c Indian Academy of Sciences
RESEARCH ARTICLE
Expression of the rgMT gene, encoding for a rice metallothionein-like
protein in Saccharomyces cerevisiae and Arabidopsis thaliana
SHUMEI JIN1 , DAN SUN1 , JI WANG1 , YING LI2 , XINWANG WANG3 ∗ and SHENKUI LIU1∗
1
Key Laboratory of Saline-alkali Vegetation Ecology Restoration in Oil Field (SAVER), Ministry of Education,
Alkali Soil Natural Environmental Science Center (ASNESC), Northeast Forestry University,
Harbin 150040, People’s Republic of China
2
Key Laboratory of Crop Germplasm Improvement and Cultivation in Cold Regions, Heilongjiang Bayi Agricultural
University, Daqing 163319, People’s Republic of China
3
Texas A and M AgriLife Research and Extension Center, Department of Horticultural Sciences, Texas A and M University,
17360 Coit Road, Dallas, TX 75252, USA
Abstract
Metallothioneins (MTs) are cysteine-rich proteins of low molecular weight with many attributed functions, such as providing
protection against metal toxicity, being involved in regulation of metal ions uptake that can impact plant physiology and
providing protection against oxidative stress. However, the precise function of the metallothionein-like proteins such as the
one coded for rgMT gene isolated from rice (Oryza sativa L.) is not completely understood. The whole genome analysis of
rice (O. sativa) showed that the rgMT gene is homologue to the Os11g47809 on chromosome 11 of O. sativa sp. japonica
genome. This study used the rgMT coding sequence to create transgenic lines to investigate the subcellular localization of the
protein, as well as the impact of gene expression in yeast (Saccharomyces cerevisiae) and Arabidopsis thaliana under heavy
metal ion, salt and oxidative stresses. The results indicate that the rgMT gene was expressed in the cytoplasm of transgenic
cells. Yeast cells transgenic for rgMT showed vigorous growth compared to the nontransgenic controls when exposed to 7 mM
CuCl2 , 10 mM FeCl2 , 1 M NaCl, 24 mM NaHCO3 and 3.2 mM H2 O2 , but there was no significant difference for other stresses
tested. Similarly, Arabidopsis transgenic for rgMT displayed significantly improved seed germination rates over that of the
control when the seeds were stressed with 100 µM CuCl2 or 1 mM H2 O2 . Increased biomass was observed in the presence of
100 µM CuCl2 , 220 µM FeCl2 , 3 mM Na2 CO3 , 5 mM NaHCO3 or 1 mM H2 O2 . These results indicate that the expression of
the rice rgMT gene in transgenic yeast and Arabidopsis is implicated in improving their tolerance for certain salt and peroxide
stressors.
[Jin S., Sun D., Wang J., Li Y., Wang X. and Liu S. 2014 Expression of the rgMT gene, encoding for a rice metallothionein-like protein in
Saccharomyces cerevisiae and Arabidopsis thaliana. J. Genet. 93, 709–718]
Introduction
Soil and water pollution resulting from toxic heavy metal
ions in the environment is a major problem worldwide. High
levels of heavy metal ions such as Cu, Cd and Zn can be quite
toxic to plant growth and development, and result in many
deleterious physiological problems (Hall 2002). High levels
of salinity (NaCl) and alkalinity (NaHCO3 and Na2 CO3 ) in
the soil dramatically affect osmotic pressure and soil pH readings, so that the productivity of land in cultivation or that used
as pasture for livestock is greatly restricted (Jixun et al. 1998).
∗ For correspondence. E-mail: Xinwang Wang, [email protected];
Shenkui Liu, [email protected].
There are two well-characterized heavy metal-binding
ligands in plant cells: (i) phytochelatins (PCs), a family
of enzymatically active cysteine-rich peptides and (ii)
metallothioneins (MTs) (Rauser 1999; Clemens 2001). MTs
are comprised of a super family of evolutionarily conserved,
low molecular mass (4–10 kDa), cysteine-rich proteins that
act to chelate heavy metals by virtue of their high affinity
for the thiol group of the cysteine (Cys) residues, and
thereby protect plants from heavy metal toxicity (Hamer
1986; Thirumoorthy et al. 2007). MTs were first isolated as
Cd-binding proteins from horse kidney in 1957 (Margoshes
and Vallee 1957). Based on the arrangement of Cys residues
within the polypeptide, MTs were classified into three distinct categories (Robinson et al. 1993). The MTs found in
Keywords. Arabidopsis; metal-ion tolerance; metallothionein; rice; salt tolerance; yeast; transgenic gene expression.
Journal of Genetics, Vol. 93, No. 3, December 2014
709
Shumei Jin et al.
higher plants belong to the type II class of proteins, which
contain two Cys-rich clusters separated by a spacer region,
and can be further categorized into four subcategories based
on the distribution patterns of Cys residues at the amino (N)terminals and carboxy (C)-terminals of the protein (Robinson
et al. 1993).
In plants, wheat germ protein, Ec, was the first plant MT
identified due to its ability to bind with zinc in wheat (Lane
et al. 1987). Since then, multiple MT isoforms have been
reported in plants; examples can be found in rice (Zhou et al.
2006), a wild relative Porteresia coarctata (Usha et al. 2011),
Arabidopsis (Zhou and Goldsbrough 1994), Elsholtzia
haichowensis (Xia et al. 2012), feather fingergrass (Chloris
virgata Swartz) (Nishiuchi et al. 2007), cork oak (Quercus
suber) (Mir et al. 2004) and cotton (Xue et al. 2009). Two
Arabidopsis MT genes were used to transform MT-deficient
yeast and showed functional complementation by providing tolerance to Cu and Cd (Zhou and Goldsbrough 1994).
