and limbs (Jagla
et al., 1995; Mennerich et al., 1998; Dietrich et al.,
1998; 1999). However, from these studies it was not
clear whether Lbx1 and Pax3 marked different or
identical populations of migrating limb muscle
precursors, or if Lbx1 was expressed in all
migrating muscle precursors. It was also not known
if Lbx1 and Pax3 were coexpressed with muscle
regulatory factors (MRFs) in differentiating muscle
precursors, which would suggest a potential role
in the differentiation or patterning of hypaxial
muscles. Antibodies against mouse Pax3 and Lbx1
were therefore generated and used to analyze the
expression of both proteins in developing embryos.
The Pax3 antibody detected Pax3 expression in
the dorsal neural tube, dorsal root ganglia,
dermomyotome and in scattered cells in the limb,
diaphragm and hypoglossal cord. Specific Lbx1
antibody staining was present in the marginal zone
of the neural tube, as well as in migrating limb
muscle precursors.
Fig. 1. Expression of the Lbx1, Pax3 and Myogenin proteins in limb muscle
precursors. (A,B) Sections through the forelimbs of E9.5 (A) and E10 (B) wildtype embryos stained with antibodies to detect Lbx1 (red) and Pax3 (green). Lbx1expressing cells are seen delaminating from the dermomyotome (arrowhead) and
migrating muscle precursors coexpress Pax3 and Lbx1 (arrow). The forming dorsal
and ventral muscle masses can be seen in B. (C) Section through the forelimb of an
E10.5 embryo showing Pax3 (green), Lbx1 (red) and Myogenin (blue). Myogenin
(arrowhead) is only expressed in the epaxial dermomyotome (dm) but not in
Pax3+/Lbx1+ migrating limb muscle precursors (arrow). (D) Expression of Pax3
(green) and Myogenin (blue) in wild-type E11 limbs. While both genes are
expressed in overlapping domains in the limb, very few Pax3+ cells co-express
Myogenin. dm, dermomyotome; dmm, dorsal muscle mass; fl, forelimb; vmm,
ventral muscle mass.
416
M. K. Gross and others
cells were clearly present in the developing epaxial
dermomyotome (Fig. 1C,D) at E10.5, few Myogenin+ cells
were present in the limb, consistent with previous studies
showing that Myogenin expression in the limb begins at
E10.5 (Ott et al., 1991; Yee and Rigby, 1993). In E11
embryos, Myogenin+ cells were found interspersed with
Lbx1+/Pax3+ muscle precursors in both the dorsal and ventral
muscle masses (Fig. 1D); however, very few, if any, cells were
seen co-expressing Pax3 and Myogenin (Fig. 1D), or Lbx1
and Myogenin (data not shown). Similar results were
obtained when Pax3, Lbx1 and MyoD expression was
compared (data not shown). From E11.5 onwards, Pax3 and
Lbx1 were expressed predominantly in undifferentiated cells
that were located at the leading
edge of migrating pools of
limb muscle precursors. These
results show that during limb
muscle development muscle
precursors that are initially
Pax3+/Lbx1+/MRF− become
Pax3−/Lbx1−/MRF+. Together,
these data demonstrate that
Pax3 and Lbx1 are not
expressed in limb myoblasts
and
indicate
that
their
downregulation
may
be
required for hypaxial muscle
precursors to differentiate.
Generation of Lbx1 mutant
mice
To examine the function of Lbx1
in hypaxial muscle precursors,
we generated a targeted mutation
in the Lbx1 gene by homologous
recombination.
An
EGFP
reporter cassette was fused in
frame into the Lbx1 coding
region at aa 62 to trace
migrating muscle precursors in
Lbx1−/− mice. However, EGFP
expression in both Lbx1−/+ and
Lbx1−/− embryos was weak,
requiring the use of an anti-EGFP
antibody to detect cells that
would normally express Lbx1. A
frame shift mutation was also
introduced into the homeobox of
Lbx1 to ensure that no functional
Lbx1 protein is produced (Fig.
2A). W9.5 ES cells were
electroporated with the Lbx1
targeting vector. Two cell lines,
6C1(A) and 2B1(B), were
isolated
that
exhibited
homologous recombination at
the Lbx1 locus (Fig. 2B). Both
cell lines when injected into
C57Bl6
blastocysts
gave
germline transmission, and
offspring from the 6C1 and
2B1 ES cell lines exhibited identical mutant phenotypes.
Heterozygous Lbx1−/+ offspring were fertile and exhibited no
gross developmental abnormalities. In contrast, homozygous
Lbx1−/− mutant mice died shortly after birth with striking defects
in the organization of the appendicular musculature.
The cause of the perinatal lethality observed in Lbx1−/− mice
is not known, although the respiratory problems observed in one
newborn mutant mice may be a major contributing factor.
Homozygous Lbx1−/− embryos did not express the Lbx1 protein,
arguing that the Lbx1 mutation is a null allele. Nevertheless, it is
possible that the first 62 amino acids of the Lbx1 protein are
translated in frame with EGFP and could therefore exhibit some
biological activity.
Fig. 2. Generation of Lbx1 knock-in mice. (A) Structure of the mouse Lbx1 locus, targeting vector and
mutated Lbx1 allele. The coding region of EGFP was cloned in frame into the first exon of Lbx1. The
homeobox is indicated by a hatched box. Arrows mark transcription start sites. The 5′ and 3′ probes
that were used for Southern analysis are shown as bars above the endogenous Lbx1 locus. Arrowheads
indicate PCR primers. The mutated Lbx1 locus is shown below the targeting vector. (B) Southern blots
of EcoRI digested genomic DNA from ES cells, and wild-type and Lbx1 mutant mice derived from
either the 6C1 cell line (A) or the 2B1 cell line (B). Genomic DNA digested with EcoRI gives a wildtype band of 10 kb with both probes. The 5′ probe detects an 8.5 kb band in the mutated Lbx1 allele.
The 3′ probe detects a 5.3 kb band in the targeted Lbx1 allele. B, BglII; N, NotI; R, EcoRI; X, XhoI;
GFP, Green Fluorescent Protein; Neo, Neomycin resistance gene; PGK, PGK promoter sequences; TK,
HSV thymidine kinase gene; An, SV40 or PGK polyadenylation sites.
