Molecular Cell, Vol. 4, 541–553, October, 1999, Copyright 1999 by Cell Press
Replisome Assembly at oriC, the Replication
Origin of E. coli, Reveals an Explanation
for Initiation Sites outside an Origin
Linhua Fang,*§ Megan J. Davey,† and Mike O’Donnell†‡
* Microbiology Department
Joan and Sanford I. Weill Graduate School of Medical
Sciences of Cornell University
New York, New York 10021
† The Rockefeller University and
Howard Hughes Medical Institute
New York, New York 10021
Summary
This study outlines the events downstream of origin
unwinding by DnaA, leading to assembly of two replication forks at the E. coli origin, oriC. We show that
two hexamers of DnaB assemble onto the opposing
strands of the resulting bubble, expanding it further,
yet helicase action is not required. Primase cannot act
until the helicases move 65 nucleotides or more. Once
primers are formed, two molecules of the large DNA
polymerase III holoenzyme machinery assemble into
the bubble, forming two replication forks. Primer locations are heterogeneous; some are even outside oriC.
This observation generalizes to many systems, prokaryotic and eukaryotic. Heterogeneous initiation sites
are likely explained by primase functioning with a moving helicase target.
Introduction
Replication origins are cis-acting sequences that direct
the assembly of proteins onto DNA for the replication
process, producing two copies of the genetic material
(Kornberg and Baker, 1992). Generally, initiation from
an origin requires an origin-binding protein, which may
act in concert with other DNA-binding factors to locally
unwind an AT-rich region within the origin sequence.
This unwound bubble region is thought to provide an
entry point leading to assembly of two helicases that
move in opposite directions. Two copies of the primase
and replicase must also be recruited to form two replication forks for bidirectional synthesis of the DNA.
Events leading to localized unwinding of DNA within
the origin have been characterized in several systems,
including the E. coli origin, oriC (Bramhill and Kornberg,
1988); the bacteriophage l origin, ori l (Schnos et al.,
1988); the origins of E. coli plasmids R6K (Mukherjee et
al., 1985) and RK2 (Konieczny et al., 1997); bacteriophage P1 (Mukhopadhyay and Chattoraj, 1993); and origins of viruses SV40 (Borowiec et al., 1990), HSV-1 (Lee
and Lehman, 1997), EBV (Frappier and O’Donnell, 1992),
and BPV (Gillette et al., 1994). However, important questions about events that occur downstream of this step
‡ To whom correspondence should be addressed (e-mail: odonnel@
rockvax.rockefeller.edu).
§ Present address: Molecular Staging Inc., 66 High Street, Guilford,
Connecticut 06437.
have not been addressed. For example, is the local unwinding sufficiently large for two helicases to assemble
for bidirectional replication, or does one helicase need
to enter first and expand the bubble via helicase action
to make room for the second helicase? The known replicative helicases are hexameric and encircle ssDNA.
Which strand does the initial helicase(s) at the origin
encircle, and if there are two, how are they positioned
relative to one another? Primases generally require at
least transient interaction with helicase to function. Can
primase function with the helicase(s) directly after helicase assembly at the origin, or must helicase-catalyzed
DNA unwinding occur prior to RNA primer synthesis?
Chromosomal replicases are comprised of a ring-shaped
protein clamp that encircles DNA, a clamp-loading complex that uses ATP to assemble the clamp around DNA,
and a DNA polymerase that binds the circular clamp,
thereby remaining tightly bound to DNA for highly processive synthesis (Kelman and O’Donnell, 1995). Can
this entire replicating machinery assemble at the origin
with the helicase before DNA unwinding, or does this
assembly process occur in a separate stage after the
helicases generate sufficient space to accommodate
these large machines? If so, how much space is needed?
This report addresses these questions through a
study of the stepwise events leading to the point at
which two replisomes are assembled in opposite directions at the E. coli origin, oriC. The study utilizes 19
different proteins produced by recombinant methods.
The E. coli chromosome is replicated bidirectionally
from oriC (Kornberg and Baker, 1992). Several copies
of the initiator protein, DnaA, bind specifically to at least
four 9-mer DNA-binding sites within the 245 bp oriC
(Fuller et al., 1984). In the presence of ATP, the interaction of DnaA with oriC melts 26 bp within a region of
three tandem 13-mer AT-rich repeats at one end of oriC
to form the “open complex” (Bramhill and Kornberg,
1988; Gille and Messer, 1991). Open complex formation
is aided by HU protein or IHF (integration host factor)
(Hwang and Kornberg, 1992). Following this, at least one
molecule of the replicative helicase, the hexameric DnaB
protein, assembles onto the origin in a reaction that
depends on DnaC protein to form the prepriming complex (Baker et al., 1987; Funnell et al., 1987; Bramhill and
Kornberg, 1988). Electron microscopy studies suggest
that DnaB binds oriC in the vicinity of the open complex
(Funnell et al., 1987). ATP is needed by DnaA and DnaC
in these initial steps, and therefore, the DnaB helicase
is active and mobile during this assembly reaction. The
mobility of DnaB has prevented determination of its exact assembly site(s) at oriC and whether one or two
DnaB hexamers assemble at oriC before helicase action.
Steps downstream of DnaB assembly have not been
described in detail but must include priming by primase
(DnaG), and the assembly of two molecules of the chromosomal replicase, DNA polymerase III holoenzyme, to
form bidirectional replication forks.
This report examines origin activation events that occur downstream of the DnaA/HU-mediated open com-
Molecular Cell
542
plex. The position and stoichiometry of DnaB at oriC
has been determined in advance of helicase-catalyzed
unwinding using a mutant of DnaB that assembles onto
DNA but is inactive as a helicase. The results demonstrate that DnaC delivers two DnaB hexamers to oriC
in the absence of helicase action; DnaC does not remain
on the DNA. DnaB assembly onto oriC results in an
expansion of the ssDNA in the open complex unaided
by helicase activity. Footprint analysis indicates that the
two helicases are positioned face to face, one on each
strand, such that they pass each other early in the unwinding process. Primase is unable to prime oriC in
the absence of helicase action, even though the origin
contains two DnaB hexamers. For want of a primed site,
replication forks containing DNA polymerase III holoenzyme also do not assemble in the absence of helicase
action. Hence, origin activation proceeds to the point
of assembly of two helicases onto DNA but thereafter
requires helicase motion for priming and assembly of
replication forks.
Helicase-mediated unwinding of approximately 100
nucleotides is sufficient for primase action on both
strands, and for assembly of two molecules of the DNA
polymerase III holoenzyme machinery. We propose that
each DNA polymerase III holoenzyme extends these initial two primers across the replication bubble until they
encounter, and couple, with the DnaB on the opposite
strand.
The RNA/DNA junctions of the primed start sites in
this in vitro system demonstrate that they are dispersed,
occurring at any of several positions, and are located
inside and outside the origin. Heterogeneous location
of primed sites is consistent with earlier in vivo mapping
studies (Hirose et al., 1983; Kohara et al., 1985). The
nearest primed sites to the initial position of DnaB at
oriC imply that each DnaB moves 65 nucleotides or
more before primase synthesizes an RNA primer. The
requirement of DnaB to move for primase to act on
oriC provides an explanation for the heterogeneity of
initiating RNA/DNA junctions. Namely, since primase requires at least transient interaction with DnaB to function, it must associate with a moving target, resulting in
dispersal of primed sites in the vicinity of the origin. This
finding may generalize, as heterogeneous location of
start sites is observed in several replication systems,
including bacteriophage l, (Tsurimoto and Matsubara,
1984; Yoda et al., 1988); R6K plasmid (Chen et al., 1998);
plasmid R1 (Bernander et al., 1992); the simian virus,
SV40 (Hay and DePamphilis, 1982; Bullock and Denis,
1995); and the S. cerevisiae origin, ARS1 (Bielinsky and
Gerbi, 1998). Based on these studies of E. coli oriC, it
seems likely that heterogeneity in priming sites at origins
of other systems will also be explained by the need for
helicase motion to support primase action.
Results
A Small Bubble at oriC Supports Assembly
of Two Replisomes
In this first experiment, we asked whether two full replisomes can assemble onto DNA upon constraining the
unwinding of the plasmid to a small area in the vicinity
of the origin. In the absence of gyrase, the unwinding
of a supercoiled 6.6 kb plasmid by DnaB helicase is
restricted to approximately 6.4% 6 2.4% of the plasmid
length, being limited by the topological tension generated upon unwinding a closed duplex circle (Baker et
al., 1987). The oriC sequence was cloned into pUC18
to generate pUC18oriC (3.1 kb final), and the extent
of unwinding by DnaB in the absence of gyrase was
examined by measuring the length of nascent leading
strand chains (as in Hiasa et al., 1996). The largest length
of these nascent chains averaged 65–83 nucleotides,
which indicates a bubble size of 66–99 nucleotides, assuming the start sites mapped later in this study, in
Figure 5. This value is within 2-fold of the 6.4% determined by the earlier electron microscopy study. To determine whether two DnaB hexamers, and one or two
molecules of DNA polymerase III holoenzyme, could assemble onto this unwound DNA, we radiolabeled proteins and added them to either pUC18oriC or pUC18.
