ORIGINAL
RESEARCH
Regenerated Luminal Epithelial Cells Are Derived
from Preexisting Luminal Epithelial Cells in Adult
Mouse Prostate
June Liu,* Laura E. Pascal,* Sudhir Isharwal,* Daniel Metzger,
Raquel Ramos Garcia, Jan Pilch, Susan Kasper, Karin Williams, Per H. Basse,
Joel B. Nelson, Pierre Chambon, and Zhou Wang
Department of Urology (J.L., L.E.P., S.I., R.R.G., J.P., J.B.N., Z.W.) and Department of Pharmacology and
Chemical Biology (Z.W.), and University of Pittsburgh Cancer Institute (J.P., P.H.B., J.B.N., Z.W.), University of
Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15232; Institut de Génétique et de Biologie
Moléculaire et Cellulaire (D.M., P.C.), Centre National de la Recherche Scientifique Unité Mixte de Recherche
7104, Institut National de la Santé et de la Recherche Médicale U964, Université de Strasbourg, Collège de
France, 67404 Illkirch, France; and Department of Environmental Health (S.K., K.W.), University of Cincinnati,
Cincinnati, Ohio 45267
Determining the source of regenerated luminal epithelial cells in the adult prostate during androgen
deprivation and replacement will provide insights into the origin of prostate cancer cells and their fate
during androgen deprivation therapy. Prostate stem cells in the epithelial layer have been suggested
to give rise to luminal epithelium. However, the extent of stem cell participation to prostate regrowth
is not clear. In this report, using prostate-specific antigen-CreERT2-based genetic lineage marking/
tracing in mice, preexisting luminal epithelial cells were shown to be a source of regenerated luminal
epithelial cells in the adult prostate. Prostatic luminal epithelial cells could survive androgen deprivation and were capable of proliferating upon androgen replacement. Prostate cancer cells, typically
exhibiting a luminal epithelial phenotype, may retain this intrinsic capability to survive and regenerate
in response to changes in androgen signaling, providing part of the mechanism for the ultimate failure
of androgen deprivation therapy in prostate cancer. (Molecular Endocrinology 25: 1849 –1857, 2011)
A
ndrogens regulate prostate homeostasis in the adult
mouse. Androgen deprivation causes dramatic prostate regression via massive apoptosis of prostatic luminal
epithelial cells, and with subsequent androgen replacement the prostate undergoes rapid regrowth and the luminal epithelial cells are repopulated. The prostate can
undergo multiple cycles of regression and regrowth in
response to repeated rounds of androgen deprivation and
replacement (1). However, the origin of regenerated luminal epithelial cells remains unresolved.
Defining the lineage of regenerated luminal epithelial
cells has significant implications in elucidating the origin
of prostate cancer cells. Stem/progenitor cells in the prostate are thought to be responsible for luminal epithelial
cell regeneration and may serve as the source of putative
prostate cancer stem cells. Thus, identification and characterization of stem/progenitor cells for the prostate luminal epithelium has been a major focus in elucidating the
origin of prostate cancer.
Androgen receptor (AR)-negative prostate stem cells in
the basal epithelial cell layer are thought to be the source
of AR-positive luminal epithelium in the regenerated
prostate (2– 6). These putative progenitor cells have been
characterized by their expression of stem cell markers and
ability to differentiate in vitro and to generate structures
resembling prostatic ducts in tissue recombinants (5,
7–10). There is no definitive evidence, however, that basal
epithelial stem cells produce the newly formed luminal
ISSN Print 0888-8809 ISSN Online 1944-9917
Printed in U.S.A.
Copyright © 2011 by The Endocrine Society
doi: 10.1210/me.2011-1081 Received May 5, 2011. Accepted August 26, 2011.
First Published Online September 22, 2011
*J.L., L.E.P., and S.I. have contributed equally to the manuscript and should be considered
as first authors.
Abbreviations: AR, Andogen receptor; BrdU, bmodeoxyuridine; CARN, castration-resistant Nkx3.1; Cx, castration; DAPI, 4⬘,6-diamidino-2-phenylindole; GFP, green fluorescent
protein; PSA, prostate-specific antigen; TAM, tamoxifen.
Mol Endocrinol, November 2011, 25(11):1849 –1857
mend.endojournals.org
1849
1850
Liu et al.
Regeneration of Luminal Cells in Adult Prostate
epithelial cells in the androgen-regenerated prostate in
vivo. Alternatively, it has been proposed that adult luminal cells develop independently of basal cells and are derived from androgen deprivation-resistant luminal stem
cells capable of self-renewal (11, 12). Based on several cell
kinetic studies of the rodent prostate, others have proposed that fully differentiated luminal cells can proliferate
in vivo, and basal and luminal cells are independent lineages capable of self-renewal (13–15). The contribution
of various mechanisms in prostate luminal epithelial regeneration remains unclear.
In the present paper, prostate-specific antigen (PSA)CreERT2-based genetic lineage marking/tracing was used
to track the fate of luminal epithelial cells during regression and regrowth of the adult mouse prostate. This study
shows the survival and repopulation of preexisting prostatic luminal epithelial cells during androgen deprivation
and replacement.
