Plant Physiology Preview. Published on December 5, 2013, as DOI:10.1104/pp.113.228783
REVOLUTA pleiotropy in natural populations
Carl J. Douglas
Department of Botany, University of British Columbia
6270 University Blvd. Vancouver, B.C. V6T 1Z4, Canada
604-822-2618
[email protected]
Genes, Development and Evolution
1
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Copyright 2013 by the American Society of Plant Biologists
Research Report
Extensive functional pleiotropy of REVOLUTA substantiated through forward
genetics
Ilga Porth1,2*, Jaroslav Klápště2,3*, Athena D. McKown2*, Jonathan La Mantia2*, Richard C.
Hamelin2, Oleksandr Skyba1, Faride Unda1, Michael C. Friedmann4, Quentin C. B. Cronk4,
Jürgen Ehlting5, Robert D. Guy2, Shawn D. Mansfield1, Yousry A. El-Kassaby2 and Carl J.
Douglas4
*These authors contributed equally to the study
1
Department of Wood Science, University of British Columbia, Vancouver, BC V6T 1Z4,
Canada
2
Department of Forest and Conservation Sciences, University of British Columbia, Vancouver,
BC V6T 1Z4, Canada
3
Department of Dendrology and Forest Tree Breeding, Faculty of Forestry and Wood Sciences,
Czech University of Life Sciences, Prague, 165 21, Czech Republic
4
Department of Botany, University of British Columbia, Vancouver, BC V6T 1Z4, Canada
5
Department of Biology and Centre for Forest Biology, University of Victoria, Victoria, BC,
V8W 3N5, Canada
Corresponding author:
Carl J. Douglas
Tel: +1 604 822 2618
Email: [email protected]
A functional hypothesis model is presented for the extensive functional pleiotropy of the
poplar Class III homeodomain-leucine zipper transcription factor gene REVOLUTA in
modulating extensive phenotypic variability.
2
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
This work was supported by Genome British Columbia Applied Genomics Innovation Program
(Project 103BIO) and Genome Canada Large-Scale Applied Research Project (Project 168BIO),
funds to RCH, QCBC, JE, RDG, SDM, YE-K, and CJD.
Corresponding author:
Carl J. Douglas
Email: [email protected]
3
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
ABSTRACT
In plants, genes may sustain extensive pleiotropic functional properties by individually affecting
multiple, distinct traits. We discuss results from three genome-wide association studies of ca. 400
natural Populus trichocarpa (poplar; black cottonwood) accessions phenotyped for 60
ecological/biomass, wood quality and rust fungus resistance traits. Single nucleotide
polymorphisms (SNPs) in the poplar ortholog of the Class III homeodomain-leucine zipper (HD
ZIP) transcription factor gene REVOLUTA (popREV) were significantly associated with three
specific traits. Based on SNP associations with fungal resistance, leaf drop, and cellulose
content, the popREV gene contains three potential regulatory sites within non-coding regions at
the gene’s 3’end where alternative splicing and messenger RNA (mRNA) processing actively
occurs. The polymorphisms in this region associated with leaf abscission and cellulose content
are suggested to represent more recent variants, whereas the SNP associated with leaf rust
resistance may be more ancient, consistent with REV’s primary role in auxin signaling and its
functional evolution in supporting fundamental processes of vascular plant development.
4
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
INTRODUCTION
The spectrum of genetic control underlying the expression of phenotypic characteristics ranges
from epistasis (governed by interactions of multiple genes) to pleiotropy (i.e., single genes or
mutations affecting multiple unrelated traits). Phenotypic traits, albeit subjectively defined,
typically outnumber genes by orders of magnitude in complex organisms, supporting the
presence of pleiotropy (Wagner and Zhang, 2011). Knowledge about the molecular basis of
pleiotropy is important for our understanding of evolvability, i.e. the capacity of an organism for
adaptive evolution (Hill and Zhang, 2012a; Wagner and Zhang, 2011; Wang et al., 2010).
Hodgkin (1998) defined seven types of pleiotropy depending on different underlying molecular
mechanisms, including alternative splicing as a source of functional pleiotropy at a gene locus.
Ongoing debate centers on whether pleiotropy is limited and modular (Wagner and Zhang, 2011)
or is wide-spread, which would support the hypothesis of universal pleiotropy (Hill and Zhang,
2012a), and whether higher pleiotropy constrains or facilitates the evolution of organismal
complexity (Hill and Zhang, 2012b; Wagner and Zhang, 2011). However, current measurements
may not satisfactorily disclose the pleiotropic level for a given polymorphism (Wagner and
Zhang, 2012). Studies of mutant phenotypes often overestimate gene pleiotropy (Wagner and
Zhang, 2011), and thus do not reflect the effects of naturally occurring mutations, which are of
particular interest to our understanding of normal gene function (Hodgkin, 1998). Quantitative
trait locus (QTL) data may also overestimate pleiotropy due to the large linkage intervals in
pedigree studies of QTLs (Gardner and Latta, 2007). Quantitative trait nucleotide (QTN)
functional variants can provide important insights into the genetics of evolution (Rockman,
2012; Streisfeld and Rausher, 2011), but only large-effect QTNs are typically accessible
(Rockman, 2012). Thus, causal variants may not be the commonly detected QTNs; instead such
variants may be present in multiple, largely small-effect genes that therefore likely remain
undetected (Rockman, 2012). Although generally less studied than exonic variants, mutational
events within introns, untranslated gene regions (UTRs) and/or untranscribed gene regulatory
regions could be key drivers of evolution (Lynch and Katju, 2004). This noncoding DNA is
enriched with functional sequences that can arise spontaneously (Rockman, 2012).
