Available online at www.sciencedirect.com
ScienceDirect
Rice Science, 2017, 24(2): 109−118
Identification of a Gravitropism-Deficient Mutant in Rice
HE Yan, SHI Yong-feng, ZHANG Xiao-bo, WANG Hui-mei, XU Xia, WU Jian-li
(State Key Laboratory of Rice Biology / Chinese National Center for Rice Improvement, China National Rice Research Institute,
Hangzhou 310006, China)
Abstract: A gravitropism-deficient mutant M96 was isolated from a mutant bank, generated by ethyl
methane sulfonate (EMS) mutagenesis of indica rice accession ZJ100. The mutant was characterized as
prostrate growth at the beginning of germination, and the prostrate growth phenotype ran through the
whole life duration. Tiller angle and tiller number of M96 increased significantly in comparison with the
wild type. Tissue section observation analysis indicated that asymmetric stem growth around the second
node occurred in M96. Genetic analysis and gene mapping showed that M96 was controlled by a single
recessive nuclear gene, tentatively termed as gravitropism-deficient M96 (gdM96), which was mapped to
a region of 506 kb flanked by markers RM5960 and InDel8 on the long arm of chromosome 11.
Sequencing analysis of the open reading frames in this region revealed a nucleotide substitution from G
to T in the third exon of LOC_Os11g29840. Additionally, real-time fluorescence quantitative PCR analysis
showed that the expression level of LOC_Os11g29840 in the stems was much higher than in the roots
and leaves in M96. Furthermore, the expression level was more than four times in M96 stem than in the
wild type stem. Our results suggested that the mutant gene was likely a new allele to the reported gene
LAZY1. Isolation of this new allele would facilitate the further characterization of LAZY1.
Key words: plant architecture; gravitropism; LAZY1; gene mapping; mutant
Plant architecture is one of the significant factors
associated with rice yield. Erect plant architecture is
considered to be the ideal plant type and continuously
selected by farmers and breeders (Kovach et al, 2007).
Previous studies have shown that gravity is a
significant external factor during plant growth and
development, and contributes to morphogenesis and
physiological function of the plant. Plant response to
gravity is called gravitropism or geotropism, and can
be divided into four sequential steps: gravity
perception, signal formation in the gravity perceptive
cell, intracellular and intercellular signal transduction,
and asymmetric cell elongation between the upper and
lower sides of the responding organs (Fukaki et al,
1996).
The normal gravitropism (shoot negative gravitropism
and root positive gravitropism) is necessary for plant
morphological development and biological function
(Dong, 2014). Most plant species show the root
positive gravitropism for the uptake of water and
minerals while exhibit the shoot negative gravitropism
in favor of photosynthesis and fertilization preferably
(Song et al, 2006). Mutants with defective
gravitropism from Arabidopsis vary in their response
to gravity and can be divided into five different
classes: class I, mutants that show an abnormal
gravitropic response in inflorescence stems only; class
II, mutants that show defective gravitropism in both
inflorescence stems and hypocotyls, but normal
gravitropism in roots; class III, mutants that show
defective gravitropism in the roots, hypocotyls and
inflorescence stems; class IV, mutants that have
defective gravitropism in hypocotyls and roots but not
in inflorescence stems; class V, mutants that exhibit
Received: 10 April 2016; Accepted: 6 June 2016
Corresponding author: WU Jian-li ([email protected])
Copyright © 2017, China National Rice Research Institute. Hosting by Elsevier B V
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/)
Peer review under responsibility of China National Rice Research Institute
http://dx.doi.org/10.1016/j.rsci.2016.06.009
110
Rice Science, Vol. 24, No. 2, 2017
only a defective gravitropic phenotype in roots
(Tasaka et al, 1999). Gravitropism has been also
observed in rice, and a few number of gravitropismrelated genes have been identified and characterized
such as LAZY1 (LA1) (Li et al, 2007), PROSTRATE
GROWTH1 (PROG1) (Jin et al, 2008), LOOSE
PLANT ARCHITECTURE1 (LPA1) (Liu et al, 2016)
and spk(t) (Miyata et al, 2005). Among these genes,
LAZY1 controls rice shoot gravitropism through
regulating polar auxin transportation (Li et al, 2007)
and LAZY1-dependent and -independent signaling
pathways have been identified in coleoptiles (Yoshihara
and Iino, 2007). PROG1 encodes a single Cys2-His2
zinc-finger protein (Tan et al, 2008), and predominantly
expresses in the axillary meristems (Jin et al, 2008). It
is believed that PROG1 lost its function during the
evolutional process in the ancestor of modern
cultivated rice. LPA1, encoding a plant-specific
INDETERMINATE DOMAIN protein, influences
plant architecture by affecting the gravitropism of leaf
sheath pulvinus and lamina joint (Wu et al, 2013). In
fact, LPA1 determines lamina joint bending by
suppressing auxin signaling that interacts with
C-22-hydroxylated and 6-deoxo brassinosteroids in
rice (Liu et al, 2016). spk(t) is thought to be a gene
responsible for the stub spreading phenotype in
Kasalath but yet to be isolated (Miyata et al, 2005).