Results
Genetic lineage tracing of luminal epithelial cells
in adult mouse prostate
A recently developed genetic lineage tracing strategy
(16) was used to follow the fate of mouse prostatic luminal epithelial cells during androgen withdrawal and androgen replacement (hereafter called “androgen manipulation”). To control for the specificity of prostatic luminal
epithelial cell labeling and the time of labeling, a previously
reported PSA-CreERT2 transgenic mouse strain expressing
tamoxifen (TAM)-inducible CreER recombinase driven by
a 6-kb human PSA promoter/enhancer was used (17, 18).
PSA-CreERT2 mice were crossed with ROSA26R-lacZ or
mT/mG mice to generate bigenic PSA-CreERT2/R26-LacZ
(Fig. 1A) or PSA-CreERT2/R26-enhanced green fluorescent
protein (GFP) (Fig. 1B) mice. The efficiency of PSA-CreERT2based genetic labeling was greatest in the lateral prostate
and was specific to the luminal epithelial cells (Supplemental Fig. 1 published on The Endocrine Society’s Journals
Online web site at http://mend.endojournals.org). As a control, no x-gal staining or GFP expression was observed
in the PSA-CreERT2/R26R or PSA-CreERT2/R26RGFP mouse injected with corn oil alone (Fig. 1C). Labeled cells were CK18 positive (Fig. 1D) and CK5- and
p63 negative (Fig. 1, E and F), indicating they were
luminal and not basal cells (6).
PSA-CreERT2-based genetic labeling of prostatic
luminal epithelial cells is androgen dependent
The PSA-CreERT2-based labeling should be androgen
dependent because the PSA promoter/enhancer is andro-
Mol Endocrinol, November 2011, 25(11):1849 –1857
gen dependent and inactive in the androgen-deprived
prostate (18). To confirm that labeling induced by TAM
in the PSA-CreERT2 system was androgen dependent,
8-wk-old male PSA-CreERT2/R26R mice were castrated,
randomized, and injected with TAM 3 wk after castration
(Cx) at 3 mg/40 g body weight (Fig. 2). One group was
euthanized 10 d after the last injection of TAM (CxTAM). The other two groups were implanted with testosterone 2 or 4 wk after the TAM injection and then euthanized 10 d after testosterone implantation (Cx-TAM ⫺2
wk-T, and Cx-TAM ⫺4 wk-T). The lateral prostates were
dissected, processed, and analyzed. Compared with approximately 20% labeling by TAM in a noncastrated,
intact group, less than 1% of luminal epithelial cells were
labeled when TAM was injected 3 wk after the Cx, verifying that labeling was androgen dependent (Fig. 2B and
Supplemental Table 1). The lack of labeling should not be
related to TAM delivery to the castrated prostate because
Cx-resistant Nkx3.1(CARN)-expressing cells in castrated prostate can be efficiently labeled by TAM administration (12). Testosterone replacement 2 or 4 wk after
TAM administration had no significant effect on the frequency of labeled luminal cells in the prostate (still ⬍1%),
indicating that TAM should be metabolized and/or excreted from the animals within 2 wk after TAM injection
(Fig. 2B and Supplemental Table 1). Similar results were
observed when TAM was injected at a higher concentration (9 mg/40 g body weight), except that labeling of the
luminal cells was slightly increased to approximately 3%
(Supplemental Table 1). In this model, therefore, PSACreERT2-based labeling is androgen dependent and occurs specifically in AR-positive luminal epithelial cells
upon transient TAM induction.
Regenerated luminal epithelial cells are derived
from preexisting luminal epithelial cells in the
adult prostate
To determine whether newly formed luminal epithelial
cells in the regenerated prostate are derived from preexisting luminal epithelial cells or from other cell types, the
fate and frequency of the genetically labeled luminal epithelial cells during cycles of androgen manipulation were
examined: specifically, the percent of luminal epithelial
cells expressing ␤-galactosidase and/or GFP as compared
with the total number of luminal epithelial cells (Fig. 3). In
this model, heritable labeling of fully differentiated prostate luminal epithelial cells through expression of lacZ or
GFP is achieved by ip injection of TAM (Fig. 3, A and B).