Thus, the function of the MT family of genes has been
demonstrated as providing protection against metal toxicity or oxidative stress and being involved in regulation of
intracellular metals (Kumari et al. 1998; Krezel and Maret
2007). The mechanism for metal tolerance in plants is most
likely the result of MTs ability to maintain the homeostasis
of essential metal ions, detoxifying heavy metals or scavenging reactive oxygen species (ROS) (Nishiuchi et al. 2007;
Guo et al. 2008; Xue et al. 2009). Additionally, plant MTs are
also involved in some important developmental processes,
such as fruit ripening, root development and suberization
(Mir et al. 2004; Moyle et al. 2005).
A MT-like gene, rgMT, was first isolated from rice
(Oryza sativa) genomic DNA which plays important roles
in alleviating both heavy metal (Cu) stress and heat shock
(Hsieh et al. 1995). So far, 11 MT isoforms have been discovered and characterized in rice (Cobbett and Goldsbrough
2002). Type I MT gene OsMT-I-1a (Os12g38270) e.g., has
been characterized to play a pivotal role in Zn homeostasis
and drought tolerance (Yang et al. 2009). Another type I MT
isoform OsMT-I-1b (Os03g17870) from rice has been characterized for its ability to bind Ni2+ , Cd2+ and Zn2+ ions
in vitro, but does not bind Cu2+ ion (Nezhad et al. 2013).
Rice MT isoform, OsMT2b (Os01g74300), was reported to
express in immature rice panicles, scutellum of germinating embryos and primordium of lateral roots (Yuan et al.
2008). Dong et al. (2010) reported a novel rice MT isoform OsMT-I-4b (Os12g38051) in roots and buds with a
promoter whose activity was highly upregulated by abscisic
acid (ABA), drought, dark and heavy metals. The expression
patterns of these MT isoforms have been characterized at the
mRNA level but no work has been carried out on the corresponding protein expression levels. The rgMT gene from
root tissue of rice was isolated in the laboratory and analysed to describe its effectiveness in imparting tolerance to
salts as well as metal ions (Zn2+ , Cu2+ and Cd2+ ) in the
transgenic prokaryote model system, Escherichia coli (Jin
et al. 2006). Although previous studies have indicated that
710
plant MT genes play an important role in alleviating Zn2+ ,
Cu2+ and Cd2+ stresses, the effectiveness of the rgMT gene
in response to Fe2+ and Na+ stresses are unknown. Thus,
the objective of this research was to study the expression of
the rgMT gene in transgenic eukaryotic model system yeast
(Saccharomyces cerevisiae) and higher plant, A. thaliana,
when challenged with heavy metal ions, salts and oxidative stresses. The subcellular localization of the rgMT gene
product was also investigated.
Materials and methods
Construction of expression vectors and yeast transformation
Previously the metallothionein-like (designed as rgMT, GenBank number U46159) was isolated from rice (O. sativa L.
Nipponbare) root cDNA library under NaHCO3 stress. This
gene is located on chromosome 11 of O. sativa sp. japonica
genome. The whole genome analysis of rice (O. sativa) was
conducted to compare the rgMT gene amino acid sequence
with 11 published rice metallothionein amino acid sequences
that were retrieved from the O. sativa TIGR database
(http://rice.plantbiology.msu.edu/index.shtml). The multiple
sequence alignment of these rice MT protein sequences was
performed using ClustalX and later it was manually edited in
MEGA ver. 4 (Tamura et al. 2007).
In this study, the coding region of the rgMT gene was
amplified from pMD18T-rgMT plasmid DNA with BamHI
sense primer 5 GGATCCATGTCTTGCAGG-3 (restriction
site underlined for all restriction enzymes) and XhoII antisense primer 5 CTCGAGTTAACAGTTGCA-3. The PCR
amplified fragments were digested with BamHI and XhoII
and then subcloned to the same site of the pYES2
expression vector (Clontech, Tokyo, Japan) resulting in
pYES2-rgMT. Green fluorescent protein (GFP) fragment
was obtained from the plasmid pEGFP DNA (Clontech)
with BamHI and NotI digestion, and then subcloned to
the same site of pYES2 to construct the control vector
(pYES2-GFP). To construct the pYES2-rgMT-GFP expression vector, the coding region of rgMT gene was amplified from pMD18T-rgMT plasmid DNA with HindIII sense
primer 5 AAGCTTATGTCTTGCAGG-3 and BamHI antisense primer 5 GGATCCCGACAGTTGCAAGG-3, and the
fragments were digested with HindIII and BamHI and then
subcloned to the same site of pYES2-GFP.
The plasmid DNAs of pYES2-rgMT, pYES2-GFP and
pYES2-rgMT-GFP were, respectively transformed into the
competent yeast strain INVSc1 (S. cerevisiae) (Clontech)
using the electric impulse method following the manufacturer’s instructions for protein expression.
Construction of expression vectors and Arabidopsis
transformation
The rgMT gene coding region was amplified from pMD18TrgMT plasmid DNA with the previously described BamHI
Journal of Genetics, Vol. 93, No. 3, December 2014
Expression of rice rgMT gene under stresses
sense primer and SacI antisense primer 5 GAGCTCTTAAC
AGTTGCA-3 . The PCR fragments were digested with
BamH1 and SacI enzymes and then subcloned to the
same site of pBI121 binary vector (Clontech) resulting in
pBI121-rgMT. The above pYES2-rgMT-GFP plasmid DNA
was amplified using the same BamHI sense primer and
SacI antisense primer 5 GAGCTCTTACTTGTACAGCTC3 . The corresponding fragment (containing both rgMT and
GFP genes) was ligated into the same site of pBI121
to construct the pBI121-rgMT-GFP expression vector. A
control vector pBI121-GFP was constructed by the ligation of pBI121 and the coding region of GFP gene
from the plasmid pEGFP DNA (Clontech) (SmaI, sense
primer 5 CCCGGGATGGTGAGCAAGGGC-3 and aforementioned SacI antisense primer).