In the present study, we identified a prostrate
growth mutant M96 from an ethane methyl sulfonate
(EMS)-induced rice accession ZJ100 mutant bank.
Here, we present the results on characterization of the
mutant phenotype, genetic analysis, gene mapping and
candidate gene prediction. Our results showed that the
prostrate growth phenotype of M96 is controlled by a
single recessive gene which is likely a new allele to
LAZY1. Isolation of this new allele, tentatively termed
as gravitropism-deficient M96 (gdM96), would
facilitate the further characterization of LAZY1.
MATERIALS AND METHODS
Rice materials
The M96 mutant was obtained from an EMS-induced
indica rice accession ZJ100 mutant bank. This mutant
has been selfed for more than 10 generations, and the
target trait has been stably expressed in both the
greenhouse and field conditions in Fuyang, Zhejiang
Province and Lingshui, Hainan Province, China.
Methods
Gravity response analysis
For gravity response experiment, the seeds of mutant
M96 and the wild type ZJ100 were dehusked and
surface sterilized with 75% ethanol for 2 min and 30%
bleach for 15 min, and then washed five times with
autoclaved distilled water. The sterilized seeds were
then planted in plates containing 1/2 MS medium (pH
5.8) and 0.5% Plant Preservative Mixture (PPMTM,
Beijing QiWei YiCheng Tech Co., Ltd., Beijing, China)
for 5 d under continuous light or continuous dark at
28 ºC in a growth chamber (Panasonic, MLR-352HPC, Osaka, Japan), respectively. Consequently, the
seedlings were placed horizontally in the same
conditions for 24 h.
Exogenous hormone treatment
For hormone treatment, the sterilized seeds were
planted in 1/2 MS medium (pH 5.8) and 0.05% Plant
Preservative Mixture (PPMTM, Beijing QiWei YiCheng
Tech Co., Ltd., Beijing, China) supplemented with
different concentrations of exogenous hormones
(Table 1) and grew in a growth chamber (Panasonic,
MLR-352H-PC, Osaka, Japan) for 5 d at 28 ºC with
14 h light and 10 h dark each day. Plant hormones
2,4-dichlorophenoxyacetic acid (2,4-D) and gibberellic
acid 3 (GA3) were purchased from Sigma-Aldrich Co.,
ST. Louis, USA.
Tissue microstructure
Optical microscopic observation of stems was performed
with plants at the heading stage grown in the paddy
fields. The second internodes above the ground were
cut longitudinally and fixed in 2.5% glutaraldehyde
overnight. The optical microscopic observation was
carried out as described by Zhang et al (2007).
Genetic analysis and gene mapping
M96 mutant was used as the female parent and
Table 1. Concentrations of exogenous hormones.