These labeled cells are tracked through cycles of androgen
manipulation by x-gal staining or expression of GFP in
the prostate. Cell populations derived from preexisting
luminal epithelial cells at the time of TAM injection can
Mol Endocrinol, November 2011, 25(11):1849 –1857
mend.endojournals.org
1851
FIG. 1. Specificity of TAM-inducible PSA-CreERT2 system in mice. A and B, Schematic diagrams showing recombination by active CreERT2 fusion protein
and lineage marking of cells in PSA-CreERT2/R26R LacZ and PSA-CreERT2/Rosa26R mT/mG mice. In the presence of TAM, CreERT2 fusion protein causes
recombination resulting in removal of the neo or mT gene and permanent, heritable expression of lacZ or GFP, which results in labeling of cells with
active PSA promoter. C, TAM-induced lineage marking of luminal epithelial in the lateral prostate. Lineage-marked cells are dark blue via x-gal staining in
tissue sections of lateral prostate of 10-wk-old PSA-CreERT2/R26R lacZ or green in PSA-CreERT2/Rosa26R mT/mG mice treated with TAM. Controls are
corn oil-injected mice. D, Immunofluorescence staining for CK18 in lateral prostate sections of PSA-CreERT2/Rosa26R mT/mG mice. E, Immunostaining for
p63 in lateral prostate sections of PSA-CreERT2/R26R lacZ mice. F, Immunofluorescence staining for CK5 in lateral prostate sections of
PSA-CreERT2/Rosa26R mT/mG mice. p63 and CK5 staining are indicated by dashed arrows. Scale bars, 25 ␮m. mEGFP, membrane-tagged enhanced
GFP.
be identified (Fig. 3A). Newly formed luminal epithelial
cells in the regenerated prostate should be labeled if and
only if they are derived from preexisting labeled differentiated luminal cells. New luminal epithelial cells derived
from any AR-negative cells, including stem cells and basal
cells, would not be labeled. These different mechanisms of
luminal epithelial cell regeneration would generate distinguishable populations of luminal cells within the prostate
after cycles of androgen manipulation based on the presence and frequency of labeled cells. If newly formed luminal epithelial cells are derived from preexisting ARpositive luminal cells, the frequency of labeled luminal
cells within the prostate should remain the same. Because
the AR-negative stem or basal epithelial cells are incapable of activating the PSA promoter/enhancer, newly
formed luminal epithelial cells derived entirely from those
cells would not contain any labeled luminal cells. Finally,
if a combination of stem/basal cells and preexisting luminal epithelial cells replenish luminal epithelial cells within
the regenerating prostate, the frequency of labeled luminal cells should be decreased.
In intact, noncastrated mice, approximately 22% of
the luminal epithelial cells were labeled with x-gal (Fig. 3,
C and E, and Supplemental Table 1). The percent of labeled luminal epithelial cells after one cycle or two cycles
of androgen manipulation remained virtually the same
1852
Liu et al.
Regeneration of Luminal Cells in Adult Prostate
FIG. 2. Androgen dependency of PSA-CreERT2-mediated genetic
marking. A, Schematic diagram showing possible outcomes of lineage
marking of cells in testis-intact and castrated PSA-CreERT2/R26R LacZ
mice. B, TAM induction of genetic marking in testis-intact and
castrated PSA-CreERT2/R26R LacZ mice. TAM was injected 3 wk after
Cx (Cx-TAM) along with testis-intact control (Intact-TAM) mice. To
verify the transient nature of TAM induction, Cx-TAM-2 wk-T and CxTAM-4 wk-T groups were generated by implanting testosterone pellets
into Cx-TAM mice 2 or 4 wk after the TAM induction. Mice were killed
10 d after TAM injection in Cx-TAM and Intact-TAM groups or 10 d
after the testosterone replacement in Cx-TAM-2 wk-T and Cx-TAM-4
wk-T groups. Scale bars, 200 ␮m. T, Testosterone.
(Fig. 3, C and E). This finding was confirmed in PSACreERT2/R26R-GFP mice (Fig. 3, D and F). Although the
efficiency of GFP genetic labeling by TAM was much
higher than lacZ labeling, i.e. about 70% of the luminal
epithelial cells, the percent of GFP labeling remained con-
Mol Endocrinol, November 2011, 25(11):1849 –1857
stant between intact and androgen-manipulated mice
(Fig. 3, D and F, and Supplemental Table 2). Based on
these observations, it appears that the majority of newly
formed luminal epithelial cells in regenerating mouse
prostate are derived from preexisting luminal epithelial
cells. There should be significant cellular turnover during
regression and regrowth of the prostate (Supplemental
Fig. 2): approximately 90% of the luminal epithelial cells
are estimated to undergo apoptosis after androgen deprivation (13) and, as a result, the majority of luminal epithelial
cells are newly formed after each cycle of regeneration. The
proliferation required for this repopulation to occur was
demonstrated by bromodeoxyuridine (BrdU) positivity in
the genetically labeled GFP-positive cells (Fig. 4). Taken together, newly regenerated luminal epithelial cells are predominantly derived from preexisting luminal cells.
These data also demonstrated the survival of a subset
of luminal epithelial cells in the regressed prostate 3 wk
after Cx (Fig. 3, C–F). The percent of genetically labeled
luminal epithelial cells in the regressed prostate remained
constant compared with the intact prostate, indicating
similar rates of survival in labeled and unlabeled luminal epithelial cells. This suggests some fully differentiated luminal epithelial cells have intrinsic mechanisms
to survive androgen deprivation. In addition, this finding indicates that the PSA promoter is equally active in
luminal cells that will undergo apoptosis and those that
will survive Cx.
