Design and development of Van-gogh-likel conditional monse knockont
StevenHan
Department of Biochemistry
McGill University
Montreal, Quebec
Canada
August 2005
A thesis submitted to McGill University in partial fulfilment of the requirements of the
degree of Master of Science
© Steven Han, 2005
1+1
Library and
Archives Canada
Bibliothèque et
Archives Canada
Published Heritage
Branch
Direction du
Patrimoine de l'édition
395 Wellington Street
Ottawa ON K1A ON4
Canada
395, rue Wellington
Ottawa ON K1A ON4
Canada
Your file Votre référence
ISBN: 978-0-494-25079-2
Our file Notre référence
ISBN: 978-0-494-25079-2
NOTICE:
The author has granted a nonexclusive license allowing Library
and Archives Canada to reproduce,
publish, archive, preserve, conserve,
communicate to the public by
telecommunication or on the Internet,
loan, distribute and sell th es es
worldwide, for commercial or noncommercial purposes, in microform,
paper, electronic and/or any other
formats.
AVIS:
L'auteur a accordé une licence non exclusive
permettant à la Bibliothèque et Archives
Canada de reproduire, publier, archiver,
sauvegarder, conserver, transmettre au public
par télécommunication ou par l'Internet, prêter,
distribuer et vendre des thèses partout dans
le monde, à des fins commerciales ou autres,
sur support microforme, papier, électronique
et/ou autres formats.
The author retains copyright
ownership and moral rights in
this thesis. Neither the thesis
nor substantial extracts from it
may be printed or otherwise
reproduced without the author's
permission.
L'auteur conserve la propriété du droit d'auteur
et des droits moraux qui protège cette thèse.
Ni la thèse ni des extraits substantiels de
celle-ci ne doivent être imprimés ou autrement
reproduits sans son autorisation.
ln compliance with the Canadian
Privacy Act some supporting
forms may have been removed
from this thesis.
Conformément à la loi canadienne
sur la protection de la vie privée,
quelques formulaires secondaires
ont été enlevés de cette thèse.
While these forms may be included
in the document page count,
their removal does not represent
any loss of content from the
thesis.
Bien que ces formulaires
aient inclus dans la pagination,
il n'y aura aucun contenu manquant.
•••
Canada
Abstract
Neural tube defect is one of the leading causes of birth defect in human. Mouse
planar cell polarity genes Vangl2 and Vangll are expressed in the developing neural tube.
Mutation in Vang12 has been shown to cause mouse equivalent of craniorachischisis. A
cre/loxP conditional Vangll knockout was designed from a pFlox vector.
The
effectiveness of the cre/loxP recombination in pFlox was tested in a bacterial system.
The targeting vector was transfected into pluripotent E.S. cells to allow homologous
recombination to displace the wildtype Vangll. Cre expressing vector was transfected
into the E.S. cells to produce both the conditional and conventional Vangll knockout.
ii
Résumé
Anomalies du tube neural est l'une des causes principales du défaut de naissance
dans l'humain. Les gènes polarité planaire Vangl2 et Vangll de souris sont exprimés
dans le tube neural se développant. La mutation dans Vangl2 a été montrée à l'équivalent
de souris de cause du craniorachisis. Un coup de grâce Vangll conditionnel de cre/loxP a
été conçu et le vecteur d'optimisation a été créé dans un vecteur de pFlox. L'efficacité de
la recombinaison de cre/loxP dans le pFlox a été examinée dans un système bactérien. Le
vecteur d'optimisation était transfected dans les cellules pluripotent d'E.S. pour permettre
à la recombinaison homologue de déplacer le wildtype Vangll. Cre exprimant le vecteur
était transfected dans les cellules d'E.S. pour produire le coup de grâce Vangll
conditionnel et conventionnel.
III
Preface
The work described in this thesis is primarily my own. Dr. M. Tremblay, Dr. Z.
Kibar, Normand Groux, and Jacinthe Sirois had provided help, expertise, and advice
towards completion of my work. Dr. D. Chui has graciously provided us with the pFlox
vector. Dr. P. Gros has provided his support and expert advices through my years in his
laboratory.
IV
Table of Content
Page
Abstract
11
Résumé
11I
Preface
iv
Table ofContent
v
List ofFigures
VII
Acknowledgements
IX
Introduction
1
1.1
Canonical and Non-canonical Wnt signaling
2
1.2
Asymmetric distribution of the primary genes determines the planar
6
Chapter 1
polarity
1.3
Neural Tube Defects
1.4
Van-gogh-like CVangl) homologues and Vangll conditional knockout
11
1.5
Conventional knockout versus cre/loxP conditional knockout
12
Methods and Materials
18
Chapter 2
7
II.1 Phage titration and screen
19
II.2 Phage large preparation
22
11.3 Targeting Vector construction from pFlox vector
23
II.4 Testing the effectiveness of the cre-directed recombination of the
27
targeting vector in an E. Coli DR10p
v
11.5 Transfection ofthe vectors and picking of the clones
27
11.6 E.S. isolation and Southem blot screen after targeting vector
28
transfection and cre recombinase transfection
II.7
Chapter 3
32p
probe preparation
30
31
Result
111.1 Conditional knockout strategy
32
111.2 Mouse 129 À phage library screen to isolate Vangll genomic DNA
33
111.3 Design and construction ofVangl1 targeting vector
33
IlIA Testing the 10xP sequence of the targeting vector in a bacterial system
36
111.5 Transfection of the targeting vector into E.S. cells and Southem
37
screen to isolate the homologously recombined clones
111.6 Transfection of the cre vector and Southem screen to detennine the
42
effectiveness of the cre-directed recombination
Chapter 4
49
Discussion
IV.t Cre/loxP Conditional knockout strategy ofVangll and the genomic
50
sequence isolation
IV.2 Transfection of the targeting vector and Southem blot analysis
50
IV.3 Cre recombinase transfection and Southem blot analysis
51
IV.4 Future studies
55
References
56
Appendix Compliance certificates
63
VI
List of Figures
Page
Chapter 1
Introduction
Figure 1: Canonical and non-canonical Wnt signaling pathway
4
Figure 2: A cartoon diagram of a neural tube formation during an
9
embryonic development
Figure 3: A homologous recombination of the targeting vector with
13
the target gene in a conventional knockout
Figure 4: Cre directed recombination within a single strand ofDNA
Chapter 2
16
Methods and Materials
Figure 5: An outline diagram ofÂ. phage screen to isolated Vangll
20
genomicDNA
Figure 6: Design and construction of pFlox targeting vector
Chapter 3
25
Results
Figure 7: PCR ofVangll exons 3 and 4 from lambda phage library
34
templates
Figure 8: Cre-directed recombination efficiency of the targeting vector
38
in a bacterial system
Figure 9: A diagram of the conditional knockout strategy
Vil
40
Figure 10: Southem blot analysis to distinguish between random the
44
insertion versus the homologous recombination of the
targeting vector
Figure Il: Southem screen to distinguish between the different outcomes
46
from a cre-directed recombination
Chapter 4
Discussion
Figure 12: A diagram showing the possible combination ofhomologous
recombinations possible between the targeting vector and
Vangll genomic DNA
Vlll
52
Acknowledgements
1 would like to express my gratitude to my supervisor Dr. P. Gros for all his
support, guidance, and understanding throughout my studies in his labo 1 would also like
to extend my appreciation to all the members that provided their support. In particular Dr.
Zoha Kibar, Dr. Elena Torban, Dr. John Forbes, Dr. Hui Jin, Norman Groux, Sergio
Appuzo, and Mellisa Mathew who have bestowed significant knowledge and laughter.
1 would like to mention a special thanks to my family for their support and my
wife for her continual belief in me.
IX
CHAPTERI
INTRODUCTION
1.1
Canonical and Non-canonical Wnt signaling
Wnt is a small secreted protein first identified in 1982 by Nusse and Varmus l .
Since then there has been almost 4000 publications related to this family of protein. In
the past several years the study of Wnt proteins has exploded having 70% of the
publications written within the past five years. Thus far there are 21 proteins on the list of
Wnt family and the list is growing. This family of protein is of interest because it has
been found to be involved in number of human diseases including carcinogenesis and
Alzheimer's disease2,3,9. It is also involved in many normal developmental processes such
as generation of the mesencephalon and cerebellum, cell/tissue polarity, and convergence
and extension (CEt-8,IO,Il. The Wnt proteins have been conserved throughout evolution
and through speciation, therefore the study of Wnt has been extensively investigated often
in Drosophila, zebrafish, Xenopus, and mouse41 •
Thus far there are two known Wnt pathways: A canonical or Wntlp-catenin
pathway and a non-canonical pathway. AIl Wnt pathways have a common beginning:
An extracellular Wnt protein binds to a seven transmembrane Frizzled (Fz) protein, which
in turn recruits and signals to cytoplasmic Dishevelled (Dvl) proteinS8 . In a canonical
Wnt pathway, the Wnt binds to a Fz with the help of LRP-5/6 co-receptors to signal Dvl
(Figure 1). With the help of G-protein, Dvl inhibits glycogen synthase kinase 3p (GSK3p)S9.
In the absence of the Wnt signal, a multi-protein complex including axin,
adenomatosis polysis coli (APC), and GSK-3p phosphorylates the p-Catenin9.
Phosphorylated p-catenin becomes ubiquitinated and degraded 12 • In the presence of Wnt
signal the Dvl inhibits the action of the muti-portein complex allowing the p-catenin to
stabilize and accumulate in the cytoplasm13 • The p-catenin then translocates into the
2
nucleus to work with LEF/TCF transcription factor to initiate transcriptions that controis
ceIl proliferation, apoptosis, and ceIl fate 14,J5.