Hormone type
2,4-dichlorophenoxyacetic acid
Gibberellic acid 3
mg/L
Treatment
1
0.1
0.5
2
0.1
1.0
3
0.5
2.0
4
1.0
4.0
5
2.0
10.0
6
4.0
20.0
HE Yan, et al. A New Allele for Rice Gravitropic Mutant
crossed to the male parent ORO. F1 plants were grown
in the paddy field and F2 population was planted in the
greenhouse at China National Rice Research Institute
(Fuyang, Zhejiang Province, China) for segregation
analysis. The DNA of the parents and F2 individuals
with prostrate growth phenotype was extracted
following the mini-preparation method (Lu et al,
1992). PCR amplification was performed according to
Shi et al (2009), and the PCR products were separated
and visualized on 6% non-denaturing polyacrylamide
gels using silver staining. A total of 1 014 simple
sequence repeat (SSR) markers evenly covering 12
chromosomes were applied in polymorphism survey
between the parents M96 and ORO. The polymorphic
markers were then used for screening the 30 mutational
randomly-selected F2 individuals for chromosome
linkage analysis and gene preliminary mapping. The
candidate gene sequence was obtained from the Rice
Genome Annotation Project (http://rice.plantbiology.
msu.edu/). Subsequently, primers were designed using
the Primer 5.0 software. Sequence analysis of the
candidate genes was carried out using DNAStar 8.0
software to identify the mutation site.
Real-time fluorescent quantitative PCR (RT-PCR) and
cDNA cloning
At the tillering stage, TRIzol Reagent Kit (Aidlab,
China) was used to extract the total RNA of the roots,
stems and leaves from M96 and the wild type. The
111
first strand of cDNA was synthesized using the
ReverTra Ace qPCR RT Master Mix with gDNA
Remover Kit (ToYoBo, Japan) for RT-PCR and cDNA
cloning. RT-PCR was carried out using the SYBR®
Premix Ex TaqTM II (Tli RNaseH Plus) Kit and
performed on Thermal Cycle Dice® Real Time System
(TaKaRa, Japan). The method of cDNA amplification
and sequence analyzing resembles as stated above.
Structural and phylogenetic analysis
BLAST analysis was performed on the NCBI website
(http://www.ncbi.nlm.nih.gov/) to search for homologs
of LAZY1. A total of 11 sequences from 9 species were
identified. The sequences were aligned using
ClustalW software, and the neighbor-joining tree
(Saitou and Nei, 1987) was generated using the
Poisson correction method in MEGA 5.1 software
(Tamura et al, 2011). Bootstrap replication with 1 000
times was used for a statistical support for the nodes
in the phylogenetic tree.
RESULTS
Phenotypic performance of M96 mutant
The prostrate growth phenotype of M96 mutant
appeared at the beginning of seed germination (Fig.
1-A) and lasted throughout the whole growth duration
(Fig. 1-B and -C). The tiller angle of M96 mutant
Fig. 1. Phenotypes of wild type (WT) and M96 mutant.
A, Sprout of WT (left) and M96 (right); B, WT (left) and M96 (right) at the early tillering stage; C, M96 at the heading stage; D, WT at the
heading stage.
112
increased gradually from the seedling stage (Fig. 1-B)
and peaked at the heading stage compared with the
wild type (Fig. 1-C and -D). In addition, the tiller
numbers of M96 mutant were increased obviously
than those of the wild type under the greenhouse
conditions (Fig. 2).
The prostrate growth of M96 was due to the
bending of the second node (Fig. 3-A). Paraffin
section observation on the curved node of M96 mutant
indicated that, unlike the equivalent cell elongation in
the wild type plants, the cell numbers per unit area of
the near-ground side (right) were more than two times
higher than those of the far-ground side (left) in the
M96 mutant (Fig. 3-B). Furthermore, both cell shape
Rice Science, Vol. 24, No. 2, 2017
Fig. 2. Comparison of tiller numbers between wild type and M96.
Error bars represent the standard deviation (n = 5).
Fig. 3. Paraffin section observation of the second node longitudinal sections.
A, Stem of wild type (WT, left) and M96 mutant (right). The arrow indicates the curved node of M96 mutant; B, Longitudinal cell numbers of the
sides of the second node in WT and M96. Different lowercase letters indicate significant differences at the 0.01 level by the Duncan’s test. Error bars
represent the standard deviation (n = 5); C, Longitudinal section on the far-ground side of the second node in WT; D, Longitudinal section on the
near-ground side of the second node in WT; E, Longitudinal section on the far-ground side of the second node in M96; F, Longitudinal section on the
near-ground side of the second node in M96.
