Published Ahead of Print on October 15, 2015, as doi:10.3324/haematol.2015.134221.
Copyright 2015 Ferrata Storti Foundation.
Ineffective Erythropoiesis Caused by Binucleated Late-Stage
Erythroblasts in mDia2 Hematopoietic Specific Knockout Mice
by Yang Mei, Baobing Zhao, Jing Yang, Juehua Gao, Amittha Wickrema, Dehua Wang,
Yihua Chen, and Peng Ji
Haematologica 2015 [Epub ahead of print]
Citation: Mei Y, Zhao B, Yang J, Gao J, Wickrema A, Wang D, Chen Y, and Ji P. Ineffective Erythropoiesis
Caused by Binucleated Late-Stage Erythroblasts in mDia2 Hematopoietic Specific Knockout Mice.
Haematologica. 2015; 100:xxx
doi:10.3324/haematol.2015.134221
Publisher's Disclaimer.
E-publishing ahead of print is increasingly important for the rapid dissemination of science.
Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that
have completed a regular peer review and have been accepted for publication. E-publishing
of this PDF file has been approved by the authors. After having E-published Ahead of Print,
manuscripts will then undergo technical and English editing, typesetting, proof correction and
be presented for the authors' final approval; the final version of the manuscript will then
appear in print on a regular issue of the journal. All legal disclaimers that apply to the
journal also pertain to this production process.
Ineffective Erythropoiesis Caused by Binucleated Late-Stage Erythroblasts in mDia2
Hematopoietic Specific Knockout Mice
Yang Mei1, Baobing Zhao1, Jing Yang1, Juehua Gao1, Amittha Wickrema2, Dehua Wang3, Yihua
Chen1, and Peng Ji1
1. Department of Pathology, Feinberg School of Medicine, Northwestern University, Chicago, IL
60611, USA
2. Section of Hematology/Oncology, Department of Medicine, The University of Chicago,
Chicago, IL 60637, USA
3. Division of Pathology and Laboratory Medicine, Cincinnati Children’s Hospital Medical
Center, Cincinnati, OH 45229, USA
Running heads: Loss of mDia2 causes ineffective erythropoiesis
Correspondence to:
Peng Ji, M.D., Ph.D.
Department of Pathology
Feinberg School of Medicine, Northwestern University
303 East Chicago Avenue, Ward 3-210
Chicago, IL 60611
Tel: 312-503-3191 Fax: 312-503-8240
Email: [email protected]
1
Word count:
Main text:1504; Figures: 3; Supplemental file: 1
Acknowledgements:
The authors thank Drs. Jing Zhang and John Crispino for helpful discussion, Dr. Lynn Doglio of
the Transgenic and Targeted Mutagenesis Laboratory of Northwestern University for the help of
generating mDia2 conditional knockout mice, Dr. Lin Li of the Mouse Histology and
Phenotyping Laboratory of Northwestern University for the help with mouse histology. The
work is supported by a Pathway to Independence award from National Institute of Health
(R00HL102154) and an American Society for Hematology (ASH) scholar award to P.J.
2
The generation of mature red blood cells is initiated from the commitment of hematopoietic stem
cells to erythroid progenitors, which is followed by their differentiation to a series of
morphologically recognizable erythroblasts1. At the end of terminal erythropoiesis, the highly
condensed nucleus migrates to one side of the cytoplasm of orthochromatic erythroblast, which
is followed by the unique enucleation process producing reticulocytes and mature red blood
cells2-4. Our previous study demonstrated that mDia2, which belongs to the mDia formin protein
family5, is a downstream effector protein of Rac GTPases regulating late-stage terminal
erythropoiesis, especially enucleation6. Here we generated conditional mDia2 knockout mouse
models to reveal the roles of mDia2 in adult erythropoiesis. The conditional mDia2 knockout
mouse models utilized an mDia2 targeting allele with exons 10 and 11 floxed. The LacZ and
neomycin cassettes were flanked by FRT to be removed by FLP recombinase (Online
Supplementary Figure S1A). We first crossed mDia2fl/+ mice with E2A-Cre transgenic mice to
generate whole body mDia2 knockout mice. The depletion of mDia2 mRNA and protein were
confirmed by real time-PCR and western blot assays (Online Supplementary Figure S1B and C,
respectively). Same as previously reported7, mDia2fl/fl E2A-Cre mice were never generated alive
(Online Supplementary Figure S1D). We found that the mDia2 knockout embryos die in uterus
at approximately embryonic day 12.5 (E12.5) (Online Supplementary Figure S1E). This
demonstrates that mDia2 is essential for embryonic development, which compromises the study
of the roles of mDia2 in vivo in adult.