In this study, no GFP-labeled basal epithelial cells
could be identified in the prostate after Cx and/or regeneration (Fig. 5). Basal cells were stained by CK5 antibody
in sections from castrated and two-cycle regenerated
prostates. Confocal microscopy examination of at least
50 CK5-positive basal epithelial cells in each mouse did
not find any GFP-positive basal cells. Some of the CK5positive cells can be surrounded by GFP-positive cells at
one focal plane but not at another focal plane. Thus,
surviving labeled luminal epithelial cells do not seem to
undergo transdifferentiation to become basal epithelial
cells during Cx or regeneration.
Discussion
Using the PSA-CreERT2-based genetic lineage tracing system, this study generated evidence for the survival and
proliferation of preexisting luminal epithelial cells during
cycles of regression and regrowth of adult prostate in the
mouse model. This finding demonstrates the importance of
preexisting luminal cells as an origin of luminal cell regeneration in adult prostate, which will have significant implications in prostate biology and prostate cancer research.
Mol Endocrinol, November 2011, 25(11):1849 –1857
mend.endojournals.org
1853
FIG. 3. Survival and regeneration of luminal epithelial cells during cycles of prostate regeneration. A, Predictions from self-duplication model and
basal cell model for luminal cell repopulation in regenerating prostate. Regenerated luminal epithelial cells derived from genetically labeled
preexisting luminal cells, with either lacZ (blue) or GFP (green), can be determined after regression and regeneration of prostate. Regeneration by
self-duplication from preexisting (labeled) cells predicts that the fraction of labeled cells would remain constant in new epithelium. In the basal
stem cell model of regeneration, luminal epithelial cells are derived from stem cells that do not express the PSA promoter-driven CreER gene, and
the percentage of labeled cells would decrease after each cycle of regression and regeneration. B, Time line employed for TAM labeling and cycles
of serial regression and regeneration. C and D, Fate of genetically labeled luminal epithelial cells during cycles of lateral prostate regression and
regeneration. Shown are images of x-gal staining and GFP in PSA-CreERT2/R26R LacZ and PSA-CreERT2/Rosa26R mT/mG mouse model,
respectively. E and F, Quantitation of the results in C and D, respectively. Number of animals is indicated in parentheses. The percentage of labeled
cells was not significantly different between groups in E (P ⫽ 0.92) or in F (P ⫽ 0.55). Error bars indicate SD. Scale bars, 200 ␮m. T, Testosterone;
Sac, euthanized.
1854
Liu et al.
Regeneration of Luminal Cells in Adult Prostate
Mol Endocrinol, November 2011, 25(11):1849 –1857
viving preexisting luminal epithelial cells
in prostate regeneration.
A popular model of prostate luminal epithelial regeneration involves
stem cells, transit amplifying cells, intermediate cells, and secretory luminal
cells (4). Transit amplifying/intermediate cells are derived from AR-negative
undifferentiated cells whereas the surviving luminal epithelial cells are deFIG. 4. Proliferation of GFP-labeled luminal epithelial cells after androgen replacement. BrdU
rived from preexisting luminal cells.
was injected 3 d and 4 d after testosterone replacement, and the prostate was isolated 4 h
Thus, the surviving luminal epithelial
after the second injection (two-cycle group as described in Fig. 3). Red arrows indicate BrdUcells should be distinctly different
labeled, GFP-positive cells (top panel). Green arrows indicate BrdU-negative, GFP-positive
cells. Animals without BrdU injection were processed in parallel as negative control. Scale
from transit-amplifying/intermediate cells.
bars, 25 ␮m. T, Testosterone.
Based on the PSA-CreERT2 genetic lineage tracing, AR-negative stem cells
Determining the source of regenerated prostate lumi- did not seem to contribute appreciably to luminal epithenal epithelial cells will help in identifying the origin of lial cell regeneration, at least during the first two cycles of
prostate cancer cells. Because regenerated luminal cells regression and regeneration. Transit amplifying and incan be derived from preexisting luminal cells, they are termediate cells are also unlikely to contribute signifialso likely to be an important origin of prostate cancer cantly during the first two cycles of regression and recells. Prostate cancer cells, which typically exhibit a lumi- growth. Transit amplifying cells, which are derived from
nal epithelial phenotype, should retain the intrinsic capa- AR-negative stem cells and reside in the basal compartbility of luminal epithelial cells to survive androgen de- ment, can give rise to intermediate cells in the luminal
privation and to regenerate upon androgen replacement. compartment (4). Both transit amplifying cells and interThis provides a reasonable explanation for the capacity of mediate cells are CK5 positive but do not express AR or
prostate cancer cells to survive under androgen-depleted express it at a very low level (4). These cells are thought to
conditions and to proliferate once androgen signaling respond to andromedin rather than androgens directly.
is abnormally activated. Taking the above consider- Thus, transit-amplifying and intermediate cells should
ations together, understanding the molecular and cel- not be labeled or labeled at very low efficiency by the
lular mechanisms responsible for luminal epithelial cell PSA-CreERT2 system, which is consistent with the obsersurvival and proliferation in response to androgen ma- vation that GFP-labeled epithelial cells were CK-5 neganipulation will provide insights into the mechanism of tive (Fig. 5). Despite heterogeneous GFP labeling in the
prostate cancer progression, particularly to the lethal prostate, the majority of the labeled GFP-positive cells
were obviously CK5 negative in both regressed and fullyCx resistance phenotype.