There are two major non-canonicai pathways that have been under intense studies
in the recent years: The WntlCa2+ pathway and the planar cell polarity (PCP) pathway
(Figure l). With the help of G protein, activation of the WntlCa2+ pathway Ieads to
intraceIlular release of Ca2+26 .
This in turn activates calcium sensitive calmodulin-
dependent protein kinase II (CamKlI) and protein kinase C (PKC)27-28.
It has been
suggested that activation of the two kinases is implicated in cell movements known as
convergence and extension (CE) as weIl as the cell fate determination.
In the PCP
pathway, Wnt signais to Dvl through Fz with the aid of G protein which in turn signais
Rh0 29 .
Rho has been weIl documented to be a modulator of cytoskeleton and is
implicated in establishing a ce11/tissue polarity6o. Studies of WntlCa2+ and PCP pathways
began separately but in the recent years it had been suggested that the two pathways are
not as different as once thought18. For example, both the WntlCa2+ and the PCP pathways
are activated by Wnt5a and Wntl1 19-22.
Aiso the PCP specifie Dsh8DIX and pkl
proteins can activate WntlCa2+ pathwai3-24 • Both the orthologs of Drosophila PCP
pathway and WntlCa2+ pathway in Xenopus and zebrafish control convergence and
extension25 . In mouse, the Ce/srI mutation disrupts both PCP and CE movement during
the neural tube formation4o,43. Combination of these evidences strongly suggests that
WntlCa2+ and PCP pathways have at least a similar mode of action and function. From
this point forward the "PCP pathway" will relate to both pathways.
Many of our current understanding of PCP come from the studies of Drosophila
eye and wing, and Xenopus, zebrafish, and mouse development1S-17,45. In the Drosophila
eye the PCP determines the anterior-posterior axes, the dorsal-ventral axes, and
3
Figure 1. Canonical and non-canonical Wnt signaling pathway. Both pathways begin
with the binding of a smali extracellular Wnt protein to a seven transmembrane Frizzied
(Fz) protein, which signaIs through Dishevelled (Dvl) protein. In a canonical/p-catenin
pathway the Wnt signal prevents the muti-protein complex from phosphorylating
catenin, which in turn becomes ubiquitinated and degraded.
P-
Wnt signal allows the
accumulation of p-catenin in the cytoplasm, which translocates to the nucleus to initiate
transcription with the help of LEF/TCF. In a non-canonical pathway, Fz signals to Rho
and to increase the intracellular Ca2+ concentration.
rearrangement.
4
This activates the cytoskeletal
Canon icalll3-Catenin
Pathway
/'
e
t
Non-Canonical
~
Pathway
<[aamy
~hOSPhOrylation
Degradation
l{-catenln~
_/7". ... - - - - -
., ~
.; .; ...... Hot.nln
\
/ \
€amK, ~
\
1
e-B
e .....
. ~ ...
Rho
~
~
~
- - - - .... ....
........
Cytoskeletal
Rearrangements
~
c===s
LEFrrCF
D
Cell proliferation, apoptosls,
and cell fate determinatlon
5
,
,,
specification ofR31R4 ommatidium precluster pair30 • Best known example ofPCP is the
organization of the Drosophila wing hair orientation46-49. Each individual wing epithelial
cell has an actin extension callcd a tricorne (the hair). All of the hair formation begins at
the distal end of each wing epithelial cell and extends distally in an angle. In the wing,
the PCP signal directs the regulation of the cytoskeleton reorganization. An asymmetric
distribution of the subceUular components controls the cytoskeleton reorganization31,53.
1.2
Asymmetric distribution of the primary genes determines the planar polarity
What has come to be known as the primary (also known as the "core") PCP genes
are those that respond to the Wnt signal in a pep pathway. The primary genes have the
unusual characteristics of disrupting the PCP pathway when they are both down regulated
or overexpressed50,51,36. The mechanism of this action is unclear. The secondary pep
genes are the tissue specifie effectors that respond to the primary genes. For example, a
roulette gene plays a role in ommatidial polarity development while the genes multiple
wing hair, inturned, andfozzy are implicated in formation of Drosophila wing hair and
bristle32-34. In contrast, the primary genes are not tissue specifie and are always involved
in pep pathways.
The primary genes include Fz, Dvl, StrabismusNan Gogh
(StbmNang), Prickle (Pk), Flamingo/Starry night (Fmi/Stan), Fat (Ft), and Dachous (Ds).
Sorne of the primary genes are distributed asymmetrically along the cell membrane and
this asymmetrical distribution partakes in creating the cell polarity36. The mechanism of
this action is unclear. In the R31R4 ommatidial precluster of a Drosophila eye the cells
that accumulate Fz and Dvl at the R31R4 interface become the R3 cell while the R4 ceU
has an accumulation ofVang at the interfaces. After the determination of the R31R4 cell
6
fate, the cells rotate along the anterior-posterior axis to have the R3 cell closer towards
the equator of the eye. In a normal Drosophila wing every individual epithelial cell is
oriented in the same way. Fz is localized to the distal end of the cell where it recruits the
Dvl to the plasma membrane while the Vang and Pk are localized to the proximal end3637,8.
This asymmetric subcellular localization determines the orientation and initiation site
of the hair. In this way the asymmetrical distribution of the primary genes determines the
planar cell polarity.
A recent study has proposed a model for the Drosophila haïr polarity development
in the abdomen36 • It has been previously proposed that an unspecified gradient X is
established in each of the abdominal compartment creating the asymmetrical distribution
of the primary genes38 • This gradient is possibly detected by the Fz protein and compared
to the gradient of the neighbouring cells with the help of Stan. This sets up a downward
activity of Fz from anterior to posterior in each of the abdominal compartment
independently of the adjacent compartment, and initiation of the hair formation occurs
close to the boundary of a neighbouring cell producing lesser Fz activity extending
towards the posterior.
1.3
Neural Tube Defects
Neural tube defects (NTD) are one of the most common birth defect affecting 1
out of 1000 pregnancies worldwide. During normal embryonic deve10pment invagination
of the ectoderm folds on itself and closes to form a tube like structure called the neural
tube, which becomes the future brain and spinal column (figure 2)53. After the neural
tube folds the closure is initiated at three locations (hindbrainlcervical boundary,
7
forebrainlmidbrain boundary, and rostral extremity of the forebrain) and extends in a
zipper-like fashion39 •
In the hindbrainlcervical boundary and forebrainlmidbrain
boundary initiation sites the closure continues bi-directionally where as in the rostral
extremity initiation site the closure continues caudally.
In a NTD the closure is delayed or fails during the embryonic development. The
phenotype can vary from little or none to a completely open neural tube. BOth the genetic
and the environmental factors attribute to NID. An environmental factors such as having
not enough folie acid prior to and/or during pregnancy accounts for 70% or more of the
NTD cases44.54. Also the genetic inheritance does not follow the simple Mendelian traits,
suggesting that multiple genes may be involved in the defect44 • In humans some of the
common NTDs include encephalocele, anencephaly, craniorachischisis and spina bifida.
In an encephalocele, anencephaly and craniorachischisis part or all of the brain and spinal
column is exposed to the environment. These types of defects are usually lethal at or
prior to birth. However the most common form of NTD is the spina bifida where the
infant often survives birth and beyond. Spina bifida occurs through the failure of Iower
spinal column to close properly and can develop into serious physiological and
neurological problems44 •
In research the NTDs are mainly studied in a mouse model. In the past few years,
it has been demonstrated that the disruption of pep genes can cause mouse NTDs. For
exampIe, mutations in Celsri causes Spin cycle (Scy) or Crash (Crsh) phenotype,
mutation in Vangl2 (Vang-like 2, also known as Ltap) causes Looptail (Lp) phenotype,
and mutation in Scribblei (Scrbi) causes Circle tail (Cre) phenotype40-42,4S. Our study
involves creating a mouse Vangll mutant.
8
Figure 2.
A cartoon diagram of a neural tube fonnation during an embryonic
development. A transverse section of a developing neural tube shows an ectodenn (E)
fol ding and dosing on itself to fonn the neural tube. The initiation of the dosure begins
at the hindbrainlcervical boundary, forebrainlmidbrain boundary, and rostral extremity
and continues bi-directionally in a zipper-like fashion.
9
E _ __
~
E
0
10
1.4
Van-gogh-like (Vangl) homologues and Vangll conditional knockout
Strabismus (Stbm) protein is a four transmembrane protein containing a PDZ
binding motif on its C-terminal.
Stbm was first identified in a Drosophila during
examining the orientation of the ommatidium in the eye.
characteristics of a "crossed eye" hence the name6S •
Stbm mutants had the
Mammalian homologues of
Drosophila Stbm is known as a Looptail associated proteinIVan-Gogh-like (LtapNangl).
In mammals there are two paralogs and in mouse they are known as Vangll and Vangl2.
A recent study has shown that Vangl1 is mainly expressed in the developing floor plate of
the neural tube around cranial region whereas the Vangl2 is expressed elsewhere in the
neural tube but the floor plate61 • A related study has shown that an overexpression of
Vangll rescues the TriIVangl2 mutant phenotype in zebrafish even though the expression
pattern showed that most of the Vangll and the Vangl2 do not overlap62. This result
shows that Vangl1 and Vangl2 may have overlapping activity however they are expressed
in separate tissue compartments indicating that both genes are required for normal
development.
Studies have shown that Vangl proteins are involved in establishing both planar
polarity and inducing CE66-67. It has been shown that the dorsal involuting marginal zone
of Keller sandwich expants undergo CE63 • Through Keller sandwich expants homologue
of mouse Vangl protein Xenopus Stbm has been shown, to be involved in CE during
neural tube formation.