To determine the specific roles of mDia2 in adult erythropoiesis, we crossed mDia2fl/fl mice with
Mx-Cre transgenic mice in which Cre recombinase is under the control of the interferon
3
inducible promoter of Mx-1 gene8. Relative hematopoietic cell specific mDia2 inducible
knockout mice were generated by polyinosinic:polycytidylic acid (poly-IC) peritoneal injection
when the mDia2fl/fl Mx-Cre mice were 6 weeks old. mDia2fl/fl and mDia2+/+Mx-Cre mice with
the same poly-IC injection were used as controls. Ten weeks after poly-IC injection, the
depletion of mDia2 in bone marrow cells was confirmed (Online Supplementary Figure S2A).
mDia2fl/flMx-Cre mice exhibited significant anemia demonstrated by the decreased hemoglobin,
total red blood cell count, and hematocrit (Figure 1A and data not shown). Red cell distribution
width (RDW) is dramatically increased, reflecting variation of the size of red blood cells (Figure
1A). These changes in red blood cell indices were specific since total white blood cell count
remained unchanged (Figure 1A). These results indicate that mDia2 plays a unique role in the
erythroid lineage.
We next examined the morphology of the hematopoietic cells from mDia2fl/fl Mx-Cre mice. In
peripheral blood, these mice exhibited anemia with anisopoikilocytosis including macrocytes,
microcytes, occasional spherocytes, and hypochromic cells, which is consistent with the
increased RDW. Polychromasia was relatively increased with abnormally large reticulocytes
(Figure 1B). The morphology of granulocytes and lymphocytes from these mice were similar to
those from the controls (data not shown). These results indicate that mDia2 could be functionally
important to maintain the membrane and cytoskeletal integrity of the mature red blood cells.
Additionally, we generated mDia2fl/flVav-Cre mice that showed the same phenotypes as
mDia2fl/flMx-Cre mice (Online Supplementary Figure S2B).
4
To determine the etiology of these abnormalities, we analyzed the bone marrow and spleen cells
from mDia2fl/flMx-Cre and control mice 10 weeks after poly-IC injection. Terminal
differentiation of bone marrow CD45 negative erythroid cells was examined using flow
cytometric analysis of CD44 surface expression together with forward scatter9. In this assay, the
CD45 negative erythroid cells were further gated based on their surface levels of CD44, which
gradually decreases during cell maturation10. As previously reported, we divided the cells into
six populations. From the early-stage erythroblasts to more mature forms, populations I to VI
represent proerythroblasts, basophilic erythroblasts, polychromatic erythroblasts, orthochromatic
erythroblasts, reticulocytes, and mature red blood cells, respectively. Compared to the controls,
bone marrow erythroblasts from populations I to III were proportionally increased in
mDia2fl/flMx-Cre mice. In contrast, populations IV to VI, especially population V (reticulocytes),
were dramatically decreased (Figure 1, C and D). Populations I to III in spleen were also
proportionally increased. However, populations IV to VI remained relatively stable compared to
the controls (Figure 1, E and F).
These results reveal that loss of mDia2 in hematopoietic cells causes 1) a significant ineffective
erythropoiesis in which most of the erythroid precursors are blocked in the orthochromatic to
reticulocyte stages, which is consistent with previous studies that mDia2 is critical for
enucleation of late stage erythroblasts6; 2) an extramedullary erythropoiesis in spleen that
compensates ineffective erythropoiesis in bone marrow, which is also demonstrated by the
prominent splenomegaly in mDia2fl/flMx-Cre mice (Online Supplementary Figure S2C). We next
analyzed the cell survival profiles of the Ter119 positive erythroid cells in bone marrow and
5
spleen of mDia2fl/flMx-Cre mice. A statistically significant portion of the erythroid cells in bone
marrow, but not in spleen, underwent cell death although the increase in cell death was relatively
small (Online Supplementary Figure S2D). We further confirmed the same phenotypes,
including increased spleen size and ineffective erythropoiesis in bone marrow and
extramedullary erythropoiesis in spleen, in mDia2fl/flVav-Cre mice (Online Supplementary
Figure S2E-G). Taken together, these data demonstrate that ineffective erythropoiesis contributes
to the major pathology of mDia2 hematopoietic specific knockout mice.
