This information is current as
of June 18, 2017.
Exon 5 Encoding the Transmembrane Region
of HLA-A Contains a Transitional Region for
the Induction of Nonsense-Mediated mRNA
Decay
Yumiko Watanabe, Katharine E. Magor and Peter Parham
J Immunol 2001; 167:6901-6911; ;
doi: 10.4049/jimmunol.167.12.6901
http://www.jimmunol.org/content/167/12/6901
Subscription
Permissions
Email Alerts
This article cites 77 articles, 35 of which you can access for free at:
http://www.jimmunol.org/content/167/12/6901.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2001 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
References
Exon 5 Encoding the Transmembrane Region of HLA-A
Contains a Transitional Region for the Induction of
Nonsense-Mediated mRNA Decay1
Yumiko Watanabe, Katharine E. Magor,2 and Peter Parham3
olymorphic MHC class I H chains associate with ␤2-microglobulin (␤2m)4 and short peptides to form cell surface
glycoproteins that are ligands for the receptors of CTL and
NK cells. The polymorphism of the human classical MHC class I
genes, HLA-A, B, and C, has been extensively studied because of
its medical importance in transplantation (1, 2). Recently, introduction of DNA methods of HLA typing facilitated the identification and characterization of a type of HLA class I allele not readily
detected by the serological methods used in clinical HLA analysis.
These null alleles have substitutions, insertions, or deletions that
prevent or reduce the expression of an HLA class I molecule at the
cell surface. To date some 25 HLA class I null alleles have been
described (3–21). HLA class II null alleles are also known, but to
a lesser extent than for class I (22–29).
In general, a null allele is very closely related in sequence to a
normally expressed allele from which it has likely evolved. A majority of HLA class I null alleles are inactivated by the presence of
a premature termination codon (PTC). These can be caused di-
P
Departments of Structural Biology and Microbiology and Immunology, Stanford University School of Medicine, Stanford, CA 94305
Received for publication August 22, 2001. Accepted for publication October
15, 2001.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This research was supported by Grant AI24258 from the National Institutes of
Health (to P.P.). Y.W. was supported in part by a fellowship from the Uehara Memorial Foundation. K.E.M. was supported in part by a fellowship from the Natural
Sciences and Engineering Research Council of Canada.
2
Current address: Department of Biological Sciences, Faculty of Sciences, University
of Alberta, Edmonton, Canada.
3
Address correspondence and reprint requests to Dr. Peter Parham, Department of
Structural Biology, Stanford University School of Medicine, Sherman Fairchild
Building D-151, 299 Campus Drive West, Stanford, CA 94305-5126. E-mail address:
[email protected]
4
Abbreviations used in this paper: ␤2m, ␤2-microglobulin; BCS, bovine calf serum;
B-LCL, B lymphoblastoid cell line; DHFR, dihydrofolate reductase; IEF, isoelectric
focusing; MUP, major urinary protein; NMD, nonsense-mediated mRNA decay; PTC,
premature termination codon; TPI, triosephosphate isomerase.
Copyright © 2001 by The American Association of Immunologists
rectly by point substitution within a codon, or indirectly by nucleotide insertion or deletion that changes the reading frame and leads
to premature termination downstream. Null alleles are characterized by low or undetectable levels of mRNA (10 –12) that limit the
production of truncated class I H chain protein. Studies on other
eukaryotic genes have revealed a pathway called nonsense-mediated mRNA decay (NMD) in which PTCs trigger the degradation
of the mRNA containing them (30 –35). The mechanism is yet to
be defined precisely, but it is best understood in yeast (31, 33).
In yeast, NMD is initiated during translation of the message in
the cytoplasm. PTCs are distinguished from the normal termination codon by the presence of specific sequence elements downstream of the PTC. Such downstream sequence elements can occur
at several places within the coding region and can activate NMD
when situated within ⬃150 nt 3⬘ of a PTC. Also found in yeast
genes are sequence elements termed stabilizer elements that can
inactivate NMD (36). Initiation of NMD is coupled to translation
termination at a PTC. A current model postulates that NMD initiates when the first ribosome to translate a message fails to dissociate specific proteins downstream of the PTC, proteins that
were bound to the downstream sequence elements in the nucleus
and retained on delivery to the cytoplasm. The retention of such
proteins in complex with mRNA (in PTC-containing, but not normal, transcripts) is then believed to stimulate a series of reactions
that lead to removal of the 5⬘ cap and degradation of the message
by a 5⬘-3⬘ exoribonuclease (31, 33).
PTCs in several mammalian genes have been shown to reduce
steady state levels of mRNA (34). These genes include those encoding dihydrofolate reductase (DHFR) (37), adenine phosphoribosyltransferase (38), ␤-globin (39 – 41), triosephosphate isomerase (TPI) (42– 47), major urinary protein (MUP) (48), TCR (49,
50), and Ig (51). A major difference between NMD in mammals
and yeast is the involvement of introns in mammalian genes. In
addition to their effect on mRNA level, PTCs in mammalian genes
can affect mRNA splicing, causing exon skipping (52) and/or intron retention (53). Such phenomena have suggested that specific
recognition of mammalian PTCs takes place in the nucleus, a view
0022-1767/01/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
HLA class I alleles containing premature termination codons (PTCs) are increasingly being found. To understand their effects on
MHC class I expression, HLA-A*2402 mutants containing PTCs were transfected into class I-deficient cells, and expression of
HLA-A mRNA and protein was determined. In exons 2, 3, and 4, and in the 5ⴕ part of exon 5, PTCs reduced mRNA levels by up
to 90%, whereas in the 3ⴕ part of exon 5 and in exons 6 and 7 they had little effect. Transition in the extent of nonsense-mediated
mRNA decay occurred within a 48-nt segment of exon 5, placed 58 nt upstream from the exon 5/exon 6 junction. This transition
did not conform to the positional rule obeyed by other genes, which predicted it to be ⬃50 –55 nt upstream of the exon 7/exon 8
junction and thus placing it in exon 6. Mutants containing extra gene segments showed the difference is caused by the small size
of exons 5 and 6, which renders them invisible to the surveillance machinery. For the protein, a transition from secretion to
membrane association occurs within a 26-nt segment of exon 5, 17 nt upstream of the exon 5/exon 6 junction. Premature termination in exon 5 can produce secreted and membrane-associated HLA-A variants expressed at high levels. The Journal of
Immunology, 2001, 167: 6901– 6911.
6902
class I gene HLA-G. To more fully understand the effects that
naturally occurring PTCs have on the expression of MHC class
I genes, we have performed an analysis of PTC-containing mutants of
a common human MHC class I allele (HLA-A*2402).