The plasmid DNAs of pBI121-rgMT, pBI121-rgMTGFP and pBI121-GFP were respectively cloned into the
binary vector of Agrobacterium tumefaciens strain EHA105
(Clontech) and used to transform A. thaliana using the
floral dip method (Clough and Bent 1998) for protein
expression.
Subcellular localization of rgMT gene in transgenic yeast
and Arabidopsis
The subcellular localization of the gene product resulting from the expression of the rgMT transgene was made
possible by the use of a microscope with UV optics that
enable the visualization of the green florescence produced
by rgMT/GFP fusion protein. Transformed yeast cells were
precultured in liquid YPD medium (1% yeast extract + 2%
peptone + 2% D-glucose) at 30◦ C overnight. The cultured
cells were collected and washed thrice with liquid YPG (1%
yeast extract + 2% peptone + 2% galactose). These cells
were cultured in a liquid YPG medium at 30◦ C for 8 h
to induce the rgMT gene and the GFP gene as well. The
seeds of the T0 transgenic Arabidopsis lines were sown on
the half-strength MS medium supplemented with 50 mg L−1
kanamycin.
GFP fluorescence was detected in both transgenic yeast
and Arabidopsis lines (Sheen 2001) using FluoView FV500
confocal laser scanning microscope (Olympus, Tokyo,
Japan).
Stress tolerances of the transgenic yeast and Arabidopsis
Southern blot analysis
Genomic DNA of transgenic Arabidopsis was isolated from
two-week-old plants using the standard CTAB method
(Murray and Thompson 1980). Approximately 6 µg DNA
per lane was digested with BamHI and separated on
1% (w/v) agarose gel. The fragments were transferred
to the Hybond-N+ nylon membrane (Amersham Pharmacia, Shanghai, China) and hybridized with a digoxigenin (DIG)-labelled full-length cDNA containing rgMT
gene at 50◦ C overnight. The probe was the production
of full-length rgMT gene amplified with forward primer
(5 -ATGTCTGCAGCTGGTGG-3) and a reverse primer
(5 -TTAACAGTTGCAAGGG-3) using PCR digoxigenin
(DIG) Labelling Mix (Roche, Basel, Switzerland). The signals were detected with CDP-Star detection reagent (Tropix,
Foster City, USA) using Amersham Pharmacia Biotech
Imagemaster VDS-CL Multi Function Bio-imaging Station
(Amersham Pharmacia).
Transgenic yeast cells containing pYES2-rgMT and pYES2
(control) were, respectively incubated in the YPD medium
overnight at 30◦ C. The concentration of overnight culture
was adjusted to OD600 = 0.5. Culture solutions with serial
dilutions (10, 10−1 , 10−2 , 10−3 and 10−4 ) were spotted onto
YPD agar plates supplemented with 160 µM CdCl2 , 7 mM
CuCl2 , 10 mM FeCl2 , 10 mM ZnCl2 , 1 M NaCl, 10 mM
Na2 CO3 , 24 mM NaHCO3 or 3.2 mM H2 O2 , respectively.
The seeds of wild type (WT) and the third generation
transgenic Arabidopsis lines were surfaced-sterilized with
70% ethanol for 1 min followed by 1% NaClO solution for
3 min. The seeds were then rinsed in sterile water thrice, and
sowed on agar solidified half-strength MS medium containing 1% (w/v) sucrose, supplemented with 100 µM CdCl2 ,
100 µM CuCl2 , 220 µM FeCl2 , 300 µM ZnCl2 , 150 mM
NaCl, 3 mM Na2 CO3 , 5 mM NaHCO3 or 1 mM H2 O2 ,
respectively. Seeds were also germinated on the regular
MS medium as a control. Root length and fresh weight
were recorded after 14-d stresses applied. The plates were
positioned vertically on shelves to measure the roots.
Northern blot analysis
The expression level of rgMT gene in transgenic yeast
and Arabidopsis plants was shown by Northern blot. Total
RNAs from transgenic yeast and Arabidopsis were extracted
using the RNeasy Mini Kit (Qiagen, Düesseldorf, Germany)
according to the manufacturer’s instructions. RNAs were
fractionated on 1% agarose–formaldehyde gel and transferred onto Hybond N+ membranes (Amersham Pharmacia), they were then hybridized with a DIG-labelled fulllength rgMT gene at 50◦ C overnight. The signal detection in
Northern blot followed the same procedures as in Southern
blot.
Results
Comparison of rgMT gene protein sequences and other rice MT
protein sequences
Eleven MT gene amino acid sequences in O. sativa were
retrieved from Rice Genome Annotation Project database
(http://rice.plantbiology.msu.edu/index.shtml), namely, Os01
g05585.1 (Chr. 1), Os01g05650.1 (Chr. 1), Os01g74300.1
(Chr. 1), Os03g17870.1 (Chr. 3), Os05g11320.1 (Chr. 5),
Os11g47809.1 (Chr. 11), Os12g38010.1 (Chr. 12), Os12g
38051.1 (Chr. 12), Os12g38270.1 (Chr. 12), Os12g38290.1
Journal of Genetics, Vol. 93, No. 3, December 2014
711
Shumei Jin et al.
78 Os12g38051.1
88
30
Os12g38300.1
Os12g38010.1
51
Os12g38270.1
Os12g38290.1
87
Os03g17870.1
Os11g47809.1
85
Os01g05585.1
98
Os01g05650.1
Os01g74300.1
rgMT-transgenic lines grew better than the control in the
presence of 7 mM CuCl2 and 10 mM FeCl2 . There was no
significant difference in growth between the rgMT-transgenic
line and control under 160 µM CdCl2 , 10 mM ZnCl2 or
10 mM Na2 CO3 stress and also there was no significant difference in growth of the rgMT-transgenic line versus the control in the presence of 1 M NaCl but the former showed better growth than the latter. Overall, the rgMT-transgenic line
grew better in the presence of 24 mM NaHCO3 or 3.2 mM
H2 O2 than the control (figure 3).