The stoichiometry of proteins bound to the DNA was
then determined by gel filtration analysis using the large
pore BioGel A-15m resin. The large plasmid DNA and
proteins bound to it elute early in the excluded volume
(fractions 10–15); proteins not bound to DNA are included and elute later (fractions 18–35). Five experiments were performed using DnaA, HU, DnaB, DnaC,
DnaG, SSB, Pol III* (DNA polymerase III holoenzyme
lacking only b), and b in which either 32P-DnaB, 3H-DnaC,
32
P-primase, 3H-Pol III*, or 3H-b was substituted for its
unlabeled counterpart.
The results, in Figure 1 (quantitated in Table 1), indicate that approximately two molecules of DnaB (as
hexamer), two molecules of Pol III*, and two b clamps
assemble onto pUC18oriC. Primase did not bind pUC18oriC, and less than one DnaC monomer was retained, consistent with the known distributive action of
primase (Marians, 1992) and apparent absence of DnaC
in the prepriming complex at oriC (Funnell et al., 1987).
Interaction of DnaB, Pol III*, and b with DNA required the
oriC sequence as illustrated in Figure 1 for the plasmid
lacking oriC (pUC18). Presumably, two replisomes, each
containing one DnaB hexamer, one Pol III* (each having
two core DNA polymerases), and one b clamp, assembled onto each molecule of pUC18oriC (recovery of DNA
was typically 85%–95%).
These isolated protein–DNA complexes are functional, requiring only gyrase for activity. Further, the isolated complexes display bidirectional replication from
oriC (not shown, but experimental design and results
are similar to those of Figure 5D). It is interesting to
note that only one b clamp is present for the two core
polymerases within Pol III*. Thus, only the leading (or
lagging) strand core polymerase is tethered to DNA by
a b clamp. It is unlikely that one replisome contains two
b clamps, one for each core polymerase, and the other
replisome lacks b, as additional studies not shown here
did not detect Pol III* on pUC18oriC in reactions lacking b.
How Far Does Orisome Assembly Proceed
in the Absence of Helicase Action?
The experiment of Figure 1 demonstrated that two replication forks assemble on an oriC plasmid in the absence
Replisome Assembly at oriC
543
Figure 1. Assembly of Proteins at the Origin
Five different experiments, differing only in which radioactive-labeled
protein was added in place of the unlabeled protein, were performed
as described in Experimental Procedures. Proteins were assembled
onto plasmid DNA either containing oriC (closed circles), or lacking
it (open circles) followed by gel filtration. Radiolabeled proteins were
located in column fractions by liquid scintillation and quantitated
from their known specific activity: (A) 32P-DnaB, (B) 3H-DnaC, (C)
3
H-Pol III*, (D) 3H-b, and (E) 32P-primase. The diagram at the top
summarizes the results. Two hexamers of DnaB are shown as encircling ssDNA. The two ring-shaped b clamps are each shown as
a torus encircling a primed site. Each Pol III* contains two core
polymerases and one g complex clamp loader (not shown).
of gyrase. This result indicates that unwinding of approximately 66–99 bp is sufficient for assembly of all the
machinery needed for bidirectional replication. Perhaps
these events are so tightly coupled that all of these
proteins assemble at oriC even before helicase action.
Table 1. Stoichiometry of Replisome Components
Component
Protein on DNA (fmol)
Ratio of Protein/DNA
DnaB
DnaC
Pol III*
475 6 91 (Hexamer)
202 6 27 (Monomer)
520 6 23 (Dimeric
polymerases)
461 6 145 (Dimer)
1.8 6 0.4a
0.8 6 0.1a
2.1 6 0.1b
b clamp
1.9 6 0.6b
Proteins were assembled onto 252 fmol pUC18oriC DNA followed
by gel filtration to separate protein assembled on DNA from protein
not bound to DNA (described in Experimental Procedures). The
results are the mean of several experiments.
a
n54
b
n55
The ssDNA created by binding of the DnaA/HU to form
open complex is approximately 26 nucleotides of melted
DNA, as determined by KMnO4 modification (Gille and
Messer, 1991). Is this DNA structure sufficient to support
assembly of two helicases, two priming events, and two
molecules of DNA polymerase III holoenzyme in the absence of further unwinding catalyzed by DnaB? The
DnaB hexamer forms a ring (San Martin et al., 1995; Yu
et al., 1996) that encircles ssDNA (Yuzhakov et al., 1996)
and appears to require 20 6 3 nucleotides of ssDNA for
tight binding (Jezewska et al., 1996). From this information, a 26-residue “bubble” would accommodate only
one molecule of DnaB, although it may be possible that
each strand of the bubble could accommodate one
DnaB hexamer.
Our strategy to determine whether one or two DnaB
hexamers, and other components of the replisome, assemble into the open complex at oriC without helicase
action was to construct a DnaB mutant that lacks helicase activity. The sequence of DnaB contains a Walker
A nucleotide-binding motif between amino acid residues
223 and 244. We replaced Lys-236, the most conserved
residue in the Walker A motif, with either Arg or Ala. The
mutations were introduced into a dnaB gene that also
includes a cAMP-dependent protein kinase motif in the
N terminus (Yuzhakov et al., 1996). The N-terminal modification, which has little effect on the activities of DnaB
(Yuzhakov et al., 1996), enables radiolabeling of the protein using [g-32P]ATP and a protein kinase.
In addition to supporting in vitro oriC replication, wildtype DnaB has many other enzymatic activities. These
DnaB activities include: ATP binding, ssDNA-dependent
ATP hydrolysis, duplex DNA unwinding, and activation
of primase on an ssDNA template (general priming activity). In Figure 2, we characterized the ATP site mutants
of DnaB by comparing these enzymatic activities with
those of wild-type DnaB.
The results show that substitution of Arg for Lys-236
(DnaBPKK236R) resulted in a DnaB that retained full activity in all four assays tested (Figures 2A–2E). As we
desire a DnaB lacking helicase activity, the K236R mutant is not discussed further in this report. Replacement
of Lys-236 with Ala (DnaBPKK236A) resulted in the desired DnaB mutant; it had only weak ATPase activity
(Figure 2B), no detectable helicase activity (Figure 2C),
and no activity in the oriC replication system (Figure 2E).
However, DnaBPKK236A retained the ability to bind ATP
(Kd 5 7 mM, Figure 2A), and to support primase action
in general priming (Figure 2D) (DnaBPKK236A is still a
hexamer, not shown). In fact, DnaBPKK236A was about
3-fold more active than DnaBPK in general priming, consistent with an earlier study of a DnaB mutant defective
in ATP hydrolysis (Shrimankar et al., 1992).
Two DnaB Hexamers Assemble onto an oriCContaining Plasmid in the Absence
of Helicase Activity
A simple explanation for the inability of DnaBPKK236A
to support oriC replication is lack of helicase activity.
However, it is also possible that DnaBPKK236A is unable
to interact with DnaC and thus fails to assemble onto
oriC. Therefore, we radiolabeled both DnaBPK and DnaBPK
K236A in order to determine directly whether the DnaB
Molecular Cell
544
Figure 2. Characterization of DnaB ATP Site Mutants
Assays were performed as described under Experimental Procedures. In each assay, all components were kept the same except for
the type of DnaB used: DnaBPK (circles), DnaBPKK236R (diamonds),
DnaBPKK236A (triangles), or no DnaB ([D] only, squares). (A) ATP
binding. (B) ATPase activity using M13mp18 ssDNA as a DNA effector. (C) Oligonucleotide displacement from M13mp18 ssDNA. (D)
General priming activity testing the ability of different DnaB proteins
to support general priming by primase on M13mp18 ssDNA. (E) oriC
replication assays.
mutant can assemble onto either ssDNA pUC18oriC
(Figure 3). 32P-DnaBPK or 32P-DnaBPKK236A was incubated with circular M13mp18 ssDNA in the presence of
ATP, with or without DnaC, then the amount of DnaB that
assembled onto DNA was quantitated by gel filtration
analysis. The results demonstrate that DnaC stimulates
the assembly of DnaBPK onto M13mp18 ssDNA (Figure
3A, left panel), consistent with an earlier study (Wahle et
al., 1989). The results using DnaBPKK236A demonstrate
that it too assembles onto ssDNA and is stimulated by
DnaC (Figure 3A, right panel). The ability of DnaBPK
K236A to function with DnaC in assembly onto DNA
suggests that the inactivity of DnaBPKK236A in oriC replication is not due to inherent inability of the DnaB mutant
to function with DnaC, or to assemble onto ssDNA.