The Class III homeodomain leucine zipper (HD ZIP) gene REVOLUTA (REV) is involved
in auxin-mediated adaxial-abaxial patterning of plant leaves in general and patterning of
secondary vascular tissues in woody species in particular (Emery et al., 2003; Robischon et al.,
5
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
2011) and represents an interesting example of how phenotypic variation can be mediated
through interference with microRNA (miRNA) binding rather than non-synonymous mutations
in the coding sequence (Emery et al., 2003; Ong and Wickneswari, 2012). Here we discuss
specific results obtained from genotype-phenotype association studies in Populus trichocarpa
(La Mantia et al., 2013; Porth et al., 2013a; McKown et al., submitted), a tree species of
significant ecological, economic, and scientific importance (Tuskan et al., 2006; Geraldes et al.,
2013), that highlight putative pleiotropic properties of REV.
RESULTS AND DISCUSSION
We conducted genome-wide association studies (GWAS) that employed ca. 400 phenotyped and
genotyped natural P. trichocarpa accessions grown in common gardens to elucidate the genetic
architecture of wood quality, ecophysiological, phenological, biomass, and rust fungus resistance
trait variation in three separate studies (Porth et al., 2013a; McKown et al., submitted; La Mantia
et al. 2013, respectively). In total, we examined SNP polymorphisms in over 3,500 broad-based
candidate genes using an Illumina 34K SNP genotyping array (Geraldes et al., 2013). The SNP
discovery panel for the array (Geraldes et al., 2013) involved 20 accessions from the Pacific
Northwest for mRNA sequencing (Geraldes et al., 2011) and 16 accessions taken from the
southern distribution range of P. trichocarpa for whole genome sequencing (Slavov et al., 2012).
Phenotypic trait variation was investigated for ~60 quantitative characteristics (Porth et al.,
2013b; McKown et al., 2013; La Mantia et al., 2013). All three studies employed the generalized
linear mixed model approach to correct for any genetic structure present in the population. The
optimal model was selected on a trait-by-trait basis using the Bayesian information criterion (Yu
et al., 2006).
Among many SNP-trait associations, these studies revealed genetic associations of wood
cellulose content and leaf phenology traits with SNPs in non-coding regions of distinct splice
variants of the poplar REV gene Potri.009G014500 (popREV; Fig. 1; Table I), consistent with
fundamental functions for REV in regulating the architecture of leaf and vascular systems (Zhong
et al., 1997; Zhong and Ye, 1999; Otsuga et al., 2001; Emery et al., 2003; Robischon et al., 2011;
Stirnberg et al., 2012). An additional putatively functional polymorphism common to all splice
variants of REV is associated with Melampsora rust fungus resistance (Fig. 1; Table I)
6
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
suggesting involvement of REV with this trait also and providing a striking example of the
extensive pleiotropic properties that plant genes can sustain.
The wood-association study also identified, among others, SNP associations within
various auxin-related genes related to variation in fiber properties, including fiber length. Fiber
development is tightly linked to the action of the phytohormone auxin (indole-acetic acid, IAA)
in vascular tissue formation (Ursache et al., 2012; Schuetz et al., 2013) as auxin signaling
regulates molecular master switches during the initiation of fiber development (Gorshkova et al.,
2012). Since IAA plays a role in regulating cambium, xylem, and fiber development as well as
fiber secondary cell wall thickening and lignification (Schuetz et al., 2013; Gorshkova et al.,
2012), the candidate SNPs within auxin-related genes identified in our study are potentially
important in the upstream regulation of plant xylem and fiber formation. In particular, REV
(synonymous to INTERFASCICULAR FBERLESS1, IFL1 and AMPHIVASAL VASCULAR
BUNDLES1, AVB1) encoding one of five Arabidopsis Class III HD ZIP transcription factors
regulates meristem function, polarity of lateral organs, vascular architecture and development,
and interfascicular fiber differentiation in Arabidopsis and other angiosperms (Emery et al.,
2003; Zhong and Ye, 1999; Ratcliffe et al., 2000, Zhong et al., 1999; Zhong and Ye, 2004). In
poplar, the REV ortholog popREV influences cambium initiation and patterning of woody stems
(Robischon et al., 2011; Hu et al., 2012). REV is part of a complex regulatory system involving
auxin, KANADI (KAN1) transcription factors, and miRNA (Ilegems et al., 2010; Emery et al.,
2003; Schuetz et al., 2013; Brandt et al., 2012). The direct targets of regulation involve several
transcription factors, some of which are regulated antagonistically to support the antagonistic
influence by REV and KAN1 on a suite of gene promoters (Reinhart el al., 2013). REV mutants
are highly pleiotropic across different species. In Arabidopsis, REV mutants exhibit differences
compared to wild-type in thicker inflorescence stems with less lignified interfascicular cells,
reduced stem strength, reduced number of branches (defect in paraclade growth) and fewer stem
leaves, enlarged and downwardly curled (i.e. revolute) cauline leaves, a change in leaf color to
dark green, and delayed leaf senescence (Talbert et al., 1995; Zhong et al., 1997), while the semidominant REV avb1 mutant exhibits aberrant cauline branches and leaves, abnormal floral
tissues, and amphivasal instead of collateral vascular bundles (Emery et al., 2003; Zhong and Ye,
2004). In poplar, gain-of-function REV mutants show severe anatomical phenotypes related to
leaf architecture, reduced internode length, callus formation on the stem surface, abnormal
7
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
cambial growth, and cambial polarity defects correlated with the positions of leaves and axillary
buds (Robischon et al., 2011). These consistent observations of phenotypic aberrations among
REV gain-of-function mutants across different plant species (Talbert et al., 1995; Emery et al.,
2003; Robischon et al., 2011; Magnani and Barton, 2011) suggest that the functionality of wildtype REV is indeed i) pleiotropic, and ii) a major hub gene (i.e. key regulatory gene) regulating
plant morphogenesis. Thus, it is anticipated that wild-type REV controls both stem and leaf
growth (Talbert et al., 1995) and recently, it was also suggested that REV controls light-mediated
elongation growth (Brandt et al., 2012).