In various other organisms including Xenopus, zebrafish,
Drosophila, and mouse, it has been shown that StbmNangl is involved in establishing
neural tube 14,43,so,51,56.
Mutation in mouse Vangl2 has been shown to cause
craniorachischisis41 • However the effect of mouse Vangll mutation is not known. Our
11
study attempts to create a conditional mouse Vangll knockout to characterize and study
the effect of the protein.
1.5
Conventional knockout versus cre/loxP conditional knockout
In a conventional knockout, pluripotent E.S. cells are transfected with a gene
targeting vector containing two regions of homology and a disruption in the coding
sequences (Figure 3). The targeting vector contains a positive selectable marker and a
negative selectable marker (in this example neomycin resistance and HSV-TK
respectively). The transfected cells are put under neomycin selection to discourage those
cens that have not incorporated the targeting vector into its genome from growing. The
vector can be integrated into the genome homologously or randomly. Most random
insertions occur through recombination at the ends of the targeting vector. This allows
integration of HSV-TK gene into the genome. Those cens that contain the HSV-TK gene
can be discouraged from growing by selecting the transfected cells with ganciclovir
selections7 • The surviving cens are main1y composed of the cells that have undergone
homologous recombination. peR and Southem blot analysis are done to identify and
verify those cens that have the knockout.
The cre/loxP conditional knockout is a moditied version of the conventional
knockout. In circumstances where the protein targeted for the knockout is vital to the
development, a conventional knockout may not be use fui in postnatal studies. A
conditional knockout has a normal protein under uninduced state whereas in an induced
state the protein is mutated. A cyclinization recombination (cre) recombinase was tirst
derived from a bacteriophage PI. A 10xP sequence consists of 8bp directional sequence
12
Figure 3. A homologous recombination of the targeting vector with the target gene in a
conventional knockout. In a conventional knockout, the targeting vector is transfected
into a pluripotent E.S. cens. The vector can be incorporated into the genome randomly or
homologously. In a homologous recombination the targeting vector lines up with the
corresponding region of the target gene and displaces the target gene.
A positive
selectable marker is used to select against those cens that have not incorporated the
targeting vector and a negative selectable marker is used to select against those cens that
have inserted the targeting vector randomly. The remaining clones are mainly made up of
clones that have undergone a homologous recombination.
13
Targeting vector
Neo
x
HSV-TK
Homologous
recombination
Target gene
Neo
Conventional knockout
14
X
in the middle flanked by two 13bp sequences that are invert of each other. The cre
recombinase recognizes two 10xP sequences and brings them together and catalyses
recombination (Figure 4). If the two 10xP sequences are on the same stretch ofDNA and
oriented in the same direction, the cre splices out the sequence in between. The cre
recombinase can be placed under various promoters that express time and/or tissue
specifically or be placed under a ligand induced promoter. Using these characteristics,
the cre/loxP can be used to delete part or the whole gene, time and/or tissue specifically.
Our study involves creating a cre/loxP conditional knockout of mouse Vangll
gene. A targeting vector was designed to insert two 10xP sequences into intronic regions
flanking the exon 4. At the start of our study, the mouse genomic sequence for Vangll
was unavailable. We obtained the genomic DNA from a mouse 129 À phage library and
used a pFlox vector to create the targeting vector.
15
Figure 4.
Cre directed recombination within a single strand of DNA.
The cre
recombinase binds to paraUel 10xP sequences on a same stretch of DNA and induce
recombination. The DNA in between the two 10xP site is spliced out. In a case where the
10xP sequences are in a reverse direction, the cre recombinase inverts the sequence in
between (not shown in diagram). In both cases the reaction is reversible.
16
~'
' ., 1
"
....
,1 ...... 1+--.......' ...
\
",
...
LoxP sequence
Ocre recombinase
17
CHAPTERII
METHODS AND MATERIALS
18
II.1
Phage titration and screen
General strategy of phage titration and screening is outline in figure 5.
À DAS~
II mouse 129 genomic library was obtained from Stratagene. The phage library was
diluted with À dilution solution (lOmM Tris pH8.0 + 10mM MgCb) 100, 10,000, and
100,000 folds. E. Coli LE392 (P2) was grown in LB overnight.at 37°C, centrifuged, and
re-suspended with equal volume of 10mM sterile MgS04. From this point forward all
E.coli LE392 (P2) was re-suspended in equal volume of sterile 10mM MgS04 prior to use.
1J11 from each of the diluted phage inoculated 200J11 of the re-suspended E. Coli at room
temperature for 20 minutes to allow the phages to adhere to the bacteria. The Ehage/E.
Coli mixture was added to 3ml of pre-heated liquid NZCYM top agar maintained at 45°C.
The top agar mixture was then poured over pre-heated (37°C) 100mm NZCYM agar plate
and spread evenly. The plate was cooled and incubated overnight at 37°C inverted. The
nuniber of plaque-forming units (Pfu) was counted and the original phage concentration
was calculated. The original phage library was diluted to give approximately 75,000 pfu
per IJ1l. 25J11 ofthis phage dilution inoculated 5ml of E. Coli LE392 (P2). The phage/E.
Coli mixture was poured into 225ml of pre-heated liquid NZCYM top agar maintained at
45°C. 9ml of the top agar mixture was evenly spread over each of the twenty 150mm
Petri dishes. The plate was cooled and incubated inverted in 37°C overnight. A nylon
membrane Was hybridized to the surface of each plate for 15min allowing the phage
particles to adhere to the membrane. Markings were made on the membrane and the
corresponding agar plate to be able to distinguish the orientation of the membrane to the
plate in the future. A duplicate nylon membrane Was made for each of the plate. Each
membranes were soaked in denaturing buffer for 30min, neutralizing buffer for 30min,
19
Figure 5. An outline diagram ofÂ. phage screen to isolated Vangll genomic DNA. The
phage infected E. Coli LE392 (P2) was plated to give 75,000 pfu/plate. The phage was
poured on NZCYM agar plate, grown, and transferred to master and replica nylon
membranes.
The phage on the membrane was denatured and the phage DNA was
crosslinked to the membrane by baking in 80°C oven for 2 hours. Southem blot was done
on both the master and the replica membranes with 348bp a_ 32p labelled N-terminal
Vangll cDNA probe. The master membrane and the replica membranes were compared
to sort out the background from the "true" positives. The phage on the corresponding
positive spots on the agar plate were cut out, re-suspended, and re-plated. This process
was repeated with 1000pfu/plate, 500pfu/plate, and 100pfu/plate to isolate a single clone
of phage without contamination. The single clone was plated again at 100pfu/plate to
verify that 100% of the pfu were positives.
20
!
-75,000 plaques/plate
r-----------I
M~
~
t
Nitrocellulose membane to pick up plaques
32-P sereen to
detect positive clone
C· o·~
1
Replica
Pick plaques
corresponding
10 positive plaques
and re-plate
'- -_____ @~
.!1iiV!t
21
-1,OOOplaquessecondtlme
<500 plaques third time
and 10X SSC for 30min taking care not to smear or move any phage partic1es around the
surface of the membrane.
The membranes were baked in vacuum oyen at 80°C for 2
hours to permanently crosslink the DNA to the membrane. The crosslinked membranes
were incubated at 65°C overnight with prehybridization solution containing 200 J..lg/ml of
single strand salmon sperm DNA. 348bp denatured a)2p labelled N-terminal cDNA
probe was added to the mixture and hybridized at 65°C overnight. The membranes were
washed using 500ml of each of the following solution: 2X SSC with 0.1 % SDS at room
temperature, 2X SSC with 0.1% SDS at 65°C, and O.5X SSC with 0.1% SDS at 65°C.
The washed membranes were air dried and exposed to Kodak BioMax@ MS Film for 4
days at -80°C. The films were developed and exarnined for spots and verified the validity
of the positives using the duplicate membranes. The corresponding areas on the agarose
plate to the positives on the membranes were cut out and re-suspended in 1m1
Â.
dilution
solution (with 10% v/v chloroform to lyse the bacteria to release the phage particles).
The plates containing 75,000 pfu has overlapping plaque forming units thus the agarose
cut out contains many phage contaminations. To isolate a single positive plaque the
phage suspensions were re-tittered, plated, and hybridized with 1000pfu/plate, then again
with 500 pfu/plate, and 10Opfu/plate. Once the single isolated positive was obtained,
plating and hybridization was repeated to give 100 pfu/plate to verify that 100% of the
clones were positive without contamination.
II.2
Phage large preparation
There were four phage clones isolated from the phage library in section 11.1. IL
large phage preparation was made from each of the four phage clones. Each clones were
22
titlered and inoculated 200ml of E. Coli LE392 (P2) to give approximately 50,000
pfu/plate. The phage/E. Coli mixture was added to 3ml of liquid NZCYM top agar preheated to 45°C. The top agar was poured evenly over 100mm NZCYM agar plate preheated to 37°C. The infected E. Coli was grown overnight at 37°C. 3ml oC\ dilution
buffer was poured over the plate and placed on a shaker at room temperature for 30min to
suspend the phage and bacterial particles. 2ml of the phage and bacteria suspension was
recovered and 0.2ml of chloroform was added to lyse the E. Coli. 300J.ll of E. Coli
LE392 (PÛ was inoculated with lOJ.lI of the phage suspension taking care not to add any
chloroform to the bacterial solution. The phage was allowed to adhere to the bacteria at
37°C water bath for 20min. The mixture was poured into IL of NZCYM liquid growth
media and grown overnight at 37°C with shaking. 5ml of Chloroform was added to the
flask and shaken for 30min.