Materials and Methods
Cells
EBV-transformed human B-lymphoblastoid cell lines (B-LCL) were cultured in Cellgro RPMI 1640 (Mediatech, Herndon, VA) supplemented with
10% bovine calf serum (BCS). The B-LCL JY expresses HLA-A*0201 and
HLA-B*0702, and TISI expresses HLA-A*2402 and HLA-B*3508. The
HLA class I-deficient cell line, 721.221, was used as the recipient for HLA
class I genes in transfection experiments (65).
Antibodies
The HLA class I-specific mAb, W6/32 (IgG2a), recognizes a monomorphic
epitope on the class I H chain and ␤2m complex (66). Rabbit polyclonal
antiserum, ABR2, was raised against a peptide (CAQGSDVSLTA) corresponding to residues 330 –339 of the cytoplasmic tail of HLA class I H
chain (67). HRP-conjugated rabbit anti-human ␤2m Ab PA174 was purchased from DAKO (Glostrup, Denmark).
DNA mutagenesis and plasmid constructs
Nonsense mutations were introduced into the HLA-A*2402 gene using the
QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA), as
instructed by the manufacturers. DNA sequences of mutated fragments and
PCR products were analyzed using an ABI 373A DNA sequencer (Applied
Biosystems, Foster City, CA). The nucleotide sequence of HLA-A*2402
was determined by Magor et al. (6) (GenBank accession number L47206);
it contains the entire ⬃5-kb HindIII genomic fragment including the promoter, 5⬘ untranslated region, exons 1– 8 and intervening introns, and the
3⬘ untranslated region. The numbering used in this study starts with the first
nucleotide of the submitted sequence of 6705 nt.
Mutants M2:53, M2(TGA):53, M3:99, M3(TAA):99, and M3(TGA):99.
A 1.33-kb EagI-NdeI fragment, corresponding to nt 1438 (exon 2) to 2775
(exon 4), was excised from the A*2402 gene and subcloned into the pGEM
5Zf vector (Promega, Madison, WI). Nonsense mutations in exons 2 or 3
were created by site-directed mutagenesis with primer pairs listed below.
The mutated fragment was excised with PflMI and NsiI, and replaced the
normal PflMI-NsiI fragment, corresponding to nt 1519 (exon 2) to 2695
(intron 3), in the A*2402 gene that was previously subcloned in pBluescriptSK⫹ (Stratagene). The ⬃5-kb HindIII fragment containing the entire
mutant A*2402 gene was then transferred from pBluescriptSK⫹ into the
pHeBo expression vector (68, 69). The following oligonucleotide primer
pairs were used for mutagenesis, and the positions of mutation are underlined: for M2:53, 5⬘-GCGCCGTGGATATAGCAGGAGGGGC-3⬘ and 5⬘GCCCCTCCTGCTGCTATATCCACGGCGC-3⬘; for M2(TGA):53, 5⬘GCGCCGTGGATATGACAGGAGGGGC-3⬘ and 5⬘-GCCCCTCCTGCT
GTCATATCCACGGCGC-3⬘; for M3:99, 5⬘-CTCCAGATGATGTAG
GGCTGCGACGTGGG-3⬘ and 5⬘-CCCACGTCGCAGCCCTACATCATC
TGGAG-3⬘; for M3(TAA):99, 5⬘-CTCCAGATGATGTAAGGCTGCG
ACGTGGG-3⬘ and 5⬘-CCCACGTCGCAGCCTTACATCATCTGGAG-3⬘;
and for M3(TGA):99, 5⬘-CTCCAGATGATGTGAGGCTGCGACGTGGG-3⬘
and 5⬘-CCCACGTCGCAGCCCTACATCATCTGGAG-3⬘.
Mutants M4:257, M4(TGA):257, M4:262, M4:274, M4:275, M5:276,
M5:279, M5:295, M5:300, M5:308, M6:315, M7:330, and M7(TGA):
330. A 1.32-kb SphI fragment, corresponding to nt 2697 (exon 4) to 4013
(intron 7), was excised from the A*2402 genomic DNA and subcloned into
the pGEM 5Zf vector cut with SphI. Nonsense mutations in exons 4, 5, 6,
and 7 in pGEM 5Zf (SphI) were created by site-directed mutagenesis with
primer pairs described below. Mutated fragments were excised with SphI
and replaced the normal SphI fragment (corresponding to nt 2697–4013) in
the A*2402 gene in pBluescriptSK⫹. The ⬃5-kb HindIII fragment containing the entire mutant A*2402 gene was then transferred into the pHeBo
expression vector. Primer pairs used for mutagenesis were as follows; the
positions of mutation in the sequences are underlined: for M4:257,
5⬘-GAGGAGCAGAGATAAACCTGCCATGTG-3⬘ and 5⬘-CACATGG
CAGGTTTATCTCTGCTCCTC-3⬘; for M4(TGA):257, 5⬘-GAGGAGCA
GAGATGAACCTGCCATGTG-3⬘ and 5⬘-CACATGGCAGGTTCATCT
CTGCTCCTC-3⬘; for M4:262, 5⬘-CACCTGCCATGTGTAGCATGAG
GGTC-3⬘ and 5⬘-GACCCTCATGCTACACATGGCAGGTG-3⬘; for M4:
274, 5⬘-CACCCTGAGATGAGGTAAGGAGGGAG-3⬘ and 5⬘-CTCCCT
CCTTACCTCATCTCAGGGTG-3⬘; for M4:275, 5⬘-CACCCTGAGATG
GTGTAAGGAGGGAG-3⬘ and 5⬘-CTCCCTCCTTACACCATCTCAGGG
TG-3⬘; for M5:276, 5⬘-CTCTTTTCCCAGAGTAATCTTCCCAGCCC-3⬘
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
first espoused in the nuclear scanning model of NMD of Urlaub et
al. (37). In contrast, factors affecting translation also influence
NMD (for example, suppressor tRNAs and mutated start codons),
implicating translation as the process during which PTCs are identified and the NMD pathway is initiated (46, 50, 53, 54). Recent
report of the coupling of transcription and translation in discrete
transcriptional “factory” sites within mammalian nuclei might explain why both nuclear and cytoplasmic associated NMD have
been observed in eukaryotes (55).
Initiation of mammalian NMD requires both a PTC and a downstream element that are contributed from the removal of an intron
while inside the nucleus (42– 44, 49). The cotranslational model of
Maquat (56) and the posttermination model of Hentze and Kulozik
(32) both propose that PTC surveillance requires machineries involved in protein translation. In these models, the template for
surveillance is fully spliced mRNA that has acquired marks or tags
deposited at the exon/exon junctions after the splicing out of introns (32, 39, 42, 49, 57). Such markers could be proteins (e.g.,
Upf3) that were acquired in the nucleus and that in the first translation of a normal message are dissociated from the mRNA by
translocation of the ribosome (58). Premature termination would
not dissociate the proteins from downstream junctions, and their
persistence as complexes with the mRNA could induce the NMD
pathway.