In contrast to mutant phenotypes generated by loss-of-function or overexpression,
forward genetics studies such as GWAS have the potential to elucidate normal gene functions by
correlating differences in the observed natural phenotypic variation with the natural allelic
variations. Our data from wild accessions of P. trichocarpa supports REV function in secondary
growth and xylem development in poplar based on the genetic association between SNP24 in
popREV and wood α-cellulose content. This indicates a possible regulatory function for REV in
coordinating cellulose biosynthesis during the differentiation of cells with secondary cell wall
such as vessels and fibers, a process about which little is known (Ambavaram et al., 2011). Our
poplar GWAS also revealed associations between a SNP in REV and natural variation in date of
leaf abscission (SNP21; McKown et al., submitted). Together, these results invoke a putative
auxin-meditated mechanism. In addition to vascular differentiation, auxin regulates leaf
senescence and abscission (Ellis et al., 2005). Furthermore, an additional function for REV in
stress and pathogen resistance was revealed in our studies by the association of SNP20 in REV
with resistance to the poplar rust fungus Melampsora xcolumbiana (La Mantia et al., 2013),
which causes yellow leaf rust and represents a serious pest to commercial poplar plantations. We
reliably inferred haplotypes for the second alternative splice variant in 435 unrelated individuals
with complete genotype data. We identified one “recessive” haplotype
AGACGTTGTAAAACGCCTAAA (based on the 21 genotyped SNPs for variant 2; Fig. 1)
related to leaf rust susceptibility. This haplotype is prevalent in poplar accessions from the
northern extent of the species’ range that set bud early compared to southern populations.
Weaker selection pressure from the pathogen in more northerly located populations than
southerly populations (Chandrashekar and Heather, 1980) is likely responsible for the
maintenance of these sensitive alleles within the population. A proposed mechanism of
8
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
resistance could be mediated through suppression of axillary bud outgrowth by auxin and
repressed leaf growth (Stirnberg et al., 2012), as REV function is implicated in polar auxin
transport (Zhong and Ye, 1999). Auxin may also regulate defense signaling via cross-talk with
the gibberellic acid negative regulators of the DELLA protein family. Proper polar auxin
transport is necessary for degradation of DELLA and de-repression of growth (Fu and Harberd,
2003). DELLA loss-of-function Arabidopsis mutants have primed salicylic acid (SA) with earlier
more robust expression of pathogenesis-related PR1 and PR2 genes (Navarro et al., 2008), yet
for poplar (and Salicaceae in general) a different mechanism may apply, as these plant systems
can sustain constitutively high amounts of SA (Xue et al., 2013). Furthermore, AUXIN F-BOX
genes positively regulate auxin signaling and are up-regulated in incompatible (resistant) poplar
leaf rust interactions (La Mantia J, unpublished data). The observation that REV regulates genes
encoding auxin biosynthetic genes (Brandt et al., 2012) helps to explain the nature of its
pleiotropy as this gene seems to regulate multiple fundamental plant developmental processes,
such as basic plant organ patterning, all of which are tightly linked to auxin signaling (Otsuga et
al., 2001; Emery et al., 2003; Ellis et al., 2005; Ilegems et al., 2010; Robischon et al., 2011;
Ursache et al., 2012; Brandt et al., 2012; Schuetz et al., 2013).
How did REV obtain its pleiotropic functionality as evidenced by association of REV
variants with variation in multiple diverse traits? Class III HD ZIP genes, such as REV, that
contain a steroidogenic acute regulatory protein (StAR)-related lipid transfer (START) domain
are plant-specific and conserved across plants (Schrick et al., 2004). In animal systems, proteins
containing the START domain, a protein module of about 210 amino acid residues that binds
lipids such as sterols, show an overlap between developmental and disease-related gene
functions. In mammals, besides being important for lipid metabolism and fertility, START
domain proteins are also involved in atherosclerosis, autoimmune disease, and cancer, and
therefore are suggested targets for drug development against such diseases (Soccio and Breslow,
2003; Clark, 2012).