Lbx1 controls limb muscle precursor migration
Lbx1 mutant mice lack most appendicular muscles
When heterozygous Lbx1 mice were bred, a number of
newborn offspring with gross morphological defects were
found dead in each litter. One live mutant pup was born and
died within two hours. All abnormal mice were homozygous
for the mutated Lbx1 allele. Lbx1−/− mice exhibited a
pronounced limb phenotype characterized by a severe
reduction in muscle mass in the shoulders, pelvic girdle and
417
the extremities of the limbs (Fig. 3). Hindlimbs were severely
reduced in girth, while the forelimbs were hyperflexed and
thinner than those of wild-type newborns (Fig. 3A,B).
Anatomical dissection of mutant and wild-type P0 mice
revealed a number of differences in the organization of the
skeletal musculature (Table 1). All hindlimb muscles were
missing, with the exception of the gluteus medius and one other
unidentified hypaxial muscle. Two hindlimb suspension
Table 1. Dissection analysis of muscles of Lbx1 mutant newborns
Forelimb muscle
Lateral/Extensor
supraspinatusa
infraspinatus
teres major
spinodeltoid
triceps (3 heads)
ext. carpi ulnaris
ext. digit. communis
ext. digit. lateralis
ext. carpi obliqus
ext. carpi radialis longus
ext. carpi radialis brevis
Status*
−
−
−
−
−
−
−
−
−
−
−
Medial/Flexors
subscapularisb
biceps brachii
brachialis
coracobrachialis
flexor carpi ulnarisc
flexor digit. profundusc
pronator teres
+ r
+
−
+
+
+ r
+
Suspensiond
pectoralis major
pectoralis minor
clavobrachialis
spinotrapezius
latissimus dorsie
serratus ventralis
rhomboidius
rhomboidius capitis
+
+
−
+
− v
+
+
+
Hindlimb muscle
Status
Ilium-Leg
gluteus medius (ilium)f
iliopsoas (iliacus)g
sartorius
rectus femoris
+
−
−
−
Ischium-Leg
biceps femoris
semimembranosus
semitendinosus
gracilis
−
−
−
−
Pubis-Leg
adductor longish
adductor femorish
pectineush
unidentifiedh
−
−
−
+
Leg
femur-distali
tibia/fibula-distali
−
−
Suspensiond
gluteus maximus
gluteus medius (vert.)f
quadratus lumborumj
iliopsoas (psoas)g
caudofemoralisk
pubococcygeusl
iliococcygeusl
−
−
+ +
− v
− v
+
−
Muscle
Status
Neck and Head
sternomastoid
cleidomastoid
sternohyoid
geniohyoidm
thyrohyoid
mylohyoidm
digastricm
masseter
clavotrapezius
scalenes
splenius
intrinsic tonguen
+
+
+
+
+
+
+
+
+
+
+
+
Abdominal
rectus abdominusd
external obliqued
internal obliqued
intercostal
diaphragm (peripheral)o
diaphragm (central)o
+
+
+
+
++
+r
Axis Muscles
psoas minor
along vertebral columnp
+
+
*+, Present; −, not detected; ++, enlarged; r, reduced in size but connected appropriately; v, vestigial muscle incorrectly or not attached detected at the
approximate location of the normal muscle.
aSome striated strands observed in fascia on anterior scapular edge.
bApproximately 20% of normal size.
cProximal heads appeared normal but tapering distally was sudden and distal tendons were weak.
dMuscles that connect the vertebral column or ribs to scapula, pelvis, or more distal appendicular bones; abdominal muscles connecting to the pelvis are listed
seperately.
eA small ribbon of striated muscle is connected by tendinous strap to the anterior proximal humerus; the approximate location of the muscle is similar to but
the humerus attachment and layering with repect to a fat pad behind the limb differs from the normal lattissimus dorsi.
fGluteus medius normally connects ilium and vertebrae to greater trochanter of femur; the size of this muscle and its connections to the ilium and greater
trochanter appear normal but connections to the vertebrae were not detected.
gIliopsoas normally connects lumbar vertebrae (psoas) and ilium (iliacus) with lesser trochanter of femur; a loosely connected muscle bundle between the
normal lumbar insertion point of the iliopsoas and some tendons converging to the femur was observed.
hAdductor muscle was clearly absent; a tiny muscle connecting the pubis to the lesser trochanter of femur was observed but could not be identified from the
two texts cited; the attachment to femur did not fit descriptions of the three muscles connecting pubis to femur; these three muscles could not be cleanly dissected
in normal newborns to allow a fourth muscle to be confirmed.
iNo muscles connecting femur or tibia/fibula to more distal bones were observed.
jApproximately 50-100% increase on bulk.
kA small and variable band of striated muscle appears in facia connecting the vertebral column to lower leg.
lHuman nomenclature according to Grays Anatomy.
mMylohyoid, geniohyoid and digastric could not be dissected cleanly but seemed to be headed to their normal connections; the overall appearance of the
musculature below the jaw was altered; mutant musculature was less integrated and did not result in a smooth packet of muscle from the mandible to the hyoid
cartilage; jaw bones appeared slightly abnormal in shape.
nTongues excised at the hyoid cartilage appeared slightly broader and and shorter than normal; sections at E13.5 show no apparent disruption of the pattern of
MyoD-positive cells from base to tip of tongue.
oCentral muscle bundle connecting central tendon to vertebral column was well formed but approximately 50% smaller; peripheral muscle fibers connecting
central tendon to sternum and ribs were enlarged and appeared less well integrated with the tendonous membrane.
pSuperficial appearance was normal; detailed dissection of muscles connecting the vertebrae to each other was not done.
418
M. K. Gross and others
Fig. 3. Comparison of newborn wild-type and homozygous mutant
Lbx1 mice. (A,B) Sideviews of newborn wild-type and homozygous
Lbx1−/− mutant pups showing the external features of their forelimbs
(A) and hindlimbs (B). The arrows mark the limbs and show the loss
of limb muscles in homozygous Lbx1−/− mice.
muscles (quadratus lumborum, pubococcygeus) were retained,
suggesting that all other suspension muscles are hypaxially
derived. In the forelimbs, all extensor muscles were absent;
however, a number of flexor muscles were still present
(Table 1). Both extensors and flexors connecting phalanges,
metacarpals, and carpals were not detected (Fig. 4C,D). Wrist
flexors were all present but reduced in size. Two of three elbow
flexors, the biceps brachii and coracobrachialis, were also
present. A loss of extensors was also observed in muscles that
surround the scapula. Muscles on the lateral (extensor) side of
the scapula (supraspinatus, infraspinatus, spinodeltoid, teres
major) which are derived from the dorsal muscle mass were
absent, whereas the subscapularis muscle on the medial
(flexor) side was only reduced in size. All muscle suspending
the forelimb from the body with the exception of the
clavobrachialis and latissimus dorsi muscles were present and
normal, suggesting that their formation does not require Lbx1.