From the studies on MUP, TPI, and ␤-globin, it has been
shown that one downstream intron is necessary for a PTC to
trigger the NMD pathway, and the PTC needs to be at least
50 –55 nt upstream of the junction of the last two exons (the two
3⬘-most exons) in the fully spliced message (39, 40, 42). Nagy
and Maquat (30) have generalized this positional rule to explain
why the normal termination codon is within the last exon of
most genes, or, in a minority of genes (7% of 1500 surveyed),
within a region 50 –55 bp upstream from the 3⬘-most exon/exon
junction: termination codons upstream of this region would lead
to transcript loss through NMD (30). Zhang et al. (42) hypothesize that 50 –55 nt is the minimum distance necessary for the
NMD-scanning mechanism to recognize both the termination
codon and the marker at the downstream exon/exon junction.
Current candidates for the scanner involve the 40S ribosomal
complex or ribosomal termination complex, possibly in association with the Upf1 protein (59), which interacts with translation termination factors (60, 61). It is proposed that the Upf3
protein first associates with the exon/exon junction of a transcript in the nucleus upon intron splicing. Upf3 then binds with
the Upf2 protein to form a complex, which then interacts with
Upf1 via the translation release factors on the ribosome and
induces NMD (58, 61).
A characteristic of gene families encoding Ag-recognition
molecules of immunity is rapid evolution through mutational
processes that inevitably generate PTCs. During T and B cell
development, PTCs are introduced at high frequency by the
gene rearrangements and accompanying reactions that are used
to make functional Ig and TCR. Expression of these PTCcontaining genes is down-regulated by the NMD pathway
(49 –51, 62). MHC class I and II genes are the most polymorphic mammalian genes known, their diversity and rapid evolution representing host responses to the selection imposed by
pathogens. Because MHC molecules select the T cell repertoire
as well as present Ags to T cells, we have previously proposed
that pathogens, depending on circumstance, can select for loss
of function and expression in MHC allotypes as well as for
presentation of novel Ags (63). In this regard, it is intriguing
that one of only two genes that Nagy and Maquat (30) found not
to obey the 50- to 55-nt positional rule was the nonclassical
DOWN-REGULATION OF HLA CLASS I BY PTC
The Journal of Immunology
Transfection
The HLA-A, B, C-deficient B-LCL 721.221 cells (1.25 ⫻ 107) were transfected by electroporation with 20 ␮g of either the wild-type HLA-A*2402
gene or mutant constructs cloned into the pHeBo vector, as previously
described (70). Transfectants were cultured in the presence of 400 ␮g/ml
hygromycin (Calbiochem, San Diego, CA) to ensure retention of the episomally replicating pHeBo vector.
Isolation of RNA
Total RNA was isolated from transfected cells and control 721.221 cells
using the TRI reagent (Molecular Research Center, Cincinnati, OH), as
recommended by the manufacturers. Cell fractionation was performed as
described (71), with minor modification. Cells were washed twice with
PBS and resuspended in hypotonic buffer (10 mM Tris (pH 7.4), 2 mM
MgCl2, 1 mM CaCl2, and 1 mM DTT) containing 1,000 U/ml RNasin
(Promega). The mild detergent Nonidet P-40 was added to the cell suspension (final concentration 0.3%) and incubated for 5 min. After being
passed through a 22-gauge needle, nuclei were pelleted by centrifugation at
1,000 rpm for 5 min. The supernatant was further centrifuged at 14,000
rpm, and the second supernatant fraction was used as a cytoplasmic fraction. Ten volumes of TRI reagent were added to the cytoplasmic fraction,
and cytoplasmic RNA was prepared as described above. Nuclei were resuspended with the hypotonic buffer without DTT and RNasin, and were
purified by centrifugation through a 0.25 M sucrose cushion at 1,000 rpm.
Nuclear RNA was isolated using the TRI reagent, as described above.
Northern blot analysis
Five micrograms of total, nuclear, or cytoplasmic RNA were used for analysis. Northern blotting was performed using Northern Max kit (Ambion,
Austin, TX) according to the manufacturer’s instructions. RNA probes
were generated by PCR amplification, followed by in vitro transcription
using the Strip-EZ RNA kit (Ambion). Primers for PCR amplification were
as follows: for HLA-A, sense oligonucleotide 5⬘-TTGTGTGGGACT
GAGAGGCAAGAGTTGTT-3⬘ and antisense oligonucleotide 5⬘-TAA
TACGACTCACTATAGGGAAAAGCCCTGGGAGGAAGGCAAGAC
CT-3⬘ (the T7 promoter sequence is underlined); for ␤2m, sense oligonucleotide 5⬘-GAATTGAAAAAGTGGAGCATTCAGACTTG-3⬘ and antisense oligonucleotide 5⬘-TAATACGACTCACTATAGGGCCTATAC
CTTCTTGAGATGTTCGTTC-3⬘; and for the Escherichia coli
hygromycin resistance gene (hygr), which is part of the pHeBo vector,
sense oligonucleotide 5⬘-CGATTCCGGAAGTGCTTGACATTGG-3⬘ and
antisense oligonucleotide 5⬘-TAATACGACTCACTATAGGGCAACCAC
GGCCTCCAGAAGAAGATG-3⬘.
The BrightStar Psoralen-Biotin Nonisotopic Labeling kit (Ambion) was
used for preparation of biotinylated RNA probes. Blots were hybridized
with the hygr probe, stripped, and reprobed with HLA-A and ␤2m probes.
Hybridization signals were detected using the BrightStar Biodetect kit
(Ambion). The blots were exposed to Kodak-XR film, and densitometric
analysis of the full-length mRNA band was performed using a scanner
(EPSON, Long Beach, CA) and the National Institutes of Health image
program (developed at the U.S. National Institutes of Health and available
on the Internet at http://rsb.info.nih.gov/nih-image/). Each HLA-A mRNA
level was normalized to the level of hygr mRNA derived from pHeBo
expression vector and indicated as the percentage of A*2402 or control
construct mRNA.
Flow cytometry
Approximately 5 ⫻ 105 cells were incubated with 2 ␮g of purified W6/32
mAb followed by fluorescein-conjugated goat anti-mouse IgG secondary
Ab (BioSource, Camarillo, CA). Cell surface expression of HLA class I
molecules was measured using a FACScan flow cytometer (BD Biosciences, San Jose, CA). Dead cells were excluded from the analysis by
propidium iodide staining.