Class III HD ZIP genes predate the evolution of vascular plants (Prigge et al., 2005). REV
represents the most recent Class III HD ZIP in land plants (Magnani and Barton, 2011). The
initial ancestral role for Class III HD ZIP genes may have been auxin signaling (Prigge et al.,
2005). New functions appear to have been acquired in parallel with the development of major
body-plan innovations (Floyd et al., 2006). As suggested elsewhere (Hu et al., 2012), these
9
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
functions were retained with relatively low divergence under purifying selection. PopREV
exhibits a distinctive gene structure with four alternative transcriptional variants of its gene
sequence, with the shortest transcriptional variant (2,568 bp) devoid of the 3’UTR sequence (Fig.
1; Supplemental Table S1). This transcriptional variant is prevalent in xylem (based on RNASeq
expression profiling, Geraldes et al., 2011; Bao et al., 2013). It is noteworthy that all detected
phenotype-genotype associations are represented by distinct SNPs (Geraldes et al., 2013) that are
all localized towards the 3’ end of the gene where alternative splicing and alternative transcript
processing occurs (Fig. 1; Table I; Supplemental Table S1).
Interestingly, SNP21 (leaf drop association) is localized in the 3’UTR present only in
splice variants 2 to 4, suggesting that this polymorphism might affect mRNA stability. SNP24
(associated with cellulose content) is located in the 3’ non-transcribed flanking regions of all
gene variants (and SNP21 is downstream of the 3’UTR of variant 1) and therefore could be in a
regulatory region affecting transcription of the gene. Thus, both SNPs may affect popREV gene
expression with important potential consequences on REV function and the traits it affects
(Kuersten and Goodwin, 2003). Among 27 genotyped SNPs in REV, 41% did not conform to
Hardy-Weinberg equilibrium including all SNPs genetically associated to the studied phenotypes
(Table I). However, none of these polymorphisms were identified within the miRNA target
region, which represents a protein coding sequence important for maintaining normal REV gene
function (Emery et al., 2003; Zhong and Ye, 2004; Floyd et al., 2006; Robischon et al., 2011).
Overall, the investigated SNPs within REV exhibited little to moderate genetic
differentiation in the populations studied, when climate-related population grouping was
employed, with the exception of the SNP associated with variation in the timing of leaf
abscission; this SNP (SNP21) is thus a candidate for an adaptive QTN to different local climate
regimes (see FST values; Table I). In brief, we used distinct climate partitions to identify
adaptive traits due to population differentiation of quantitative traits (QST) based on local climate
of origin. The estimated QST values for leaf drop and rust resistance traits (both traits were also
validated over time, McKown et al., submitted; La Mantia et al., 2013) deviated from neutral
expectations (Porth et al., submitted). Then, we used the same subgroup partitioning to determine
such QTNs associated with adaptive traits that also identified as FST outliers. The SNP within
REV associated with leaf drop is suggested to be adaptive to different temperature regimes.
However, we note here that the selection pressure driven by climate represents only one aspect of
10
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
adaptive evolution in poplar; phenology traits, in particular, are strongly adapted to latitudinal
origins, while soil composition (aridity and moisture) also contribute to plant adaptation.
Comparing the three associated SNPs, the polymorphism associated with Melampsora
resistance is found in relatively high LD with several SNPs throughout the REV gene region.
This increased LD might be due to diversifying selection evident for this SNP along the northsouth geographic cline of the P. trichocarpa distribution (Geraldes et al., submitted). In contrast,
the leaf abscission and cellulose associated SNPs are not in LD with any other SNP within the
REV gene region and may have evolved at different rates based on the observed recombination
patterns (Fig. 1; Table I). As the LD pattern across the REV gene is likely incomplete due to a
possible ascertainment bias (rare SNPs in the population and/or non-genotyped SNPs), which is
related to the employed SNP discovery panel for the genotyping platform. Unfortunately, we
cannot confidently use this LD information to make inferences about the age of the mutations,
although minor allele frequencies (MAF) hint at the relative ages of mutations. In this context,
the MAF for variants associated with leaf abscission and cellulose, respectively, were much
lower than the MAF for the rust resistance SNP (Table I). This is consistent with an initial role
for REV in auxin signaling and subsequent functional evolution in supporting fundamental
processes of vascular plant development (Prigge et al., 2005), and it is particularly consistent
with auxin as a regulator in plant defense with effects on plant growth and development (Kazan
and Manners, 2009) The complex regulatory network governing REV expression and the
potentially profound effects of its mis-expression in poplar (Robischon et al., 2011; Schuetz et
al., 2013) suggest that pleiotropic phenotypic variability associated with SNPs in REV 3’ noncoding regions may be related to variation in the splice variants through 4 transcript levels that
are conditioned by regulatory SNPs.