HE Yan, et al. A New Allele for Rice Gravitropic Mutant
113
exhibited a similar phenotype at all the concentrations
of 2,4-D and GA3 (data not shown), indicating that the
prostrate growth phenotype of M96 mutant could not
be recovered by 2,4-D and GA3.
gdM96 is likely a new allele of LAZY1
Fig. 4. Gravity response of wild type (WT) and M96 under light
and dark conditions.
A, 5-day-old WT (top) and M96 (bottom) seedlings grown under
light; B, 5-day-old WT (top) and M96 (bottom) seedlings grown under
dark. Arrows indicate gravity direction.
and cell arrangement of the near-ground side and
far-ground side of the second curved node in M96
mutant were irregular especially at the far-ground side
(Fig. 3-C, -D and -F). These results indicated that the
asymmetric growth at the two sides of the second
node might result from the asymmetric cell number,
size and distribution.
Gravity response of M96 was not affected by light
and exogenous hormone
To determine the effect of light on the prostrate
growth, the wild type and M96 were grown under
light and dark conditions, respectively. Our results
showed that the wild type responded to gravity
stimulus markedly and tended to recover for erect
growth under light condition, but the M96 lost the
gravity response ability and remained horizontally
(Fig. 4-A). Similar responses to gravity were observed
both for the wild type and M96 under dark condition
(Fig. 4-B). The results suggested that light had no
contribution to the gravity response of M96 mutant.
To determine the effect of plant hormones on the
prostrate growth of M96, different concentrations of
exogenous hormones (2,4-D and GA3) were applied.
We found that both the wild type and M96 mutant
To determine the genetic control of the prostrate
growth phenotype in M96, we crossed M96 with ORO.
All the F1 plants derived from the cross M96/ORO
showed the normal phenotype similar to ORO. In the
F2 population, only the prostrate growth phenotype
and normal growth phenotype were observed. Among
a total of 302 F2 individuals, 224 plants were normal
and 78 plants were prostrate, matching the predicted
3:1 Mendelian ratio (χ2 = 0.11 < χ20.05 = 3.84). These
results indicated that the mutation was governed by a
single recessive nuclear gene, tentatively termed as
gravitropism-deficient M96 (gdM96). To locate the
gene, 311 polymorphic markers between the two
parents were used for linkage analysis and initial gene
mapping with 30 randomly selected mutant type F2
individuals. Among these markers, four SSR markers
(RM536, RM6901, RM229 and RM27051) on
chromosome 11 were probably linked to the target
gene (Table 2 amd Fig. 5-A). By genotyping all 319
mutant type of F 2 individuals, the target region was
narrowed down to 506 kb between markers RM5960
and InDel8 (Table 2 and Fig. 5-A).
According to the Rice Genome Annotation Project
(http://rice.plantbiology.msu.edu/), we found the target
region contained the LAZY1 gene (LOC_Os11g29840)
previously reported by Li et al (2007). Since LAZY1 is
responsible for prostrate growth, we consider that it
might be the targeted gene for gdM96 as well. We then
proceeded to sequence LOC_Os11g29840 in M96 and
the wild type. The results showed that the mutant
allele has a single base substitution (G/T) at the
position of 2 580 bp compared with the wild type (Fig.
Table 2. Part of primers used in this study.