To find out the underlying pathology of ineffective erythropoiesis, we compared the morphology
of bone marrow cells from mDia2fl/flMx-Cre and control mice. Strikingly, many erythroblasts in
mDia2fl/flMx-Cre mice were binucleated (Figure 2A). Notably, most of the binucleated
erythroblasts were in the polychromatic to orthochromatic stages of differentiation. Consistent
with the findings in the peripheral blood, no abnormal changes were evident in the myeloid or
lymphoid lineages (Figure 2A).
To quantify the bi-and multi-nucleated erythroblasts in mDia2fl/flMx-Cre mice, we labeled the
bone marrow cells with DNA staining dye similar to what is used in cell cycle analysis. In this
way, the bi-and multi-nucleated cells will be manifested in and beyond the G2/M phase,
respectively. Clearly, the Ter119 positive erythroblasts from both bone marrow (Figure 2, B and
C) and spleen (Figure 2, D and E) in mDia2fl/flMx-Cre mice showed a dramatic increase in G2/M
phase compared to their counterparts in control mice. The multinucleated erythroblasts were also
increased in mDia2fl/flMx-Cre mice, whereas they were absent in control mice (Figure 2, C and
6
E). The same increase of binucleated and multinucleated cells was similarly present in mDia2fl/fl
Vav-Cre mice (Figure 2, F and G). When analyzed in different developmental stages of terminal
erythropoiesis based on CD44 expression in mDia2fl/flMx-Cre mice (Figure 1C), we found that
most of the binucleated erythroblasts were in stage IV orthochromatic phase of differentiation in
bone marrow (Figure 2H). This is consistent with the morphologic findings (Figure 2A).
To further understand the mechanism of mDia2 in erythropoiesis, we used a well established
mouse erythroblasts in vitro differentiation system11-13. Compared to the controls, the lineage
negative cells from mDia2fl/flMx-Cre mice showed significantly decreased proliferation,
differentiation, and enucleation (Online Supplementary Figure S3A, B, and C, respectively).
Morphologic analysis of the erythroid cells with loss of mDia2 revealed frequent binucleated and
enucleating cells (Online Supplementary Figure S3D), further confirming the in vivo assays and
the cell autonomous defects. These binucleated cells are mostly present in Ter119 positive
erythroblasts but not in the Ter119 negative cells and appeared at the late stages of terminal
differentiation at 48 h or 72 h (Online Supplementary Figure S3E and F), again confirming the
in vivo findings.
We next attempted to rescue anemia in mDia2 deficient mice. Previous reports showed that
macrophages contribute to the pathogenesis of ineffective erythropoiesis in beta-thalassemia14,15.
Depletion of macrophages by a single dose of clodronate significantly improves anemia in betathalassemia mouse model14. We therefore treated these mice similarly with a single dose of
clodronate, followed by complete blood count and blood smear examination. This treatment led
7
to a significant improvement of anemia as indicated by increased red blood cell counts,
hemoglobin levels and hematocrit (Figure 3A and B). We confirmed the depletion of
macrophages in bone marrow (Online Supplementary Figure S4A and B). Bone marrow
examination also showed that clodronate reduced the percentage of early stage erythroblasts
whereas reticulocytes and red blood cells (populations V and VI, respectively) were significantly
increased (Figure 3C). Although spleen already showed compensation in mDia2 conditional
knockout mice (Online Supplementary Figure S2G), clodronate treatment further reduced the
early stage ineffective erythroblasts (Figure 3D). Consistently, the improved erythropoiesis in
bone marrow and spleen led to a normalized spleen weight (Figure 3E). These results further
demonstrate the therapeutic effects of macrophage depletion in the treatment of ineffective
erythropoiesis.