The surviving, labeled luminal epithelial cells com- grown prostate. Although confocal microscopy did not
prised approximately 70% of the luminal epithelial cells detect any CK-5-positive GFP-labeled cells (Fig. 5), their
in the castrated and regenerated prostate, suggesting the existence cannot be ruled out. Regardless, this argues that
proliferative capacity of luminal cells. This was supported the majority of surviving, labeled epithelial cells in the
by BrdU labeling of a majority of GFP-labeled prostate luminal compartment of castrated prostate are not CK5luminal epithelial cells in a castrated prostate 3 d after positive intermediate or transit-amplifying cells, suggesttestosterone replacement (Fig. 4). This BrdU labeling ex- ing that prostate regeneration is driven largely by preexperiment was not intended to track cell fate because BrdU isting luminal epithelial cells.
The finding in this study is not consistent with prelabeling is not specific to luminal cells and can be diluted
during cell divisions (14). The BrdU labeling result was vious reports suggesting that AR-negative putative stem/
consistent with previous data that the maximum of lumi- progenitor/basal epithelial cells give rise to a majority of
nal epithelial cell proliferation occurred around 3 d after luminal epithelial cells and to structures resembling prosandrogen replacement (19, 20). Taken together, the ma- tate glandular architecture based on tissue recombination
jority of surviving luminal epithelial cells in the regressed experiments in the presence of urogenital sinus mesenprostate is capable of proliferating and participating in chyme cells (7). Urogenital sinus mesenchyme cells have
the repopulation of luminal epithelial cells during prostate potent induction capabilities toward prostatic differentiregeneration. This finding argues an important role for sur- ation; they can even induce the differentiation of bladder
Mol Endocrinol, November 2011, 25(11):1849 –1857
mend.endojournals.org
1855
FIG. 5. Confocal microscopic analysis of CK5-stained lateral prostate sections of PSA-CreERT2/Rosa26R mT/mG mice after Cx (TAM-Cx) and two
cycles of regeneration (TAM-Cx-2 Cycle T). The lateral prostate sections were from castrated or regenerated prostates as described in Fig 3. Shown
are representative images of confocal microscopy of GFP and CK5 staining and regular fluorescent microscopy of GFP and DAPI staining. Arrows
indicate CK5-positive basal cells. In confocal images, CK5-positive cells can be surrounded by GFP-positive cells in one focal plane but not in
another focal plane. Scale bars, 25 ␮m. T, Testosterone.
epithelial cells into cells expressing prostate epithelial proteins (21). According to the results presented here, however,
basal cells are unlikely to be an important source of newly
regenerated luminal epithelial cells in the prostate in vivo, at
least during the first two cycles of regression and regeneration. Furthermore, labeled luminal epithelial cells in the
adult prostate do not seem to undergo transdifferentiation
to become basal epithelial cells during cycles of regression
and regeneration. Thus, regeneration of PSA-CreERT2labeled luminal epithelial cells appears independent of basal
cell lineage in the prostate.
A limitation of the lineage tracing of luminal epithelial
cells is its inability to detect the existence of rare stem cells
such as the CARN. These potential stem cells are very
rare, comprising only approximately 0.7% of the epithelial cells in the castrated mouse prostate (12). The PSACreERT2-labeled luminal cells seemed to behave differently from CARN, although both types of the labeled cells
are capable of regenerating. Genetically labeled CARN
can differentiate into both basal and luminal epithelial
cells in prostate regeneration, and the labeled cells were
increased from 0.37% to 3.3% after the initial cycle of
regeneration and then maintained in the subsequent cycles of regression and regeneration (12). In contrast, PSACreERT2-labeled cells maintained their abundance at approximately 70% and luminal phenotype in the prostate
during regression or regeneration (Fig. 3), but did not
seem to differentiate into basal cells. Further studies will
be necessary to determine the relationship between
CARN and PSA-CreERT2-labeled cells.
Another limitation to this study is that only two cycles
of regression-regeneration were performed. Prostatic lu-
minal epithelial cells may have short-term proliferation
capacity, which can be exhausted after multiple cycles of
regression-regeneration of the prostate. However, there is
no evidence suggesting that the mechanism of prostate
regeneration in early cycles of Cx-androgen replacement
is different from that in the late cycles. Further studies will
be needed to address this issue.
The finding of luminal epithelial regeneration from
preexisting luminal cells raises several important questions. For example, are prostatic luminal cells surviving
Cx predetermined or stochastic? Is it possible that labeled
luminal cells will exhaust their regeneration potential after multiple cycles of regression and regeneration? Also, is
regeneration of adult prostate during androgen manipulation different from early prostate development in urogenital sinus? To address these important questions, additional studies will be needed.