The bacterial debris were pelleted in Sorvall RC-5 at
7000rpm and discarded. The supematant was placed in a clean flask and 60g ofNaCI and
70g ofPEG 8000 was added. The mixture was stirred at 4°C for 4 hours to dissolve. The
mixture was centrifuged in Sorvall RC-5 at 7000rpm for 20min to precipitate the phage
particles. The supematant was discarded and the phage pellet was dried and re-dissolved
in 10mi of 37°C 'A. dilution solution. 7.5 g of CsCI was added and dissolved. The phage
was purified using CsCI gradient spun at 40,000rpm in Beckman L8-70M ultracentrifuge
with Vti-70 rotor. The phage was extracted and dialysed against IL of 'A. dilution solution
3 tÏmes for 4 hours each.
II.3
Targeting Vector construction from pFlox vector
23
Construction of the mouse Vangll targeting vector is summarized in figure 6.
Primer pairs 5'CTGAGTGTCGACGGCTGGTTTTCTGGTGGTAT-TAAACC3' and
5'GACTCAGTCGACGTGCTAGACTGTCAGATGCTTTTGC3', 5'CCCAAAGGATCCCAGACTCTTGTTGAATGATCACACCAGG3'
~d5'GGGTTTGGATCCCTTTGG­
GAATTGCCATTGAGG3', 5'CCGTTTAAGCTTATAGACACAATGATGGCTACC3'
and 5'CGCTTTAAGCTTCAGCCCAACCGCATGACATTC3' were used to amplify
three consecutive genomic mouse V~gll sequences: The intron 3, exon 4 (the exon 4 in
this study refers to the entire exon 4 coding region plus the adjacent 780bp intron 3 ~d
316bp intron 4)
~d
intron 4 respectively. These primers introduce Sai l, Bam HI,
~d
HinD III sites into the flanking ends of the PCRs of intron 3, exon 4, and intron 4
respectively to aid in cloning of the PCRs into the targeting vector. The PCRs were
subcloned into commerciaIly available Invitrogen TOPO® TA cloning vector according to
the protocoi provided
~d
transformed into DHI0p E. Coli cells. A
s~dard
mini-prep
was done to isolate the three clones. The three clones were sequenced to verify that no
mutations were introduced. Intron 3, exon 4 and intron 4 were digested out from their
TOPO® vectors using Sai l, Bam HI, ~d HinD III respectively and gel purified using
QlAEX Il gel extraction kit according to the kit protocol. Exon 4, intron 4, and intron 3
(in this order, one at a time) were cloned into the pFlox vector using a
s~dard
cloning
method64 • First the exon 4 was cloned into an empty pFlox vector using SaIl
endonucleases
~d
a
s~dard
mini-prep was done. Since a single enzyme was used to
clone, the pFlox vector was mapped to verify the orientation of the insert. This process
was repeated with intron 4 then intron 3. The inserts had to be cloned in this order due to
the existence of endonuclease sites in the intron 4 and intron 3. Intron 4 introduced an
extra Bam HI site in addition to the pre-existing Bam HI site in the pFlox vector. This
24
Figure 6.
Design and construction of pFlox targeting vector.
Three separate peR
amplifications of intron 3, exon 4, and intron 4 were done from a continuous stretch of
mouse 129 genomic DNA. Each peR products were subcloned into TOPO® TA vector
and sequenced to verify that no mutations were introduced.
Subcloned peRs were
digested, purified, and cloned into pFlox vector containing three 10xP sequences,
neomycin resistance gene, and thymidine kinase gene. Exon 4, intron 4, and intron 3
were introduced into pFlox in this order to avoid introduction of endonuclease sites,
which would have disrupted cloning of another insert.
Mfe 1 unique site was also
introduced into 5'end of intron 3 to linearize the targeting vector prior to transfection into
E.S. cells.
25
Mouse 129 genomic DNA
f Lié";
E.
Subcloned &
sequencedin
TOPO® vector
PCR
; li
1
HinD~1,irtb~lëD III
pFlox
Targeting vector
26
... LoxP sequence
extra site would have made cloning of the exon 4 with Barn HI more difficult. Intron 3
introduced an extra HinD III site in addition to the re-existing HinDIII site in the pFlox
vector.
This would have made cloning of the intron 4 more difficult.
Finally, the
targeting vector was mapped using various endonucleases to verify that all three inserts
were in correct orientation.
II.4
Testing the effectiveness of the cre-directed recombination of the targeting
vector in an E.Coli DHI013
The efficiency of cre-directed recombinase was tested in an E. Coli DHI013 cells.
50ng of the targeting vector and 85ng of the cre recombinase vector (generously provided
by Klause Haller) was co-transformed into an E. Coli DHlO13 cells using a standard
transformation protocol64 •
The transformed E. Coli were grown on arnpicillin and
chlorarnphenicol treated LB plates at 30°C for 2 days.
10 clones were picked and
streaked on an arnpicillin treated LB plate and grown at 37°C overnight. Each of the ten
clones was picked and inoculated 10ml of LB containing 100 J.1g/ml arnpicillin.
A
standard mini-prep was done. Each of the clones was mapped using Eco RI, Sac l, Barn
HI, and HinD III endonucleases.
II.5
Transfection of the vectors and picking of the clones
A standard CsCI maxi-prep was done on the pFlox targeting vector and the cre
64
producing vector
•
The vectors were linearized using a unique endonuclease sites. Then
27
they were purified using QIAEX II gel extraction kit according to the kit protocol and
concentrated to 1JlgIJ.11 via evaporation in 37°C incubator.
Electroporation of the
targeting vector or cre producing vector was done into pluripotent E.S. cell, and the four
mutant (A2, C6, H6, and H9) clones respectively. The cells were grown in a complete
growth media and washed two times with PBS prior to digestion with trypsin 0.25% for
10-15min at 37°C. Single cell dispersions were counted and re-suspended in PBS to get
2x1Q7 celllml. 1ml of the E.S. cells were incubated on ice for 5 min with 60JlI (60Jlg) of
linearized targeting vector. Electroporation of 240V, 500JlF was done. The cells were
placed on ice for another 5 min and spread evenly on 10 10cm petri dish. The cells were
grown overnight with complete growth media without any selection then grown under
neomycin selection and ganciclovir selection for targeting vector and cre producing
vector transfection respectively for 10 days. The clones were picked and transferred to 96
well plates containing 150JlI of the growth media and left overnight to recover. Then the
cells were trypsonized and dissociated by pipetting up and down gently. The cells were
allowed to adhere to the weIl. The media was replaced carefully and the cells were grown
overnight. They were washed gently and triplicated by trypsonizing for 15 min and
diving into 3 weIl of three new 96 weIl plates. One of the three replicate plates was
frozen in 150JlI of freezing media (80% complete media, 10% serum, and 10% DMSO)
and 30 JlI of sterile mineral oil. The remaining two plates were grown until enough cells
could be harvested for DNA preparation.
II.6
E.S. isolation and Southern blot screen after targeting vector transfection and
cre recombinase transfection
28
Genomic DNA preparation and Southem blot targeting vector transfection was
mostly identical to cre recombinase transfection.
The one difference was the
endonuclease used for Southem blot analysis. The E.S. clones were picked and grown in
96 well plates. 50J.ll of lysis buffer with Img/ml proteinase K was added to each of the
wells and incubated at 55°C overnight. 100mi of 100% ethanol (containing 75mM NaCI)
was added to overnight digestion and incubated for 2 hours to precipitate the DNA. The
DNA was washed two times in 70% ethanol, dried at room temperature for 2 hours, and
re-suspended in 30J.ll of digestion mixture.
Digestion mixture containing Eco RV or
HinD III were used to identify those cells that have undergone homologous
recombination with the targeting vector. To identify the cells that have undergone cre
directed recombination, HinD III containing digestion mixture was used. The digestions
were done overnight at 37°C and run on 1% TAE agarose gel at 23V for 16 hours. The
gel was soaked in diluted ethidium bromide solution and the migration of the DNA was
measured under UV.
A nylon membrane was hybridized to the agarose gel overnight using standard
capillary method with 10X SSC buffer. The membrane was baked in 80°C vacuum oyen
for 2 hours to permanently crosslink the DNA to the membrane. The membrane was
prehybridized in a solution, with 50% formamide (v/v) and 200J.lg/ml denatured single
stranded salmon sperm DNA, overnight at 42°C. Denatured a_32 p labelled 460bp intron 3
probe was mixed into the prehybridization solution and hybridized at 42°C overnight (the
probe was located at 5' end just outside the cloning region of intron 3, see figure 10A).
The membrane was washed in 2X SSC & 0.1% SDS solution at room temperature for
15min, 2X SSC & 0.1 % SDS solution at 65°C for 45min, O.5X SSC & 0.1 % SDS
29
solution at 65°C for 45min, and O.lX SSC & 0.1 % SDS solution at 65°C for 45min. The
membrane was air dried, wrapped in saran wrap, and exposed to BioMax® MS film for
various days to obtain optimal results.
II.7
32p
probe preparation
Primers pair 5'GAATTCCCAAATGGTTCTCAAGGGTAT3' and 5'GAATTCTAACTATACAGACCAGCCATTTGA3' were used to PCR 460bp intron 3 AT 5' end
just outside the cloning region (Figure 10A). The PCR was subcloned into TOPO® TA
cloning vector and a standard CsCI maxi-prep was done64. The vector was digested with
Eco RI to release the probe and the probe was purified using QIAEX II gel extraction kit.