Next, 32P-DnaBPKK236A was used to directly assess
whether it can assemble onto oriC, and if so, to measure
the stoichiometry of DnaB on the origin in the absence
of helicase activity. 3H-DnaC was also used in the same
experiment to determine the fate of DnaC with this DnaB
mutant. The radiolabeled proteins, along with DnaA, HU,
Figure 3. Two DnaB Hexamers Assemble onto oriC in the Absence
of Helicase Action
DnaB assembly experiments are described in Experimental Procedures. (A) Assembly of DnaBPK (left panel) or DnaBPKK236A (right
panel) onto M13mp18 ssDNA in the presence (triangles) or absence
(circles) of DnaC. (B) 32P-labeled DnaBPKK236A and 3H-DnaC were
incubated with plasmid DNA along with DnaA protein, HU, and SSB.
Assembly of DnaBPKK236A, left panel; 3HDnaC (right panel); pUC18oriC, triangles; pUC18, circles.
and SSB, were incubated with 252 fmol of either pUC18
or pUC18oriC, and then analyzed by gel filtration to
quantitate protein bound to DNA (Figure 3B). The results
show that approximately 510 fmol (as hexamer) of 32PDnaBPKK236A comigrated with pUC18oriC (Figure 3B,
triangles in the left panel). The reaction contained a
5-fold molar excess of DnaC (as monomer) per hexamer
of DnaB, yet only about one 3H-DnaC monomer was
retained on pUC18oriC (Figure 3B, triangles in the right
panel). This result confirms that most of the DnaC dissociates from DNA after loading the DnaB mutant onto
oriC. Hence, helicase action is not required for DnaC to
dissociate from DnaB. Plasmid lacking oriC did not retain significant amounts of either 32P-DnaBPKK236A or
3
H-DnaC (Figure 3B, circles in the left and right panels,
respectively).
The overall conclusion of these experiments is that
two hexamers of DnaB can assemble onto oriC in the
absence of helicase activity. Hence, the helicase action
of one DnaB hexamer is not required to generate additional ssDNA for assembly of the second DnaB hexamer.
Replisome Assembly at oriC
545
Figure 4. Helicase Action Is Needed for Priming and Replisome Assembly
(A) Assembly of Pol III* (left panel) and b (right panel) on pUC18oriC
was performed using either DnaBPK (closed circles) or DnaBPKK236A
(open circles).
(B) RNA synthesis on pUC18oriC was performed using either DnaBPK
(closed circles) or DnaBPKK236A (open circles).
This ability to assemble two DnaB hexamers onto oriC,
even before helicase action, ensures bidirectional replication of the chromosome and likely underlies the observations of an earlier study (Baker et al., 1987) demonstrating that replication from oriC appears bidirectional
even when limiting protein components are supplied to
the reaction.
Do two complete replisomes assemble at oriC in the
absence of helicase action? The use of a DnaB mutant
to assemble two DnaB hexamers at oriC in the absence
of helicase activity makes it possible to test for priming
and assembly of DNA polymerase III holoenzyme at oriC
without further helicase-catalyzed DNA unwinding.
Primase Action at oriC Requires the Helicases
to Move
The experiment of Figure 3 demonstrates that two hexamers of the inactive helicase, DnaBPKK236A, assemble
onto the origin. Can two molecules of DNA polymerase
III holoenzyme also assemble onto the origin in the absence of DNA unwinding? This was tested in Figure 4A
upon adding primase, 3H-Pol III* and b (or Pol III* and
3
H-b) along with DnaA, HU, DnaC, and either DnaBPK
or DnaBPKK236A. Reactions were then analyzed by gel
filtration. The results demonstrate that neither 3H-Pol III*
nor 3H-b assembled onto the origin using the inactive
helicase mutant; the control reaction using active helicase showed the expected amounts of 3H-Pol III* and
3
H-b bound to pUC18 oriC.
It may be presumed that priming of the origin must
occur in order for Pol III* and the b clamp to assemble
onto the DNA. To determine whether primase can function at oriC in the absence of helicase activity, we assembled DnaBPKK236A onto pUC18oriC using DnaC
along with DnaA and HU, then measured RNA synthesis
upon adding primase. As a control, a parallel experiment
was performed using DnaBPK in place of DnaBPKK236A.
The results, in Figure 4B, show that DnaBPK, but not
DnaBPKK236A, supports primer synthesis at oriC. Hence,
DnaB helicase motion is required for primase action at
oriC. This result was somewhat surprising as primase
is fully active with DnaBPKK236A in general priming on
ssDNA (Figure 2D). Therefore, the inability of DnaBPK
K236A to activate primase at oriC is not due to an
inability of primase to interact, or otherwise function,
with DnaBPKK236A. Presumably there is simply insufficient ssDNA template upon which primase can act in
the origin, and helicase action is required to produce
the ssDNA necessary for primase action.
Quantitation of RNA synthesis produced in the reaction using DnaBPK (and wild-type DnaB; data not shown)
yielded approximately 22 ribonucleotides incorporated
into each oriC plasmid on average (Figure 4B, 20 min
time point). Assuming a primer size of 10–12 nucleotides,
as determined for E. coli primase in another study (Kitani
et al., 1985), approximately two primers are synthesized
per oriC plasmid in this study. Two primers per origin
is consistent with the value of two b clamps assembled
onto each oriC plasmid as determined in Figure 1.
Amount of Unwinding Needed
for Replisome Assembly
The experiments presented thus far demonstrate that
origin activation is divided into two very distinct stages:
events that lead to assembly of two DnaB hexamers
at oriC and events downstream of helicase-catalyzed
unwinding that lead to assembly of two replisomes. How
far must the helicases travel for primase to act? To
address this question, we mapped the initial positions
(RNA/DNA junctions) at which primase acts at oriC using
native DnaB.
To determine the location of start sites, newly replicated pUC18oriC was purified from protein and then
treated with alkali to remove RNA primers. The RNA/
DNA junction sites were mapped by extending 32P-primers that anneal to one or the other strand of the duplex.
Primer extension, using the Klenow fragment of E. coli
DNA polymerase I, proceeds to the end of the DNA
strand, which, for strands initiating in or near oriC, will
result in products less than 1 kb in length.
The mapping results, shown in Figure 5, indicate that
primed start sites occur at multiple positions on both
strands near the left part of oriC (Figures 5A and 5B).
This is the region of the open complex where DnaB is
thought to assemble, as will be demonstrated later (Figure 6). The position and frequency of the observed RNA/
DNA junction sites are summarized in Figure 5C. The
asymmetric distribution of the initiation sites for the two
strands with respect to oriC is consistent with previous
in vivo mapping studies of the bidirectional start sites
from oriC (Hirose et al., 1983; Kohara et al., 1985). Hence,
the counterclockwise strand initiates within oriC, and
Molecular Cell
546
Figure 5. Mapping of RNA/DNA Junctions of Initial Start Sites at oriC
Primer extension using 32P-labeled primers was used to determine the location of RNA/DNA junctions on replicated pUC18oriC as described
under Experimental Procedures. (A) Autoradiogram of a sequencing gel of 32P-primer extension products that map RNA/DNA junctions on the
bottom strand. (B) Autoradiogram of 32P-primer extension products on the top strand. The positions of the 13-mer repeats (L, M, and R) and
AT-rich region in oriC are illustrated on the side of the gels. (C) Summary of initiation sites using 96 nM primase. Vertical line heights reflect
relative intensities in the sequencing gels. Horizontal arrows indicate direction of DNA synthesis. The vertical arrow, at position 392358 9 (11),
indicates the left boundary of oriC. Numbers reflect the position in the E. coli genome. The number within parentheses indicates the position
in the minimal oriC sequence (Kornberg and Baker, 1992). (D) Bidirectional replication was confirmed using pBROTB (shown in upper panel)
as described in Experimental Procedures. The 2 and 3 kb fragments between terB sites and oriC are indicated on the plasmid map. An
autoradiogram of a denaturing agarose gel of the replication products (lower panel) with increasing amounts of DnaB (as indicated) is shown.