In summary, newly-formed luminal epithelial cells are
predominantly derived from preexisting luminal epithelial
cells during the first two cycles of regression and regrowth in
the adult mouse prostate. This study demonstrates the survival and proliferation of luminal epithelial cells in response
to Cx and androgen replacement, respectively. Understanding the mechanisms of androgen action in prostatic luminal
epithelial cell regeneration may shed light on the progression
of prostate cancer cells to Cx resistance.
Materials and Methods
Animal work
All animal studies were performed according to an approved
IACUC protocol. Generation of PSA-CreERT2 mice has been pre-
1856
Liu et al.
Regeneration of Luminal Cells in Adult Prostate
viously described (17), and Rosa26R-lacZ (22) and mT/mG (23)
mice were obtained from The Jackson Laboratory (Bar harbor,
ME). PSA-CreERT2 mice were cross-bred with ROSA26R-lacZ
mice (The Jackson Laboratory) to generate double transgenic PSACreERT2/R26R-lacZ mice. Genotyping was confirmed by PCR
using tail genomic DNA. Primers specific for Cre recombinase mice
were upstream primer TTGCCTGCATTACCGGTCGATG and
downstream primer TCCAGCCACCAGCTTGCATG. Doublefluorescent mT/mG mice, which express red fluorescence before,
and green fluorescence after, TAM-induced Cre-mediated recombinationwerealsogeneratedtoconfirmresults.Membranetargeted tdTomato (mT)/membrane-targeted enhanced GFP
(mG) mice were crossed with PSA-CreERT2 mice to generate
PSA-CreERT2/Rosa26R mT/mG mice. Genotyping was confirmed by PCR of tail genomic DNA with primers; wild-type
forward, CTCTGCTGCCTCCTGGCTTCT; wild-type reverse,
CGAGGCGGATCACAAGCAATA; and mutant reverse, TCAATGGGCGGGGGTCGTT.
TAM induction of Cre activity in mice containing the PSACreERT2 allele was performed as previously described (24).
Briefly, TAM (Sigma Chemical Co., St. Louis, MO) suspended
in corn oil 3 mg/40 g of body weight or vehicle alone was
injected ip daily for 5 consecutive days in adult mice. Mice were
randomized into groups and either euthanized 10 d after the last
TAM injection or subjected to Cx with sc testosterone pellet
implantation 3 wk after Cx. For cycles of prostate regrowth and
regression, testosterone pellets were removed from the mice 2
wk after implantation at the end of the regrowth phase, then
removed, after which the prostate was allowed to regress for 3
wk before reimplantation of another testosterone pellet. Testosterone pellets were made as previously described (25). Approximately 7.5 mg testosterone (Sigma) were tightly packed into a
silicone tube with an inner diameter of 1.58 mm and outer
diameter of 3.18 mm (Helix Medical, Carpinteria, CA).
To verify androgen dependency and the transient nature of
TAM-induced labeling, TAM was either injected or administered by oral gavage 3 wk after Cx in control groups. At 2 wk or
4 wk after the last dose of TAM, mice were either euthanized, or
implanted with testosterone pellet. After regeneration of the
prostate, mice were either euthanized or subjected to pellet removal for serial regression and/or regeneration of prostate.
Whole mount x-gal and GFP staining
and histology
The lateral prostate was dissected and stained with x-gal as
described previously (18, 26). Briefly, prostate lobes were dissected in cold PBS and fixed in lacZ fix buffer (0.2% glutaraldehyde; 50 mM EGTA, pH 7.3; 100 mM MgCl2 in PBS) on ice for
30 min with gentle shaking. Tissues were then washed three
times for 20 min each in lacZ wash buffer (2 mM MgCl2, 0.01%
sodium deoxycholate, 0.02% Nonidet P-40 in PBS). Staining
was performed with 1 mg/ml x-gal, 5 mM potassium ferrocyanide, and 5 mM potassium ferricyanide in lacZ wash buffer at
room temperature for 2 h, with gentle shaking and protection
from light. After staining, samples were washed three times for
10 min in PBS to stop the reaction and postfixed in 4% paraformaldehyde in PBS before paraffin embedding. Sections (5
␮m) were counterstained with neutral red. Slides were imaged
using a Leica DM LB microscope (Leica Microsystems, Inc.,
Mol Endocrinol, November 2011, 25(11):1849 –1857
Buffalo Grove, IL) equipped with QImaging micropublisher 3.3
digital camera (QImaging, Surrey, British Columbia, Canada).
For double fluorescent mice, tissue and cryosection preparation were as described previously (23). Briefly, prostates
were fixed in 4% paraformaldehyde for 24 h, followed by
30% sucrose for 24 h. Lobes were then dissected for subsequent cryoembedding in OCT compound (Sakura Finetek
USA, Inc., Torrance, CA). Sections (10 ␮m) were washed
with PBS and mounted with Vectastain mounting media with
4⬘,6-diamidino-2-phenylindole (DAPI) (Vector Laboratories).