One difference that was seen in the organization of proximal
forelimb flexors in Lbx1−/− mice was the loss of the brachialis
muscle, which is one of the two principal flexors of the elbow
joint. Further differences were seen in the anatomy of the flexor
muscles that connect the humerus, radius and ulna to the carpal
bones. These flexor muscles, while still present and correctly
attached, were truncated along the proximodistal axis of the
limb. Muscle tissue was observed only at the proximal ends of
Fig. 4. Limb muscle
development in wild-type
and Lbx1−/− mice.
(A,B) Hematoxylin and eosin
stained cross sections (6 µm)
through the forelimbs of a
wild-type (A) and a Lbx1
mutant (B) mouse at P0. Both
sections are located
approximately 800 µm from
the ulna-carpal joint. (A) In
wild-type embryos, flexor (f)
and extensor (e) muscle
groups are both present.
(B) In Lbx1−/− mice, only
tendons (*) are present.
(C,D) Hematoxylin and eosin
stained mid-sagittal sections
through the forelimb paws of
wild-type (C) and mutant (D)
P0 mice. Striated muscle (m)
is only present in the paws of
wild-type mice.
(E-L) Longitudinal sections
through E13.5 wild-type
(E,G,I,K) and Lbx1−/−
(F,H,J,L) embryos stained
with an antibody to MyoD
(red). (E,F) Flexor muscles
are present in the upper forelimbs of wild-type and Lbx1−/− embryos. (G,H) Sections from midway between the elbow and wrist showing flexor
muscles at this level are present in wild-type embryos and largely absent from Lbx1−/− embryo (the arrowhead marks a single flexor muscle).
(I) A section located more distal to those shown in G and H showing flexor muscles extend further toward the wrist in wild-type embryos.
(J) Section through the head of the humerus (h) showing the limb is contiguous with the body at this level and that MyoD+ muscle cells are
located adjacent to the ulna (u, see arrowhead). (K) Section through the tibia (t) and fibula (f) showing muscles in the lower hindlimb of a wildtype embryo. (L) Cross section through the hindlimb of a Lbx1−/− embryo at the same level as K. Note the complete absence of MyoD+ cells. e,
extensor muscles; f, flexor muscles; fb, fibula; h, humerus; im, intercostal muscles; m, muscle; r, radius; s, skin; t, tibia; u, ulna.
Lbx1 controls limb muscle precursor migration
419
Fig. 5. Migration of hypaxial muscle precursors in Lbx1 mutant mice. (A,B) Cross sections through the forelimb of Lbx1−/+ (A) and Lbx1−/− (B)
embryos at E9.5 stained with antibodies to Pax3 (green), Myogenin (blue) and c-Met (red). Cells in the ventral dermomyotome coexpress Pax3
and c-Met in both wild-type and Lbx1−/− embryos. c-Met is also expressed in cells migrating from the ventral lip of the dermomyotome.
Examples of Pax3+ cells that are migrating into the forelimb are shown (arrowheads in A). In Lbx1−/− embryos, Pax3+ cells are beginning to
migrate ventrally instead of entering the limb (arrowhead in B). (C,D) Cross sections through the forelimb of Lbx1−/+ and Lbx1−/− embryos at
E10.5 showing Pax3+ cells in the limb of Lbx1−/+ (C) but not Lbx1−/− (D) embryos. The arrows point to c-Met expression in the dorsal limb that
is still present in Lbx1−/− embryos. (E,F) Adjacent sections to C and D showing Pax3+/EGFP (Lbx1)+ cells in the limbs of a Lbx1−/+ embryo
(see arrows in E). In E10.5 Lbx1−/− embryos, Pax3+/EGFP(Lbx1)+ cells (yellow) do not migrate into the forelimb (see arrow in F). (G) Cross
section through the hindlimb at E10.5 showing Pax3+/EGFP (Lbx1)+ cells migrating into the hindlimb of a Lbx1−/+ embryo. (H) Cross section
through the hindlimb of an E10.5 Lbx1−/+ embryos showing Pax3+/EGFP (Lbx1)+ cells are still located dorsally close to the dermomyotome
(see arrow). Abbreviations: dm, dermomyotome; fl, forelimb; hl, hindlimb.
both bones, giving way to tendon midway between the elbow
and wrist. In wild-type P0 mice, skeletal muscle tissue extends
three-quarters of the way from the elbow to the wrist (Fig.
4A,B). In contrast to the severe loss of appendicular muscles in
Lbx1−/− mice, the deep muscles of the back, intercostal muscles
and ventral body wall muscles were similar to age matched
wild-type and heterozygous littermates (data not shown).
Appendicular muscles are missing in mutant
embryos
To determine whether skeletal muscles develop in the limbs of
Lbx1 mutant mice and are subsequently lost or whether these
limb muscles never form, the pattern of differentiating muscles
in E13.5 mouse embryos was analyzed. At this time, myoblasts
in the limb have segregated into distinct populations that mark
the developing muscle anlagen. A complete series of cross
sections through forelimbs and hindlimbs of wild-type and
Lbx1−/− embryos was stained with an antibody to MyoD.
MyoD+ cells were absent from the hindlimbs of Lbx1−/−
embryos, except for the anlage of the gluteus medius that was
located lateral to the ileum and one other unidentified muscle.
The number and size of MyoD+ muscle anlagen in the forelimb
was compared at increasing distances from the junction of the
humerus and ulna bones (Fig. 4E-I). In Lbx1−/− embryos,
extensor muscle anlagen were completely absent at this stage,
while the developing flexor muscles showed a substantial
reduction in their size midway between the wrist and elbow
(Fig. 4G,H). In wild type embryos, MyoD expression extended
further toward the wrist (Fig. 4I). Sections through E13.5
Lbx1−/− embryos at the level of the elbow, show the anlagen
for those muscles that are retained in mutants, i.e. biceps
brachii, coracobrachialis and wrist-flexors, were located
between the humerus/ulna and ribs (Fig. 4J). This shows that
proximal forelimb flexor muscles form when the elbow joint is
no longer separated from the body wall and suggests a model
to explain the selective development of some flexor muscles in
Lbx1−/− mice.