For each Southem hybridization 0.5ug of the probe was labelled with [a}2P]-dATP using
DNA polymerase 1 klenow fragments. The radiolabelled probe was washed in sephadex
G-50 beads to separate the probe from the unincorporated [a)2P]-dATP. Just before use,
the probe was heated at 100°C for 10min to denature.
30
CHAPTERIII
RESULT
31
111.1
Conditional knockout strategy
Vangll is a protein expressed mostly in the floor plate during the mouse neural
tube development. A conventional knockout ofVangll may produce a non-viable mouse.
In our study we are interested in developing a viable mouse mutant.
In order to
circumvent this possible complication we have designed and implemented a cre/loxP
conditional knockout strategy in which the knockout is induced only in the presence of
cre recombinase. Since the cre recombinase can be placed under the control of a tissue
and/or time specifie promoter, a conditional Vangll knockout can be made. The cre
recombinase can also be placed under a ligand induced promoter or an adenovirusdirected cre expression system. The overall strategy was to insert two 10xP sequences
flanking the Vangll exon 4 within intron 3 and intron 4.
In our cre/loxP conditional knockout, the exon 4 was targeted for deletion. Exon
4 contains the first three of the four transmembrane domains. The deletion will also cause
a frameshift and an early termination adding to the disruption. AlI that of the original
genomic protein remaining would be the flfSt 24 N-terminal amino acids (without any
transmembrane domains nor PDZ binding motif) of total 524. Our strategy involved
creating a targeting vector that includes neomycin resistance (Neo) and thymidine kinase
(TK.) selectable markers, and three 10xP sequences (Figure 9). The targeting vector was
linearized and transformed into pluripotent E.S. cells to displace the wildtype Vangll via
homologous recombination. Finally, the Neo and TK markers were displaced from the
genome by a partial cre-directed recombination. This minimizes the changes made to the
genome.
32
111.2
Mouse 129 Â phage library screen to isolate Vangll genomic DNA
At the start of the project, the mouse Vangll genomic DNA sequence was
unavailable. However, the cDNA sequence had been known. We used the cDNA as a
probe to screen the mouse 129 ').. DAS~ II genomic library. A full length Vangll
genomic DNA was greater than 39Kb. The average length of the foreign DNA that the
mouse 129 ').. DAS~ II library contains was approximately lOKb thus a single phage did
not contain the fulliength ofVangll genomic DNA. However, we only required the exon
4 and 3Kb of the surrounding introns. We used a_ 32 p dATP labelled 460bp N-terminal
cDNA probe to screen the phage library. Four clones were isolated from the screen and
analysed for their content. Exons 3, 4,5, and 6 were amplified using PCR and found that
all four phages contained only the exons 3 and 4 (Figure 7). At this point the genomic
sequence of the mouse Vangll became available in database, thus sequencing of the
genomic Vangll became unnecessary. From the genomic sequence in database, PCR
primers were designed to amplify 1.5Kb of introns 3 and 4 adjacent to the exon 4 to
verify the existence of the surrounding introns. From the ').. phage template, the PCR of
introns 3 and 4 were possible from aU four phage clones (data not shown).
111.3
Design and construction of Vangll targeting vector
Section III.1 described that our conditional knockout strategy was to insert two
loxP sequences flanking the exon 4. It has also been mentioned that exon 4 in this paper
refers to the exon ~ coding region as well as the adjacent 780bp intron 3 and 316bp intron
33
Figure 7. PCR of Vangll exons 3 and 4 from lambda phage library templates. Four
phages were isolated and its DNA purified. PCR amplification of exons 2-6 were done
on the four phages to determine which exons were present in the clones. The result
shows that all four clones contain the exons 3 and 4 but not exons 5,6, and 7 (data not
shown).
34
()
()
()
0'
;::,
;::,
0'
0'
(1)
(1)
(1)
1\)
c:.n
1
en
....
1
(,)
()
0'
;::,
;::,
....
(1)
1\)
~
~
• • il •
,
exon 4 (608bp)
1
1
1
exon 3 (139bp)
'"
35
4. These introns were included to prevent disruption of the splice junctions around the
coding sequence.
The design of the targeting vector is summarized in figure 6. An empty pFlox
vector containing Neo and TK selection markers as well as three 10xP sequences were
used to create the targeting vector. peRs of 1.5Kb intron 3, 1.7Kb exon 4, and 1.5Kb
introns 4 of continuous segments were done using Taq Hi-Fidelity to minimize mutations.
These fragments were first subcloned into TOPO® TA vector and sequenced to verify that
there were no mutations. The TOPO® clones were digested, purified, and cloned into
pFlox vector one at a time as described in figure 6.
111.4
Testing the loxP sequence of the targeting vector in a bacterial system
Prior to transfection of the targeting vector into an embryonic stem cells, the 10xP
sequences' ability to undergo cre-directed recombination was verified in a bacterial
system. The targeting vector and the cre recombinase vector were co-transformed into an
E. Coli DHlO(3 cells.
The targeting vector was isolated and purified following the
expression of the cre recombinase.
The targeting vector was mapped using various
endonucleases to determine the effectiveness of the recombinase. There were three loxP
sites in the targeting vector, therefore there were four possible outcomes (figure 8A).
Two of which were partial cre-directed recombination between the intemalloxP site with
one of the two flanking outer loxP sites.
Anotherpossibility was a complete
recombination between the two outermost loxP sites. Lastly, there was a possibility that
no recombination occurred resulting in no change to the targeting vector. 10 clones of the
36
targeting vectors that had been co-transforrned with cre producing vector was isolated,
purified, and digested. The clones were digested with several endonucleases and the
digestion map showed that 100% of the clones examined had undergone a complete
recombination (figure 8B). This showed that the cre/loxP recombination in the targeting
vector was efficient.
111.5
Transfection of the targeting vector into E.S. cells and Southern screen to
isolate the homologously recombined clones
The targeting vector was linearized and transfected into pluripotent mouse 129
E.S. cells. The transfections and the picking of the clones were generously perforrned by
Jacinth Sirois. There were three possible outcomes of the transfection. A random
insertion of the targeting vector into E.S. genome, a homologous recombination of the
targeting vector into the genome, or the targeting vector may remain unincorporated. The
homologous recombination displaces the existing mouse E.S. wildtype Vangll genome
with the modified Vangll from the vector including the selection markers and the three
loxP sites (figure 9). The randomly incorporated vector can be inserted anywhere in the
genome, therefore the E.S. mouse genomic Vangll remain a wildtype. The transfections
were exposed to neomycin selection to select out the E.S. cells that have not incorporated
the targeting vector into its genome. At this point, both the homologously inserted clones
and the randomly incorporated clones survive the neomycin treatment. To distinguish
between the random insertion versus the homologous recombination, Southem blot was
perforrned on 480 transfected clones. They were isolated, amplified, and digested with
Eco RV endonucleases. 460bp 5' Vangll probe was used to screen the clones
37
Figure 8. Cre-directed recombination efficiency of the targeting vector in a bacterial
system.
(A) A diagram showing the four possible outcomes from a cre-directed
recombination in a bacterial system on the targeting vector. 1. No recombination: In a
case where the cre recombinase is ineffective in catalyzing the recombination, the
targeting vector shows no change in digestion pattern compared to a non-transformed
targeting vector. 2. A partial recombination where the selection markers (Neo/TK) are
spliced out 3. A partial recombination where the exon 4 is spliced out. 4. A complete
recombination, where both the markers and the exon 4 are spliced out.
Expected
digestion map is indicated for each of the four possible outcomes. (B) Ten clones were
digested with Eco RI, Sac l, Bam HI, and HinD III. Eco RI digestion map of the ten
clones showed that all ten clones have gone under cre-directed recombination. Sac l,
Bam HI, and HinD III digestion map also confirmed this result (Data not shown).
38
A
Targeting vector
Exptead
fragments
Expecad
fragments
4.0kb
2.0kb
1.7kb
No change
2.2kb
1.5kb
'
:;:>
1
\~
Expected
... LoxP sequence
+
fragments
4.0kb
2.0kb
60bp
B
Eco RI digest of
Clones 1-10
39
1.5kb
60bp
/
li
P
60b
4.0kb
2.2kb
(3)
1
ft
\
Expected
fragments
4.0kb
2.5kb
1.7kb
1.5kb
60bp
Figure 9. A diagram of the conditional knockout strategy. Linearized pFlox targeting
vector was transfected into pluripotent E.S. cells where a homologous recombination
displaces the genomic Vangll DNA to produce cre sensitive Vangll. A partial credirected recombinase can splice out the Neo/TK markers to produce a conditional
knockout or splice out both the markers and the exon 4 to produce a conventional
knockout. A partial cre-directed recombination can occur to splice out the exon 4 but
these clones were selected against with ganciclovir. Also the cells that did not undergo
cre-directed recombination were selected against with ganciclovir.
40
Targeting
Vector
Neo/IK
f
:; li Ml. J, ; .' If;;·
;1
. kg
i
Transfection
Linearize with Mfe 1
Ne..
Fi
i fi 4 Iii
Homologous Recombination
X
fi4
Mouse 129 genomic DNA
. iEla 1 d
Nec/TK
Cre-directed
recombination
... LoxP sequence
ES Cell
41
(figurelOA). The probe was located just outside the 5' end of the intron 3 cloning site.
This allowed the separation of the wildtype Vangll and the modified Vangl!. Since the
randomly inserted clones have an identical Vangll gene as the wildtype, a single 8.8Kb
fragment was expected with an Eco RV digest and the 5' probe. With the homologously
inserted clones several Eco RV sites were introduced into the Vangll within the NeolTK
markers. This changed the 8.8Kb wildtype fragments into a 5.3Kb recombinant fragment.