Enzyme-linked immunosorbent assay
Cells (5 ⫻ 105/ml) were cultured either in RPMI 1640/10% BCS (for
721.221) or in RPMI 1640 –30% BCS containing 400 ␮g/ml hygromycin
(for transfectants). Cell culture supernatants were collected after 1 day and
filtered with a 0.22-␮m filter to remove residual cell debris. HLA class I
molecules were detected using a sandwich ELISA system, as previously
described (71). Briefly, Maxisorp Immunoplates (Nunc, Naperville, IL)
were coated with 100 ␮l of W6/32 Ab (2 mg/ml in PBS) overnight at 4°C.
Plates were blocked with 2% BSA in PBS for 30 min at 20°C. Cell culture
supernatants (1/25, 1/50, 1/100 dilutions) were added to the blocked plates.
Plates were incubated for 2 h at room temperature. One hundred microliters
of HRP-conjugated anti-human ␤2m Ab (1/2000 dilution) were added, and
the plates were incubated for 2 h at room temperature. Two hundred microliters of o-phenylenediamine peroxidase substrate solution (SigmaAldrich, St. Louis, MO) were added to each well. After a 30-min incubation, the color reaction was stopped with 3 N hydrochloric acid, and absorbance at 490 nm was measured using a microtiter plate reader.
Metabolic radiolabeling
Cells (1 ⫻ 107/ml) were preincubated for 1 h in methionine- and cysteinefree RPMI 1640 medium (Life Technologies, Rockville, MD) containing
10% dialyzed FCS (Sigma-Aldrich) at 37°C. [L-35S]methionine (70 ␮Ci)
(SJ1015; Amersham Pharmacia Biotech, Piscataway, NJ) was added, and
cells were incubated for 5 h.
Immunoprecipitation and isoelectric focusing gel electrophoresis
Cell lysis and immunoprecipitation were performed as described previously (72). Briefly, cell lysates were precleared with normal mouse IgG or
normal rabbit serum, and Staphylococcus aureus cells (Roche Molecular
Biochemicals, Indianapolis, IN) to reduce nonspecific binding. Precleared
lysates were incubated in the presence of 5 ␮g of mouse mAb W6/32 or 5
␮l of ABR2 rabbit antiserum for 1 h at 4°C. Immunoprecipitation was
performed in the presence of 50 ␮l of S. aureus cells. Immune complexes
were washed, treated with 20 ␮l of neuraminidase type VIII (SigmaAldrich), and analyzed by isoelectric focusing (IEF). Banding patterns
were visualized by autoradiography.
Results
The purpose of this investigation was to assess the effects of PTCs
when introduced at different sites within an allele of a highly polymorphic, classical HLA class I gene. To study this question, we
generated mutants of HLA-A*2402, an allele that is prevalent in
many human populations and one for which we have previously
described natural variants containing PTCs (11).
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
and 5⬘-GGGCTGGGAAGATTACTCTGGGAAAAGAG-3⬘; for M5:279,
5⬘-GAGCCATCTTCCTAGCCCACCGTCCC-3⬘ and 5⬘-GGGACGGTGG
GCTAGGAAGATGGCTC-3⬘; for M5:295, 5⬘-CCTGGTTCTCCTTTG
AGCTGTGATCAC-3⬘ and 5⬘-GTGATCACAGCTCAAAGGAGAACCA
GG-3⬘; for M5:300, 5⬘-GCTGTGATCACTTGAGCTGTGGTCGC-3⬘ and
5⬘-GCGACCACAGCTCAAGTGATCACAGC-3⬘; for M5:308, 5⬘-GCT
GCTGTGATGTGAAGGAGGAACAGC-3⬘ and 5⬘-GCTGTTCCTCCTT
CACATCACAGCAGC-3⬘; for M6:315, 5⬘-CTTCCCACAGATTGAAAA
GGAGGGAGC-3⬘ and 5⬘-GCTCCCTCCTTTTCAATCTGTGGGAAG3⬘; for M7:330, 5⬘-CAGTGACAGTGCCTAGGGCTCTGATGTG-3⬘ and
5⬘-CACATCAGAGCCCTAGGCACTGTCACTG-3⬘; and for M7(TGA):330,
5⬘-CAGTGACAGTGCCTGAGGCTCTGATGTG-3⬘ and 5⬘-CACATCAGAG
CCTCAGGCACTGTCACTG-3⬘.
Plasmid constructs containing extra exon or intron fragments were inserted into the BglII site at position 3515 in intron 5 of A*2402 and M5:
308. A PCR was made that contained plasmid template (50 ng), dNTPs (2
mM each), two primers (25 pmol), and 2.5 U native Pfu DNA polymerase
in 50 ␮l 1⫻ reaction buffer (Stratagene). Amplification of the DNA fragment was performed for 28 cycles of 20 s at 94°C, 25 s at 60°C, and 90 s
at 72°C.
Mutants E4, E4:257, E4:262, and E4:274. DNA fragments containing
normal or mutated exon 4 were amplified by PCR using the sense oligonucleotide Bgl4F 5⬘-GCGAGATCTTGACAGATGCAAAATGCCTGAA-3⬘
and the antisense oligonucleotide Bgl4R 5⬘-GACAGATCTGGGGCCCT
GACCCTGACCCTGCTAAAGG-3⬘ (BglII restriction sites are underlined) from template plasmids A*2402, M4:257, M4:262, and M4:274. The
PCR products were digested with BglII and inserted into the BglII site in
intron 5 of the A*2402 gene (situated at nt 3515).
Mutants M5:308,E4; M5:308,I3; M5:308,E6/7; and M5:308,E4:257.
DNA fragments containing normal or mutated exon 4 were generated by
PCR using Bgl4F and Bgl4R primers from A*2402 or E4:257 plasmid
template. A DNA fragment containing normal intron 3 was amplified from
A*2402 by PCR using sense oligonucleotide Bgl3F 5⬘-GCGAGATCTGT
GACTCTGAGGTTCCGCCCTG-3⬘ and antisense oligonucleotide Bgl3R
5⬘-GACAGATCTTTCAGGCATTTTGCATCTGTCA-3⬘ (BglII sites underlined). DNA fragments containing normal exons 6 and 7 were amplified
from A*2402 by PCR using sense oligonucleotide Bgl6F 5⬘-GCG
AGATCTGAAACTTCTCTGGGGTCCAAGACT-3⬘ and antisense oligonucleotide Bgl6R 5⬘-GACAGATCTCAATGCAAAGAAACCCCATAG
CAC-3⬘ (BglII sites underlined). PCR products were digested with BglII
and inserted into the BglII site (nucleotide corresponding to 3515) in intron
5 of M5:308.
6903
6904
DOWN-REGULATION OF HLA CLASS I BY PTC
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 1. PTCs in exons encoding the extracellular domains of the HLA-A*2402 H chain gene cause down-regulation of mRNA and cell surface
protein expression. A, Shows the exon-intron organization of the normal HLA-A*2402 gene and of the mutant constructs containing PTCs in exons 2–7.