Quantitation of the 2 and 3 kb bands using a phosphorimager indicates equal amounts of each in every lane (taking into account differences
in intensity due to their different sizes).
the clockwise strand initiates outside the left boundary
of oriC (note the solid arrows in Figure 5C). Essentially
all of the observed junctions are within 12 nucleotides
of an upstream 59-APu-39 in the complementary strand,
the preferred two-nucleotide initiation sequence for E.
coli primase (template strand, 59-PyT-39) (Kitani et al.,
1985). It is interesting to note that the most frequent
RNA/DNA junction sites on the lower strand template
occur approximately 60–70 bp outside the left boundary
of oriC, although some sites are much closer, up to
seven nucleotides distant from the left oriC boundary
(see Figure 5C). The RNA/DNA junction sites on the
upper strand fall within the leftmost region of oriC. The
experiment was performed at several different concentrations of primase. As the concentration of primase is
elevated, the sites closest to the origin are generated
more frequently, consistent with the observation that a
high concentration (80 nM) of primase promotes efficient
bidirectional DNA replication (Hiasa and Marians, 1994).
Another interesting feature of the mapping results is that
the junction sites located on the top and bottom strands
are separated by at least 69 bp. This result suggests
that the extension products from these primed sites
overlap, and therefore, the two replicases pass one another during chain extension (explained more fully in the
Discussion).
Replisome Assembly at oriC
547
Figure 6. Footprint Analysis of DnaB on oriC
Using KMnO4
(A) KMnO4 modification experiments were
performed as described under Experimental
Procedures. In brief, pUC18oriC was incubated with DnaA and/or DnaBPKK236A plus
DnaC, then treated with KMnO4, followed by
location of the modified residues by primer
extension analysis in a sequencing gel. The
left gel is the upper strand analysis, and the
lower strand is shown to the right. All reactions except lane 1 contained 0.46 mg DnaA.
Lane 1, 0.35 mg DnaBPKK236A; lane 2, no
DnaBPKK236A; lane 3, 0.18 mg DnaBPKK236A;
and lane 4, 0.35 mg DnaBPKK236A. DnaC was
added at an equimolar ratio to DnaBPKK236A
(monomer to monomer). The diagram between the gels shows ssDNA in the DnaAinduced open complex (middle diagram)
compared to the DnaBC-induced expanded
melted region of the origin to include the L
13-mer and AT-rich region (bottom diagram).
The direction of helicase movement is indicated by the arrows.
(B) Scale representation of DnaB on a 55 nt
bubble. The dimensions of DnaB are based
on those from electron microscope studies.
It seems likely that most of the sites noted in Figure
5C are leading strand start sites. However, the possibility
that some of these are lagging strand start sites (i.e.,
for the other replicase) cannot be rigorously excluded.
An argument indicating these to be mainly initiating sites
is as follows. If only one or two of these sites were
initiating leading strand sites, and the rest were lagging
strand RNA/DNA junctions, then the relative intensity of
the few leading strand sites would be greater (i.e.,
greater than 5-fold) than the many lagging strand start
sites. However, the intensity of the various sites, while
far from uniform, does not show an exceptionally strong
signal for just one or two sites.
To confirm that two replication forks are formed when
all the proteins are assembled close to oriC, the replication products were examined using a system developed by Hiasa and Marians (1994) to analyze the
leading strands. This system makes use of a construct,
pBROTB, which contains the minimal oriC sequence
flanked on either side by a replication termination site
terB (see diagram in Figure 5D). One terB site is 2896
bp from the right edge of oriC (DnaA box 4), and the
other is 1823 bp from the left edge of oriC (the L 13mer). In the presence of Tus protein, fork movement is
blocked at the terB site, limiting chain extension to either
2 kb (leftward) or 3 kb (rightward). In Figure 5D, DnaB
was titrated into the pBROTB oriC replication assay,
and replication products were analyzed in an alkaline
agarose gel. The results show that both the 2 and 3 kb
fragments were produced equally throughout the DnaB
titration, demonstrating bidirectional replication from
oriC. A similar titration of Pol III* into this assay yielded
comparable results to the DnaB titration, indicating cooperative assembly of the two replisomes (data not
shown). These results are consistent with the conclusions of an earlier study in which each replication protein
was titrated into the oriC replication assay (Baker et al.,
1987). The fact that bidirectional replication is observed
even at very low Pol III* or DnaB suggests that assembly
of the two replisomes is a cooperative process, although
an alternative explanation that replication is unidirectional and random, yielding an equal population of plasmids with only one fork traveling in either direction, cannot be ruled out.
Two DnaB Helicases Face Each Other at the Left
Edge of oriC
The experiment of Figure 5 demonstrated that the RNA/
DNA junctions on one strand are located within oriC,
and the junctions on the other strand lie outside, but
near, the left boundary of oriC. Presumably DnaB initially
assembles onto oriC in the vicinity of these initiation
sites. This region is about where the melted DNA of
the open complex resides, at which DnaB has been
proposed to assemble (Baker et al., 1987; Funnell et al.,
1987; Bramhill and Kornberg, 1988). Footprint analysis
of DnaB at oriC is hampered by the mobile nature of
the DnaB helicase in the presence of ATP (ATP is required for DnaA and DnaC function). Hence, DnaBPKK236A, which assembles at oriC but is inactive as a
Molecular Cell
548
helicase, should remain stationary, thereby allowing
footprint analysis of DnaB at the origin. DnaB binds
ssDNA (Jezewska et al., 1996) and encircles it (Yuzhakov
et al., 1996). We presume that DnaB encircles ssDNA
at oriC, especially since DnaC does not remain at oriC
to act as a protein bridge between DnaB and the DNA.
Therefore, the single-strand DNA modification reagent,
potassium permanganate, was used in this footprinting
study (DNase was tried as well). This reagent modifies
single-stranded T residues, which block Pol I, providing
a means of mapping them using 32P–end labeled primers
and primer extension.
In Figure 6A, KMnO4 modification, and protection of
modification by DnaB, was examined to determine the
location of DnaB at oriC. Initially, the entire oriC sequence was analyzed, but Figure 6A focuses on the
leftmost region of oriC as all significant DnaB/DnaCmediated alterations occurred in and near the open
complex. A previous study of KMnO4 modification of
oriC plasmid DNA in the presence of DnaA and 5 mM
ATP indicated that two of the three 13-mers (R and M)
became unwound (Gille and Messer, 1991), consistent
with the known region of oriC that is melted by DnaA
in the open complex (Bramhill and Kornberg, 1988). A
similar result is observed in Figure 6A in which DnaA
and HU are incubated with pUC18oriC in the absence
of DnaB and DnaC (lane 1 for both upper [left panel]
and lower [right panel] strands). The DnaBPKK236A and
DnaC were then added in increasing amounts (but at a
constant ratio to each other) to the DnaA-induced open
complex. The results demonstrate that addition of DnaC
and DnaBPKK236A, besides enhancing activity of some
residues, protects the R and M 13-mers of one strand
(the lower strand in Figure 6A), suggesting that at least
one DnaB hexamer may reside in this region. The strand
opposite this sequence (upper strand in Figure 6A) becomes enhanced for reactivity with KMnO4. This result
is consistent with DnaB encircling the lower strand,
thereby protecting it, but enhancing reactivity of the
upper strand by increasing the percentage of time the
upper strand is single stranded at steady state. Although
the outside strand is modified, we do not interpret this
to mean that there is no contact of this strand with DnaB.
Rather, we suggest that any interaction of the outside
strand with DnaB is insufficient to completely prevent
modification by this small chemical probe. In this regard,
a DNase I footprinting study of SV40 T antigen on a
synthetic bubble yielded similar results; the encircled
strand was well protected whereas the outside strand
was only weakly protected (Smelkova and Borowiec,
1998).
The addition of DnaB and DnaC also appears to expand the open complex bubble as evidenced by new
KMnO4 reactivity of the L 13-mer and AT-rich region on
the lower strand. However, the upper strand opposite
these new sites is not reactive, even though it contains
several T residues. This result suggests that a DnaB
hexamer may occupy this region encircling the upper
strand, protecting it from modification, and that the opposite strand, which is not located inside the DnaB ring,
is left as nearly unprotected single-strand DNA, explaining its high degree of modification. Although there
are other possible explanations for these observations,
such as kinks or other distortions of origin DNA, we feel
that protection of ssDNA by DnaB is a simple explanation that is consistent with the known binding mode of
this enzyme on DNA. The location of one DnaB on each
strand is also consistent with the observed bidirectional
replication using these same proteins and assay conditions (shown in Figure 5D). Control reactions not shown
here indicate that when either DnaBPKK236A or DnaC is
added separately, the pattern of modification by KMnO4
is unaltered. We have also used the double-strand cleavage agent, DNase I, in these studies, but the results
were not informative as the oriC sequence is mostly
protected (e.g., by DnaA) with or without addition of
DnaB/DnaC (data not shown).
Given the 59-to-39 directionality of DnaB unwinding,
and the location of the two helicases indicated by the
footprinting study, the DnaB hexamers are oriented
head to head (i.e., they face one another) and must pass
one another during the initial unwinding of the origin.
These initial positions of the DnaB hexamers are separated from the RNA/DNA junction sites mapped in Figure
2 by at least 65 residues. Hence, the helicases move at
least 65 nt, before the first priming event occurs.