From the 480 Eco RV Southem blots, there were seven clones showing the 5.3Kb
recombinant fragment (figure lOB,C). The seven clones were digested again with HinD
III and screened with the same 5' probe to verify the· Eco RV Southem blot result. In a
HinD III digest the wildtype fragment was Il.9Kb whereas the recombinant fragment
was 8.2Kb. One HinD III site was introduced in the homologously displaced genome.
This site was located on the 5' edge of the intron 4 insert. In a HinD III Southem blot
analysis, only four of the seven clones had the expected 8.2Kb recombinant fragment.
The other three had a larger fragment of approximately 15Kb. The four clones (A2, C6,
H6 and H9) that had the expected recombinant fragments with both the Eco RV and the
HinD III screens were used to continue building the conditional knockout.
111.6
Transfection of the cre vector and Southem screen to determine the
effectiveness of the cre-directed recombination
The clones A2' C6, H6, and H9 contained three 10xP sites and the Neo/TK
selection markers. To minimize the changes that were made to the final Vangl1 genome
relative to the wildtype, the selection markers needed to be spliced out.
This was
achieved through transfection of the cre recombinase into the four mutant clones. There
42
were four possible outcomes from the cre transfections (figure llA).
1. The cre
recombinase may be ineffective and no cre-directed recombination occurs. 2. Partial
recombination event can occur between the two 10xP sites flanking the exon 4 splicing
out the exon and leaving the selection markers. 3. Partial recombination event can occur
between the two 10xP sites flanking the selection markers splicing out the selection
markers and leaving the exon 4. 4. A complete recombination event can occur between
the two outer most 10xP sequences splicing out both the markeTS and the exon 4. In the
first two cases, the selection markers neomycin resistance· and thymidine kinase were
intact where as in the latter two cases the selection markeTS were spliced out. Those cells
that carry thymidine kinase gene cannot survive under the ganciclovir selection. In the
fust two cases the selection markers were intact allowing them to be selected against
using ganciclovir. The latter two cases have spliced out the selection markers allowing
them to survive.
The cells from the third case can be used to produce conditional
knockout whereas the cells from the fourth case can be used to produce a conventional
knockout In our experiment the expected result was removal of the recombinant 8.2Kb
and appearance of the smaller 4.6Kb or 2.9Kb fragments (figure lIB).
336 clones were isolated from the A2, C6, H6, and H9 cre transfections. AlI of
which were lysed to isolate the genomic DNA, and digested with HinD III. They were
probed with the 460bp 5' probe (same as in section 1II.5). The C6 and the H6
transfections lost the 8.2Kb recombinant fragment and only had the wildtype Il.9Kb
band. The loss of the 8.2Kb recombinant fragment without appearance of a smaller
fragment can only mean that the homologous recombinant DNA no longer exists in these
clones. It is possible that a small amount of wildtype cell has survived the neomycin
selection and in the event of ganciclovir negative selection these cells thrived to give rise
43
Figure 10. Southern blot analysis to distinguish between random the insertion versus the
homologous recombination of the targeting vector. (A) Eco RV and HinD III digestion
map ofwildtype (random insertion of the targeting vector has the same Vangll genome as
a wildtype) Vangll and Vangll homologous displaced with the targeting vector. (B-C)
Digestion of the seven clones (out of the 480 screened) showing the 5.3Kb recombinant
fragments in Eco RV digest. (D-E) OnIy four of the seven clones in figure B and C (A2,
C6, H6, and H9) showed the 8.2Kb recombinant fragment in HinD III digest.
remaining three HinD III digests had a larger l5Kb fragment.
44
The
A
Wildtype/random Vangl1
l
11.9Kb (HinD III)
l
cloned region
_11-------=------1
jcEiQi
t
.r
j
•
8.8Kb (Eco RV)
LoxP site
. . 460bp probe
Vangl1 homologously displaced with the targeting vector
8.2Kb (HinD III)
l
F
NeôïTK
t
;: 4
i
Et;
t
5.3Kb (Eco RV)
B
(")
EcoR V
C
~»("):J::J:
.... t-JmmUJ
(")~ "11
~
D
(")
0
O";'
a .akb Wlldtype
E
§»("):J::J:
"it-JmmUJ
-••
5.3kb recombinant
HinD III
(")~ "11
9-
0
- ' 0 0'0"
a .akb Wlldtype
J>.
5.3kb recombinant
HinD III
-P.
.,. •
t-Ja
9-
'III!
EcoR V
/\la
11 .9kb Wlldtype
a .2kb recombinant
J>.
-1• III
45
-15kb recombinant
11 .9kb wildtype
.;
t
EcoR V sites
!
HinD III sites
i
.1
Figure Il. Southem screen to distinguish between the different outcomes from a credirected recombination. (A) There are four possible outcomes from a transfection of cre
recombinase producing vector (including the possibility that the recombinase was
ineffective). Two of the four possibilities contain the selection markers NeorrK. These
clones are selected against under the presence of ganciclovir. The remaining two possible
outcomes have cells that lack the Neo/TK gene. These two cells can be used to create a
conditional knockout or a complete knockout. (B) A Southem blot analysis of the four
clones (A2, C6, H6, and H9) following cre recombinase transfections and HinD III
digestion.
The C6 and the H6 cre transfections show a single wildtype band.
A2
transfection has two different results. 50% of the clones have two bands (wildtype and
8.2Kb recombinant fragment), the other half contains a third band of 4.6Kb. The H9 credirected transfection has the wildtype band and the 4.6Kb band.
46
A
Wildtype DNA
11.9kb
r
l
cloned region
.. ~I--~~~~--~
Homologously recombinant vangl1
g,
8.2kb
r .------------~------------~
.
. . 460bp probe
<II
LoxP sequence
l HinD III site
No change
2.9kb
4.6kb
B
)&
Complete Knockout
;~"-------i-4~6~.5~k=b-Ne-Q-II-R-----'J
HinO III digest
~~
(.,)1\)
t:r t:r
Dl
Dl
~~~àiiS
11.9kb (wildtype)
8.2kb (recombinant)
4.6kb (partial credirected recombination)
47
to reversion. AlI of the clones from the H9 transfections contained the expected Il.9Kb
wildtype and the 4.6Kb fragment.
The 4.6Kb fragment corresponds to a partial cre-
directed recombination splicing out the neo/TK selection markers and these cells could be
used to create a conditional knockout. In the A2 cre transfection, approximately half of
the clones had two bands of Il.9Kb wildtype and 8.2Kb recombinant fragment. These
clones are identical to the ones that have not undergone a cre-directed recombination.
They also suggest that sorne of the E.S. cells containing TK can survive under the
ganciclovir selection. This strongly suggests that a ganciclovir selection is not complete.
The other half of the A2 clones contained a third band of approximately 4.6Kb, which
suggests a mixed population of partial cre-directed recombinants and survival of clones
that have not undergone a cre-directed recombination surviving a ganciclovir selection.
In this instance the neomycin selection has been complete but the ganciclovir selection
was incomplete.
From the results found from C6, H6, and A2 clones, it is clear that a re-screen of
the clones with both higher concentration of neomycin and subsequent negative
ganciclovir selection to further determine the reason for the unexpected results and to
gain confidence that the cre-selected H9 clones truly contain a single clones free of
contamination.
48
CHAPTERIV
DISCUSSION
49
IV.I
Cre/loxP Conditional knockout strategy of Vangll and the genomic sequence
isolation
The goal of this project was to create a cre dependent conditiona1 knockout of
mouse 129 Vangll gene by inserting two loxP sequences flanking the exon 4.
Our
strategy involved creating a targeting vector in a pFlox vector with exon 4 and
surrounding intronic regions including loxP sites and NeolTK markers as seen in figure 6.
Through homologous recombination between the targeting vector and the E.S. genome,
the exon 4, loxP sequences, and the selection markers displaced the origina1 genomic
sequence. To construct the targeting vector Vangll sequence was required. At the start
ofthis project only the cDNA sequence was available. Mouse 129 Vangll genomic DNA
was obtained from the Â. phage library. However at the time the phages were isolated, the
complete genomic sequence of the Vangll became available, thus eliminating the need to
sequence the genomic Vangll.
Based on the sequence from the database, the PCR
primers were designed to amplify the intron 3, exon 4, and intron 4. These PCRs were
used to create the targeting vector.
IV.2
Transfection of the targeting vector and Southern blot analysis
In our Eco RV digested Southem blot analysis of the E.S. clones transfected with
the targeting vector, we saw seven clones containing the 5.3Kb recombinant fragment
(figure 10). However in the HinD III digested Southem of the same seven clones, only
four showed the 8.2Kb recombinant fragment. The remaining three clones had 15Kb
recombinant fragment. A partia1 HinD III digest or a mutation in the introduced HinD III
site may explain the appearance of the 15Kb recombinant fragment. It is also possible
50
that the homologous recombination occurred between the intron 3 and the exon 4. In the
targeting vector, there are three regions of homology that recombinations can occur
(figure 12). The recombination between intron 3 and exon 4 would introduce extra Eco
RV sites but not HinD III site.
Recombination between exon 4 and intron 4 would
introduce an extra HinD III site but not Eco RV sites (these clones are not expected to
survive under neomycin selection because they do not contain the resistance gene).
Recombination between intron 3 and intron 4 would introduce both the Eco RV and the
HinD III sites.
Therefore the three possible combinations can be distinguished by
digesting the clones with both Eco RV and HinD III.
In our first case where the
recombination occurs at intron 3 and exon 4, the Eco RV digested Southem was expected
to give the 8.8Kb recombinant fragment and the HinD III digested Southem was expected
to give a 15.5Kb recombinant fragment. This recombination event can also explain the
15Kb recombinant fragment seen in figure 10E.