Quantification of x-gal and GFP-labeled cells in
lateral prostate
For x-gal labeling, five sections per animal per each group
were scored manually with at least four animals per group. All
visible prostatic ducts in lateral lobes were imaged at 40⫻ magnification, and all clearly visibly distinguishable cells were
counted. The percentage of x-gal-labeled cells was determined
by dividing the number of labeled cells by the total number of
cells scored in each region. The results were expressed as the
mean and the SD at each time point, and comparison between
groups were calculated using the one-way ANOVA and Bonferonni’s Multiple Comparison Test as appropriate. GFP-labeled
cells were counted similarly, with five sections per animal per
each group with at least two animals per group.
Immunostaining
Immunohistochemical staining was performed on serial
10-␮m cryosections prepared from frozen formaldehyde-fixed
blocks, incubated in 0.5% Triton X 100 for 10 min, followed by
antigen retrieval through boiling in antigen-unmasking solution
(Vector Laboratories, Inc., Burlingame, CA). Slides were
blocked with blocking reagents provided in the M.O.M. (Mouse
on Mouse) immunodetection kit (Vector Laboratories) for
mouse primary antibodies or in 10% normal serum for other
antibodies, and then incubated with primary antibodies overnight at room temperature. Primary antibodies and dilutions
used were p63 (1:50, clone A4A, sc-8431, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), BrdU (1:200, antibody 1893;
Abcam, Cambridge, MA), CK5 (1:250, PRB-160P; Covance
Laboratories, Inc., Madison, WI), and CK18 (1:100, antibody
668, Abcam). Slides were then incubated with secondary antibodies (diluted 1:200 in 0.3% horse or donkey serum, PBS)
labeled with Alexa Fluor 350, Alexa Fluor 594, or Alexa Fluor
647 (Invitrogen, Carlsbad, CA). Sections were mounted with
Vectastain mounting media either with or without DAPI.
BrdU labeling
Mice received an ip injection of 0.25 ml BrdU labeling reagent (Zymed Laboratories, Inc., South San Francisco, CA; Invitrogen) 28 h and 4 h before euthanasia.
Fluorescent and confocal microscopy
Immunofluorescent staining was imaged using a Zeiss Axioplan2 microscope (Carl Zeiss MicroImaging, LLC, Thornwood, NY) equipped with fluorescein isothiocyanate, tetamethylrhodamine isothiocyanate and DAPI filters, and images were
merged using Axiovision Rel. 4.5 imaging software. For confocal microscopy, immunofluorescence staining was imaged using
the Leica TCS-SL confocal microscope (Leica Microsystems Inc,
Mol Endocrinol, November 2011, 25(11):1849 –1857
Bannockburn, IL) with a 63⫻/1.4 NA oil immersion lens. Final
composites were constructed with IMARIS (Bitplane) software
Version 7.0.
Acknowledgments
We thank Dr. Dean Bacich for critical reading and insightful
discussion.
Address all correspondence and requests for reprints to:
Zhou Wang, Ph.D., University of Pittsburgh School of Medicine-University of Pittsburgh Medical College Shadyside,
Department of Urology, 5200 Center Avenue, Suite 209,
Pittsburgh, Pennsylvania 15232. E-mail: [email protected].
E-mail addresses for other authors are as follows. J.L.:
[email protected]; L.E.P.: [email protected]; S.I.: isharwal.
[email protected]; D.M.: [email protected]; R.R.G.:
[email protected]; J.P.: [email protected]; S.K.:
[email protected]; W.K.: [email protected]; P.H.B.:
[email protected]; J.B.N.: [email protected]; P.C.:
[email protected]; Z.W.: [email protected].
This work was supported in part by National Institutes of
Health Grants 5 R37 DK51193, R01 CA 108675, 1 P50
CA90386, and P30 CA047904. J.L. was a recipient of the Mellam Family Foundation Fellowship and L.E.P. is a trainee of
National Institutes of Health T32 DK007774 training program.
Disclosure Summary: The authors declare that they have no
competing interests.
References
1. Isaacs JT 1985 Control of cell proliferation and cell death in the
normal and neoplastic prostate: a stem cell model. In: Rodgers CH,
Coffey DS, Cunha G, Grayhack JT, Henman JR, Horton R, eds.