Muscle precursors do not migrate into the limb in
Lbx1−/−− embryos
The expression of Lbx1 in migrating muscle precursors and the
loss of appendicular muscles in E13.5 Lbx1−/− embryos led us
to ask whether limb muscle precursors are impaired in their
ability to migrate in Lbx1−/− mice. The distribution of Pax3+
420
M. K. Gross and others
muscle precursors was analyzed in a complete series of
sections through the limbs of E9.5 and E10.5 wild-type,
Lbx1−/+ and Lbx1−/− embryos. At E9.5 a clear difference was
seen in the distribution of Pax3+ cells in wild-type versus Lbx1
mutant embryos. Whereas in wild-type embryos, Pax3+ cells
had already invaded the limb, in Lbx1 mutant embryos these
cells were clustered in the trunk, just beneath the ventrolateral
lip of the dermomyotome (Fig. 5A,B).
The differences observed in the migration of limb muscle
precursors were even more pronounced at E10.5. In wild-type
(not shown) and Lbx1−/+ embryos (Fig. 5C,E) Pax3+ cells had
already segregated into dorsal and ventral populations. In
contrast, no Pax3+ cells were seen in the forelimbs of E10.5
Lbx1−/− mutant embryos. Instead, an enlarged stream of Pax3+
cells was observed immediately adjacent to the ventral aspect
of the limb at posterior forelimb levels (Fig. 5F arrow). These
Pax3+ cells expressed EGFP, demonstrating that the cells
that normally express Lbx1 fail to migrate into the limbs of
Lbx1−/− embryos. When Pax3 expression was examined in
sections through the hindlimbs of E10.5 Lbx1−/− embryos, a
pool of delaminated Pax3+/EGFP+ cells was seen just ventral
to the dermomyotome (Fig. 5H). In comparable sections
through Lbx1−/+ hindlimbs, Pax3+/EGFP+ cells were seen in
the limb (Fig. 5G). In Lbx1−/− embryos, hindlimb muscle
precursors delaminate, but fail to migrate far from the ventral
edge of the dermomyotome.
In mice lacking c-Met, limb muscle precursors fail to
migrate into the limb, resulting in the complete loss of limb
muscles (Bladt et al., 1995; Maina et al., 1996) and raising
the possibility that c-Met is no longer expressed in Lbx1−/−
embryos. When c-Met expression was examined at E9.5,
strong c-Met staining was observed in the ventral
dermomyotome in both normal and Lbx1−/− embryos (Fig.
5A,B). c-Met receptor expression was also seen in
delaminating muscle precursors, demonstrating that the
failure of limb muscle precursors to enter the limb in
Lbx1−/− embryos is not due to the loss of c-Met. This finding
is consistent with the different morphologies of the ventral
dermomyotome which we observe in Lbx1 mutant embryos
compared to that reported for c-Met mutant embryos. In
Lbx1−/− embryos, muscle precursors delaminate from the
dermomyotome, whereas in c-Met−/− embryos these cells
retain their epithelial morphology (Dietrich et al., 1999).
Together, these results suggest that Lbx1 and c-Met regulate
different morphogenetic events in migrating muscle
precursors. Interestingly, we also noted that antibodies to cMet did not detect large numbers of Pax3+ cells that coexpress c-Met in the limb proper, suggesting that c-Met is
downregulated once muscle precursors delaminate from the
dermomyotome (Fig. 5A).
Muscle precursors do not differentiate prematurely
in Lbx1−/−− mutants
Myogenesis in the mouse begins at E9.5 in the dorsal
dermomyotome (Ott et al., 1991); however, it is delayed in
the ventral lip of the dermomyotome, especially at limb and
cervical levels where Lbx1 is expressed. Expression of MyoD
and Myogenin in the limb does not begin until after muscle
precursor cells have finished migrating, suggesting
myogenesis is not compatible with long-range cell migration.
Furthermore, our results show that Myogenin is not expressed
until after Lbx1 and Pax3 are downregulated (Fig. 1, data not
shown). Therefore, Lbx1 may be required to delay
myogenesis in migrating hypaxial muscle precursors, and
premature muscle differentiation may cause the defects in
Lbx1−/− mice. To test this hypothesis, E9.5 Lbx1−/− mutant
embryos were examined for evidence of precocious
myogenesis. Myogenin+ cells were observed beneath the
dorsal dermomyotome in both Lbx1−/+ and Lbx1−/− embryos
at E9.5, consistent with the early expression of Myogenin in
epaxial myoblasts described elsewhere (Fig. 5A,B). However,
no Myogenin+ cells were seen amongst the Pax3+/EGFP+
cells that had delaminated and failed to enter the limb in Lbx1
mutants. At E10.5, two populations of Myogenin+ cells were
detected in the body wall adjacent to the limbs in both wildtype and mutant embryos (Fig. 5C,D, arrowhead). However,
there was no increase in the number of Myogenin+ cells in
Lbx1−/− embryos. Furthermore, the EGFP+ population of cells
did not express Myogenin (Fig. 5 compare D and F). These
results argue that the cell migration defect in Lbx1 mutants is
not caused by hypaxial muscle precursors differentiating
prematurely.
Altered cell migration leads to the formation of some
appendicular muscles
Our observation that Pax3+/Lbx1+ cells migrate ventrally at
forelimb levels (Fig. 5F), but not at hindlimb levels (Fig.
5H), led us to investigate whether this difference could
account for the different patterns of muscle development that
occur in the forelimbs and hindlimbs of Lbx1−/− mutants.