IV.3
Cre recombinase transfection and Southem blot analysis
The four clones (A2, C6, H6, and H9) that have had homologous recombination
between intron 3 and intron 4 were taken and transfected with the cre recombinase
producing vector. The desired outcome of the cre transfection was to produce both a
complete knockout and a conditional knockout. The conditional Knockout is expected to
give a recombinant fragment of 4.6Kb with HinD III and 2.9Kb recombinant fragment for
a complete knockout. In our HinD III digested Southem blot analysis of the cre-treated
clones, the clones C6 and H6 showed a single wildtype II.9Kb fragment. This shows
that the recombinant DNA no longer exists in these clones. In our cre transfection we
51
Figure 12. A diagram showing the possible combination of homologous recombinations
possible between the targeting vector and Vangll genomic DNA.
There are three
possible outcomes in a homologous recombination: Recombination between regions (1)
and (2), regions (1) and (3), and regions (2) and (3). These clones are subjected to
neomycin selection. The recombination product from regions (2) and (3) does not carry
the neomycin resistance. The remaining two contains the neomycin resistance. With Eco
RV digest alone these two recombination events cannot be distinguished. With both the
Eco RV and HinD III digests we can discem the three.
52
Targeting vector
iN
Regions:
$
5
H
4 -
Nen/l K
i 214 -r
14
0
d.a
(~
i ;IE14·
a ;
J
;
Vangl1 genomic DNA
Double
crossover
15Kb (Hi nO III)
+
i '
t
t
(2V(~
(1 )/(3)
Neonk
;
+
ER;
+
4.6Kb (HinO III)
!__
+
+L_______ f_i_4__Ls
___~______~;!
5.3Kb (Eco RV)
8.8Kb (Eco RV)
tU
+
t
.&
4
NeâlTK
t
5.3Kb (Eco RV)
.. HlnD III Emlonuclease site
t
Eco RV Enctonuclease site
53
fi.
+
H
assumed that the C6 and the H6 clones were pure and free of wildtype contamination. If
a srnall amount of wildtype E.S. cells contaminated the recombinant clones, under the
pressure of ganciclovir the wildtype cells would flourish giving rise to a single Il.9Kb
wildtype band.
Examination of the A2 Southern blot showed two different patterns. In half of the
clones both the wildtype and the recombinant 8.2Kb band was present. In the remaining
half of the clones a third 4.6Kb fragment was present. In both cases, the presence of the
8.2Kb recombinant fragment show that the recombinant Vangll gene contains both the
Neo/TK markers and the exon 4 Cie no cre-directed recombination has occurred). This
suggests that either the TK does not express or the ganciclovir selection is ineffective.
The presence of a 4.6Kb fragment in 50% of the clones suggest that a cre-directed
recombination has occurred. Having both the 8.2Kb and 4.6Kb recombinant fragments in
a single clone is giving a conflicting result. The 8.2Kb fragment suggests no cre-directed
recombination has occurred but the 4.6Kb fragment suggests that a partial cre-directed
recombination has occurred. A possible explanation is that the clone in fact is a mixed
population of cells. This may be due to an incomplete ganciclovir selection. The 8.2Kb
recombinant fragment should not have survived under the ganciclovir selection.
Furthermore the A2 clones with 2 bands all came from one 96 well plates whereas the A2
clones with 3 bands all come from a single 96 well plates. These two groups of clones
come from a single experiment suggesting that there was some type of problem with the
procedure during the experiment. If the A2 cre transfectant cells were contaminated with
the cells that have not been transfected with cre recombinase it is possible to see both the
8.2Kb and the 4.6Kb recombinant fragments. It is also possible that the probe is nonspecifie, however the sequence of the probe was checked in the public database to verify
54
that it does not contain repeat sequence (data not shown). Also the probe was hybridized
against wildtype HinD III digest and the Southem blot showed a clean single band (data
not shown).
The cre transfected H9 clones had the wildtype 11.9Kb and the 4.6Kb
recombinant fragment.
This 4.6Kb fragment corresponds to the partial cre directed
recombination, which can he used to create mouse Vangll conditional knockout.
IV.4
Future studies
Even though the C6 and the H6 clones have been considered a lost after cre
transfection, we will go back in stock to re-grow all four clones prior to cre transfection
under a greater neomycin stringency to make sure that all the wildtype E.S. cells are
eliminated. Then re-transfection with cre recombinase can be done. These clones need to
be under greater ganciclovir stringency to make sure that the clones that carry the TK
gene do not survive. The surviving clones could be screened in the same manner to select
for the conditional and the complete knockout.
The cre transfected H9 clones should be sequenced to verify that the two loxP
sequences are intact and also to verify that no mutations have occurred in exon 4 or its
splice junctions.
Once the verifications have been completed the E.S. cells can be
injected into a blastocyst to produce the conditional knockout.
55
REFERENCE
56
1.
Nusse, R. and Varmus, H.E. Many tumors induced by the mouse mammary tumor
virus contain a provirus integrated in the same region of the host genome. Cel!. 31:
99-109. 1982.
2.
Karim R., Tse G., Putti T., Scolyer R., and Lee S. The significance of the Wnt
pathway in the pathology ofhuman cancers. Pathology. 36(2): 120-8. 2004.
3.
Laurent-Puig P., Blons H., and Cugnenc P.H. Sequence of molecular genetic
events in colorectal tumorigenesis. Europeanjournal of cancer prevention. 1: S3947. 1999.
4.
Mazieres J., He B., You L., Xu Z., Jablons D.M. Wnt signaling in lung cancer.
Cancer Letters. 222(1): 1-10. 2005.
5.
Pinto D and Clevers H. Wnt control of stem ceUs and differentiation in the
intestinal epithelium. Experimental cel! research. 306(2): 357-63. 2005.
6.
Wang J. and Wynshaw-Boris A. The canonical Wnt pathway in early mammalian
embryogenesis and stem ceU maintenance/differentiation. Current opinion in
genetic development. 14(5): 533-9. 2004
7.
Inestrosa N.C., Urra S., and Colombres M. Acetylcholinesterase (AChE) Amyloid-beta-Peptide Complexes in Aizheimer's Disease. The Wnt Signaling
Pathway. Current Alzheimer research. 1(4): 249-54. 2004.
8.
Glass DA 2nd, Bialek P., Ahn J.D., Starbuck M., Patel M.S., Clevers H., Taketo
M.M., Long F., McMahon A.P., Lang R.A., and Karsenty G. Canonical Wnt
signaling in differentiated osteoblasts controls osteoclast differentiation.
Developmental cel!. 8(5): 751-64. 2005.
9.
Fanto M, McNeill H. Planar polarity from flies to vertebrates. Journal of cel!
science. 117(pt 4): 527-33. 2004.
10.
Eiji M., Tatsuya K., and Harukazu N. Role of Lmx1b and Wntl in
mesencephalon and metencephalon development. Development. 129: 5269-5277.
2002.
Il.
Angeliki L., Paula A., Christine M., Wolfgang W., and Marion W. The isthmic
neuroepithelium is essential for cerebeUar midline fusion. Development. 130:
5319-5330. 2003.
12.
Kibar Z., Vogan K.J., Groulx N., Justice M.J., Underhill D.A., Gros P. Ltap, a
mammalian homolog of Drosophila StrabismusNan Gogh, is altered in the mouse
neural tube mutant Loop-tail. Nature Genetics. 28(3): 251-5. 2001.
13. Bhanot P., Brink M., Samos C.H., Hsieh J.C., Wang Y., Macke J.P., Andrew D.,
Nathans J., and Nusse R. A new member of the frizzled family from Drosophila
functions as a Wingless receptor. Nature. 382(6588): 225-30. 1996.
57
14.
Kohn A.D. and Moon R.T. Wnt and calcium signaling: beta-Catenin-independent
pathways. Cell Calcium. Epub ahead ofprint. 2005.
15.
Orford K., Crockett c., Jensen J.P., Weiss man A.M., and Byers S.W. Serine
phosphorylation-regulated ubiquitination and degradation of beta-catenin. Journal
ofBiological Chemistry. 272(40): 24735-8. 1997.
16.
Pandur P., Maurus D., and Kuhl M. Increasingly complex: new players enter the
Wnt signalling network. BioEssays. 24: 881-884. 2002.
17.
Masaru Katho. Strabismus (STB)Nang-like (VANGL) gene family (Review).
National Cancer Center Research Institute. International Journal of Molecular
Medicine. 10: 11-15. 2002.
18.
Moon R.T., Bowerman B., Boutros M., and Perrimon N. The Promise and Perils
ofWnt Signaling Through f3-Catenin. Science. 296: 1644-1646. 2002.
19.
Slusarski D.C., Corces V.G., and Moon R.T. Interaction of Wnt and a Frizzled
homologue triggers G-protein-linked phosphatidylinositol signaling. Nature. 390:
410-413. 1997.
20.
Kuhl M., Sheldahl L.C., Malbon C.C., and Moon R.T. Calciumlcalmodulin
dependent protein kinase II is stimulated by Wnt and Frizzled homologs and
participates in axis formation in Xenopus. Journal of Biological Cehmistry. 275:
12701-12711. 2000.
21.
Sheldahl L.C., Park M., Malbon C.C., Moon R.T. Protein kinase C is
differentially stimulated by Wnt and Frizzled homologs in a G-protein dependent
manner. Current Biology. 9: 695--698. 1999.
22.
Ciani L. and Salinas P.C. Wnts in the vertebrate nervous system: from patterning
to neuronal connectivity. Nature reviews. Neuroscience. 6(5): 351-62. 2005.
23.