It is interesting to note that no SNPs were detected in exons (Table I). This could indicate
low allelic frequency of exonic SNPs in the population (with allele frequencies lower than 5%),
probably due to purifying selection. This is specifically suggested for the miRNA targeted
protein coding sequence that is important for maintaining normal REV gene function. There is
evidence from REV gain-of-function experiments by Magnani and Barton (2011) that the C
terminus of REV (specifically, the Per-ARNT-Sim-like (PAS-like) MEKHLA domain at the C
terminus) is particularly important in regulating REV activity in a mechanism that is sequenceindependent but involves steric masking of the leucine zipper domain such that
11
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
homodimerization is prevented and REV cannot function as a transcription activator. MEKHLA
is therefore considered a negative regulator in the normal function of REV (Magnani and Barton,
2011).
We detected several other examples of pleiotropy in poplar (McKown et al., submitted;
Porth et al., submitted). This involves pleiotropy within trait categories (phenology,
ecophysiology, or growth/biomass) and, importantly, also across these field trait categories
(McKown et al., submitted). In addition, three association genetics studies (Porth et al., 2013a;
La Mantia et al., submitted; McKown et al., submitted) revealed pleiotropy across completely
different phenotypic traits (wood properties; phenology; leaf rust resistance, of which the
apparent pleiotropic functions of REV was the most striking example. REV has been intensively
studied in Arabidopsis using reverse genetics functional approaches, in which this transcription
factor was identified as an important regulator of multiple aspects of plant development. These
data support our findings from GWAS in poplar that underscore the functional integration of
plant developmental traits related to the molecular mecahanisms governing cellulose fiber
production (secondary growth) and leaf life span. Another example of considerable pleiotropy in
forest trees involved the recent discovery of several genomic regions in spruce associated with
growth and herbivory resistance traits (Porth et al., 2012).
The association of distinct SNP variants in the popREV gene with phenotypic variation in
several diverse traits underscores the importance of the REV transcription factor in regulating
expression of different developmental processes and provides a striking example of a pleiotropic
gene with variants that impact these traits. Alternative splicing that generates different protein
isoforms, and gene expression level variation, may both facilitate pleiotropic gene functions.
popREV variants associated with variation in distinct traits are located in the last intron at the 3’
end, the 3’UTR and untranscribed downstream region. Thus, functional pleiotropy of the poplar
REV gene in modulating extensive phenotypic variability may be best explained by gene
expression and/or mRNA processing.
LITERATURE CITED
Ambavaram MM, Krishnan A, Trijatmiko KR, Pereira A (2011) Coordinated activation of
cellulose and repression of lignin biosynthesis pathways in rice. Plant Physiol 155: 916931
12
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Antao T, Lopes A, Lopes RJ, Beja-Pereira A, Luikart G (2008) LOSITAN: A workbench to
detect molecular adaptation based on a F(st)-outlier method. BMC Bioinformatics 9: 323
Bao H, Li E, Mansfield SD, Cronk QC, El-Kassaby YA, and Douglas CJ (2013) The
developing xylem transcriptome and genome-wide analysis of alternative splicing in
Populus trichocarpa (black cottonwood) populations. BMC Genomics 14:359
Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, Ott F, Schmid
M, Greb T, Schwarz M, et al (2012) Genome-wide binding-site analysis of
REVOLUTA reveals a link between leaf patterning and light-mediated growth responses.
Plant J 72: 31-42
Chandrashekar M, Heather WA (1980) Temperature sensitivity of reactions of Populus spp. to
races of Melampsora larici-populina. Phytopathology 71: 421-424
Clark BJ (2012) The mammalian START domain protein family in lipid transport in health and
disease. J Endocrinol 212: 257–275
Ellis CM, Nagpal P, Young JC, Hagen G, Guilfoyle TJ, Reed JW (2005) AUXIN
RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and
floral organ abscission in Arabidopsis thaliana. Development 132: 4563-4574
Emery JF, Floyd SK, Alvarez J, Eshed Y, Hawker NP, Izhaki A, Baum SF, Bowman JL
(2003) Radial patterning of Arabidopsis shoots by class III HD-ZIP and KANADI genes.