In summary, our study reveals the key roles of mDia2 in adult terminal erythropoiesis. Loss of
mDia2 affects terminal erythropoiesis particularly in the orthochromatic stage by compromising
cytokinesis and enucleation of the condensed nuclei. This leads to the inhibition of
differentiation of the early-stage erythroblasts. These pathologic features closely mimic certain
inherited diseases in human such as congenital dyserythropoietic anemia, which indicates that
mDia2 may play a role in its pathogenesis. Additionally, the mDia2 conditional and tissue
specific knockout mouse models also provide tools to study the functions of mDia2 in different
organ systems.
8
Authorship and Disclosures
Y.M. and P.J. designed the research. Y.M., B.Z. and J.Y. performed the experiments. J.G., D.W.,
Y.C., and P.J. analyzed the pathology of the mice. Y.M., Y.C., A.W., and P.J. analyzed all the
other data. P.J. wrote the paper. The authors report no potential conflicts of interests.
9
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Hattangadi SM, Wong P, Zhang L, Flygare J, Lodish HF. From stem cell to red cell:
regulation of erythropoiesis at multiple levels by multiple proteins, RNAs, and chromatin
modifications. Blood. 2011;118(24):6258–6268.
Ji P, Murata-Hori M, Lodish HF. Formation of mammalian erythrocytes: chromatin
condensation and enucleation. Trends Cell Biol. 2011;21(7):409–415.
Ji P. New Insights into the Mechanisms of Mammalian Erythroid Chromatin
Condensation and Enucleation. Elsevier Ltd; 2015.
Keerthivasan G, Wickrema A, Crispino JD. Erythroblast enucleation. Stem Cells Int.
2011;2011:139851.
Faix J, Grosse R. Staying in shape with formins. Dev Cell. 2006;10(6):693–706.
Ji P, Jayapal SR, Lodish HF. Enucleation of cultured mouse fetal erythroblasts requires
Rac GTPases and mDia2. Nat Cell Biol. 2008;10(3):314–321.
Watanabe S, De Zan T, Ishizaki T, et al. Loss of a Rho-Regulated Actin Nucleator,
mDia2, Impairs Cytokinesis during Mouse Fetal Erythropoiesis. Cell Reports.
2013;5(4):926–932.
Kühn R, Schwenk F, Aguet M, Rajewsky K. Inducible gene targeting in mice. Science.
1995;269(5229):1427–1429.
Liu J, Zhang J, Ginzburg Y, et al. Quantitative analysis of murine terminal erythroid
differentiation in vivo: novel method to study normal and disordered erythropoiesis.
Blood. 2013;121(8):e43–9.
Liu J, Mohandas N, An X. Membrane assembly during erythropoiesis. Curr Opin
Hematol. 2011;18(3):133–138.
Zhang J, Socolovsky M, Gross AW, Lodish HF. Role of Ras signaling in erythroid
differentiation of mouse fetal liver cells: functional analysis by a flow cytometry-based
novel culture system. Blood. 2003;102(12):3938–3946.
Socolovsky M, Fallon AE, Wang S, Brugnara C, Lodish HF. Fetal anemia and apoptosis
of red cell progenitors in Stat5a-/-5b-/- mice: a direct role for Stat5 in Bcl-X(L) induction.
Cell. 1999;98(2):181–191.
Shuga J, Zhang J, Samson LD, Lodish HF, Griffith LG. In vitro erythropoiesis from bone
marrow-derived progenitors provides a physiological assay for toxic and mutagenic
compounds. Proc Natl Acad Sci USA. 2007;104(21):8737–8742.
Ramos P, Casu C, Gardenghi S, et al. Macrophages support pathological erythropoiesis in
polycythemia vera and β-thalassemia. Nat Med. 2013;19(4):437–445.
Chow A, Huggins M, Ahmed J, et al. CD169 macrophages provide a niche promoting
erythropoiesis under homeostasis and stress. Nat Med. 2013;19(4):429–436.
10
FIGURE LEGENDS
Figure 1. Hematopoietic specific mDia2 knockout mice develop anemia and ineffective
erythropoiesis.
(A) Hemoglobin, peripheral red blood cell count, red blood cell distribution width (RDW) and
absolute white blood cell count from age matched control (mDia2fl/fl, N=11 and mDia2+/+MxCre, N=11) and hematopoietic specific knockout (mDia2fl/flMx-Cre, N=8) mice 10 weeks post
the first poly-IC injection. (B) Wright-Giemsa stains of peripheral blood smear from indicated
mice. Scale bars: 15 μm. (C-F) Flow cytometric analysis of CD44 and forward scatter levels of
CD45 negative erythroblasts from the bone marrow (C) and spleen (E) of indicated mice.