The model in Figure 6B uses the dimensions of DnaB
from microscopic studies and a bubble size of 55 bp.
The model indicates that there is very little ssDNA available on the side of DnaB on which primase is expected
to function. Given these tight spatial constraints to primase, it is not surprising that priming does not occur in
the absence of helicase motion.
Discussion
Extent of Orisome Assembly in the Absence
of Helicase Action
The E. coli origin of replication, oriC, is bidirectional,
and therefore, two replisomes assemble onto DNA and
commence replication in opposite directions. Going into
this study, it seemed possible that replisome assembly
would be tightly coupled to open complex formation at
the origin and that two replisomes may even assemble
at the origin before the helicases start to move. Indeed,
this report shows that two hexamers of the DnaB helicase assemble onto the DnaA-activated origin in the
absence of helicase motion (using an ATP site mutant).
However, the study proceeds to demonstrate that in
the absence of helicase action, orisome assembly is
blocked to further action. Primase does not function
until after the helicases have moved. Lacking a primed
site, DNA polymerase III holoenzyme cannot lock onto
the DNA. However, only limited helicase movement, approximately 100 nucleotides or less, is sufficient for primase action and the assembly of two molecules of DNA
polymerase III holoenzyme onto the DNA. The initial
positions at which DnaB assembles onto oriC were identified by footprinting to be within the open complex
region known to be melted by DnaA. Mapping of the
RNA/DNA junctions at oriC supports the conclusion that
helicase motion precedes priming, as the closest junction sites are at least 65 residues from the positions at
which DnaB assembles onto oriC.
The results of this report indicate that events occurring directly at the origin are limited to helicase entry,
and that replication forks assemble at a different time
Replisome Assembly at oriC
549
and place, and thus can be considered a distinct stage
of the replication process. Presumably, the product of
the first stage, in which two helicases are present on
the origin, must undergo some alteration before primase
can function. Limited helicase motion catalyzes this alteration, allowing transit to the priming and replisome
assembly stage. The fact that the first priming site junctions on each DNA strand of oriC are only 69 nucleotides
apart suggests that the helicases need not travel too
far for priming to occur.
These studies also demonstrate that an ATP site mutant of DnaB assembles onto oriC, and therefore, DnaB
does not need to hydrolyze ATP during the assembly
process. However, DnaC is an ATP interacting protein,
and its presence is required for DnaB assembly onto
oriC (Funnell et al., 1987; Wahle et al., 1989). In studies
not reported here, we find that an ATP site mutant of
DnaC, while still capable of binding to DnaB, is inactive
for assembly of DnaB at oriC (L. F. and M. O., unpublished data). Hence, ATP is required for DnaB assembly
at oriC, but this ATP requirement is mediated through
the action of DnaC.
The present study shows that DnaC is not retained
with DnaB at oriC, consistent with the inability to detect
DnaC with DnaA and DnaB at oriC by electron microscopy (Funnell et al., 1987) and the finding that DnaC
does not remain in the assembled primosome on the
ssDNA genome of the wX174 phage (Kobori and Kornberg, 1982; Ng and Marians, 1996). The absence of DnaC
at oriC suggests that DnaB has been fully assembled
around ssDNA at the origin rather than simply being
held to the origin indirectly through the action of DnaC.
DnaB has also been shown to interact with DnaA (Marszalek and Kaguni, 1994), but this interaction alone is
insufficient to hold DnaB tightly to the origin since addition of DnaB to the oriC-containing plasmid in the presence of DnaA, but absence of DnaC, does not result in
association of DnaB with oriC (data not shown).
This report demonstrates that helix destabilization of
oriC by DnaA/HU is sufficient for the assembly of two
DnaB hexamers. Prior to this study, it was equally possible that only one DnaB hexamer initially assembled onto
oriC, and that assembly of the second DnaB hexamer
required the first DnaB to enlarge the region of ssDNA
at oriC via its helicase activity, thereby making a bubble
of sufficient size for the second DnaB.
A Model of Replisome Assembly at oriC
This study indicates the stages in assembly of replication forks at an origin illustrated in Figure 7. In the first
stage, two DnaB hexamers assemble at, and enlarge,
the open complex (no helicase action needed). DnaC is
necessary for this stage but dissociates upon assembly
of DnaB onto DNA. Primase cannot act in stage I, possibly due to a general lack of available ssDNA behind the
helicase where ssDNA exits the DnaB ring (i.e., primase
acts on ssDNA, requires interaction with DnaB for activity, and synthesizes RNA in the direction opposite DnaB
motion). In progressing to stage II, limited helicase motion (or DNA motion through the helicases, explained
below) provides the ssDNA template needed for primase
to synthesize an RNA primer. The results of this study
indicate that upon incorporation of approximately 22
Figure 7. Stages in Assembly of Two Opposed Replication Forks
at oriC
(A) Stages in replisome assembly. Stage I, two DnaB hexamers
are assembled onto the DnaA-activated open complex through the
action of DnaC. Stage II, DnaB helicases pass each other creating
ssDNA for primase action. The passing action ensures that the region between the helicases is melted and remains so upon being
coated with SSB. Primase must interact with DnaB to initiate RNA
synthesis resulting in RNA primers in cis to DnaB. Stage III, two
replicases assemble onto the two primed sites. Stage IV, the two
molecules of Pol III holoenzyme extend DNA opposite the motion
of DnaB assembled on the same strand. Hence, the polymerases
pass one another to reach the DnaB helicases on the opposite
strand, which move in the same direction as DNA polymerization.
(B) The factory model for replication indicates that the polymerases
remain fixed while the DNA moves.
ribonucleotides per origin, two b clamps assemble on
the DNA, suggesting the presence of two RNA primers
(e.g., each 10–12 nucleotides in length). We propose
that these primers initiate the two opposed leading
strands (see below). In stage III, two b clamps are assembled onto the primed sites, and two molecules of Pol
III* assemble with them. Since there are two core polymerases within one molecule of Pol III*, each b clamp
must tether only one of the two core polymerases within
Pol III* to DNA.
The direction of chain elongation by DNA polymerase
III holoenzyme is opposite that of DnaB. Therefore, once
Molecular Cell
550
DNA polymerase III holoenzyme assembles onto an initiating RNA primer, it extends it in the direction opposite
the motion of the DnaB that is on the same strand as the
polymerase. In stage IV, DNA polymerase III eventually
catches up with the other DnaB that is on the opposite
strand, moving in the same direction as the polymerase.
This encounter results in a replisome in which DNA polymerase III holoenzyme, located on the leading strand,
couples to DnaB on the lagging strand (through the t
subunit of DNA polymerase III holoenzyme; Kim et al.,
1996; Yuzhakov et al., 1996). The action of primase with
DnaB produces the first lagging strand RNA primer providing the substrate for assembly of another b clamp
and association of the second core of Pol III* with this
clamp (stage V, not shown). The resulting replisome is
now engaged on both leading and lagging strands. The
actions described above for the assembly of one replisome are mirrored at the fork advancing in the other
direction, resulting in bidirectional replication.
It is unlikely that the first core within the holoenzyme
that associates with the b clamp on the initiating primer
acts as the lagging strand polymerase. If this were the
case, the leading strand would also need to be primed,
and this action would require DnaB to switch strands
two times, from the lagging strand to the leading strand
for primase action, and then back to the lagging strand.
The ability of DnaB to switch strands once has been
documented; however, this action required the assistance of other proteins not present in this study (Allen
et al., 1993).
Study of Bacillus subtilis indicates that the several
molecules of Pol III remain fixed at midcell during replication (Lemon and Grossman, 1998) and that the origin
moves from midcell to the poles (Webb et al., 1997).
This “factory model,” in which DNA moves through fixed
replisomes, is illustrated for stages III and IV in Figure
7B. Here, the two DnaB hexamers form a fixed double
hexamer that spools ssDNA out from between them.
The ssDNA loop grows from both directions. The first
RNA primer is extended around the loop to become the
leading strand (left diagram). Continued DNA unwinding
generates the lagging strand (right diagram).
Advantages of Two Helicases that Face and Pass
One Another
The results of this study indicate that two DnaB hexamers at oriC are positioned face to face, such that they
pass one another as they translocate on ssDNA (Figure
7). As the helicases move, duplex DNA is unwound, and
SSB prevents the strands from reannealing. During the
proposed exchange of the replicases from one helicase
to the other (stage IV), the region of DNA between the
two helicases must be traversed without further assistance of helicase action. Helicases that pass one another, as in Figure 7, will have already melted the region
between them, and the strands will remain separated
by the action of SSB, allowing smooth transit of DNA
polymerase III holoenzyme from one side to the other.