Curr Biol 13: 1768-1774
Floyd SK, Zalewski CS, Bowman JL (2006) Evolution of class III homeodomain-leucine
zipper genes in streptophytes. Genetics 173: 373-388
Fu XD, Harberd NP (2003) Auxin promotes Arabidopsis root growth by modulating gibberellin
response. Nature 421: 740-743
Gardner KM, Latta RG (2007) Shared quantitative trait loci underlying the genetic correlation
between continuous traits. Mol Ecol 16: 4195-4209
Geraldes A, Pang J, Thiessen N, Cezard T, Moore R, Zhao Y, Tam A, Wang S, Friedmann
M, Birol I, et al (2011) SNP discovery in black cottonwood (Populus trichocarpa) by
population transcriptome resequencing. Mol Ecol Resour 11: 81-92
Geraldes A, Difazio SP, Slavov GT, Ranjan P, Muchero W, Hannemann J, Gunter LE,
Wymore AM, Grassa CJ, Farzaneh N, et al (2013) A 34K SNP genotyping array for
13
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Populus trichocarpa: Design, application to the study of natural populations and
transferability to other Populus species. Mol Ecol Resour 13: 306-323
Gorshkova T, Brutch N, Chabbert B, Deyholos M, Hayashi T, Lev-Yadun S, Mellerowicz
EJ, Morvan C, Neutelings G, Pilate G (2012) Plant Fiber Formation: State of the Art,
Recent and Expected Progress, and Open Questions. Crit Rev Plant Sci 31: 201-228
Hill WG, Zhang X-S (2012a) On the Pleiotropic Structure of the Genotype–Phenotype Map and
the Evolvability of Complex Organisms. Genetics 190: 1131-1137
Hill WG, Zhang X-S (2012b) Assessing pleiotropy and its evolutionary consequences:
pleiotropy is not necessarily limited, nor need it hinder the evolution of complexity. Nat
Rev Genet 13: 296-296
Hodgkin J (1998) Seven types of pleiotropy. Int J Dev Biol 42: 501-505
Hu R, Chi X, Chai G, Kong Y, He G, Wang X, Shi D, Zhang D, Zhou G (2012) Genomewide identification, evolutionary expansion, and expression profile of homeodomainleucine zipper gene family in poplar (Populus trichocarpa). PLoS One 7: e31149
Ilegems M, Douet V, Meylan-Bettex M, Uyttewaal M, Brand L, Bowman JL, Stieger PA
(2010) Interplay of auxin, KANADI and Class III HD-ZIP transcription factors in
vascular tissue formation. Development 137: 975-984
Kazan K, Manners JM (2009) Linking development to defense: auxin in plant-pathogen
interactions. Trends Plant Sci 14: 373-382
Kuersten S, Goodwin EB (2003) The power of the 3' UTR: Translational control and
development. Nat Rev Genet 4: 626-637
La Mantia J, Klápště J, El-Kassaby YA, Azam S, Guy RD, Douglas CJ, Mansfield SD,
Hamelin R (2013) Association analysis identifies Melampsora ×columbiana poplar leaf
rust resistance SNPs. PLoS One 8: e78423
Lynch M, Katju V (2004) The altered evolutionary trajectories of gene duplicates. Trends
Genet 20: 544-549
Magnani E, Barton MK (2012) A Per-ARNT-Sim-Like sensor domain uniquely regulates the
activity of the homeodomain leucine zipper transcription factor REVOLUTA in
Arabidopsis. Plant Cell 23: 567–582
McKown A, Guy R, Azam MS, Drewes E, Quamme L (2013) Seasonality and phenology alter
functional leaf traits. Oecologia 172: 1-13
14
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Navarro L, Bari R, Achard P, Lison P, Nemri A, Harberd NP, Jones JDG (2008) DELLAs
control plant immune responses by modulating the balance and salicylic acid signaling.
Curr Biol 18: 650-655
Ong SS, Wickneswari R (2012) Characterization of microRNAs Expressed during Secondary
Wall Biosynthesis in Acacia mangium. PLoS One 7: e49662
Otsuga D, DeGuzman B, Prigge MJ, Drews GN, Clark SE (2001) REVOLUTA regulates
meristem initiation at lateral positions. Plant J 25: 223-236
Porth I, White R, Jaquish B, Alfaro R, Ritland C, Ritland K (2012) Genetical genomics
identifies the genetic architecture for growth and weevil resistance in spruce. PLoS ONE
7: e44397
Porth I, Klápště J, Skyba O, Hannemann J, McKown AD, Guy RD, DiFazio S, Muchero
W, Ranjan P, Tuskan GA, et al (2013a) Genome-wide association mapping for wood
characteristics in Populus identifies an array of candidate SNPs. New Phytol 200:710-726
Porth I, Klápště J, Skyba O, Lai BS, Geraldes A, Muchero W, Tuskan GA, Douglas CJ, ElKassaby YA, Mansfield SD (2013b) Populus trichocarpa cell wall chemistry and
ultrastructure trait variation, genetic control and genetic correlations. New Phytol 197:
777-790
Prigge MJ, Otsuga D, Alonso JM, Ecker JR, Drews GN, Clark SE (2005) Class III
homeodomain-leucine zipper gene family members have overlapping, antagonistic, and
distinct roles in Arabidopsis development. Plant Cell 17: 61-76
Ratcliffe OJ, Riechmann JL, Zhang JZ (2000) INTERFASCICULAR FIBERLESS1 is the
same gene as REVOLUTA. Plant Cell 12: 315-317
Reinhart BJ, Liu T, Newell NR, Magnani E, Huang T, Kerstetter R, Michaels S, Barton
MK (2013) Establishing a framework for the ad/abaxial regulatory network of
Arabidopsis: ascertaining targets of Class III HOMEODOMAIN LEUCINE ZIPPER and
KANADI regulation. Plant Cell 25:3228-3249
Robischon M, Du J, Miura E, Groover A (2011) The Populus class III HD ZIP,