Populations I-VI were defined as proerythroblasts, basophilic erythroblasts, polychromatic
erythroblasts, orthochromatic erythroblasts, reticulocytes, and red blood cells, respectively9.
Statistical analysis of (C) and (E) were shown in (D) and (F) respectively. N=3 in each group. *
P<0.05; ** P<0.005; *** P<0.0005.
Figure 2. Loss of mDia2 causes binucleated late-stage erythroblasts in adult mice.
(A) Wright-Giemsa stains of bone marrow smear from indicated mice. Black and red arrows
indicate normal and binucleated erythroblasts, respectively. Scale bars: 15 μm. (B-C) Cell cycle
analysis of the nucleated Ter119 positive erythroid cells in bone marrow of the indicated mice.
Statistical analysis of each phase of the cell cycle was shown in (C). N=3 in each group. (D-E)
Cell cycle analyses as in B and C except the experiments were performed in spleen of the
indicated mice. N=3 in each group. (F-G) Nucleated Ter119+ erythroblasts from bone marrow
(F) and spleen (G) of the mDia2fl/flVav-Cre and control mice were gated for cell cycle analysis as
11
in (B) and (D). Representative plots are presented. (H) The cell cycle analysis was performed on
the gated populations from bone marrow as in Figure 1C. Representative plots of cells from the
indicated populations were presented as duplicate in each group. All the experiments were
repeated at least three times.
Figure 3. Macrophage depletion alleviates anemia and ineffective erythropoiesis in mDia2
hematopoietic specific knockout mice.
(A) Eight-week old littermate mice with indicated genotypes were retro-orbitally injected with a
single dose of clodronate-liposomes (150μl) or vehicle control (Phosphate buffered salineliposomes). Peripheral blood was collected two days after injection and the indicated red blood
cell indices were measured using an automated hematology analyzer. (B) Wright-Giemsa stains
of peripheral blood smear from indicated mice. Scale bars: 10 μm. (C-D) Quantification of
populations I-VI from flow cytometric analysis of terminal erythropoiesis in bone marrow (C)
and spleen (D) of indicated mice as in Figure 1C and 1E. N = 5 in each group. (E) Quantification
of spleen size of indicated mice (Left). Photographs of spleens from mDia2fl/flVav-Cre mice
treated with vehicle control and clodronate-liposomes (Right). N = 5 in each group.
12
Supplemental Methods
Materials
Iscove modified Dulbecco medium (IMDM, 12440-046) was purchased from Gibco. Fetal
bovine serum (Cat#06200) and bovine serum albumin (Cat#09300) were purchased from Stem
Cell Technologies, Recombinant human insulin (I9278) and recombinant human holo-transferrin
(T1283) were ordered from Sigma-Aldrich. Penicillin-streptomycin and L-glutamine were
purchased from HyClone. Erythropoietin (Epo, NDC 59676-310-00) was purchased from
Amgen. The biotin mouse lineage panel (Cat#559971) was purchased from BD Pharmingen to
mark lineage positive cells or to positively or negatively select lineage positive cells from mouse
bone marrow cells. The phycoerythrin (PE)–conjugated antibodies rat anti-mouse CD11b/Mac1
(M1/70, Cat#553311), PE-CD8α (53-6.7, Cat#553033), PE-CD45.1 (A20, Cat#553776),
Fluorescein isothiocyanate (FITC)-CD45.1 (A20, Cat#11-0453-85) and Cy5-Annexin V
(Cat#559934) were obtained from BD Pharmingen. Allophycocyanin (APC)-conjugated antimouse CD45.2 (109814) were purchased from Biolegend. FITC-conjugated CD71 (R17217, SC52504) was purchased from Santa Cruz Biotech. PE-human/mouse CD44 (IM7, 12-0441-82),
PE-mouse Ter119 (Ter119, 12-5921-83), APC-mouse Ter119 (Ter119, 17-5921-83), PECyanine 7(PE-Cy7)-mouse CD4 (GK1.5, 25-0041-81), PE-Cy7-Gr1 (RB6-8C5, 25-5931-81),
Pacific Blue-human/mouse B220 (RA3-6B2, 11-0452-82) and FITC-CD45.2 (104, Cat#11-045485) antibodies were purchased from eBiosciences. Hoechst 33342, 4,6 diamidino-2phenylindole, and rhodamine phalloidin were purchased from Molecular Probes, Invitrogen.