Exons containing a PTC are stippled. HLA class I-deficient 721.221 cells were transfected with wild-type and mutant constructs in the pHeBo vector, and
Northern blotting analysis was performed on total RNA (B), nuclear RNA (C, left), and cytoplasmic RNA (C, right). The blots were sequentially probed
for the bacterial hygr of the pHeBo vector, for HLA-A, and for ␤2m. Although lacking functional HLA-A gene, the 721.221 cell line has normal ␤2m gene.
As controls, untransfected 721.221 cells and 721.221 cells transfected with vector alone were included in the blotting analysis. HLA-A mRNA levels are
expressed as a percentage of normal A*2402 mRNA after normalization to the level of hygr mRNA. The diamond (⽧) indicates signal on the HLA-A blot
that remained from previous hygr hybridization and that was not completely removed during dehybridization. D, Transfectants expressing the
The Journal of Immunology
PTCs in exons 2, 3, and 4, but not exons 5, 6, and 7, reduce
levels of HLA-A mRNA
protein at the surface of the transfected cells using the monomorphic HLA class I-specific Ab W6/32 (66) in flow cytometry (Fig.
1D). As expected, 721.221 cells transfected with M2:53, M3:99,
and M4:257 gave no expression at the cell surface, whereas the
cells transfected with M5:308, M6:315, and M7:330 gave levels of
W6/32 reactivity similar to that obtained with the A*2402 control.
For the latter mutants, the level of protein at the cell surface correlated well with the level of mRNA (Fig. 1, B and C).
IEF analysis of immunoprecipitates obtained with the W6/32 Ab
demonstrated that 721.221 cells transfected with the M5:308 and
M6:315 constructs expressed truncated proteins having isoelectric
points identical to those predicted from their amino acid sequences
(an isoelectric point of 5.81 for M5:308, and 5.99 for M6:315).
Each of these mutant proteins was associated with ␤2m (Fig. 1E).
As a control, similar immunoprecipitation analysis was performed
with the polyclonal antiserum ABR2, which is specific for 10 aa
(residues 330 –339) in the cytoplasmic tail of HLA-A near the
carboxyl terminus (67). Fig. 1E showed that wild-type A*2402
reacted with ABR2, whereas none of the A*2402 mutants reacted,
as expected from the positions of the PTCs.
This set of mutants studied contained different nonsense codons
as their PTCs, and all three types of nonsense codon were represented among the mutants. To assess whether the type of PTC
affects mRNA level, we performed the following experiments.
First, we made and compared a panel of mutants that all had TGA
as their termination codons. This codon is most commonly used in
human genes and terminates almost one-half of them (48%) (73);
it is also the natural termination codon for HLA-A. In this panel of
mutants all having TGA as the termination codon, the PTCs were
at the same sites as those described in Fig. 1A. Northern blot comparison of mRNA levels in transfectants expressing the two sets of
mutants revealed no effects of different termination codons (data
not shown). Second, all three types of termination codon were
introduced at codon 99 in exon 3. All three mutants down-regulated the mRNA level to a similar extent, again showing no differential effect due to the type of PTC (data not shown).
Codons 275–295 in exon 5 of the HLA-A gene contain a
transitional region for the induction of NMD
That termination at sites in exons 2, 3, and 4 gave dramatic reduction in mRNA level, while termination in exons 5, 6, and 7 had
little effect, identifies the sequence from codon 257 (in exon 4) to
codon 308 (in exon 5) as a region in which there is a transition in
the effects of PTCs on mRNA level. To define more precisely this
region of transition, additional mutants were made having PTCs at
various positions in between codons 257 and 308 (Fig. 2A). These
mutant genes were transfected into 721.221 cells, and HLA-A RNA
expression was analyzed by Northern blot (Fig. 2B).
Comparison of these mutants shows that PTCs at codons 295,
300, and 308 in the 3⬘ half of exon 5 have mRNA levels comparable with that of A*2402, although they differ from the control in
having a characteristic pattern of immature pre-mRNA. In contrast, PTCs placed at the 3⬘ end of exon 4 and in the 5⬘ part of exon
5 reduced the mRNA level, with the greatest effects being seen for
the two 5⬘-most PTCs, those causing termination at codons 274
and 275 (84% and 85% reduction, respectively). In mutant M4:
275, the PTC is split between exons 4 and 5, but this arrangement
A*2402 mutants were analyzed by flow cytometry for binding to W6/32, an Ab that recognizes a conformational epitope of the complex of HLA class I
H chain and ␤2m. The mean fluorescence intensity (mfi) is indicated for each transfectant. E, Transfectants that were positive by flow cytometry were
radiolabeled and immunoprecipitated either with W6/32 (upper panel) or the rabbit antiserum ABR2 specific for residues 330 –339 of the cytoplasmic tail
(lower panel). The precipitates were treated with neuraminidase and analyzed on IEF gels. To provide standards in the IEF gel immunoprecipitates were
made from B cell lines JY (A*0201, B*0702) and TISI (A*2402, B*3508).
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
PTCs were individually introduced into exons 2–7 of the HLAA*2402 gene. Together these six exons specify the 341 residues of
the mature HLA-A*2402 protein (Fig. 1A). Wherever possible,
mutations were chosen to mimic ones present in the human population either in expressed or null HLA class I genes. Thus, the
mutation made in exon 3 (Phe99 to stop) corresponds to that in
HLA-B*1526N (12), the mutation made in exon 4 (Tyr257 to stop)
corresponds to that in A*0215N (5), and the mutation made in exon
6 (Arg315 to stop) corresponds to the normal site of termination in
the oligomorphic nonclassical class I gene, HLA-G (64).
Genomic DNA fragments containing the A*2402 promoter/enhancer sequence and either normal or mutated A*2402 genes were
subcloned into the pHeBo expression vector containing a hygromycin resistance gene. HLA-A, B, C-deficient 721.221 cells were
transfected with the normal or mutated A*2402 genes, and stable
cell lines were established by culture with hygromycin. Northern
blot analysis of total RNA revealed that the HLA-A mRNA levels
were decreased in transfectants expressing mutants having a PTC
in exon 2, 3, or 4 (M2:53, M3:99, and M4:257, respectively; Fig.
1B). In contrast, the PTCs in exons 5, 6, and 7 (M5:308, M6:315,
and M7:330, respectively) had little effect on mRNA abundance
(Fig. 1B). Whereas the levels of HLA-A message differed between
the transfectants, they had comparable levels of endogenous ␤2m
transcripts. Several species of higher m.w., immature HLA-A premRNAs were detected in all the transfectants. However, these species were more abundant in the transfectants expressing mutants
with PTCs in exons 2, 3, and 4 than in transfectants expressing
either normal A*2402 or mutants with PTCs in exons 5, 6, and 7
(Fig. 1B).