Os05g11320.1
100
Expression of rgMT gene in transgenic Arabidopsis in response
to stresses
0.1
Figure 1. The phylogenetic tree of MTs reported from rice (O.
sativa) based on their amino acid sequences. The scale bar represents 0.1 changes per nucleotide. Boost values are from 1000 replicates. Solid lozenge indicates that the rgMT amino acid sequence
was clustered together with Os11g47809.1.
(Chr. 12) and Os12g38300.1 (Chr. 12), respectively. ClustalX
results revealed that rgMT gene amino acid sequence
has 100% identity with Os11g47809 in O. sativa sp.
japonica and both of them were on chromosome 11 clustered
with other type I members (Kumar et al. 2012). The rooted
phylogenetic tree of the OsMT genomic sequences (Yang
et al. 2009) showed a very close relationship between them
(figure 1).
Three transgenic Arabidopsis lines (T1 , T2 and T3 ) were
selected for Northern blot analysis (figure 4). The overexpression of the rgMT gene in transgenic Arabidopsis
was enabled by the constitutive expression provided by the
CaMV35S promoter. The results showed that each transgenic
line had a high level of rgMT gene expression as demonstrated by a strong hybridization signal (figure 4). No transcript signal corresponding to the size of rgMT transcript
was detected in WT plants, indicating that there is no MT
sequence homology between rice and Arabidopsis genomes
(figure 4). Southern blot data showed only one copy of the
transgene in each of the three transgenic Arabidopsis lines
(figure 5).
Expression of rgMT gene in transgenic yeast in response
to stresses
Subcellular localization of rgMT gene product/protein
in transgenic yeast
Abiotic stress factors that induced the expression of the
rgMT transgene in yeast were investigated. Two transgenic
yeast lines were obtained: one contained empty pYES2
(control) and another contained rgMT gene. Northern blot
analysis showed a strong signal of total RNA hybridizing
with a DIG-labelled rgMT probe (figure 2), indicating the
rgMT gene expression in the transgenic yeast. Significant
differences were observed in the growth rate of transgenic
yeast cells under various abiotic stresses studied (figure 3).
No difference between rgMT-transgenic line and control
was found when there was no stress applied. However, the
The pYES2-GFP (control) and pYES2-rgMT-GFP vectors
were successfully transformed into the cells of yeast strain
INVISc1 (figure 6). The green fluorescence of pYES2-GFP
(figure 6a) and pYES2-rgMT-GFP (figure 6b) fusion proteins
were observed inside the cytoplasm, indicating that the rgMT
gene was localized peripherally into the yeast cytoplasm.
pYES2
pYES2-rgMT
Subcellular localization of rgMT gene in Arabidopsis
Agrobacterium binary vectors containing either pBI121GFP (control) or pBI121-rgMT-GFP were transformed into
Arabidopsis to obtain transgenic plants carrying rgMT
and GFP transcriptional fusion proteins. The results indicated that both pBI121-GFP (figure 6c) and pBI121-rgMTGFP (figure 6d) were detected by green fluorescence
appearing in the cytosol of the transgenic Arabidopsis
leaves.
Stress tolerance of the transgenic Arabidopsis
Figure 2. The expression of rgMT gene in transgenic yeast
detected by Northern blot. The upper band indicates the Northern
blot and the lower bands indicate the PCR detection on agarose gel.
712
The seed germination rates of the Arabidopsis transgenic
line and WT were investigated by measuring the root
length (table 1) and fresh weight (table 2) of 15 plants of
each genotype under different stresses. When tested on a
Journal of Genetics, Vol. 93, No. 3, December 2014
Expression of rice rgMT gene under stresses
Figure 3. Cell growth of rgMT-transgenic yeast in the presence of various stresses. Serial 10-fold dilutions of yeast
cells containing pYES2-rgMT and pYES2 (control) were grown onto solid YPD media supplemented with the indicated
stress for 3–7 days at 30◦ C.
control medium without stress treatments, there were no significant differences observed for root length and fresh weight
between WT and transgenic lines. However, when the germination medium was supplemented with various free radical
ion concentrations, both root length and fresh weight of the
WT plant were significantly lower than the control (without
stress treatment), indicating that the seed germination rate
of the WT was inhibited in the presence of certain abiotic
stresses. In contrast, the root and fresh weight of Arabidopsis line showed no significant difference when compared
to the control under most of the stress treatments, except
for 100 µM CdCl2 and 150 µM NaCl. When compared to
the WT, the roots of T plants were longer when stressed
by 100 µM CuCl2 and 1 mM H2 O2 (table 1), and more
fresh weight under the stresses of 100 µM CuCl2 , 220 µM
FeCl2 , 3 mM Na2 CO3 , 5 mM NaHCO3 and 1 mM H2 O2
(table 2).
WT
WT
T1
T2
T1
T2
T3
T3
Figure 4. The expression of rgMT gene in transgenic Arabidopsis detected by Northern blot. The upper band indicates the Northern blot and the lower bands indicate the PCR detection on agarose
gel. WT, wild type plant; T1 , T2 and T3 are the third generation
transgenic lines harbouring the rgMT gene.
Figure 5. The expression of rgMT gene in transgenic Arabidopsis detected by Southern blot. WT, wild type plant. T1 , T2 and T3
are the third generation transgenic lines harbouring the rgMT gene.
Southern blot shows the copies of the rgMT gene in T1 , T2 and T3
transgenic lines.
Journal of Genetics, Vol. 93, No. 3, December 2014
713
Shumei Jin et al.