Marker
RM536
RM6091
RM229
RM27051
RM287
RM5960
InDel8
M96
M96RT-2
Ubiquitin
Forward primer (5′−3′)
TCTCTCCTCTTGTTTGGCTC
GCGGACACACCAGAGAATAAGC
CACTCACACGAACGACTGAC
ACCTGGCTACCATCCAAACACG
GGCTACACCTACACGCGAGAACC
CGAGCAGCACTGGAGAACACC
AACACCACCCGATTCCCT
ATCATTGCCGTTGTCATCATCT
AAAGTCTACCCCGAGAACAC
CCCTCCACCTCGTCCTCAG
Reverse primer (5′−3′)
ACACACCAACACGACCACAC
GTGCTGTCCTGTCCTTGAATCC
CGCAGGTTCTTGTGAAATGT
GCTTTAGGGAGTTCCTGATGTGC
AGATGCATGGAATGCCTGTTTGG
CTCCTAGGTGCAGCGGACTACC
CAGATTGGATGAGCAGCAAC
CAGCACATTCAAGCCCTTCTAT
CTCTTGTTGCCGTTCATCTC
AGATAACAACGGAAGCATAAAAGTC
114
Rice Science, Vol. 24, No. 2, 2017
Fig. 5. Gene mapping and candidate gene analysis.
A, Gene mapping of M96 mutant; B, Sequence of the mutational region in LOC_Os11g29840 from the wild type; C, Sequence of the mutational
region in LOC_Os11g29840 from M96. Arrows indicate the position at 2 580 bp.
5-B). To confirm the co-segregation of polymorphism
between the genotype and the phenotype in the F2
population. Each three randomly-chosen F2 plants
with and without the mutant phenotype, respectively,
were sequenced, and the results showed that all the
M96 plants had the same mutation while all the wild
type individuals had no mutation. The cDNA of
gdM96 consists of 1 599 bp including a 28 bp 5′-UTR,
a 320 bp 3′-UTR and a 1 251 bp coding sequence.
gdM96 has five exons and four introns, and encodes a
predicted protein with 416 amino acid residuals. The
G/T mutation was confirmed at the cDNA level and
presumably resulted in the change from 74th glycine
in the wild type to cysteine in M96.
nuclear localization sequence (NLS) domain are
presented in the monocots including S. bicolor, Z.
mays, S. italica, O. brachyantha, B. distachyon, A.
tauschii, T. urartu. The similarity level from high
to low is O. brachyantha (76%), S. italica (64%), S.
bicolor (63%), Z. mays (61%), B. distachyon (57%), A.
tauschii (56%) and T. urartu (54%). Although several
genes controlling the prostrate growth both in
Arabidopsis and rice have been isolated, they have
very low similarities in the protein level with A.
thaliana (24%), O. sativa (PROG1) (7%), and no
similarity with O. sativa (LPA1) (Fig. 7). These results
suggest that the prostrate growth is controlled
differently between/in the monocot and the dicot, and
gdM96 is specifically expressed and relatively
conserved in monocot
To determine the expression level of gdM96, RT-PCR
was carried out using different organs. The results
showed that the target gene transcripts were abundant
in the stems while rare in the roots and leaves both in
the wild type and M96. The expression level of gdM96
in stems of M96 was more than four times compared
with the wild type (Fig. 6). It suggested that the target
gene was expressed specifically in the stem, and it
might play an important role in controlling the rice
tiller angle.
A database search (http://www.ncbi.nlm.nih.gov/)
reveals that LAZY1 homologus proteins with a
conserved transmembrance domain and a putative
Fig. 6. Expression analysis of target gene in root, stem and leaf of
the wild type and M96 by real-time PCR.
Error bars represent the standard deviation (n = 5). ** represents
the significant difference at the 0.01 level by the Duncan’s test.
HE Yan, et al. A New Allele for Rice Gravitropic Mutant
115
Fig. 7. Structural and phylogenetic analysis of gdM96 homologs.
A, Comparison of amino acid sequences of gdM96 homologs. Accession numbers for the respective protein sequences are as follows: O. sativa
(LAZY1) (LOC_Os11g29840), O. sativa (PROG1) (LOC_Os07g05900), O. sativa (LPA1) (LOC_Os03g13400), A. thaliana (NP_196913.2); O.
brachyantha (XP_015697926), S. italic (XP_004979290), A. tauschii (EMT22503), B. distachyon (XP_010237715), S. bicolor (XP_002449512), Z.
mays (AEM59513) and T. urartu (EMS62694). The asterisk indicates the mutant site in M96, the red squared box indicates the predicted
transmembrane domain and the blue squared box indicates the putative nuclear localization sequence domain. B, Dendrogram of gdM96 homologs.