Polyclonal anti-mouse mDia2 antibody was generated by immunizing rabbits with mDia2
proteins according to standard procedure.
RNA extraction and quantitative RT-PCR
The total RNA was extracted using Trizol reagent according to the manufacturer’s protocol (life
technologies). 1µg total RNA was used for the reverse transcription by qScript cDNA supermix
(Quanta Biosciences). Relative mRNA expression levels of various genes were assessed by
QRT-PCR. Each template was tested in triplicate. The abundance of each gene was normalized
to 18s rRNA. The primer sequences used in this study were mDia1 forward 5’GGACTGCTTCTGGACAAAGG-3’; reverse 5’-TCTCCACCTTCTTGATCCTTCT-3’; mDia3
forward
5’-
AATCTTCTGGAAGCCCTACAGT;
reverse
5’-
GGCCGTCTGTTATCTGGATTTC-3’; mDia2 forward 5’- AGCCTTGACTTCAGCTGGAG3’;
reverse
5’-
GGTGAAGCCTGAAGTCCAAA-3’;
18s
rRNA
forward
5’-
GCAATTATTCCCCATGAACG-3’; reverse 5’- GGCCTCACTAAACCATCCAA-3’.
Flow cytometric and cell cycle analysis
For bone marrow, mouse bone marrow cells were flushed using a syringe with 30.5G needle and
passed through a 40μm cell strainer. The single cell suspensions were labeled with appropriate
antibodies in FACS buffer (1×PBS containing 0.5% BSA and 2mM EDTA) for 15 min at room
temperature, washed and resuspended in FACS buffer. Propidium iodide (PI) or 4’, 6 diamidino2-phenylindole (DAPI) was added at the final step to exclude the dead cells. The cells were then
analyzed by BD FACSCanto II flow analyzer and the data were further analyzed by FlowJo
software.
For peripheral blood, approximately 50~80μl tail vein or retro-orbital blood from mice were
collected in BD microtainer tubes with EDTA supplied by BD Biosciences. The blood was first
assayed by complete blood count (CBC) test, and was then resuspended in red blood cell (RBC)
lysis buffer for 5-7 minutes on ice with intermittent mixing. Immediately after incubation, the
RBC lysed cells were washed with ice cold PBS and passed through a 40μm cell strainer, which
were then labeled with appropriate antibodies for flow cytometry analysis as detailed above.
For spleen, after measuring the weight, the whole spleen was dispersed into single cell
suspensions of splenocytes by homogenization using the frosted ends of the slides and passing
through 40μm cell strainer. The cells were then labeled with appropriate antibodies for further
flow cytometric analysis.
To analyze the cell cycle distribution of erythroblast cells from bone marrow and spleen, the
single cell suspensions were incubated with phycoerythrin (PE) or allophycocyanin (APC)–
conjugated Ter119 antibodies, washed with FACS buffer and resuspended in IMDM containing
Vybrant DyeCycle Violet (V35003) from Molecular Probes, Invitrogen. The cells were kept at
37˚C for 30 min. Propidium iodide (PI) was added prior to flow cytometry acquisition to exclude
the dead cells. The DNA low population defined as RBCs was eliminated from Ter119 positive
cells and the DNA content distribution of remaining nucleated cells (defined as erythroblasts) are
then analyzed by histogram and Watson (Pragmatic) model with FlowJo software.
Mice genotyping
The genotype of Diap3 floxed alleles was assayed by genomic PCR using the follow primers:
forward:
5’-
CTACCAACCTACCCATCCATC-3’;
reverse:
5’-
CGAGAGCATTTATGAGCTGCATACAA-3’. Primers for mDia2-deficient allele genotyping,
forward: 5’- TTGGCTGTTCTGGAAGTTGC-3’; reverse: 5’- CAGCAGCATTCCTTTCCACA-
3’.
For
Flp
transgenic
mice
genotyping,
the
primers
are
forward:
5’-
CACCACCTAAGGTGCTTGTTC-3’; reverse: 5’-CTGCTTCTTCCGATGATTCG-3’ (PCR
product ~370bp). The Cre primers for both Mx1-Cre and E2A-Cre are forward: 5’CGTACACCAAAATTTGCCTGC-3’; reverse: 5’-CTAGAGCCTGTTTTGCACGTT-3’ (PCR
product
~390bp).