Expression of Pax3 and Myogenin was analyzed in a
complete series of serial sections through E11.5 forelimbs
and hindlimbs to identify populations of migrating muscle
precursors (Pax3+) and myoblasts (Myogenin). In wild-type
E11.5 embryos, large numbers of Pax3+ cells were seen
within the limb as expected. These cells were located both
dorsally and ventrally where they had begun to separate into
muscle anlagen (Fig. 6A). When sections through the
posterior forelimbs of Lbx1−/− mice were analyzed, a large
pool of Pax3+ cells was observed immediately adjacent to
the ventral aspect of the limb (Fig. 6B). These muscle
precursors (Fig. 6B arrow) did not appear to be migrating
into the limb, and instead clustered at the junction of body
wall and ventral limb. Myogenin+ cells were distributed
throughout this posterior-ventral pool of Pax3+ cells,
indicating limb muscle precursors had already begun to
differentiate adjacent to the ventral limb. Furthermore, this
pool of cells appear to be sufficiently close to the limb to
receive normal muscle patterning signals, thereby giving rise
to the biceps brachii and coracobrachialis flexor muscles,
but not the brachialis. Since Pax3+ muscle precursors were
only present adjacent to the posterior forelimb at E11.5, we
conclude that all hypaxial muscle precursors in the anterior
half of the forelimb, including the precursors that would
normally give rise to extensors, instead migrate ventrally and
enter the septum transversum. Consistent with this
hypothesis, there is an increase in the number of Pax3+ cells
in the diaphragm at E11.5 (Fig. 7).
We did not observe a similarly located pool of Pax3+ cells
at hindlimb levels in E11.5 Lbx1−/− embryos (Fig. 6C,D),
confirming our observations that muscle precursors are unable
to migrate at hindlimb levels (Fig. 5G,H). Nevertheless, an
Lbx1 controls limb muscle precursor migration
421
Fig. 6. Expression of Pax3 and Myogenin in E11.5 wild-type and
Lbx1−/− embryos. (A,B) Pax3 (green) and Myogenin (blue) expressing
cells in the forelimbs of wild-type (A) and Lbx1−/− (B) embryos.
Sections are at the level of the posterior forelimb. An abnormal pool
of Pax3+ cells adjacent to the ventral forelimb is marked by an arrow
in B. A second more medial population of Pax3+ cells is also visible
(arrowhead). The arrowheads in A mark migrating Pax3+ cells within
the limb. (C,D) Sections through the hindlimb of a wild-type (C) and
a Lbx1−/− (D) embryo showing Pax3+ (green) and Myogenin+ (blue)
cells. Note the extensive migration of Pax3+ cells into the hindlimbs
of the wild-type embryo (arrowhead in C), but not the Lbx1−/− embryo.
Pax3+ and Myogenin+ cells are still present dorsally in Lbx1−/−
embryos (D). (E,F) Expression of Pax3 (green) and Myogenin (blue)
in the trunk at hindlimb levels in Lbx1−/− embryos (F) and wild-type
embryos (E). Increased numbers of Myogenin+ cells at located at the
ventral edge of the myotome in Lbx1−/− embryos (arrow). dm,
dermomyotome; fl, forelimb; hl, hindlimb.
increase in the number of Myogenin+ cells at the ventral edge
of the epaxial dermomyotome was noted in Lbx1−/− embryos
(Fig. 6E,F arrows) suggesting that cells that normally migrate
laterally into the limb instead congregate just ventral to the
epaxial dermomyotome. These cells may contribute to the
gluteus medius muscle that is still present in the hindlimb and
connects the ilium to the femur (see Table 1). This muscle is
located lateral to the pelvic bone, indicating that it is an
extensor and is derived from dorsal muscle precursors. In
addition, the quadratus lumborum, a hindlimb suspension
muscle, is enlarged in Lbx1−/− mice, suggesting hypaxial
muscle precursors that do not migrate contribute to this
muscle.
Tongue and diaphragm muscles form in Lbx1−/−−
mice
Lbx1 and Pax3 are not only expressed in limb muscle
precursors that migrate laterally into the limb buds, but also in
muscle precursors that migrate ventrally into the thorax to
generate the diaphragm muscles and into the branchial arches
to form the intrinsic tongue muscles (Fig. 7; Dietrich et al.,
1999; Mackenzie et al., 1998). To determine whether the ventral
migration of these two populations of hypaxial muscle
precursors is altered in Lbx1−/− mice, E10.5 and E11.5 embryos
were examined for the presence of migrating Pax3+ cells in the
diaphragm and second branchial arch. In E11.5 wild-type and
Lbx1−/− embryos, Pax3+ muscle precursors were seen in the
diaphragm. However, the diaphragms of Lbx1−/− embryos at
E11.5 consistently contained more Pax3+ cells (Fig. 7A,B),
Fig. 7. Tongue and diaphragm muscle
development in Lbx1 mutant mice.
(A,B) Cross sections through the
developing diaphragm at E11.5 showing
Pax3+ (green) muscle precursors that have
migrated into the septum transversum
(see arrows). Most of the Pax3+ cells coexpress Pax7 (blue). The Lbx1−/−
diaphragm (B) contains more muscle
precursors that the wild-type diaphragm
(A). (C,D) Sections at the level of the first
and second branchial arch showing Pax3+
(green) cells migrating into the tongue
anlage. Pax3+ cells that are weakly Lbx1+
(yellow) can be seen in C, showing Pax3+
tongue muscle precursors coexpress
Lbx1. (E,F) Hematoxylin and eosin
stained longitudinal sections through the
thorax of wild-type (E) and Lbx1−/− (F)
newborn mice, showing that muscle is present in the diaphragm (d) of Lbx1−/− mice. (G,H) Hematoxylin and eosin stained longitudinal
sections through the face and tongue showing the tongue musculature is normal in Lbx1−/− mice. d, diaphragm; da, dorsal aorta; mh,
mylohyoid muscle; st, septum transversum; t, tongue.
422
M. K. Gross and others
suggesting that the muscle precursors that normally enter the
anterior forelimb migrate inappropriately into the septum
transversum. The migration of tongue muscle precursors was
also examined at E10.5 for evidence of changes in their
migratory behaviour. A delay was seen in the migration of
Pax3+ cells into the second branchial arch in E10.5 embryos
(Fig. 7C,D). However, by E11.5 large numbers of Pax3+ cells
were present within the tongue primordium of Lbx1−/− mice
(data not shown).