popREVOLUTA, influences cambium initiation and patterning of woody stems. Plant
Physiol 155: 1214-1225
Rockman MV (2012) The QTN program and the alleles that matter for evolution: all that's gold
does not glitter. Evolution 66: 1-17
15
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Schrick K, Nguyen D, Karlowski WM, Mayer KFX (2004) START lipid/sterol-binding
domains are amplified in plants and are predominantly associated with homeodomain
transcription factors. Genome Biol 5: R41
Schuetz M, Smith R, Ellis B (2013) Xylem tissue specification, patterning, and differentiation
mechanisms. J Exp Bot 64: 11-31
Slavov GT, DiFazio SP, Martin J, Schackwitz W, Muchero W, Rodgers-Melnick E,
Lipphardt MF, Pennacchio CP, Hellsten U, Pennacchio LA, et al (2012) Genome
resequencing
reveals
multiscale
geographic
structure
and
extensive
linkage
disequilibrium in the forest tree Populus trichocarpa. New Phytol 196: 713-725
Soccio RE, Breslow JL (2003) StAR-related lipid transfer (START) proteins: mediators of
intracellular lipid metabolism. J Biol Chem 278: 22183–22186
Stirnberg P, Zhao S, Williamson L, Ward S, Leyser O (2012) FHY3 promotes shoot
branching and stress tolerance in Arabidopsis in an AXR1-dependent manner. Plant J 71:
907-920
Streisfeld MA, Rausher MD (2011) Population genetics, pleiotropy, and the preferential
fixation of mutations during adaptive evolution. Evolution 65: 629-642
Talbert PB, Adler HT, Parks DW, Comai L (1995) The REVOLUTA gene is necessary for
apical meristem development and for limiting cell divisions in the leaves and stems of
Arabidopsis thaliana. Development 121: 2723-2735
Tuskan GA, DiFazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph
S, Rombauts S, Salamov A, et al (2006) The genome of black cottonwood, Populus
trichocarpa (Torr. & Gray). Science 313: 1596-1604
Ursache R, Nieminen K, Helariutta Y (2012) Genetic and hormonal regulation of cambial
development. Physiol Plantarum 147: 36-45
Wagner GP, Zhang J (2011) The pleiotropic structure of the genotype–phenotype map: the
evolvability of complex organisms. Nat Rev Genet 12: 204-213
Wagner GP, Zhang J (2012) Universal pleiotropy is not a valid null hypothesis: reply to Hill
and Zhang. Nat Rev Genet 13: 296-296
Wang Z, Liao B-Y, Zhang J (2010) Genomic patterns of pleiotropy and the evolution of
complexity. Proc Natl Acad Sci USA 107: 18034-18039
16
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Xue LJ, Guo W, Yuan Y, Anino EO, Nyamdari B, Wilson MC, Frost CJ, Chen HY, Babst
BA, Harding SA and Tsai CJ (2013) Constitutively elevated salicylic acid levels alter
photosynthesis and oxidative state but not growth in transgenic Populus. Plant Cell 25:
2714-2730
Yu J, Pressoir G, Briggs WH, Vroh Bi I, Yamasaki M, Doebley JF, McMullen MD, Gaut
BS, Nielsen DM, Holland JB, et al (2006) A unified mixed-model method for
association mapping that accounts for multiple levels of relatedness. Nat Genet 38: 203208
Zhong R, Taylor JJ, Ye ZH (1997) Disruption of interfascicular fiber differentiation in an
Arabidopsis mutant. Plant Cell 9: 2159-2170
Zhong R, Ye ZH (1999) IFL1, a gene regulating interfascicular fiber differentiation in
Arabidopsis, encodes a homeodomain-leucine zipper protein. Plant Cell 11: 2139-2152.
Zhong R, Taylor JJ, Ye ZH (1999) Transformation of the collateral vascular bundles into
amphivasal bundles in an Arabidopsis mutant. Plant Physiol. 120: 53-64
Zhong R, Ye ZH (2004) amphivasal vascular bundles 1, a gain of function mutation of the
IFL1/REV gene, is associated with alterations in the polarity of leaves, stems, and carpels.
Plant Cell Physiol. 45: 369-385
17
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Figure Legend
Figure 1. Poplar REVOLUTA (REV) gene structure, linkage disequilibrium plot, and SNP
locations.
The gene structures for splice variants/transcriptional variants of REVOLUTA (Phytozome
Populus trichocarpa v.3) are presented schematically as exon (black boxes)-intron (lines)-UTR
(grey boxes)/noncoding (dots) at the bottom of the figure
Locations of twenty-seven genotyped SNPs are shown as asterisks above the gene models; the
solid lines connect to the genetic associations of tag SNPs within the specific splice variants with
Melampsora rust fungus resistance (SNP20), leaf drop (SNP21), and % alpha cellulose content
(SNP24); dashed lines indicate SNPs with no significant association with phenotype.
The linkage disequilibrium (LD) relationships (R2) of the SNPs are shown at the top and are
color-coded to show the extent of LD between genotyped SNPs.
Principle component analysis was used to adjust for population structure in the analyses of wood
traits and leaf rust resistance (Porth et al., 2013a; La Mantia et al., 2013); the ‘area under the
disease curve’ resistance measure was adjusted for date of bud set prior to association analysis
(La Mantia et al., 2013); Q matrix population structure correction was applied for phenology
traits that co-vary with latitudinal population structure (McKown AD, unpublished data).
