Supplementary Figure 1 A B GPR81 shControl shControl 200 μm 200 μm shGPR81 h 200 μm D Merge E C shGPR81 hG 81 200 μm F ASPC1-low 200 μm ASPC1-high 200 μm Supplementary Figure 1: Lentiviral shRNA mediated knockdown or ectopic expression of GPR81. (A) Relative mRNA expression of GPR81 in Capan-II cells following lentiviral stable knockdown of GPR81 (shGPR81) or lentiviral control (shControl). Results are the mean ± SEM, normalized to shControl. n ≥ 3. ***p<0.001; ****p<0.0001 by ANOVA. (B) shControl (top) or shGPR81 (bottom) Capan-II cells were coimmunostained for GPR81 (red) and DAPI (blue). Scale bar, 200μm. n ≥ 3. (C) Quantification of GPR81 protein levels, normalized to shControl. Data are mean ± SEM. n ≥ 3. **p<0.01 by t-test. (D) Relative mRNA expression GPR81 of BxPC3 cells transfected with siControl or siGPR81. Data are p by y ANOVA. mean ± SEM, normalized to siControl. n ≥ 3, ***p<0.001 (E) Relative mRNA expression of GPR81 mRNA in ASPC1-low and ASPC1- high cells. Data are mean ± SEM, normalized to ASPC1-low cells. **p<0.01 by t-test. (F) ASPC1-low (top) or ASPC1-high (bottom) cells were immunostained for GPR81 (red). Scale bar, 200μm. n ≥ 3. Supplementary Figure 2 Supplementary Figure 2: Lentiviral shRNA mediated knockdown of GPR81 is associated with reduced levels of MCT1. Relative mRNA expression of MCT1 in Capan-II cells following lentiviral stable knockdown of GPR81 with 2 unique shRNA (shGPR81-1 & shGRP81-2) or lentiviral control (shControl). Results are the mean ± SEM, normalized to shControl. n ≥ 3. ** p<0.01; ***p<0.001 by ANOVA Gene Forward Primer Reverse Primer GPR81 AATTTGGCCGTGGCTGATTTC ACCGTAAGGAACACGATGCTC PGC1α GCGGACAGAACTGAGAGACC CCATCATCCCGCAGATTTAC MCT1 CACTTAAAAATGCCACCAGCA AGAGAAGCCGATGGAAATGA MCT4 GTTGGGTTTGGCACTCAACT GAAGACAGGGCTACCTGCTG CD147 CCATGCTGGTCTCGAAGTCAG CCGTTCATGAGGGCCTTGTC 18S GAGCGGTCGGCGTCCCCCAACTTC GCGCGTGCAGCCCCGGACATCTAA Supplemental Table 1: Primer sequences for quantitative RT-PCR
© Copyright 2026 Paperzz