116
Rice Science, Vol. 24, No. 2, 2017
multiple mechanisms may present in the monocot rice
as well.
DISCUSSION
Gravitropism is a complex multistep process, and the
main progress on its molecular mechanism has been
achieved in the dicotyledon A. thaliana, but the
molecular mechanism of gravitropism in monocotyledon
remains largely unknown. In this study, the rice
mutant M96 showed the prostrate phenotype from the
beginning of germinating to the maturity. The phenotype
is irrelevant to light and exogenous hormone treatment
and directly caused by the asymmetric cell growth and
development at the second node of the stems.
Morphologically, the mutant phenotype of M96 is
similar to the rice mutants la1-ZF802 and lpa1.
gdM96 (LOC_Os11g29840) is likely a new allele of
LAZY1 based on the physical location and DNA
sequence, although genetic complementation or RNAi
is required to prove it functionally. lazy1, controlling
the protrate growth of the rice mutant la1-ZF802, has
8 bp deletion in the fourth exon and leads to the
premature termination of LAZY1 protein, which
contains a conserved transmembrane domain (amino-acid
residues 62–83) and a putative NLS domain (aminoacid residues 286–312) (Li et al, 2007). In the present
study, gdM96 has a single base substitution at the
position of 2 580 bp, resulting in a change from
glycine to cysteine at the 74th amino acid residual.
Unlike lazy1, gdM96 is upregulated in M96. However,
the transcript of gdM96 might function improperly
and finally leads to the loss of gravitropic response
similar to lazy1. Interestingly, this residual is located
in the transmembrane domain. We therefore speculate
that the conserved transmembrane domain may play a
critical role through structural conformation in the
determination of gravitropism response in the monocot
rice.
Previous studies have reported that light can
regulate plant gravitropism by phytochrome (Hangarter,
1997). The A. thaliana mutant enhanced bending 1
(ehb1) exhibits hypocotyl bending under blue light
conditions although hypocotyl bending may be also
induced by gravitropism (Knauer et al, 2011). Shoots
of the tomato lazy-2 mutant exhibit negative
gravitropism in the dark, but show positive
gravitropism under light (Hasenstein and Kuznetsov,
1999), and the altered gravitropic response of lazy-2 is
phytochrome-regulated (Gaiser and Lornax, 1993).
Furthermore, the gravitropic set-point angle (GSA) of
the hypocotyl in lazy-2 seedlings under white light
conditions is sensitive to 3-(3,4-dichlorophenyl)1,1-di-methylurea (DCMU) and norflurazon treatment,
hence the light effects on the GSA of an organ could
be mediated via both phytochrome and photosynthesis
(Digby and Firn, 2002). Unlike the cases above, M96
mutant could not respond to gravity stimulus under
both light and dark conditions. Therefore, we
conclude initially that both phytochrome and
photosynthesis of M96 mutant are normal as in the
wild type.
ZmCLA4, the maize homolog of LAZY1, plays a
negative role in the control of maize erect-leaf-angle
through the alteration of mRNA accumulation, leading
to altered shoot gravitropism and cell development
(Zhang et al, 2014). In this study, gdM96 is
specifically expressed in the stems. However, detailed
analysis of mRNA accumulation on the far-ground
and near-ground sides of the stem should be carried
out in order to explain the reason causing the bending
growth in M96.
Auxin is the first phytohormone identified in plants
(Pennazio, 2002) and plays an important role in the
process of plant development. Previous study has
shown that LAZY1 is a negative regulator in polar
auxin transport (PAT) and loss-of-function of LAZY1
enhances PAT greatly and consequently alters the
endogenous indole-3-acetic acid (IAA) distribution in
shoots, leading to the reduced gravitropism (Li et al,
2007). In contrast, strigolactones are a group of newly
identified plant hormones which inhibit auxin
biosynthesis and attenuate rice shoot gravitropism,
mainly by decreasing the local IAA content (Sang et al,
2014). Furthermore, ethylene significantly promotes
the elongation of floating rice internodes (Azuma et al,
2003), and the previous studies have shown a possible
interaction between ethylene and auxin transport in
root gravitropism (Buer et al, 2003; Vandenbussche
et al, 2003). In this study, the gravitropism of M96
remain unchanged with exogenous hormones (2,4-D
and GA3) treatment although high concentration
exogenous hormone inhibits the growth of M96
seedlings. These results suggested that the biosynthetic
pathways of 2,4-D and GA3 in M96 mutant were
normal. However, the plant gravitropic growth might
be related to hormones such as IAA, GA,
brassinosteroid and ethylene, but their interactions and
specific roles in mediating gravitropism are still
obscure. Therefore, further investigation is required to
test the response of M96 to other kinds of auxins.