18
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Table I. Features of 27 SNPs in popREV (Potri.009G014500) genotyped in an association population
Tag SNP (Geraldes
et al., 2013) 1
Location
Location feature
HE2
FST2
MAF
Splice variant 1-4
scaffold_9_2556002
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
intron
0.504193
0.036061
0.47691
intron
0.504857
0.033881
0.49884
intron
0.428818
0.028909
0.31235
intron
0.226606
0.008931
0.12587
intron
0.453198
0.036915
0.34642
intron
0.504843
0.033775
0.49769
intron
0.504844
0.033773
0.49769
intron
0.262775
0.010365
0.16051
intron
0.395116
0.027997
0.27252
intron
0.11118
0.008393
0.06134
intron
0.504236
0.037609
0.47564
intron
0.504859
0.033876
0.49883
intron
0.263309
0.010729
0.16088
Splice variant 1-4
scaffold_9_2556257
Splice variant 1-4
scaffold_9_2556661
Splice variant 1-4
scaffold_9_2556664
Splice variant 1-4
scaffold_9_2556886
Splice variant 1-4
scaffold_9_2556960
Splice variant 1-4
scaffold_9_2557200
Splice variant 1-4
scaffold_9_2557957
Splice variant 1-4
scaffold_9_2558943
Splice variant 1-4
scaffold_9_2559321
Splice variant 1-4
scaffold_9_2559505
Splice variant 1-4
scaffold_9_2560010
Splice variant 1-4
scaffold_9_2560210
19
Detected associations
Splice variant 1-4
scaffold_9_2560374
intron
0.504283
0.036495
0.47801
intron
0.44196
0.037899
0.31597
Splice variant 1-4
scaffold_9_2560840
scaffold_9_2561340
Splice variant 1-4
scaffold_9_2562685
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
intron
0.45543
0.030888
0.35082
Splice variant 1-4
intron
0.458848
0.037309
0.35267
scaffold_9_2562888
Splice variant 1-4
intron
0.183453
-0.00455
0.10233
scaffold_9_2562964
Splice variant 1-4
intron
0.470355
0.040831
0.37153
scaffold_9_2563210
Splice variant 1-4
intron
scaffold_9_2563600
Splice variant 2-4
scaffold_9_2563682
Melampsora xcolumbiana
0.511584
0.08915
0.48956
resistance4
exon,3'-UTR
0.24597
0.116677
0.13741
leaf drop5
3’ flanking
intergenic
0.502272
0.040688
0.46846
scaffold_9_2563761
3’ flanking
intergenic
0.193176
-0.00458
0.10855
scaffold_9_2563977
3’ flanking
intergenic
0.272897
0.020284
0.16051
scaffold_9_2564040
3’ flanking
intergenic
0.352358
0.006295
0.23248
scaffold_9_2564643
3’ flanking
intergenic
0.4637
0.010006
0.36706
scaffold_9_2565072
3’ flanking
intergenic
0.331155
0.001465
0.20882
1
% alpha cellulose6
SNPs in bold did not conform to Hardy-Weinberg equilibrium.
HE (expected heterozygosity) and FST (fixation index) were calculated using Fdist2 implemented in LOSITAN software package (Antao et al.,
2008) on the basis of 433 P. trichocarpa individuals and sub-grouping according to climatic variables (Porth I, unpublished data).
3
minor allele frequeny
2
20
4
Melampsora xcolumbiana resistance: ‘area under the disease curve’ resistance measure adjusted for date of bud set (La Mantia et al., 2013)
leaf drop: adaptive phenology trait (McKown et al., 2013; McKown AD, unpublished data)
6
% alpha cellulose: percentage of relative alpha cellulose content in dry wood (Porth et al., 2013a; Porth et al., 2013b)
5
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
21
SUPPLEMENTAL DATA
Supplemental Table S1: Sequences of popREV alternative splice variants (Phytozome v.3)
22
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Figure 1. Poplar REVOLUTA (REV) gene structure, linkage disequilibrium plot, and SNP locations.
The gene structures for splice variants/transcriptional variants of REVOLUTA (Phytozome Populus
trichocarpa v.3) are presented schematically as exon (black boxes)-intron (lines)-UTR (grey
boxes)/noncoding (dots) at the bottom of the figure
Locations of twenty-seven genotyped SNPs are shown as asterisks above the gene models; the solid
lines connect to the genetic associations of tag SNPs within the specific splice variants with
Melampsora rust fungus resistance (SNP20), leaf drop (SNP21), and % alpha cellulose content
(SNP24); dashed lines indicate SNPs with no significant association with phenotype.
The linkage disequilibrium (LD) relationships (R2) of the SNPs are shown at the top and are colorcoded to show the extent of LD between genotyped SNPs.
Principle component analysis was used to adjust for population structure in the analyses of wood traits
and leaf rust resistance (Porth et al., 2013a; LaMantia et al., 2013); the ‘area under the disease curve’
resistance measure was adjusted for date of bud set prior to association analysis (LaMantia et al., 2013);
Q matrix population structure correction was applied for phenology traits that co-vary with latitudinal
population structure (McKown AD, unpublished data).
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.