However, if the two helicases had assembled on the
origin back to back, the section of DNA between them
may contain unmelted duplex DNA. In this event, DNA
polymerase III holoenzyme, which is poor at strand displacement, would need to melt this region without assistance from DnaB.
Primase Hits a Moving Target as the Basis Underlying
Initiation Site Heterogeneity
Primase must interact with DnaB to synthesize a primer
(Arai and Kornberg, 1979). Helicase motion is not required for primase to function with DnaB since the ATP
site mutant, DnaBPKK236A, supports primase activity in
general priming on ssDNA. Nevertheless, DnaB motion
is a requirement for primase action at oriC. A likely reason that helicase must move for primase action is the
need to produce template for primase. The requirement
that helicase unwind DNA for primase action at oriC
implies that primase must locate a moving target in order
to synthesize an RNA primer. The mobile nature of the
substrate for primase explains why priming sites are not
located in a single unique spot on each strand within
the origin sequence but instead are located at one of
several positions both inside and outside the origin
boundaries.
The rate of DnaB helicase–catalyzed unwinding in the
absence of DNA polymerase III holoenzyme is only about
35 nucleotides per second and requires interaction with
the t subunit of DNA polymerase III holoenzyme for
efficient unwinding (800 nucleotides per second) (Kim
et al., 1996). Hence, DnaB at the origin, prior to replisome
assembly, would move slowly, increasing the probability
that primase action will be localized near the origin.
Generality of This Model to Eukaryotes and Phage l
Replication origins from prokaryotes to yeast, and several mammalian viruses (HSV, EBV, SV40, and BPV),
contain an origin recognition element (e.g., DnaA-binding sites of oriC) and a DNA-unwinding element (e.g.,
the 13-mer AT-rich region of oriC). Association of an
origin-binding protein with the origin recognition element produces a limited unwinding of the DNA unwinding element. Presumably the replicative helicase(s) assembles on the unwound DNA, possibly as a dual set
for bidirectional unwinding as illustrated herein for the
E. coli system. As noticed in several other replication
systems, the initiation sites on the two strands are heterogeneous, being located in various positions inside
and outside the origin. This study identifies the underlying basis for initiation site heterogeneity as a requirement that the DnaB helicases move for primase to function. The need for primase to associate with a moving
target results in dispersal of the initiation sites in and
around the origin. The conservation in initiation mechanisms among a large variety of replication systems suggests that the results of this study will generalize.
Experimental Procedures
Materials and DNAs
Radioactive nucleotides were from New England Nuclear; unlabeled
nucleotides, Pharmacia; DNA modification enzymes, New England
Biolabs; DNA oligonucleotides, Oligos Etc. Protein concentrations
were determined using the Bio-Rad Protein Assay kit with BSA as
a standard. Reaction buffer is 40 mM HEPES-NaOH (pH 7.4), 10 mM
MgCl2, 5 mM DTT, 100 mg of BSA/ml; sonication buffer is 20 mM
Tris–HCl (pH 8.0), 100 mM NaCl; ATP binding buffer is 50 mM Tris–
HCl (pH 7.9), 5 mM MgCl2, 10% glycerol, and 20 mM NaCl; buffer
A is 25 mM HEPES-NaOH (pH 7.4), 1 mM EDTA, 2 mM DTT, 15%
glycerol; buffer B is 50 mM Tris–HCl (pH 7.5), 1 mM EDTA, 1 mM
DTT, 10% glycerol; and buffer C is 20 mM Tris–HCl (pH 7.5), 0.1
mM EDTA, 5 mM DTT, 5 mM MgCl2, 10% glycerol.
Replisome Assembly at oriC
551
M13mp18 ssDNA was phenol extracted from phage that were
twice banded in CeCl density gradients as described (Turner and
O’Donnell, 1995). A pUC-derived plasmid containing the oriC sequence, pUC18oriC (3132 bp), was constructed upon inserting the
SmaI/XhoI restriction fragment (465 bp) containing oriC from
M13oriC26 RF (Kaguni et al., 1982) into the SmaI/SalI restriction
sites of pUC18.
DnaB ATP-Binding Site Mutants
The DnaB expression plasmid, pHK-dnaB, which encodes DnaB
with a 23-residue N-terminal leader consisting of a cAMP-dependent
protein kinase motif and a six-residue His tag (Yuzhakov et al., 1996),
was modified at the ATP-binding site using oligonucleotide-directed
mutagenesis using the PCR-based overlap extension technique.
The Lys-236 codon was replaced with a codon encoding either
Arg or Ala to yield either DnaBPKK236R or DnaBPKK236A. Sequence
analysis of the PCR-produced expression plasmids confirmed that
only the desired mutations were introduced into the dnaB gene.
Proteins
Subunits of DNA polymerase III holoenzyme were purified as previously described (Yuzhakov et al., 1996). Pol III* (the holoenzyme
lacking only b) was reconstituted from pure subunits and purified
from excess unassembled subunits (Yuzhakov et al., 1996). The
following replication proteins were purified as described previously:
DnaA, gyrase AB (Fang, 1999), HU (Parada and Marians, 1991),
DnaB, primase, SSB, DnaBPK, DnaBPKK236R, and DnaBPKK236A
(Yuzhakov et al., 1996). 3H-u, 3H-b, and 3H-DnaC were prepared by
reductive methylation of the purified proteins (Yuzhakov et al., 1996).
Their specific activities were: 3H-u, 15 cpm/fmol; 3H-b, 67 cpm/fmol;
and 3H-DnaC, 50 cpm/fmol. The 3H-labeled proteins retained at least
90% activity in replication assays as compared to their unlabeled
counterparts. 3H-core was reconstituted from a, e, and 3H-u and
then was purified from excess unassembled subunits as described
(Stukenberg and O’Donnell, 1995); the specific activity was 15 cpm/
fmol. PrimasePK contained the same terminal leader as DnaBPK. PrimasePK and DnaBPK phosphorylated as previously described (Yuzhakov et al., 1996).
Stoichiometry of Proteins at oriC
Five parallel experiments were performed that differed only in which
radioactive protein (32P-DnaB, 3H-DnaC, 3H-Pol III*, 32P-primasePK,
or 3H-b) was substituted for its unlabeled counterpart. Reactions
contained 252 fmol of either pUC18oriC or pUC18, 88 pmol of SSB,
18 pmol of DnaA, 4.4 pmol of (as hexamer) DnaB, 20 pmol of DnaC,
12 pmol of DnaG, 3.6 pmol of HU, 2 pmol of (as dimer) b, 1.5 pmol
of Pol III*, 5 mM ATP, 0.5 mM each GTP, CTP, and UTP, 5 mM
creatine phosphate, and 2 mg of creatine kinase in 100 ml reaction
buffer. After 30 min at 378C, reactions were placed in a tabletop
centrifuge for 30 min at 48C to remove any proteins that had formed
an aggregate, and then the reactions were analyzed by gel filtration
on 5 ml BioGel A-15m columns equilibrated with buffer C containing
100 mM NaCl at 258C. Fractions of 200 ml were collected, and 150
ml of each fraction was analyzed in a liquid scintillation counter
(Wallac). A parallel experiment using tritium-labeled plasmid and
unlabeled proteins indicated a recovery of DNA of approximately
90%. The amount of protein bound to oriC was calculated by determining the area under the peak, which was normalized to the
amount of protein loaded on the column. Values of protein bound
to DNA are not corrected for DNA recovery, nor are results obtained
using pUC18 subtracted from results using pUC18oriC.
oriC Replication Assays
Replication assays contained either 60 fmol of pUC18oriC or
pBROTB, 22 pmol of SSB, 4.6 pmol of DnaA, 1.1 pmol of (as hexamer)
DnaB, 5 pmol of DnaC, 3 pmol of DnaG, 0.9 pmol of HU, 0.5 pmol
of gyrase, 0.5 pmol of (as dimer) b, 370 fmol of Pol III*, 5 mM ATP,
0.5 mM each GTP, CTP, and UTP, 40 mM each dATP, dGTP, and
dCTP, 40 mM [a-32P]TTP (3000–6000 cpm/pmol), 5 mM creatine
phosphate, and 0.5 mg of creatine kinase in 25 ml of reaction buffer.
Additions were performed on ice and then shifted to 378C for 30
min (unless otherwise noted). Replication products were quantitated
by spotting onto DE81 filters as described (Yuzhakov et al., 1996).