GFP + bright
Bright
pBI121-rgMT-GFP
GFP
pBI121-GFP
(a)
(b)
GFP+chlorophyll
DIC
pYES2-rgMT-GFP
GFP
pYES2-GFP
(c)
(d)
Figure 6. Laser scanning confocal images of rgMT-transgenic yeast INVISC1 (S. cerevisiae) (a and b) and A. thaliana (c and d) cells
which were captured by the FluoView FV500 confocal laser scanning microscope (Olympus, Japan) at 488 nm. Imaging was, respectively
visualized under green fluorescent protein channel (GFP), merged GFP and bright light channel (GFP + bright) and bright channel (Bright)
for yeast cells and under green fluorescent protein channel (GFP), merged green fluorescent protein (green) and chlorophyII autofluorescent
(red) channel (GFP + chlorophy) and transmission light channel with differential interference contrast (DIC) for Arabidopsis cells. (a)
Expression of the GFP protein in yeast; (b) expression of the rgMT-GFP fusion protein in yeast; (c) expression of the GFP protein in
Arabidopsis; (d) expression of the rgMT-GFP fusion protein in Arabidopsis.
714
Journal of Genetics, Vol. 93, No. 3, December 2014
Expression of rice rgMT gene under stresses
Table 1. Comparison of root length between Arabidopsis wild type (WT) and transgenic line (T) under different abiotic
stresses. Values are means ± SD of 15 plants of each genotype.
Mean (cm)
WT
Compared
to control
Compared
to WT
2.75± 0.17
0.00± 0.00
1.57± 0.15
1.32± 0.09
2.05± 0.06
1.56± 0.08
1.22± 0.09
1.81± 0.15
0.15± 0.03
aA
bB
bB
bB
bA
bB
bB
bB
bB
aA
aA
aA
aA
aA
aA
aA
aA
aA
Stress
Control
100 µM CdCl2
100 µM CuCl2
220 µM FeCl2
300 µM ZnCl2
150 µM NaCl
3 mM Na2 CO3
5 mM NaHCO3
1 mM H2 O2
Mean (cm)
T
Compared
to control
Compared
to WT
2.71± 0.14
0.05± 0.00
2.25± 0.05
1.47± 0.00
2.18± 0.12
1.82± 0.13
1.28± 0.08
2.00± 0.06
0.99± 0.08
aA
bB
bA
bB
bA
bB
bB
bA
bB
aA
aA
bA
aA
aA
aA
aA
aA
bB
Lower and upper case letters indicate 5 and 1% significant levels, respectively. Control without any treatments.
Table 2. Comparison of fresh weight between Arabidopsis wild type and transgenic line under different abiotic stresses. Values
are means ± SD of 15 plants of each genotype.
Mean (cm)
WT
Compared
to control
Compared
to WT
5.12± 0.11
1.64± 0.02
3.36± 0.14
3.27± 0.12
4.44± 0.12
2.78± 0.19
1.75± 0.08
3.31± 0.10
303± 0.07
aA
bB
bA
bA
bA
bA
bB
bA
bB
aA
aA
bA
aA
aA
aA
aA
aA
bB
Stress
Control
100 µM CdCl2
100 µM CuCl2
220 µM FeCl2
300 µM ZnCl2
150 µM NaCl
3 mM Na2 CO3
5 mM NaHCO3
1 mM H2 O2
Mean (cm)
T
Compare
to control
Compared
to WT
5.07± 0.07
1.84± 0.02
4.73± 0.08
4.33± 0.04
4.61± 0.16
2.85± 0.03
3.31± 0.10
4.64± 0.15
4.44± 0.05
aA
bB
aA
aA
aA
bB
bB
aA
aA
aA
aA
bA
bA
aA
aA
bB
bA
bA
WT, wild type; T, transgenic line.
Lower and upper case letters indicate 5 and 1% significant levels, respectively. Control without any treatments.
Discussion
A MT-like gene, rgMT was first isolated from rice genomic
DNA (Hsieh et al. 1995) and differential expression of
this gene in rice roots, leaves and sheaths was confirmed,
when exposed to heavy metals and heat shock stresses. To
date, there are 13 MT genes and 15 protein products in
O. sativa sp. japonica genome (Kumar et al. 2012). The
MT gene family plays an important role in plant reaction
to heavy metal toxicity (Kumari et al. 1998; Guo et al.
2003; Brkljacic et al. 2004; Lee et al. 2004; Wu and Chen
2005; Zhigang et al. 2006) and oxidative stresses. (Krezel
and Maret 2007; Zhu et al. 2009; Samardzic et al. 2010), as
well as increasing seed germination and seedling vigour
(Zhou et al. 2012). A homologue of MT gene was obtained
from rice root cDNA library and its overexpression in
Escherichia coli under metal, salt and drought stresses
was studied (Jin et al. 2006). This gene protein product
showed 100% similarity with Os11g47809.1 in O. sativa
sp. japonica on chromosome 11 (Yang et al. 2009; Kumar
et al. 2012). The function of the homologue in other O.
sativa sp. japonica cultivars has been analysed under NaCl,
CuSO4 and ZnSO4 stresses (Kumar et al. 2012). The rgMT
gene expression in yeast and Arabidopsis when exposed
to various metal ions, salts and oxidative stresses were
studied. Since, plant MT genes do not in general contain
transit peptides (Zhou et al. 2012), it was predicted that
these proteins would be localized in the central vacuole
(Vögeli-Lange and Wagner 1990). Subcellular fractionation
of extracts from S. pombe which were engineered to contain
an HMT1-lacZ fusion protein demonstrated that the vacuolar
membrane fraction contained the fusion protein (Ortiz et al.
1992). The results indicate that the fusion protein (rgMTGFP) was located in the cytoplasm of the transgenic cells
which was also in agreement with the other published studies (Lee et al. 2004; Wong et al. 2004; Zhigang et al. 2006).