HE Yan, et al. A New Allele for Rice Gravitropic Mutant
gdM96 is conserved among the monocot species
with a conserved transmembrane domain and a NLS
domain. The transmembrane domain may be critical to
its function associated with the response to gravity.
However, the rice PROG1 and LPA1 are quite
different from gdM96 and LAZY1 both in their DNA
sequences and protein structures. Furthermore, protein
similarities between gdM96 or LAZY1 and the dicot
Arabidopsis are also low. All there indicate that the
prostrate growth phenotypes are complicated and
probably controlled by multiple mechanisms in plant
species. Thus, the isolation of gdM96 in the present
study would facilitate the further investigation of
mechanisms underlying the plant gravitropic response.
ACKNOWLEDGEMENT
This study was supported by the National High
Technology Research and Development Program of
China (Grant No. 2014AA10A603).
REFERENCES
Azuma T, Hatanaka T, Uchida N, Yasuda T. 2003. Interactions
between abscisic acid, ethylene and gibberellin in internodal
elongation in floating rice: The promotive effect of abscisic acid
at low humidity. Plant Growth Regul, 41(2): 105–109.
Buer C S, Wasteneys G O, Masle J. 2003. Ethylene modulates
root-wave responses in Arabidopsis. Plant Physiol, 132(2):
1085–1096.
Digby J, Firn R D. 2002. Light modulation of the gravitropic
set-point angle (GSA). J Exp Bot, 53: 377–381.
Dong Z B. 2014. Map-based cloning and functional analysis on the
maize LAZY1 gene. Beijing: China Agricultural University. (in
Chinese with English abstract)
Fukaki H, Fujisawa H, Tasaka M. 1996. How do plant shoots bend
up? The initial step to elucidate the molecular mechanisms of
shoot gravitropism using Arabidopsis thaliana. J Plant Res,
109(2): 129–137.
Gaiser J C, Lomax T L. 1993. The altered gravitropic response of
the lazy-2 mutant of tomato is phytochrome regulated. Plant
Physiol, 102(2): 339–344.
Hangarter R P. 1997. Gravity, light and plant form. Plant Cell
Environ, 20(6): 796–800.
Hasenstein K H, Kuznetsov O A. 1999. The response of lazy-2
tomato seedlings to curvature-inducing magnetic gradients is
modulated by light. Planta, 208(1): 59–65.
Jin J, Huang W, Gao J P, Yang J, Shi M, Zhu M Z, Luo D, Lin H X.
2008. Genetic control of rice plant architecture under
domestication. Nat Genet, 40(11): 1365–1369.
Knauer T, Dümmer M, Landgraf F, Forreiter C. 2011. A negative
effector of blue light-induced and gravitropic bending in
117
Arabidopsis. Plant Physiol, 156(1): 439–447.
Kovach M J, Sweeney M T, McCouch S R. 2007. New insights
into the history of rice domestication. Trends Genet, 23(11):
578–587.
Li P J, Wang Y H, Qian Q, Fu Z M, Wang M, Zeng D L, Li B H,
Wang X J, Li J Y. 2007. LAZY1 controls rice shoot gravitropism
through regulating polar auxin transport. Cell Res, 17(5):
402–410.
Liu J M, Park S J, Huang J, Lee E J, Xuan Y H, Je B I, Kumar V,
Priatama R A, Raj K V, Kim S H, Min M K, Cho J H, Kim T H,
Chandran A K N, Jung K H, Takatsuto S, Fujioka S, Han C D.