Mapping Initiation Sites of Bidirectional DNA Replication
Replication of the pUC18oriC plasmid was allowed to proceed for
30 min at 378C described above (using primase at 0–240 nM using
unlabeled nucleotides). DNA was purified by phenol/chloroform extraction in the presence of 0.5% (w/v) SDS and 20 mM EDTA, followed by filtration on a Sephadex G25 spin column and ethanol
precipitation using 10 mg yeast tRNA as carrier. Primer extension
was performed using DNA polymerase I Klenow fragment as described previously (Frappier and O’Donnell, 1992) using as primers
either 59-d[GATCCTTTCCAGGTTGTTG]-39 to anneal to newly synthesized top strand DNA or 59-d[GTCGGCTTGAGAAAGACCTG]-39
to anneal to newly synthesized bottom strand DNA chains. Annealing to unreplicated starting template simply produces very long
primer extension products that migrate very high in the sequencing
gel (see control lane in Figure 5). Primer extension was stopped
upon addition of formamide and dye, and the samples were analyzed
by electrophoresis through a 6% (w/v) polyacrylamide 50% urea
gel. The gel was dried and exposed to either Phosphor storage
screens (Molecular Dynamics) or to Kodak BioMax film.
Assembly of DnaB onto ssDNA
Reactions contained 5 mM ATP, 2.2 pmol (as hexamer) of either
32
P-labeled DnaBPK or DnaBPKK236A, 280 pmol of M13mp18 ssDNA,
and 10 pmol of DnaC (where added) in 100 ml of reaction buffer.
After 10 min at 378C, samples were analyzed by gel filtration through
5 ml BioGel A-15m columns.
Assembly of DnaB onto oriC
Reactions contained 4.4 pmol of (as hexamer) 32P-labeled DnaBPKK236A, 15 pmol of 3H-DnaC, 88 pmol of SSB, 18.4 pmol of DnaA,
3.6 pmol of HU, and 252 fmol of either pUC18oriC or pUC18 in 100
ml of reaction buffer containing 5 mM ATP. After 30 min incubation
at 378C, and a 30 min spin in a tabletop centrifuge at 48C, reactions
were analyzed by gel filtration through 5 ml BioGel A-15m columns
equilibrated with buffer C containing 100 mM NaCl at 258C.
ATP Binding Assays
Quantitative ATP binding assays were performed using nitrocellulose membrane circles (25 mm) as previously described (Hingorani
and O’Donnell, 1998). The reactions contained a constant amount
of DnaB protein (2 mM) and increasing concentrations of [a-32P]ATP
(0–120 mM) in a total volume of 15 ml of ATP binding buffer.
ATP Hydrolysis Activity
ATPase assays were performed in 25 ml of reaction buffer containing
5 mM [g-32P]ATP (3–6 3 106 cpm) and 165 ng of M13mp18 ssDNA.
DnaB (2 mg) was added to reactions on ice, then shifted to 378C.
At the indicated times, aliquots of 3 ml were removed and quenched
upon adding 3 ml of 40 mM EDTA and 1% SDS. Quenched reactions
were spotted (0.5 ml) onto a thin layer chromatography sheet coated
with polyethyleneimine (PEI-Cellulose F, EM Science) and developed in 0.6 M potassium phosphate (pH 3.4). Free phosphate at
the solvent front and ATP at the origin were quantitated using a
phosphorimager and the ImageQuant software (Molecular Dynamics).
DNA Oligonucleotide Displacement Activity
A partial duplex M13mp18 substrate was prepared upon annealing
30 pmol of a 59-end 32P-labeled 30-mer oligonucleotide (complementary to map position 6817–6846) to 5 pmol of M13mp18 circular
ssDNA in a total volume of 70 ml as described (Studwell and O’Donnell, 1990). The annealed mixture was gel filtered through a 5 ml
BioGel A-15m column equilibrated with 10 mM Tris–HCl (pH 7.5), 1
mM EDTA, and 100 mM NaCl to separate the partial duplex (in the
void fraction) from unhybridized oligonucleotide (in the included
fractions). Helicase reactions were performed as described previously (Shrimankar et al., 1992) with the following modifications:
reactions contained approximately 40 fmol of substrate in 25 ml of
reaction buffer containing 5 mM ATP; amounts of DnaB are indicated
in the figure legends. Reactions were incubated 10 min at 378C, then
quenched with 0.2% SDS and 20 mM EDTA (final concentration), and
analyzed on a 15% polyacrylamide gel in Tris borate buffer at room
Molecular Cell
552
temperature. Results were visualized using a phosphorimager and
quantitated using ImageQuant software (Molecular Dynamics).
General Priming Assays
Reactions contained 70 fmol M13mp18 ssDNA, 3 pmol primase, 2
pmol DnaB (wild-type or mutant, as indicated) in 25 ml of reaction
buffer containing 1 mM ATP and 10 mM each GTP, CTP, and [a32
P]UTP (3000–6000 cpm/pmol). Reactions were incubated at 378C,
and 4 ml aliquots were quenched with 4 ml of 40 mM EDTA and 1%
SDS after 0, 5, 10, 15, 20, and 30 min. RNA synthesis was quantitated
using DE81 filters as described (Yuzhakov et al., 1996).
KMnO4 Modification
Reactions contained 240 fmol of pUC18oriC and 5 mM ATP in 25
ml of reaction buffer lacking DTT. The indicated amounts of DnaA,
DnaB, and/or DnaC were added, and reactions were incubated 30
min at 378C. KMnO4 was then added to 40 mM, and after a further
4 min at 378C, the reaction was quenched with 1.3 M 2-mercaptoethanol. DNA was purified by phenol-chloroform extraction in the presence of 0.5% (w/v) SDS and 20 mM EDTA, then it was passed
through a Sephadex G25 spin column in water followed by ethanol
precipitation using 10 mg yeast tRNA as carrier. Primer extension
was performed as described above.
RNA Synthesis at oriC
The amount of RNA synthesized at oriC by primase was performed
in 25 ml reactions containing 60 of fmol pUC18oriC as DNA template,
22 of pmol SSB, 4.6 pmol of DnaA, 1.1 pmol of (as hexamer) DnaB,
5 pmol of DnaC, 3 pmol of DnaG, 0.9 pmol of HU protein, 1 mM
ATP, and 10 mM each GTP, CTP, and 32P-UTP (3000–6000 cpm/
pmol) in reaction buffer. Reactions were incubated at 378C, and
aliquots of 4 ml were removed and quenched with 4 ml of 40 mM
EDTA and 1% SDS at 0 (before 378C incubation), 5, 10, 15, 20, and
30 min of incubation at 378C. RNA synthesis was quantitated upon
spotting the reaction onto DE81 filters as described (Yuzhakov et
al., 1996).
Acknowledgments
The authors are grateful to Dr. Kenneth J. Marians and Dr. Hiroshi
Hiasa for providing the pBROTB plasmid and Tus protein used in
testing proper bidirectional DNA replication. This work was supported by a grant from the National Institutes of Health (GM38839).
Received June 16, 1999; revised August 13, 1999.
Chen, D., Feng, J., Kruger, R., Urh, M., Inman, R.B., and Filutowicz,
M. (1998). Replication of R6K g origin in vitro discrete start sites for
DNA synthesis dependent of Pi and its copy-up variants. J. Mol.
Biol. 282, 775–787.
Fang, L. (1999). Ph.D. thesis, Weill Graduate School of Medical Sciences of Cornell University, New York, NY.
Frappier, F., and O’Donnell, M. (1992). EBNA1 distorts oriP, the
Epstein-Barr virus latent replication origin. J. Virol. 66, 1786–1790.
Fuller, R.S., Funnell, B.E., and Kornberg, A. (1984). The DnaA protein
complex with the E. coli chromosomal origin (oriC) and other sites.
Cell 38, 889–900.
Funnell, B.E., Baker, T.A., and Kornberg, A. (1987). In vitro assembly
of a prepriming complex at the origin of the Escherichia coli chromosome. J. Biol. Chem. 262, 10327–10334.
Gille, H., and Messer, W. (1991). Localized DNA melting and structural perturbations in the origin of replication, oriC, of Escherichia
coli in vitro and in vivo. EMBO J. 10, 1579–1584.
Gillette, T.G., Lusky, M., and Borowiec, J.A. (1994). Induction of
structural changes in the bovine papillomavirus type 1 origin of
replication by the viral E1 and E2 proteins. Proc. Natl. Acad. Sci.
USA 91, 8846–8850.
Hay, R.T., and DePamphilis, M.L. (1982). Initiation of SV40 DNA
replication in vivo: location and structure of 59 ends of DNA synthesized in the ori region. Cell 28, 767–779.
Hiasa, H., and Marians, K.J. (1994). Primase couples leading- and
lagging-strand DNA synthesis from oriC. J. Biol. Chem. 269, 6058–
6063.
Hiasa, H., Yousef, D.O., and Marians, K.J. (1996). DNA strand cleavage is required for replication fork arrest by a frozen topoisomerasequinolone-DNA ternary complex. J. Biol. Chem. 271, 26424–26429.