To investigate this difference further, fractions of nuclear and
cytoplasmic RNA were prepared from the total RNA isolated from
the transfected cells and separately analyzed on Northern blots
(Fig. 1C). As expected, the higher m.w. bands corresponding to
incompletely processed pre-mRNA were found only in the nuclear
fractions. The abundance of these species was highest for the mutants with PTCs in exons 2, 3, and 4, and of intermediate level for
the mutant with a PTC in exon 5. Normal A*2402 and the mutants
with PTCs in exons 6 and 7 gave comparably low levels. The
cytoplasmic fractions contained only mature mRNA, an inverse
correlation being seen between the abundance of mature message
in the cytoplasm and that of immature pre-mRNA species in the
nucleus. These data are all consistent with the PTCs in exons 2, 3,
and 4 triggering increased degradation of HLA-A transcripts by a
process of NMD, a process well characterized for other mammalian and yeast genes (30 –35).
From the positions of the PTCs, we predicted that the mutant
proteins terminating in the extracellular domains (those encoded
by mutants M2:53, M3:99, and M4:257) would associate with neither ␤2m nor cellular membranes. In contrast, the mutant proteins
terminating in the transmembrane (M5:308) or cytoplasmic domains (M6:315 and M7:330) were predicted to associate with both
␤2m and cellular membranes. Although mutant M5:308 terminates
in exon 5 that encodes the transmembrane domain, it does so at a
site 3⬘ of the sequence encoding the hydrophobic transmembrane
anchor. To test these predictions, we assessed the level of HLA-A
6905
6906
In the HLA-A gene, exon size and number both affect the
location of the transitional region for NMD
The foregoing analysis demonstrates that PTCs on the 5⬘ side of
exon 5 cause a major reduction in the steady state level of mRNA,
whereas PTCs on the 3⬘ side of exon 5 do not. For PTCs within
exon 5, there is a gradual transition between the two extremes.
That these changes occur in the fourth-last exon contrasted with
the results from DHFR, glutathione peroxidase 1, TCR-␤, TPI, and
␤-globin genes, in which a boundary was found in the penultimate
exon (37, 39, 40, 42, 44, 49, 54, 74).
To investigate this point further, we made and studied several
artificial constructs of the HLA-A*2402 gene in which the length
and content of the intron between exons 5 and 6 were changed. In
the first set of constructs, an extra copy of exon 4 and its immediate
flanking regions were inserted into the natural intron 5 (Fig. 3A).
In these constructs, the fourth-last exon (the third exon upstream of
the last exon/exon junction) was the extra exon 4 rather than the
natural exon 5. Addition of this exon to the normal A*2402 gene
(mutant E4) did not reduce the level of mRNA in transfected cells,
although it was now longer due to the extra exon (Fig. 3B). Constructs containing PTCs in the extra exon 4 gave lower levels of
mRNA in transfected cells, but with evidence of a gradient decreasing from 3⬘ to 5⬘ according to the position of the PTC (Fig.
3B). This is in contrast with PTCs in exon 4 of the normal HLA-A
gene, in which they uniformly led to strong reduction of mRNA
(⬃90% reduction in M4:257, M4:262, and M4:274). These data
are consistent with a model in which the transition for mRNA
decay induction of HLA-A is in the third exon upstream of the last
exon/exon junction. Also supporting this model were the properties of a construct (M5:308,E4) in which the extra exon 4 was
placed in the context of a PTC at codon 308 in exon 5 (Fig. 4A).
The effect of the extra exon 4 was to convert this PTC from one
that did not reduce the level of mRNA to one that did (88% reduction; Fig. 4B). The effect of the extra exon 4 was not simply due
to an increase in size, because the addition of an intronic sequence
of similar size did not convert PTC 308 (M5:308,I3) into one that
reduced mRNA level (Fig. 4).
As a further assessment of the model, the extra exon 4 in M5:
308,E4 was replaced by a similarly sized fragment containing exon
6, intron 6, exon 7, and flanking regions to give mutant M5:
308,E6/7 (Fig. 4A). If the region of transition in this construct
localizes to the third exon upstream from the last exon/exon junction (the extra exon 7), then PTC 308 in exon 5 is predicted to
strongly reduce the level of mRNA. The observed effect was partial reduction to a level one-third of that seen in the absence of
extra exons (Fig. 4B). Thus, in this construct, the transitional region extends into the fifth exon upstream of the final exon/exon
junction. This result indicates that the short exons 6 and 7, which
are 33 and 48 nt in length, respectively, do not behave equivalently
to the longer exon 4 (276 nt) in determining where PTCs will cause
down-regulation of mRNA. It appears that the size of the exons is
also a factor determining the site of transition. The small size of
exons 6 and 7 in HLA-A could also explain why the transition
region in the normal HLA-A*2402 gene is in the fourth-last exon,
whereas in DHFR, glutathione peroxidase 1, TCR-␤, TPI, and
␤-globin genes, it is the penultimate exon (37, 39, 40, 42, 44, 49,
54, 74).
Discussion
PTCs can arise in mRNA as a result of transcriptional error, somatic mutation, or the inheritance of germline mutation. The surveillance mechanism that causes mRNA-containing PTCs to be
degraded has obvious benefits to cells and organisms; it prevents
synthesis of mutant proteins that are inactive and would in some
cases interfere with the function of the normal protein. The alleles
and loci of the MHC class I family are noted for diversity and rapid
evolution (75), processes that appear driven by the changing pressures
imposed upon vertebrate populations by pathogenic microorganisms.
For these genes, in which novelty appears frequently advantageous, it
is necessary to understand the role that PTC-mediated mRNA degradation has upon their expression and evolution.
We have found that all PTCs placed in exons 2– 4 encoding the
extracellular domains of HLA-A caused ⬃90% reduction in the
level of mature mRNA (Fig. 1). This degree of PTC-induced
down-regulation is comparable with that found for the IgH chain
gene (76), ␬ L chain gene (51, 53), and the TCR-␤ chain gene (50),
but contrasts with reductions of 70 – 80% caused by PTCs in the
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
did not interfere with its recognition, a phenomenon also reported
from studies of the TPI and TCR-␤ chain genes (43, 49). These
results further localize the region of transition within codons 275–
295 in exon 5. They also show that there is a gradual decline in
mRNA level as the PTC moved upstream in this region (⬃70%
reduction with PTC 279 and 276, and up to ⬃85% reduction with
PTC 275).
Experiments were also performed to determine the relative
quantities of protein made in the transfectants shown in Fig. 2C.