2016. Loose Plant Architecture1 (LPA1) determines lamina joint
bending by suppressing auxin signaling that interacts with
C-22-hydroxylated and 6-deoxo brassinosteroids in rice. J Exp
Bot, 67(3): 1883–1895.
Lu Y J, Zheng K L. 1992. A simple method for isolation of rice
DNA. Chin J Rice Sci, 6(1): 47–48. (in Chinese with English
abstract)
Miyata M, Komori T, Yamamoto T, Ueda T, Yano M, Nitta N. 2005.
Fine scale and physical mapping of Spk(t) controlling spreading
stub in rice. Breeding Sci, 55(2): 237–239.
Pennazio S. 2002. The discovery of the chemical nature of the
plant hormone auxin. Rivista Di Biol, 95(2): 289–308.
Saitou N, Nei M. 1987. The neighbor-joining method: A new
method for reconstructing phylogenetic trees. Mol Biol Evol,
4(4): 406–425.
Sang D J, Chen D Q, Liu G F, Liang Y, Huang L Z, Meng X B,
Chu J F, Sun X H, Dong G J, Yuan Y D, Qian Q, Li J Y, Wang
Y H. 2014. Strigolactones regulate rice tiller angle by
attenuating shoot gravitropism through inhibiting auxin
biosynthesis. Proc Natl Acad Sci USA, 111: 11199–11204.
Shi Y F, Chen J, Liu W Q, Huang Q N, Shen B, Leung H, Wu J L.
2009. Genetic analysis and gene mapping of a new rolled-leaf
mutant in rice (Oryza sativa L.). Sci China C: Life Sci, 52(9):
885–890.
Song C B, Yang W T, Du D L, Li D. 2006. Progress on plant
gravitropism mechanism and its related functional genes. In:
Proceedings of the Workshop on Research & Development of
Biotechnology in Hainan.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S.
2011. MEGA5: Molecular evolutionary genetics analysis using
maximum likelihood, evolutionary distance, and maximum
parsimony methods. Mol Biol Evol, 28(10): 2731–2739.
Tan L B, Li X R, Liu F X, Sun X Y, Li C G, Zhu Z F, Fu Y C, Cai
H W, Wang X K, Xie D X, Sun C Q. 2008. Control of a key
transition from prostrate to erect growth in rice domestication.
Nat Genet, 40: 1360–1364.
Tasaka M, Kato T, Fukaki H. 1999. The endodermis and shoot
gravitropism. Trends Plant Sci, 4(3): 103–107.
Vandenbussche F, Smalle J, Le J, Saibo N J M, de Paepe A,
Chaerle L, Tietz O, Smets R, Laarhoven L J J, Harren F J M, van
Onckelen H, Palme K, Verbelen J P, van Der Straeten D. 2003.
The Arabidopsis mutant alh1 illustrates a cross talk between
ethylene and auxin. Plant Physiol, 131(3): 1228–1238.
Wu X R, Tang D, Li M, Wang K J, Cheng Z K. 2013. Loose Plant
118
Architecture 1, an INDETERMINATE DOMAIN protein
involved in shoot gravitropism, regulates plant architecture in
rice. Plant Physiol, 161(1): 317–329.
Yoshihara T, Iino M. 2007. Identification of the gravitropismrelated rice gene LAZY1 and elucidation of LAZY1-dependent
and -independent gravity signaling pathways. Plant Cell Physiol,
48(5): 678–688.
Zhang J, Ku L X, Han Z P, Guo S L, Liu H J, Zhang Z Z, Cao L R,
Rice Science, Vol. 24, No. 2, 2017
Cui X J, Chen Y H. 2014. The ZmCLA4 gene in the qLA4-1
QTL controls leaf angle in maize (Zea mays L.). J Exp Bot, 65:
5063–5076.
Zhang Q F, Xu J D, Li Y, Xu P Z, Zhang H Y, Wu X J. 2007.
Morphological, anatomical and genetic analysis for a rice mutant
with abnormal hull. J Genet Genomics, 34(6): 519–526.
(Managing Editor: LI Guan)