These results indicate that MT is a cytoplasmic protein rather
than a structural membrane protein, with the rgMT gene
product residing predominantly in the cytoplasm protecting
cells from the extreme damaging environmental conditions.
Previous studies have shown that yeast share similar
metabolic pathways with plants and its functional protein
Journal of Genetics, Vol. 93, No. 3, December 2014
715
Shumei Jin et al.
operating system is relatively simple (Holdsworth et al.
2008). It was hypothesized that the rgMT-transgene when
introduced into yeast has the ability to increase its tolerance to stress. We also explored whether the rgMT rice
gene could function to protect against metal ions, salts
and oxidative stressors in transgenic yeast and Arabidopsis.
The cells of the transgenic lines harbouring the rgMT gene
were found to be protected, when exposed to various abiotic stresses. The rgMT transgene provided no significant
improvement in response to CdCl2 stress, in agreement with
the observations by Hsieh et al. (1995). The results indicated that the rgMT gene plays an important role in protection from metal, salt and oxidative stressors in both yeast and
Arabidopsis.
Seed germination resulting in seedling vigour is an important step for plant establishment. However, seedling can be
depleted when certain environmental stressors are encountered (McDonald 1999; Holdsworth et al. 2008). Overexpression of the rgMT gene can serve to stimulate the plant’s
ability to grow even when certain stress conditions exist.
The results show that transgenic lines have the potential to
have higher seed germination rates and improved seedling
vigour when challenged with diverse environmental conditions (Dickson 1980). These improvements can be explained
by the protective effects of the rgMT gene product when
challenged with environmental stressors (Zhou et al. 2012).
This study shows that rgMT-transgenic Arabidopsis plants
demonstrated increased salt or oxidative tolerances during
early developmental stages of seedling growth. The growth
of both root radical and rapidly expanding young leaves
were less affected by the stress threat in the rgMT transgenic lines, compared to the WT plants. These functions
have been demonstrated in rice in response to heavy metal
(Dong et al. 2010) and drought stresses (Yang et al. 2009).
It has been previously demonstrated that plant MTs can have
an impact on plant growth and development processes by
remediating the negative effects of abiotic stressors
(Bhalerao et al. 2003). One of the mechanisms by which the
stress can affect the plant cell is by inducing the generation
of reactive oxygen species (ROS) (Menezes-Benavente et al.
2004; Huang et al. 2005). Under these conditions, the plant
MTs may serve to protect and function as ROS scavengers
that are produced in response to oxidative stresses imposed
by an adverse environment (Navabpour et al. 2003; Akashi
et al. 2004; Mir et al. 2004; Wong et al. 2004; Xue et al.
2009; Samardzic et al. 2010). For example, the Cd detoxification mechanism of AtMT2a and AtMT3 may not include
sequestration of Cd into vacuoles or other organelles, but
rather serve to reduce ROS in Cd-treated cells (Zhu et al.
2009). The Arabidopsis T-DNA insertion mutant, mt2a, had
higher H2 O2 levels than WT plants under cold stress
(Zhu et al. 2009). The elevated expressions of MT
genes in buckwheat (Fagopyrum esculentum Moench)
and Quercus suber cork were found under exogenous
H2 O2 treatment (Mir et al. 2004; Brkljacic et al. 2004).
Recently, a type-2 MT gene in rice, OsMT2b, was demonstrated to be involved in ROS scavenging and signalling
716
(Wong et al. 2004). Another type-2 MT gene, OsMT1e-P,
overexpressed in tobacco resulted in lower amounts of ROS
(H2 O2 ) accumulation under salinity stress. In this study, the
rgMT-transgenic Arabidopsis had higher tolerance levels
than the nontransgenic lines, indicating that the rgMT gene
enhanced their tolerance to salt stress by serving as ROS
scavengers. The antioxidative properties of the rgMT gene
might be a function of the sulfhydryl complex in the protein. However, the elevated gene expression in Arabidopsis
and yeast under abiotic stresses requires further research in
transgenic rice.
Conclusion
By searching the whole rice genome sequences, the rice metallothionein (rgMT) gene was found to be a homologue to
the other type 1 members in the chromosome 11 in O. sativa
sp. japonica genome. The expression of rgMT gene was verified as being located in the cytoplasm of the cells of transgenic yeast and Arabidopsis under certain concentrations
of salt, metal and oxidant stresses. Transgenic yeasts and
Arabidopsis plants presented vigourous cell growth or
increased seed germination rate and biomass yield when
compared to nontransgenic yeast or Arabidopsis under various stresses. Thus, the rgMT gene plays an important role in
alleviating the toxic effects of metal ions (CuCl2 and FeCl2 ),
salts (Na2 CO3 and NaHCO3 ) and oxidative (H2 O2 ) stresses
that the rice plants may encounter in soil. These elevated
gene expressions are yet to be further confirmed in transgenic
rice genome under various abiotic stresses.
Acknowledgements
The authors thank Dr Dennis Genovesi and Dr Robert Trigiano for
their critical review before submission. This work was supported
by the National Natural Science Foundation of China (NSFC)
(no. 31070616), the Natural Science Foundation of Heilong Jiang
Province (no. C200714), the Youth Science Foundation of Harbin
City (no. 2008RFQXN007) and the Open Project of Key Laboratory
of Crop Germplasm Improvement in Cold Regions of Heilongjian
Province (CGI201204).
References
Akashi K., Nishimura N., Ishida Y. and Yokota A. 2004 Potent
hydroxyl radical-scavenging activity of drought-induced type2 metallothionein in wild watermelon. Biochem. Biophys. Res.
Commun. 323, 72–78.
Bhalerao R., Keskitalo J., Sterky F., Erlandsson R., Björkbacka H.,
Birve S. J. et al. 2003 Gene expression in autumn leaves. Plant
Physiol. 131, 430–442.