Anatomical and histological investigation of newborn
Lbx1−/− mice confirmed the presence of a muscular diaphragm
in Lbx1−/− mice (Fig. 7E,F). While small differences were
noted in the distribution of muscle tissue within the
diaphragm, i.e. there was slightly more muscle laterally in
mutant than in wild-type newborn mice (data not shown), the
overall organization of the diaphragm in Lbx1−/− mutant mice
was similar to newborn wild-type mice (Fig. 7 c.f. E,F). No
significant difference was seen in the size or organization of
the tongue muscles in Lbx1−/− mice. The muscle fibres in the
tongue were multinucleate and organized into the patterned
bundles of muscle fibres that are characteristic for the intrinsic
muscles of the tongue (Fig. 7G,H). Taken together, these
results demonstrate that while muscle precursors are unable to
migrate laterally into the limb, they still migrate along ventral
routes into the septum transversum and branchial arches to
form the muscles of the diaphragm and tongue, respectively.
DISCUSSION
We have examined the function of Lbx1 in the development of
hypaxial muscles by inactivating the Lbx1 gene in mice. Our
results show that the ablation of Lbx1 causes the widespread,
but incomplete, loss of appendicular muscle and reveals a role
for Lbx1 in directing the lateral migration of muscle precursors
into the limbs. Our findings and a
model for how these muscle defects
arise in Lbx1−/− mice are discussed
below.
Pax3, Lbx1 and c-Met regulate
distinct aspects of hypaxial
muscle development
Inactivation of Lbx1 leads to the loss of
most appendicular muscles, whereas
diaphragm and tongue muscles are
spared. While the loss of appendicular
muscles that occurs in Lbx1 mutants is
substantial, it is less severe than
the muscle phenotypes seen in Pax3
and c-Met mutant mice. In Sp
(Pax3−) mice, appendicular, tongue,
diaphragm and ventral body wall
muscles fail to form (Franz et al., 1993;
Bober et al., 1994; Goulding et al.,
1994; Tajbakhsh et al., 1997). Thus,
Pax3 is necessary for the development
of all hypaxial muscle precursors,
including those populations that do not
undergo long range cell migration. The
defects in c-Met mutant embryos are
less severe than those seen in Sp embryos. However, unlike
Lbx1 mutants, the tongue and diaphragm muscles as well as all
appendicular muscles are missing (Bladt et al., 1995; Maina et
al., 1996).
Although Pax3 is required for the migration of limb muscle
precursors (Daston et al., 1996), there is evidence that Pax3
also plays an early role in the differentiation of hypaxial muscle
precursors (Maroto et al., 1997, Tajbakhsh et al., 1997). In Sp
embryos the loss of hypaxial muscles is accompanied by a
shortening of the dermomyotomes (Bober et al., 1994; Daston
et al., 1996, Tajbakhsh et al., 1997) suggesting hypaxial muscle
precursors may either degenerate or are not specified correctly
in the absence of Pax3. Additional evidence that Pax3 controls
the early specification of hypaxial muscle precursors comes
from the demonstration that all trunk muscles are lost in
Myf5/Pax3 mutant mice (Tajbakhsh et al., 1997). In c-Met
mutant mice, the underlying cause of these muscle defects is
the failure of cells in the ventrolateral dermomyotome to
undergo an epithelial to mesenchymal transition (Dietrich et
al., 1999). Unlike c-Met, Lbx1 is not required for the
delamination of hypaxial muscle precursors. In Lbx1−/−
embryos, tongue and diaphragm muscle precursors migrate
ventrally along their normal routes in the embryo, whereas
appendicular muscle precursors delaminate, but fail to migrate
laterally.
Further evidence that these genes control different steps in
the development of hypaxial muscles comes from epistasis
experiments. In Sp mutant embryos, the expression of c-Met
and Lbx1 is severely reduced in the ventral dermomyotome,
demonstrating that both genes lie downstream of Pax3
(Mennerich et al., 1998; Dietrich et al., 1999). However, it is
not known if Pax3 directly regulates the expression of either
gene, and while potential binding sites for Pax3 have been
identified in the c-Met promoter (Epstein et al, 1996), these
sites have not been shown to be functionally significant in vivo.
Fig. 8. Model showing the migration routes of muscle precursors in wild-type and Lbx1−/−
embryos. The upper panels show the migration of Pax3+ muscle precursors at different axial
levels. The migratory routes of Pax3 cells in wild-type (middle panels) and Lbx1−/− (lower
panels) embryos are shown. Abbreviations: L, lateral; V, ventral.
Lbx1 controls limb muscle precursor migration
c-Met does not function upstream of Lbx1, since Lbx1 is still
expressed in mice lacking c-Met or its ligand, Scatter Factor
(Dietrich et al., 1999). Furthermore, expression of c-Met and
Pax3 also does not depend on Lbx1 as seen in Fig. 5. This is
consistent with the different muscle phenotypes seen in the
Lbx1−/− mice compared to c-Met−/− and Sp mice. Thus, Lbx1
and c-Met function independently downstream of Pax3 to
control migration and delamination, respectively.
Lbx1 selectively regulates muscle precursor
migration along a lateral pathway into the limb
Lbx1 is expressed in all known migrating hypaxial muscle
precursors, and contrary to expectations, some populations of
hypaxial muscle precursors do migrate in Lbx1−/− embryos.
Thus, Lbx1 does not specify the general property of long
range migration in hypaxial muscle precursors. However,
Lbx1 is required for the migration of muscle precursors into
the limb field. Three models could account for the loss of
muscle precursors in the limbs of Lbx1−/− mice. First, Lbx1
serves to maintain limb precursors in an undifferentiated state
during migration, leading to the premature differentiation of
migratory cells in Lbx1 mutants. This is unlikely since MRF
expression was not observed in the proximal limb buds of
Lbx1−/− embryos between E9.5 and E10.5 (Fig. 5). Second,
Lbx1 serves to activate cellular components required for cell
motility. However, the presence of ventrally migrating EGFP+
cells in Lbx1−/− embryos demonstrates that Lbx1 is not
required for motility per se. Finally, Lbx1 could control the
migration of hypaxial muscle precursors by allowing them to
respond to guidance cues along their migratory routes. The
observation that muscle precursors in Lbx1−/− embryos can
still migrate ventrally, but not laterally, argues for this model,
and suggests that Lbx1 regulates responsiveness to a lateral
migration cue emanating from the limb bud.