Analysis by flow cytometry showed that M5:308 was the only
mutant that expressed W6/32-reactive HLA protein at the cell surface, which it did with an abundance comparable with the A*2402
control (Fig. 2C). Exon 5 encodes the transmembrane domain plus
short, flanking, hydrophilic sequences. Of the mutations made in
this panel, the PTC in mutant M5:308 is that in the 3⬘-most position, and its protein product includes all of the hydrophobic transmembrane anchor. The proteins encoded by the other mutants in
this group lack part or all of this anchor, suggesting that their
absence at the cell surface could have arisen because they do not
associate with cell membranes. To test this hypothesis, we investigated whether the culture medium in which the transfectants had
been grown contained soluble, secreted HLA-A molecules. This
was done using a quantitative ELISA based upon the W6/32 Ab.
In comparison with untransfected 721.221 cells or cells transfected with the pHeBo vector alone, the supernatants from all
transfected cells contained W6/32-reactive material (Fig. 2D). For
A*2402 and mutant M5:308, the amounts were small, as both express membrane-bound proteins. By comparison, transfectants expressing mutants M5:295 and M5:300, which had mRNA levels
comparable with the A*2402 transfectant, but no HLA-A protein at
the cell surface, secreted high amounts of soluble HLA-A into the
extracellular culture fluid. Mutants with a PTC at other upstream
positions in exon 5 or at the 3⬘ end of exon 4 gave lower levels of
soluble HLA-A, well correlated with their mRNA level. So, within
this panel of mutants, the amount of protein made correlated with
the level of mRNA, but its cellular location depended upon the
placement of the PTC and its effect on membrane anchoring. The
transition for membrane anchoring is relatively sharp, as removal
of eight residues from the carboxyl-terminal end of the transmembrane region (the difference between M5:308 and M5:300) effectively converted the HLA-A molecules from a membrane-bound to
a soluble form.
These experiments show that codons 275–295 in exon 5 contain
a transitional region in which the effect of a PTC goes from causing 85% down-regulation of mRNA level to having negligible effect. A second critical region was also defined, one in which the
PTCs do not lead to mRNA decay, but convert the protein from
being membrane bound to being soluble and secreted. This region
encompasses codons 295–300 and may extend into one or both
flanking regions, although not beyond codons 279 and 308.
DOWN-REGULATION OF HLA CLASS I BY PTC
The Journal of Immunology
6907
TPI, DHFR, and ␤-globin genes (37, 39, 40, 45). An impression
gained from this admittedly small sample of genes is that diversifying genes of the adaptive immune system are under more stringent control by NMD than housekeeping genes. Our results also
explain why many of the known natural HLA class I null alleles,
having been defined by loss of cell surface antigenic phenotype,
produce low or undetectable levels of mRNA: these alleles have
PTCs in exon 1, 2, 3, or 4 (Fig. 5). It is therefore likely that any
natural variant of an HLA class I gene having a PTC in exon 1, 2,
3, or 4 will be highly down-regulated at the mRNA level.
In our experiments, PTCs in exons 6 and 7 of HLA-A did not
induce NMD, whereas PTCs in exon 5 had a variable effect that
depended upon their positions. PTCs at the 5⬘ end of exon 5 gave
maximal down-regulation of mRNA level; PTCs at the 3⬘ end had
little effect. The region of transition was from codon 275 (85%
down-regulation) to codon 295 (normal mRNA level). Analysis of
other mammalian genes previously revealed this trend in which
there is a boundary dividing the gene into two parts, a 5⬘ part in
which PTCs induce NMD and a 3⬘ part in which they do not. From
results obtained on the MUP, TPI, and ␤-globin genes, Nagy and
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 2. PTCs at different sites in exon 5 differentially down-regulate mRNA
expression and can give rise to secreted or membrane-bound proteins. A, The positions
of mutations in exon 5 and the 3⬘ end of exon 4 of the A*2402 gene. B, A Northern blot
of total RNA extracted from 721.221 cells transfected with the mutant constructs. The
blot was sequentially probed for hygr, HLA-A, and ␤2m. As controls, untransfected
721.221 cells and 721.221 cells transfected with vector alone were included in the
analysis. HLA-A mRNA levels are expressed as a percentage of wild-type A*2402
mRNA after normalization for the levels of hygr mRNA. C, Flow cytometry of 721.221
cells transfected with the A*2402 mutants described. The positive control was 721.221
transfected with normal A*2402; the negative controls were untransfected 721.221 cells
and cells transfected with the pHeBo vector alone. The mean fluorescence intensity
(mfi) is indicated for each of the transfectants. D, ELISA analysis for W6/32-reactive
HLA-A*2402 molecules in the culture media in which the transfectants and control
cells were grown.
6908
DOWN-REGULATION OF HLA CLASS I BY PTC
Maquat (30) proposed a positional rule that defined the boundary
as being 50 –55 nt upstream of the 3⬘-most exon/exon junction in
the fully spliced mRNA (30). According to this rule, PTCs in the
last exon and in the 3⬘-most 19 codons from the end of the penultimate exon should not induce NMD. An exception to this rule is
the TCR-␤-chain gene, for which down-regulation occurred for
FIGURE 4. Exon size and number influence PTC-mediated decay. A, Mutants M5:308,E4, M5:308,I3, and M5:308,E6/7 in which exon 4, intron 3, and
exons 6 and 7 from the normal A*2402 gene have been inserted as an extra component within intron 5 of M5:308. As a positive control, E4 is a construct
in which an additional exon 4 has been inserted into intron 5 of the normal A*2402 gene. As a negative control, M5:308,E4:257 is a construct in which
an additional exon 4 from mutant M4:257 has been inserted into intron 5 of M5:308. Exons containing a PTC are stippled. B, A Northern blot of total RNA
isolated from 721.221 cells transfected with A*2402 mutants. Untransfected 721.221 cells and 721.221 cells transfected with vector alone were included
as controls. The blot was sequentially probed for hygr, HLA-A, and ␤2m. HLA-A mRNA levels are expressed as a percentage of normal A*2402 or M5:308
mRNA, after normalization for the levels of hygr mRNA.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 3. The mRNA-down-regulating effect of PTCs in exon 4 is ameliorated when the exon is artificially placed in the natural intron 5. A, Two types
of mutant constructs of HLA-A*2402. First are mutants M4:257, M4:262, and M4:274, which have PTCs at positions 257, 262, and 274 of exon 4. Second
are constructs E4:257, E4:262, and E4:274 in which the mutant exon 4 from mutants M4:257, M4:262, and M4:274 has been inserted as an extra exon
within intron 5 of the normal A*2402 gene. As a control, E4 is a construct in which an additional exon 4 has been inserted into the intron. Exons containing
a PTC are stippled. B, A Northern blot of total RNA isolated from 721.221 cells transfected with A*2402 mutants. Untransfected 721.221 cells and 721.221
cells transfected with vector alone were included as controls. The blot was probed sequentially for hygr, HLA-A, and ␤2m. HLA-A mRNA levels are
expressed as a percentage of normal A*2402 or E4 mRNA, after normalization for the levels of hygr mRNA.