Brkljacic J. M., Samardzic J. T., Timotijevic G. S. and Maksimovic
V. R. 2004 Expression analysis of buckwheat Fagopyrum esculentum Moench metallothionein-like gene MT3 under different
stress and physiological conditions. J. Plant Physiol. 161, 741–
746.
Clemens S. 2001 Molecular mechanisms of plant metal tolerance
and homeostasis. Planta 212, 475–486.
Journal of Genetics, Vol. 93, No. 3, December 2014
Expression of rice rgMT gene under stresses
Clough S. J. and Bent A. F. 1998 Floral dip, a simplified method for
agrobacterium-mediated transformation of Arabidopsis thaliana.
Plant J. 16, 735–743.
Cobbett C. and Goldsbrough P. 2002 Phytochelatins and metallothioneins, roles in heavy metal detoxification and homeostasis.
Ann. Rev. Plant Biol. 53, 159–182.
Dickson M. 1980 Genetic aspects of seed quality. Hort. Sci. 15,
771–774.
Dong C. J., Wang Y., Yu S. S. and Liu J. Y. 2010 Characterization of
a novel rice metallothionein gene promoter, its tissue specificity
and heavy metal responsiveness. J. Integr. Plant Biol. 52, 914–
924.
Guo W. J., Weenun B. and Goldsbrough P. B. 2003 Characterization
of the Arabidopsis metallothionein gene family, tissue-specific
expression and induction during senescence and in response to
copper. New Phytol. 159, 369–381.
Guo L., Fu C. and Miao W. 2008 Cloning, characterization, and
gene expression analysis of a novel cadmium metallothionein
gene in Tetrahymena pigmentosa. Gene 423, 29–35.
Hall J. L. 2002 Cellular mechanisms for heavy metal detoxification
and tolerance. J. Exp. Bot. 53, 1–11.
Hamer D. H. 1986 Metallothionein. Annu. Rev. Biochem. 55, 913–
951.
Holdsworth M. J., Bentsink L. and Soppe W. J. J. 2008 Molecular
networks regulating Arabidopsis seed maturation, after-ripening,
dormancy and germination. New Phytol. 179, 33–54.
Hsieh H. M., Liu W. K. and Huang P. 1995 A novel stress-inducible
metallothionein-like gene from rice. Plant Mol. Biol. 28, 381–389.
Huang C., He W., Guo J., Chang X., Su P. and Zhang L. 2005
Increased sensitivity to salt stress in an ascorbate-deficient
Arabidopsis mutant. J. Exp. Bot. 56, 3041–3049.
Jin S., Cheng Y., Guan Q., Liu D., Takano T. and Liu S. 2006 A
metallothionein-like protein of rice rgMT functions in E. coli and
its gene expression is induced by abiotic stresses. Biotechnol.
Lett. 281, 1749–1753.
Jixun G., Gang S., Wenming M., Lixun W. and Fugui Z. 1998 Natural recovery of saline-alkaline spots in Aneurolepidium chinense
grassland. J. Northeast Normal Uni. 2, 61–64.
Krezel A. and Maret W. 2007 Dual nanomolar and picomolar Zn
II binding properties of metallothionein. J. Am. Chem. Soc. 129,
10911–10921.
Kumar G., Kushwaha H. R., Panjabi-Sabharwal V., Kumari S., Joshi
R., Karan R. et al. 2012 Clustered metallothionein genes are coregulated in rice and ectopic expression of OsMT1e-P confers
multiple abiotic stress tolerance in tobacco via ROS scavenging.
BMC Plant Biol. 12, 107.
Kumari M. R., Hiramatsu M. and Ebadi M. 1998 Free radical scavenging actions of metallothionein isoforms I and II. Free Radic.
Res. 29, 93–101.
Lane B., Kajioka R. and Kennedy T. 1987 The wheat germ Ec protein is a zinc-containing metallothionein. Biochem. Cell Biol. 65,
1001–1005.
Lee J., Shim D., Song W. Y., Hwang I. and Lee Y. 2004 Arabidopsis
metallothioneins 2a and 3 enhance resistance to cadmium when
expressed in Vicia faba guard cells. Plant Mol. Biol. 54, 805–815.
Margoshes M. and Vallee B. L. 1957 A cadmium protein from
equine imaging hyperintensity in Alzheimer’s disease, correlation with kidney cortex. J. Am. Chem. Soc. 79, 4813–4814.
McDonald M. 1999 Seed deterioration, physiology repair and
assessment. Seed Sci. Technol. 27, 177–238.
Menezes-Benavente L., Kernodle S. P., Margis-Pinheiro M. and
Scandalios J. G. 2004 Salt-induced antioxidant metabolism
defenses in maize Zea mays L. seedlings. Redox Rep. 9, 29–36.
Mir G., Domenech J., Huguet G., Guo W.J., Goldsbrough P., Atrian
S. and Molinas M 2004 A plant type 2 metallothionein MT from
cork tissue responds to oxidative stress. J. Exp. Bot. 55, 2483–
2493.
Moyle R., Fairbairn D. J., Ripi J., Crowe M. and Botella J. R. 2005
Developing pineapple fruit has a small transcriptome dominated
by metallothionein. J. Exp. Bot. 56, 101–112.
Murray M. and Thompson W. F. 1980 Rapid isolation of high
molecular weight plant DNA. Nucleic Acids Res. 8, 4321–4326.
Navabpour S., Morris K., Allen R., Harrison E., A-H-Mackerness
S. and Buchanan-Wollaston V. 2003 Expression of senescenceenhanced genes in response to oxidative stress. J. Exp. Bot. 54,
2285–2292.
Nezhad R. M., Shahpiri A. and Mirlohi A. 2013 Heterologous
expression and metal-binding characterization of a type 1 metallothionein isoform OsMTI-1b from rice Oryza sativa. Protein J.
32, 131–137.