Hingorani, M.M., and O’Donnell, M. (1998). ATP binding to the Escherichia coli clamp loader powers opening of the ring-shaped clamp
of DNA polymerase III holoenzyme. J. Biol. Chem. 273, 24550–24563.
Hirose, S., Hiraga, S., and Okazaki, T. (1983). Initiation site of deoxyribonucleotide polymerization at the replication origin of the Escherichia coli chromosome. Mol. Gen. Genet. 189, 422–431.
Hwang, D.S., and Kornberg, A. (1992). Opening of the replication
origin of Escherichia coli by DnaA protein with HU or IHF. J. Biol.
Chem. 267, 23083–23086.
Jezewska, M.J., Kim, U.S., and Bujalowski, W. (1996). Binding of
Escherichia coli primary replicative helicase DnaB protein to singlestranded DNA. Long-range allosteric conformational changes within
the protein hexamer. Biochemistry 36, 10320–10326.
References
Kaguni, J.M., Fuller, R.S., and Kornberg, A. (1982). Enzymatic replication of E. coli chromosomal origin is bidirectional. Nature 296,
623–627.
Allen, G.C., Dixon, N.E., and Kornberg, A. (1993). Strand switching
of a replicative helicase promoted by the E. coli primosome. Cell
74, 713–722.
Kelman, Z., and O’Donnell, M. (1995). DNA polymerase III holoenzyme: structure and function of a chromosomal replicating machine.
Annu. Rev. Biochem. 64, 171–200.
Arai, K.-I., and Kornberg, A. (1979). A general priming system employing only DnaB protein and primase for DNA replication. Proc.
Natl. Acad. Sci. USA 76, 4308–4312.
Kim, S., Dallmann, H.G., McHenry, C.S., and Marians, K.J. (1996).
Coupling of a replicative polymerase and helicase: a tau-DnaB interaction mediates rapid replication fork movement. Cell 84, 643–650.
Baker, T.A., Funnell, B.E., and Kornberg, A. (1987). Helicase action
of DnaB protein during replication from the Escherichia coli chromosomal origin in vitro. J. Biol. Chem. 262, 6877–6885.
Kitani, T., Yoda, K.-Y., Ogawa, T., and Okazaki, T. (1985). Evidence
that discontinuous DNA replication in Escherichia coli is primed by
approximately 10 to 12 residues of RNA starting with a purine. J.
Mol. Biol. 184, 45–52.
Bernander, R., Krabbe, M., and Nordstrom, K. (1992). Mapping of
the in vivo start site for leading strand DNA synthesis in plasmid
R1. EMBO J. 11, 4481–4487.
Bielinsky, A.-K., and Gerbi, S.A. (1998). Discrete start sites for DNA
synthesis in the yeast ARS1 origin. Science 279, 95–98.
Borowiec, J.A., Dean, F.B., Bullock, P.A., and Hurwitz, J. (1990).
Binding and unwinding—how T antigen engages the SV40 origin of
DNA replication. Cell 60, 181–184.
Bramhill, D., and Kornberg, A. (1988). Duplex opening by DnaA protein at novel sequence in initiation of replication at the origin of the
E. coli chromosome. Cell 52, 743–755.
Bullock, P.A., and Denis, D. (1995). DNA synthesis generally initiates
outside the simian virus 40 core origin in vitro. Mol. Cell. Biol. 15,
173–178.
Kobori, J.A., and Kornberg, A. (1982). The Escherichia coli DnaC
product. II. Purification, physical properties, and role in replication.
J. Biol. Chem. 257, 13763–13769.
Kohara, Y., Tohdoh, N., Jiang, X.-W., and Okazaki, T. (1985). The
distribution and properties of RNA primed initiation sites of DNA
synthesis as the replication origin of Escherichia coli chromosome.
Nucleic Acids Res. 13, 6847–6866.
Konieczny, I., Doran, K.S., Helinski, D.R., and Blasina, A., (1997).
Role of TrfA and DnaA proteins in origin opening during initiation
of DNA replication of the broad host range plasmid RK2. J. Biol.
Chem. 272, 20173–20178.
Kornberg, A., and Baker, T.A. (1992). DNA Replication, Second Edition (New York: W.H. Freeman and Co.).
Replisome Assembly at oriC
553
Lee, S.S.-K., and Lehman, I.R. (1997). Unwinding of the box I element
of a herpes simplex virus type 1 origin by a complex of the viral
origin binding protein, single-strand DNA binding protein, and single-stranded DNA. Proc. Natl. Acad. Sci. USA 94, 2838–2842.
Lemon, K.P., and Grossman, A.D. (1998). Localization of bacterial
DNA polymerase: evidence for a factory model of replication. Science 282, 1516–1519.
Marians, K.J. (1992). Prokaryotic DNA replication. Annu. Rev. Biochem. 61, 673–719.
Marszalek, J., and Kaguni, J.M. (1994). DnaA protein directs the
binding of DnaB protein in initiation of DNA replication in Escherichia
coli. J. Biol. Chem. 269, 4883–4890.
Mukherjee, S., Patel, I., and Bastia, D., (1985). Conformational
changes in a replication origin induced by an initiator protein. Cell
43, 189–197.
Mukhopadhyay, G., and Chattoraj, D.K. (1993). Conformation of the
origin of P1 plasmid replication: initiator protein induced wrapping
and intrinsic unstacking. J. Mol. Biol. 231, 19–28.
Ng, J.Y., and Marians, K.J. (1996). The ordered assembly of the
uX174-type primosome. I. Isolation and identification of intermediate
protein-DNA complexes. J. Biol. Chem. 271, 15642–15648.
Parada, C.A., and Marians, K.J. (1991). Mechanism of DnaA proteindependent pBR322 DNA replication. DnaA protein mediated transstrand loading of the DnaB protein at the origin of pBR322 DNA
replication. Biol. Chem. 266, 18895–18906.
San Martin, M.D., Stamford, N.P.J., Dammerova, N., Dixon, N.E.,
and Carazo, J.M. (1995). A structural model for the Escherichia coli
DnaB helicase based on electron microscopy data. J. Struct. Biol.
114, 167–176.
Schnos, M., Zahn, K., Inman, R.B., and Blattner, F.R. (1988). Initiation
protein induced helix destabilization at the origin: a prepriming step
in DNA replication. Cell 52, 385–395.
Shrimankar, P., Stordal, L., and Maurer, R. (1992). Purification and
characterization of a mutant DnaB protein specifically defective in
ATP hydrolysis. J. Bacteriol. 174, 7689–7696.
Smelkova, N.V., and Borowiec, J.A. (1998). Synthetic DNA replication
bubbles bound and unwound with twofold symmetry by a simian
virus 40 T-antigen double hexamer. J. Virol. 72, 8676–8681.
Studwell, P.S., and O’Donnell, M. (1990). Processive replication is
contingent on exonuclease subunit of DNA polymerase subunit of
DNA polymerase III holoenzyme. J. Biol. Chem. 265, 1175–1178.
Stukenberg, P.T., and O’Donnell, M. (1995). Assembly of a chromosomal replication machine: two DNA polymerases, a clamp loader,
and a sliding clamp in one holoenzyme particle. V. Four different
polymerase-clamp complexes on DNA. J. Biol. Chem. 270, 13384–
13391.
Tsurimoto, T., and Matsubara, K. (1984). Multiple initiation sites of
DNA replication flanking the origin region of ldv genome. Proc. Natl.
Acad. Sci. USA 81, 7402–7406.
Turner, J., and O’Donnell, M. (1995). Cycling of E. coli DNA polymerase III from one sliding clamp to another: model for the lagging
strand. Methods Enzymol. 262, 442–449.
Wahle, E., Lasken, R.S., and Kornberg, A. (1989). The DnaB-DnaC
replication protein complex of Escherichia coli. II. Role of the complex in mobilizing DnaB functions. J. Biol. Chem. 264, 2469–2475.
Webb, C.D., Teleman, A., Gordon, S., Straight, A., Belmont, A., Lin,
D.C.-H., Grossman, A.D., Wright, A., and Losick, R. (1997). Bipolar
localization of the replication origin regions of chromosomes in vegetative and sporulating cells of B. subtilis. Cell 88, 667–674.
Yoda, K.-Y., Yasuda, H., Jiang, X.-W., and Okazaki, T. (1988). RNAprimed initiation sites of DNA replication in the origin region of
bacteriophage l genome. Nucleic Acids Res. 16, 6531–6546.
Yu, X., Jezewska, M.J., Bujalowski, W., and Egelman, E.H. (1996).
The hexameric E. coli DnaB helicase can exist in different quaternary
states. J. Mol. Biol. 259, 7–14.
Yuzhakov, A., Turner, J., and O’Donnell, M. (1996). Replisome assembly reveals the basis for asymmetric function in leading and
lagging strand replication. Cell 86, 877–886.