Benign prostatic hyperplasia. Washington DC: Department of
Health and Human Services, National Institutes of Health; 85–94
2. Bonkhoff H, Remberger K 1996 Differentiation pathways and histogenetic aspects of normal and abnormal prostatic growth: a stem
cell model. Prostate 28:98 –106
3. Litvinov IV, Vander Griend DJ, Xu Y, Antony L, Dalrymple SL,
Isaacs JT 2006 Low-calcium serum-free defined medium selects for
growth of normal prostatic epithelial stem cells. Cancer Res 66:
8598 – 8607
4. Uzgare AR, Xu Y, Isaacs JT 2004 In vitro culturing and characteristics of transit amplifying epithelial cells from human prostate tissue. J Cell Biochem 91:196 –205
5. Lawson DA, Xin L, Lukacs RU, Cheng D, Witte ON 2007 Isolation
and functional characterization of murine prostate stem cells. Proc
Natl Acad Sci USA 104:181–186
6. Wang Y, Hayward S, Cao M, Thayer K, Cunha G 2001 Cell differentiation lineage in the prostate. Differentiation 68:270 –279
7. Leong KG, Wang BE, Johnson L, Gao WQ 2008 Generation of a
prostate from a single adult stem cell. Nature 456:804 – 808
8. Richardson GD, Robson CN, Lang SH, Neal DE, Maitland NJ,
Collins AT 2004 CD133, a novel marker for human prostatic epithelial stem cells. J Cell Sci 117:3539 –3545
mend.endojournals.org
1857
9. Burger PE, Xiong X, Coetzee S, Salm SN, Moscatelli D, Goto K,
Wilson EL 2005 Sca-1 expression identifies stem cells in the proximal region of prostatic ducts with high capacity to reconstitute
prostatic tissue. Proc Natl Acad Sci USA 102:7180 –7185
10. Xin L, Lawson DA, Witte ON 2005 The Sca-1 cell surface marker
enriches for a prostate-regenerating cell subpopulation that can
initiate prostate tumorigenesis. Proc Natl Acad Sci USA 102:6942–
6947
11. Kurita T, Medina RT, Mills AA, Cunha GR 2004 Role of p63 and
basal cells in the prostate. Development 131:4955– 4964
12. Wang X, Kruithof-de Julio M, Economides KD, Walker D, Yu H,
Halili MV, Hu YP, Price SM, Abate-Shen C, Shen MM 2009 A
luminal epithelial stem cell that is a cell of origin for prostate cancer.
Nature 461:495–500
13. Evans GS, Chandler JA 1987 Cell proliferation studies in the rat
prostate: II. The effects of castration and androgen-induced regeneration upon basal and secretory cell proliferation. Prostate 11:
339 –351
14. Tsujimura A, Koikawa Y, Salm S, Takao T, Coetzee S, Moscatelli
D, Shapiro E, Lepor H, Sun TT, Wilson EL 2002 Proximal location
of mouse prostate epithelial stem cells: a model of prostatic homeostasis. J Cell Biol 157:1257–1265
15. Verhagen AP, Ramaekers FC, Aalders TW, Schaafsma HE, Debruyne FM, Schalken JA 1992 Colocalization of basal and luminal
cell-type cytokeratins in human prostate cancer. Cancer Res 52:
6182– 6187
16. Dor Y, Brown J, Martinez OI, Melton DA 2004 Adult pancreatic
␤-cells are formed by self-duplication rather than stem-cell differentiation. Nature 429:41– 46
17. Ratnacaram CK, Teletin M, Jiang M, Meng X, Chambon P,
Metzger D 2008 Temporally controlled ablation of PTEN in adult
mouse prostate epithelium generates a model of invasive prostatic
adenocarcinoma. Proc Natl Acad Sci USA 105:2521–2526
18. Cleutjens KB, van der Korput HA, Ehren-van Eekelen CC, Sikes
RA, Fasciana C, Chung LW, Trapman J 1997 A 6-kb promoter
fragment mimics in transgenic mice the prostate-specific and androgen-regulated expression of the endogenous prostate-specific antigen gene in humans. Mol Endocrinol 11:1256 –1265
19. Bruchovsky N, Lesser B, Van Doorn E, Craven S 1975 Hormonal
effects on cell proliferation in rat prostate. Vitam Horm 33:61–102
20. Sugimura Y, Cunha GR, Donjacour AA, Bigsby RM, Brody JR
1986 Whole-mount autoradiography study of DNA synthetic activity during postnatal development and androgen-induced regeneration in the mouse prostate. Biol Reprod 34:985–995
21. Cunha GR, Lung B, Reese B 1980 Glandular epithelial induction by
embryonic mesenchyme in adult bladder epithelium of BALB/c
mice. Invest Urol 17:302–304
22. Soriano P 1999 Generalized lacZ expression with the ROSA26 Cre
reporter strain. Nat Genet 21:70 –71
23. Muzumdar MD, Tasic B, Miyamichi K, Li L, Luo L 2007 A global
double-fluorescent Cre reporter mouse. Genesis 45:593– 605
24. Hayashi S, McMahon AP 2002 Efficient recombination in diverse
tissues by a tamoxifen-inducible form of Cre: a tool for temporally
regulated gene activation/inactivation in the mouse. Dev Biol 244:
305–318
25. Wang Y, Gupta S, Hua V, Ramos-Garcia R, Shevrin D, Jovanovic
BD, Nelson JB, Wang Z 2010 Prolongation of off-cycle interval by
finasteride is not associated with survival improvement in intermittent androgen deprivation therapy in LNCaP tumor model. Prostate 70:147–154
26. Lobe CG, Koop KE, Kreppner W, Lomeli H, Gertsenstein M, Nagy
A 1999 Z/AP, a double reporter for cre-mediated recombination.
Dev Biol 208:281–292