Zhu S., Liu L., Korzh V., Gong Z., and Low B.C. RhoA acts downstream of
Wnt5 and Wnt11 to regulate convergence and extension movements by involving
effectors Rho Kinase and Diaphanous: Use of zebrafish as an in vivo model for
GTPase signaling. Cell Signal. Epub ahead ofprint. 2005.
24.
Veeman M.T., Axelrod J.D., and Moon R.T. A second canon. Functions and
mechanisms of beta-catenin-independent Wnt signalling. Developmental Cell.
5(3): 367-77. 2003.
25.
Heisenberg C.P., Tada M., Rauch G.J., Saude L, Concha M.L., Geisler R.,
Stemple D.L., Smith J.C., and Wilson S.W. Silberblick/Wnt11 mediates
convergent extension movements during zebrafish gastrulation.
Nature.
405(6782): 76-81. 2000.
58
26.
Kilian B, Mansukoski H, Barbosa FC, Ulrich F, Tada M, Heisenberg CP. The
role of Ppt/Wnt5 in regulating cell shape and movement during zebrafish
gastrulation. Mechanisms ofDevelopment. 120(4): 467-76. 2003.
27.
Sheldahl L.C., Park M., Malbon C.C., and Moon R.T. Protein kinase C is
differentially stimulated by Wnt and Frizzled homologs in a G-protein-dependent
manner. Current Bi%gy. 9(13): 695-8. 1999.
28.
Slusarski D.C., Yang-Snyder J., Busa W.B., and Moon R.T. Modulation of
embryonic intracellular Ca2+ signaling by Wnt-5A. Developmental Biology.
182(1): 114-20. 1997.
29.
Sheldahl L.c., Slusarski D.C., Pandur P., Miller J.R., Kuhl M., and Moon R.T.
Dishevelled activates Ca2+ flux, PKC, and Cam.KII in vertebrate embryos. Journal
ofCell Biology. 161(4): 769-77. 2003.
30.
Veeman MT, Slusarski DC, Kaykas A, Louie SH, Moon RT. Zebrafish prickle,
a modulator of noncanonical WntIFz signaling, regulates gastrulation movements.
Current Bioloby. 13(8): 680-5. 2003.
31.
Waxman J.S., Hocking A.M., Stoick C.L., and Moon R.T. Zebrafish Dapperl
and Dapper2 play distinct roles in Wnt-mediated developmental processes.
Development. 131: 5909-5921. 2004.
32.
Curtin J.A., Quint E., Tsipouri V., Arkell R.M., Cattanach B., Copp A.J.,
Henderson D.J., Spurr N., Stanier P., Fisher E.M., Nolan P.M., Steel K.P.,
Brown S.D., Gray I.C., and Murdoch J.N. Mutation of Celsrl disrupts planar
polarity of inner ear haïr cells and causes severe neural tube defects in the mouse.
Current Biology. 13(13): 1129-33. 2003.
33.
Wada H., Iwasaki M., Sato T., Masai 1., Nishiwaki Y., Tanaka H., Sato A.,
Yasuhiro N., and Okamoto H. Dual roles of zygotic and maternal Scribblel in
neural migration and convergent extension movements in zebrafish embryos.
Development. 132: 2273-2285. 2005.
34. Theisen H., Purcell J., Bennett M., Kansagara D., Syed A., and Marsh J.L.
Dishevelled is required during wingless signaling to establish both cell polarity and
cell identity. Deve/opment. 120(2): 347-60. 1994.
35.
Keller R.E., Danilchik M., Gimlich R., and Shih J. The function and mechanism
of convergent extension during gastrulation of Xenopus laevis. Journal of
embryology and experimental morph%gy. 89 Suppl: 185-209. 1985.
36.
Heisenberg c.P., Tada M., Rauch G.J., Saude L., Concha M.L., Geisler R.,
Stemple D.L., Smith J.C., and Wilson S.W. Silberblick/Wnt11 mediates
Nature.
convergent extension movements during zebrafish gastrulation.
405(6782): 76-81. 2000.
59
37. Wehrli M. and Tomlinson A. Epithelial planar polarity in the developing
Drosophila eye. Development. 121(8): 2451-9. 1995.
38.
Reifegerste R. and Moses K. The genetics of epithelial polarity and pattern in the
Drosophilaretina. BioEssays. 21: 275-285. 1999.
39.
Eaton S. Cell biology of planar polarity transmission in the Drosophila wing.
Mechanism ofDevelopment. 120(11): 1257-64. 2003.
40.
Martinez A.A. Wnts as morpho gens? The view from the wing of Drosophila.
Nature reviews. Molecu/ar cell biology. 4(4): 321-5. 2003.
41.
Stewart B.A. Membrane trafficking in Drosophila wing and eye development.
Seminars in cell & developmental biology. 13(2): 91-7. 2002.
42.
Strigini M. and Cohen S.M. Formation ofmorphogen gradients in the Drosophila
wing. Seminars in cell & developmental biology. 10(3): 335-44. 1999.
43.
Eaton S. Planar polarity in Drosophila and vertebrate epithelia. Current Opinion in
Cell Biology. 9: 860-866. 1997.
44. Rossant J. and Tam P.P.L. Mouse development : patteming, morphogenesis, and
organogenesis. London: Harcourt Academic. 2002.
45. Darken R.S., Scola A.M., Rakeman A.S., Das G., Mlodzik M., and Wilson P.A.
The planar polarity gene strabismus regulates convergent extension movements in
Xenopus. The EMBO Journal. 21: 976-985. 2002.
46.
Goto T. and Keller R. The Planar Cell Polarity Gene Strabismus Regulates
Convergence and Extension and Neural Fold Closure in Xenopus. Developmental
Biology. 247: 165-181. 2002.
47. Lawrence P.A., Casai J., and Struhl G. Cell interactions and planar polarity in
the abdominal epidermis ofDrosophila. Development. 131: 4651-4664. 2004.
48.
Adler P.N., Charlton J., Park W.J. The Drosophila tissue polarity gene inturned
functions prior to wing hair morphogenesis in the regulation of hair polarity and
number. Genetics. 137(3): 829-36. 1994.
49.
Collier S. and Gubb D. Drosophila tissue polarity requires the cell-autonomous
activity of the fuzzy gene, which encodes a novel transmembrane protein.
Development. 124: 4028-4037. 1997.
50.
Choi K-W. and Benzer S. Rotation of photoreceptor clusters in the developing
Drosophila eye requires the nemo gene. Cell. 78: 125-136. 1994.
51.
Ma D., Yang C.H., McNeill H., Simon M.A., Axelrod J.D. Fidelity in planar cell
polarity signalling. Nature. 421(6922): 543-7. 2003.
60
52.
Lawrence P.A., Casai J. and Struhl G. Towards a model of the organisation of
planar polarity and pattern in the Drosophila abdomen. Development. 129: 27492760. 2002.
53.
Copp A.J., Greene N.D., and Murdoch J.N. The genetic basis of mammalian
neurulation. Nature Reviews. Genetics. 4(10): 784-93. 2003.
54.
Mitchell L.E., Adzick N.S., Melchionne J., Pasquariello P.S., Sutton L.N., and
Whitehead A.S. Spina Bifida. Lancet. 364(9448): 1885-95. 2004.
55.
Greene N.D. and Copp A.J. Mouse models of neural tube defects: investigating
preventive mechanisms. American journal of medical genetics. Part C, Seminars in
medical genetics. 135(1): 31-41. 2005.
56.
Doudney K. and Stanier P. Epithelial Cell Polarity Genes Are Required for
Neural Tube Closure. American Journal of Mediacal Genetics Part C. 135C: 4247. 2005.
57.
Wolff T. and Rubin G.M. Strabismus, a novel gene that regulates tissue polarity
and cell fate decisions in Drosophila. Development. 125: 1149-1159. 1998.
58.
Doudney K., Moore G.E., Stanier P., Ybot-Gonzalez P., Paternotte C., Greene
N.D., Copp A.J., and Stevenson R.E. Analysis of the planar cell polarity gene
Vang12 and its co-expressed paralogue Vangll in neural tube defect patients.
American Journal ofMedical Genetics. 136A: 90-92. 2005.
59.
Jessen J.R. and Solnica-Krezel L. Identification and developmental expression
pattern of van gogh-like 1, a second zebrafish strabismus homologue. Gene
Expression Patterns. 4: 339-344. 2004.
60.
Katoh Y. and Katoh M. Comparative genomics on Vangll and Vangl2 genes.
International Journal ofOncology. 26(5): 1435-40. 2005.
61.
Torban E., Wang H.J., Groulx N., and Gros P. Independent mutations in mouse
Vangl2 that cause neural tube defects in looptail mice impair interaction with
members of the Dishevelled family. The Journal ofBiological Chemistry. 279(50):
52703-13. 2004.
62.
Mazda O. Improvement of nonviral gene therapy by Epstein-Barr virus (EBV)based plasmid vectors. Current Gene Therapy. 2(3): 379-92. 2002.
63.
Das G., Jenny A., Klein T.J., Eaton S., and Mlodzik M. Diego interacts with
Prickle and StrabismusNan Gogh to localize planar ceIl polarity complexes.
Development. 131(18): 4467-76. 2004.
64.
Keller R., Shih J., and Sater A. The cellular basis of the convergence and
extension of the Xenopus neural plate. Developmental Dynamics. 193(3): 199-217.
1992.
61
65.
Sambrook J., Fritsch E.F., and Maniatis T. Molecular cloning : a laboratory
manual. Cold Spring Harbor, N.Y.: Co Id Spring Harbor Laboratory Press. 1989.
62
APPENDIX
COMPLIANCE CERTIFICATES
63