Ontogeny of hypaxial muscles in Lbx1−/−− mice
Flexors and extensor muscles in the limbs are thought to arise
from the ventral and dorsal muscle masses, respectively. In
Lbx1−/− mice, six flexor muscles are retained in the forelimb
and two extensors are still present in the hindlimb. This raises
the question as to whether the defects in appendicular muscle
formation in Lbx1−/− mice are primarily due to changes in cell
migration, or whether Lbx1 has an additional role in specifying
subsets of appendicular muscle precursors. Our detailed
examination of hypaxial muscle precursor migration, combined
with an in depth analysis of the muscle defects in E13.5 and P0
mutants, explains how certain appendicular muscles persist in
Lbx1 mutants without invoking an additional role for Lbx1 in
muscle specification. A model that outlines the migration routes
of muscle precursors in wild-type and Lbx1 mutant embryos is
shown in Fig. 8. In this model, there is only a ventral migration
route at occipital levels. Two overlapping migratory cues are
present at anterior forelimb levels in mammals, and these direct
cells to migrate laterally into the dorsal limb and ventrally into
the septum transversum (see Fig. 8), while at posterior forelimb
levels, cells migrate along a ventrolateral route. At hindlimb
levels there is a lateral pathway, but no corresponding ventral
route. With this model, we can explain the presence of all of
the residual muscles in Lbx1−/− mice by assuming that Lbx1 is
required only for lateral migration, not ventral migration. Thus
in Lbx1−/− embryos, forelimb muscle precursors can migrate
423
toward the ventral limb, but not enter it, whereas at hindlimb
levels they are unable to migrate at all.
The absence of a ventral migratory pathway in the hindlimb
is consistent with the accumulation of delaminated muscle
precursors immediately below the dermomyotome in Lbx1−/−
embryos (Fig. 5H). EGFP+ cells are present in E10.5 Lbx1−/−
embryos at hindlimb levels (Fig. 5H), demonstrating hindlimb
hypaxial muscles are still specified, and in E11.5 Lbx1−/−
embryos there are increased numbers of Myogenin+ cells near
the ventral dermomyotome. In newborn Lbx1−/− mice, the
gluteus medius muscle is present, demonstrating that this
hypaxial muscle still develops at hindlimb levels. The dorsal
location of this muscle, argues that the precursors of the
gluteus medius do not need to migrate extensively for it to
form, hence its presence in Lbx1−/− mice. Secondly, we observe
a substantial increase in the size of the quadratus lumborum
muscle, suggesting that non-migrating hypaxial muscle
precursors may also be recruited to contribute to this muscle.
The constellation of flexors retained in the forelimbs of
Lbx1−/− mice is also very specific, and argues against a simple
model where Lbx1 specifies dorsal forelimb muscle precursors
(extensors), but not ventral forelimb precursors (flexors). We
observe that in Lbx1−/− embryos, Pax3+ muscle precursors still
migrate ventrally at both forelimb levels. At anterior forelimb
levels, these cells enter the septum transversum and contribute to
the diaphragm (Fig. 7). At more posterior levels they are unable
to do so, and instead form a pool of cells immediately adjacent
to the posterior forelimb (Fig. 6). Thus, the loss of all dorsal
appendicular muscles at forelimb levels most likely reflects a
failure of these muscle precursors to migrate laterally into the
limb. Not all forelimb flexor muscles are present in Lbx1 mutant
mice. While the biceps and coracobrachialis are retained and are
morphologically normal, the brachialis is missing. In wild-type
E10 embryos, few Pax3+ cells enter the ventral half of the limb
at anterior forelimb levels (Fig. 8). Conversely, many Pax3+ cells
are present in ventral limb posteriorly (Fig. 8). However, by E10.5
the ventral muscle mass is evident both in the anterior and
posterior forelimb, indicating that cells in the ventral forelimb
relocate anteriorly. We propose that in Lbx1−/− embryos, muscle
precursors do not enter the posterior forelimb and are therefore
unable to migrate anteriorly, and as a result the brachialis muscle
never forms. Consistent with this, there is no pool of Pax3+ cells
adjacent to the anterior forelimb in E11.5 Lbx1−/− embryos (data
not shown). Nevertheless, muscle precursors that are present at
posterior forelimb levels can give rise to the biceps brachii and
coracobrachialis without migrating into the limb. Thus, the loss
of the lateral migration pathway is sufficient to account for the
abnormal patterning of elbow flexors.
Previous studies have shown that elements of the skeletal
primordia are the likely source of the signals that pattern
skeletal muscles during development (see Kardon, 1998). This
together with our observations, provides an explanation as to
why some muscles form in Lbx1 mutant mice. At the time that
the forelimb muscle anlagen are forming, the elbow joint is
connected to the body wall where migrating Pax3+ muscle
precursors have congregated in Lbx1−/− embryos, thus allowing
them to be patterned by the adjacent appendicular skeleton (Figs
4 and 6). Although hindlimb muscle precursors do not appear
to migrate, they do detach from the dermomyotome and are
positioned close to the dorsal pelvis. Thus, in all cases it appears
that the muscles that form in Lbx1−/− mice do so because they
424
M. K. Gross and others
are located near elements of the appendicular skeleton that play
an instructive role in patterning the developing muscle anlagen.
The observation that abnormally migrating hypaxial muscle
precursors still form anatomically correct muscles, indicates
muscle precursors are naive and can be programmed to form
different types of hypaxial muscles. Thus, it appears that the
role of limb muscle precursor migration during embryogenesis
is to position muscle precursors within the limb mesenchyme,
so they can then respond to patterning signals derived from the
appendicular skeleton.
This research was supported by grants from NIH (NS31978) and
the March of Dimes to Martyn Goulding, and from the Human
Frontier Science Program. Laura Moran-Rivard was supported by an
NIH Predoctoral Training Fellowship (GM07420). The antiMyogenin monoclonal antibody was obtained from the
Developmental Studies Hybridoma Bank, University of Iowa. We
would also like to thank Elise Lamar for her critical reading of the
manuscript and Joseph Wu for technical assistance.
REFERENCES
Bladt, F., Reithmacher, D., Isenmann, S., Aguzzi, A. and Birchmeier, C.
(1995). Essential role for the c-met receptor in the migration of myogenic
precursor cells in to the limb bud. Nature 376, 768-771.
Bober, E., Franz, T., Arnold, H.-H., Gruss, P. and Tremblay, P. (1994). Pax3 is required for the development of limb muscles: a possible role for the
migration of dermomyotomal muscle precursor cells. Development 120,
603-612.