Primers
for
AGATGCCAGGACATCAGGAACCTG-3’;
Vav-Cre
are
forward:
reverse:
5’5’-
ATCAGCCACACCAGACACAGAGATC-3’ (PCR product ~240bp). All the experiments were
conducted in accordance with the Guide for the Care and Use of Laboratory Animals and were
approved by the Institutional Animal Care and Use Committees at Northwestern University.
Supplemental Figures
Figure S1. Generation of conditional mDia2 knockout mice and the phenotypes of mDia2fl/fl
E2A-Cre mice.
(A) Schematic representations of the wide type and targeted mDia2 alleles. Positions of primers
for genomic DNA PCR are indicated by blue arrows and the expected length of the PCR band
are shown in aqua lines on the lower panel. The genotyping PCR on a 2% agarose gel was
shown. (B) Quantification of mRNA levels of Diap1, 2 and 3 of indicated E9 live embryos by a
quantitative real time PCR assay. WT (mDia2+/+ E2A-Cre): N=2, Het (mDia2fl/+ E2A-Cre): N=4,
KO (mDia2fl/fl E2A-Cre): N=2. (C) Western blotting analysis of mDia2 and mDia1 from E9
embryos lysates of the wild type (WT) and mDia2fl/fl E2A-Cre (KO). HSC70 was used as a
loading control. (D) Genotype analysis of the offspring from mDia2fl/+ E2A-Cre heterozygous
mating. (E) Representative photographs show the conditional knockout of mDia2 in the early
stage of embryonic development causing embryonic lethality at approximately E12.5.
Figure S2. mDia2 hematopoietic specific knockout mice develop ineffective erythropoiesis
and splenomegaly.
(A) Relative mDia2 mRNA levels in cells from brain and bone marrow of age matched control
(mDia2fl/fl and mDia2+/+Mx-Cre) and hematopoietic specific knockout (mDia2fl/flMx-Cre) mice 10
weeks after the first poly-IC injection. (B) Peripheral blood hemoglobin, RBC, RDW and WBC
count from 6-8 weeks aged control (mDia2fl/fl, N=6), hematopoietic specific heterozygous
(mDia2fl/+Vav-Cre, N=6), and knockout (mDia2fl/flVav-Cre, N=13) mice. (C) Quantification of
spleen weight and representative photographs from mDia2 control and Mx-Cre conditional
knockout mice. (D) Statistical summary of flow cytometric analysis of the relative percentage of
the survival cells in Ter119 positive cells derived from bone marrow and spleen of the indicated
mice. (E-G) Quantifications of I-VI populations, assayed by flow cytometric analysis of CD44
expression and forward scatter as in Figure 1C and 1E, were shown in (E) for bone marrow and
in (F) for spleen from mDia2fl/flVav-Cre and control mice. Quantitative analysis of spleen weight
from these mice was shown in (G). All the experiments were repeated at least three times.
Figure S3. Impaired terminal erythropoiesis and formation of binucleated erythroblasts of
mDia2 deficient hematopoietic progenitor cells in vitro
(A-C) Lineage negative bone marrow progenitor cells were purified from the indicated mice and
cultured in erythropoietin containing medium. Relative cell proliferation rate during in vitro
erythroid differentiation culture was shown in (A) at indicated time point. The percentages of
CD71 and Ter119 double positive cells were shown in (B) for differentiation assay. The
percentages of enucleation were presented in (C), respectively. (D) Wright-Giemsa stains of
representative cultured late stage erythroblasts of (A-C) from mDia2+/+Mx-Cre (control) and
mDia2fl/flMx-Cre mice at 48hr. Scale bars: 3 µm. (E-F) Cell cycle analysis of the Ter119 positive
(E) and negative cells (F) from (A) at indicated time point.
Figure S4 Clodronate eliminates macrophage in bone marrow and spleen.
Flow cytometric analysis of bone marrow (BM) and spleen cells after clodronate treatment by
staining cells with CD11b and F4/80. Representative plots are presented in (A). Quantitative
analysis of the percentages of macrophage is shown in (B). N=5 in each group.