Nishiuchi S., Liu S. and Takano T. 2007 Isolation and characterization of a metallothionein-1 protein in Chloris virgata Swartz that
enhances stress tolerances to oxidative, salinity and carbonate
stress in Saccharomyces cerevisiae. Biotechnol. Lett. 29, 1301–
1305.
Ortiz D. F., Kreppel L., Speiser D. M., Scheel G., McDonald
G. and Ow D. W. 1992 Heavy metal tolerance in the fission
yeast requires an ATP-binding cassette-type vacuolar membrane
transporter. EMBO J. 11, 3491–3499.
Rauser W. E. 1999 Structure and function of metal chelators
produced by plants. Cell Biochem. Biophys. 31, 19–48.
Robinson N. J., Tommey A. M., Kuske C. and Jackson P. J. 1993
Plant metallothioneins. Biochem. J. 295, 1–10.
Samardzic J. T., Nikolic D. B., Timotijevic G. S., Jovanovic Z. S.,
Milisavljevic M. D. and Maksimovic V. R. 2010 Tissue expression analysis of FeMT3, a drought and oxidative stress related
metallothionein gene from buckwheat Fagopyrum esculentum.
J. Plant Physiol. 167, 1407–1411.
Sheen J. 2001 Signal transduction in maize and Arabidopsis mesophyll protoplasts. Plant Physiol. 127, 1466–1475.
Tamura K., Dudley J., Nei M. and Kumar S. 2007 MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0.
Mol. Biol. Evol. 24, 1596–1599.
Thirumoorthy N., Manisenthil Kumar K. T., Shyam Sundar A.,
Panayappan L. and Chatterjee M. 2007 Metallothionein, an
overview. World J. Gastroenterol. 13, 993–996.
Usha B., Keeran N., Harikrishnan M., Kavitha K. and Parida A.
2011 Characterization of a type 3 metallothionein isolated from
Porteresia coarctata. Biol. Plant. 55, 119–124.
Vögeli-Lange R. and Wagner G. J. 1990 Subcellular localization
of cadmium and cadmium-binding peptides in tobacco leaves.
Implication of a transport function for cadmium-binding peptides. Plant Physiol. 92, 1086–1093.
Wong H. L., Sakamoto T., Kawasaki T., Umemura K. and
Shimamoto K. 2004 Down-regulation of metallothionein, a
reactive oxygen scavenger., by the small GTPase OsRac1 in rice.
Plant Physiol. 135, 1447–1456.
Wu J. P. and Chen H. C. 2005 Metallothionein induction and
heavy metal accumulation in white shrimp Litopenaeus vannamei exposed to cadmium and zinc. Comp. Biochem. Physiol. C
Toxicol. Pharmacol. 140, 383–394.
Xia Y., Qi Y., Yuan Y., Wang G., Cui J., Chen Y. et al. 2012 Overexpression of Elsholtzia haichowensis metallothionein 1 EhMT1
in tobacco plants enhances copper tolerance and accumulation
in root cytoplasm and decreases hydrogen peroxide production.
J. Hazard. Mater. 233, 23465–23471.
Xue T., Li X., Zhu W., Wu C., Yang G. and Zheng C. 2009 Cotton
metallothionein GhMT3a, a reactive oxygen species scavenger,
increased tolerance against abiotic stress in transgenic tobacco
and yeast. J. Exp. Bot. 60, 339–349.
Yang Z., Wu Y., Li Y., Ling H. Q. and Chu C. 2009 OsMT1a,
a type 1 metallothionein plays the pivotal role in zinc homeostasis and drought tolerance in rice. Plant Mol. Biol. 70, 219–
229.
Journal of Genetics, Vol. 93, No. 3, December 2014
717
Shumei Jin et al.
Yuan J., Chen D., Ren Y., Zhang X. and Zhao J. 2008 Characteristic and expression analysis of a metallothionein gene,
OsMT2b, down-regulated by cytokinin suggests functions in root
development and seed embryo germination of rice. Plant Physiol.
146, 1637–1650.
Zhang X., Liu S. and Takano T. 2008 Two cysteine proteinase
inhibitors from Arabidopsis thaliana, AtCYSa and AtCYSb,
increasing the salt, drought, oxidation and cold tolerance. Plant
Mol. Biol. 68, 131–143.
Zhigang A., Cuijie L., Yuangang Z., Yejie D., Wachter A., Gromes
R. and Rausch T. 2006 Expression of BjMT2, a metallothionein
2 from Brassica juncea, increases copper and cadmium tolerance
in Escherichia coli and Arabidopsis thaliana, but inhibits root
elongation in Arabidopsis thaliana seedlings. J. Exp. Bot. 57,
3575–3582.
Zhou J. and Goldsbrough P. B. 1994 Functional homologs of fungal metallothionein genes from Arabidopsis. Plant Cell 6, 875–
884.
Zhou G., Xu Y., Li J., Yang L. and Liu J.Y. 2006 Molecular analyses of the metallothionein gene family in rice Oryza sativa L. J.
Biochem. Mol. Biol. 39, 595–606.
Zhou Y., Chu P., Chen H., Li Y., Liu J., Ding Y., Tsang
E. W., Jiang L., Wu K. and Huang S. 2012 Overexpression of Nelumbo nucifera metallothioneins 2a and 3 enhances
seed germination vigour in Arabidopsis. Planta 235, 523–
537.
Zhu W., Zhao D. X., Miao Q., Xue T. T., Li X. Z. and Zheng C.
C. 2009 Arabidopsis thaliana metallothionein, AtMT2a, mediates ROS balance during oxidative stress. J. Plant Biol. 52, 585–
592.
Received 11 December 2013, in final revised form 20 May 2014; accepted 30 May 2014
Unedited version published online: 25 June 2014
Final version published online: 28 October 2014
718
Journal of Genetics, Vol. 93, No. 3, December 2014