Chevallier, A., Kieny, M. and Mauger, A. (1977). Limb-somite relationship:
origin of the limb musculature. J. Embryol. Exp. Morphol. 41, 245-258.
Christ, B. and Ordahl, C. P. (1995). Early stages of chick somite
development. Anat. Embryol. 191, 381-396.
Christ, B., Jacob, H. and Jacob, M. (1977). Experimental analysis of the
origin of the wing musculature in avain embryos. Anat. Embryol. 150, 171186.
Christ, B., Jacob, M. and Jacob, H. J. (1983). On the origin and development
of the ventro-lateral trunk musculature in the avian embryo. An
experimental and ultrastructural study. Anat. Embryol. 166, 87-101.
Daston, G., Lamar, E., Olivier, M. and Goulding, M. (1996). Pax-3 is
necessary for the migration but not differentiation of limb muscle precursors
in the mouse. Development 122, 1017-1027.
Denetclaw, W. J., Christ, B. and Ordahl, C. P. (1997). Location and growth
of epaxial myotome precursor cells. Development 124, 1601-1610.
Dietrich, S., Abou-Rebyeh, F., Brohmann, H., Bladt, F., SonnenbergReithmacher, E., Yamaai, T., Lumsden, A., Brand-Saberi, B. and
Birchmeier, C. (1999). The role of SF/HGF and c-Met in the development
of skeletal muscle. Development 126, 1621-1629.
Dietrich, S., Schubert, F. R. and Gruss, P. (1993). Altered Pax gene
expression in mouse notochord mutants: the notochord is necessary to
initiate and maintain ventral identity in the somite. Mech Dev. 44, 189207.
Dietrich, S., Schubert, F. R., Healy, C., Sharpe, P. T. and Lumsden, A.
(1998). Specification of hypaxial musculature. Development 125, 22352249.
Epstein, J. A., Shapiro, D. N., Cheng, J., Lam, P. Y. and Maas, R. L. (1996).
Pax3 modulates expression of the c-Met receptor during limb muscle
development. Proc. Natl. Acad. Sci. USA 93, 4213-4218.
Fan, C.-M. and Tessier-Lavigne, M. (1994). Patterning of mammalian
somites by surface ectoderm and notochord: evidence of sclerotome
induction by a hedgehog homolog. Cell 79, 1175-1186.
Franz, T., Kothary, R., Surani, M. A., Halata, Z. and Grim, M. (1993). The
Splotch mutation interferes with muscle development in the limbs. Anat.
Embryol. 187, 153-160.
Gilbert, S. G. (1968). Pictoral anatomy of the cat. p16-36. University of
Washington Press, Seattle.
Goulding, M., Lumsden, A. and Paquette, A. J. (1994). Regulation of Pax3 expression the dermomyotome and its role in muscle development.
Development 120, 957-971.
Harlow, E. and Lane, D. P. (1988). Antibodies: A Laboratory Manual. Cold
Spring Harbor, NY: Cold Spring Harbor Press.
Jagla, K., Dolle, P., Mattei, M. G., Jagla, T., Schurbaur, B., Dretzen, G.,
Bellard, F. and Bellard, M. (1995). Mouse Lbx1 and human LBX1 define
a novel mammalian homeobox gene family related to the Drosophila lady
bird genes. Mech. Dev. 53, 345-356.
Kardon, G. (1998). Muscle and tendon morphogenesis in the avian hindlimb.
Development 125, 4019-4032.
Mackenzie, S., Walsh, F. S. and Graham, A. (1998). Migration of
hypoglossal muscle precursors. Dev. Dynam. 213, 349-358.
Maroto, M., Reshef, R., Munsterberg, A., Koester, S., Goulding, M. and
Lassar, A. B. (1997). Ectopic Pax-3 activates MyoD and Myf-5 expression
in both embryonic mesoderm and in neural tissue. Cell 89, 139-148.
Maina, F., Casagranda, F., Audero, E., Simeone, A., Comoglio, P. M.,
Klein, R. and Ponzetto, C. (1996). Uncoupling of Grb2 from the c-Met
receptor in vivo reveals complex roles in muscle development. Cell 87, 531542
Mennerich, D., Schafer, K. and Braun, T. (1998). Pax-3 is necessary for Ibx1
expression in myogenic precursor cells of the limb. Mech. Dev. 73, 147-158.
Munsterberg, A. E. and Lassar, A. B. (1995). Combinatorial signals from
the neural tube, floor plate and notochord induce myogenic bHLH gene
expression in the somite. Development 121, 651-660.
Ordahl, C. P. and Le Douarin, N. (1992). Two myogenic lineages within the
developing somite. Development 114, 339-353.
Ott, M. O., Bober, E., Lyons, G., Arnold, H. and Buckingham, M. (1991).
Early expression of the myogenic regulatory gene, myf-5, in precursor cells
of skeletal muscle in the mouse embryo. Development 111, 1097-1107.
Parry, W. (1982). The embryonic origin of the abdominal musculature of the
albino rat. Am. J. Anat. 122, 491-522.
Pourquie, O., Coltey, M., Teillet, M.-A., Ordahl, C. and Le Douarin, N.
M. (1993). Control of dorsoventral patterning of somitic derivatives by
notochord and floor plate. Proc. Natl. Acad. Sci. USA 90, 5242-5246.
Tajbakhsh, S., Rocancourt, D., Cossu, G. and Buckingham, M. (1997).
Redefining genetic heirachies controlling skeletal myogenesis: Pax3 and
Myf5 act upstream of MyoD. Cell 89, 127-138.
Williams, B. A. and Ordahl, C. P. (1994). Pax-3 expression in segmental
mesoderm marks early stages in myogenic specification. Development 120,
785-796.
Williams, P. L., Warwick, R., Dyson, M. and Bannister, L. H. (1989). Grays
Anatomy 37th Edition, Churchill-Livingstone, Edinburgh, London,
Melbourne, New York.
Yang, X. M., Vogan, K., Gros, P., and Park, M. (1996). Expression of the
met receptor tyrosine kinase in muscle progenitor cells in somites and limbs
is absent in Splotch mice. Development 122, 2163-2171.
Yee, S. P. and Rigby, P. W. (1993). The regulation of myogenin gene
expression during the embryonic development of the mouse. Genes Dev. 7,
1277-1289.