The Journal of Immunology
6909
transcripts containing PTCs in the penultimate exon at positions
only 8 –10 nt upstream from the 3⬘-most exon/exon junction (49).
Neither do PTCs in the HLA-A gene conform to the positional rule,
but in a way different from that seen in the TCR-␤ gene. According
to the positional rule, the transitional boundary of HLA-A should
reside at codons 323–324 in exon 6. In our experiments, PTCs in
the last three exons (6, 7, and 8) of HLA-A did not induce NMD,
the boundary being situated ⬎58 nt upstream of the third-last (exon
5/exon 6) rather than the ultimate, exon/exon junction (Fig. 6).
That the boundary in the HLA-A gene is located ⬃58 nt upstream of an exon/exon boundary suggests that the scanning machinery recognizes PTCs similarly in the HLA-A, MUP, TPI, and
␤-globin genes (30). What distinguishes HLA-A is that the junctions between exons 6 and 7 and between exons 7 and 8 do not
appear to count. Exons 6 and 7 in HLA-A are unusually small
exons, comprising just 33 and 48 nt, respectively. That these exons
are shorter than 50 –55 nt might explain why PTCs are recognized
differently than according to the prevailing paradigm. Emphasizing
the distinct behavior of the short exons was our observation that
the presence of four short downstream exons did not move the
transition region completely out of exon 5 (Fig. 4). In contrast,
insertion of an additional, longer exon into intron 5 moved the
transition region out of exon 5 and downstream into the inserted
exon (Fig. 3). One possibility is that the boundaries involving such
short exons are not marked in the nucleus in the same way as those
involving longer exons, and that this makes them invisible to the
scanning machinery. Alternatively, the close juxtaposition of PTCs
in short exons and the marks that define the exon junctions may
prevent effective recognition by the scanning machinery. The latter
possibility is compatible with the hypothesis of Zhang et al. (42) that
50 –55 nt represents the minimum separation needed for the scanning
machinery to recognize both a PTC and a downstream mark.
In classical MHC class I genes, the cytoplasmic tails are always
encoded by a number of short exons. Thus, the results we obtained
for HLA-A are likely to have generality for other classical class I
genes. A corollary of the positional rule is that when the natural
termination codons are not encoded in the last exon, it lies no
further than 50 –55 nt upstream of the 3⬘ end of the penultimate
exon. Of the genes surveyed by Nagy and Maquat (30), only two
FIGURE 6. Schematic showing the distances between the PTC in
A*2402 mutant mRNA and either the exon 5/exon 6 or the 3⬘-most exon/
exon junction. A, Within the fully spliced HLA-A mRNA the positions of
PTCs in the 3⬘ end of exon 4 and in exons 5, 6, and 7, which were analyzed
here. The positions of the PTC are indicated by the vertical arrows. B and
C, The horizontal line indicates the region between the PTC and the relevant junction in the fully spliced mRNA. The number at the right gives the
separation in nucleotides; the relative thickness of the lines indicates the
mRNA level.
are reported to fail this rule, one of these being the relatively nonpolymorphic, human MHC class I gene HLA-G (64); however, this
might not be entirely true for HLA-G. Although the genomic organization of HLA-G is homologous to that of HLA-A, the homologous HLA-G exon 7 has not been found in any reported cDNA
sequenced (77). An alternative stop codon in exon 6 is also used
for the natural termination of HLA-G. Thus, the exon 6/exon 8
junction is effectively the 3⬘-most junction, which placed the natural stop codon in exon 6 at a position only 31 nt upstream of the
ultimate exon/exon junction, and thus adhering to the positional
rule of Nagy and Maquat (30). As such, the observations with our
HLA-A mutants are even more remarkable.
From our analysis, the functional possibilities of variant HLA
class I genes containing PTCs appear to depend dramatically upon
where the PTC is located. Variant alleles having PTCs in exons
1– 4, the highly polymorphic part of the gene, would be largely
shut down by NMD. Moreover, almost all such variants would not
encode class I H chains that associate with ␤2m and bind peptides.
Such mutations could be the substrate for positive selection under
circumstances in which a class I alelle or locus is having a deleterious effect on host survival and reproduction. The HLA-H and J
loci appear to be examples of class I genes that were once functional for which alleles containing PTCs have been fixed either
through selection or genetic drift (78, 79). However, in most circumstances, it is expected that alleles with PTCs in exons 1– 4 will
lack advantage and may diminish immune responsiveness: heterozygotes will become effective homozygotes for the other functional allele, and homozygotes will lack the locus altogether. This
need not be obviously detrimental, as evidenced by apparently healthy
homozygotes for HLA-A*0215N (5) and HLA-B*1526N (12).
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 5. HLA null alleles with PTC in exon sequence. A schematic
of the exon-intron organization of an HLA class I gene showing the position of PTCs in natural HLA-A and B variants. The arrows point to the sites
of the PTCs for the following alleles: a, A*6811N (PTC: ⫺6) (15); b,
B*4419N (PTC: ⫺6) (17); c, B*4022N (PTC: 58) (20); d, A*6818N (PTC:
59) (2); e, B*3703N (PTC: 89) (2); f, B*1526N (PTC: 99) (12); g, B*3925N
(PTC: 113) (2); h, A*0232N (PTC: 141) (18); i, B*4423N (PTC: 141) (2);
j, B*5127N (PTC: 144) (2); k, A*2308N (PTC: 164) (2); l, B*0808N (PTC:
189) (19); m, A*2611N (PTC: 164) (2); n, A*0104N (PTC: 196) (8); o,
A*2307N (PTC: 196) (2); p, A*2411N (PTC: 196) (11); q, B*5111N (PTC:
196) (13); r, A*2409N (PTC: 224) (11); s, A*0215N (PTC: 257) (5); and t,
A*0243N (PTC: 264) (2). The positions of the PTCs are indicated following the allele designation in parentheses. PTCs in 11 alleles are generated
from frameshift mutation by 1-bp deletion (a, b, l), 2-bp deletion (g), 1-bp
insertion (n, o, p, q, t), 2-bp insertion (m), and 20-bp insertion (d); the PTCs
generated are downstream of insertion/deletion event. The other nine alleles have nucleotide substitutions that generate PTCs.
6910
Acknowledgments
We thank Drs. Stewart Cooper and Mark S. Carter for technical advice and
helpful discussion; Drs. Lisbeth Guethlein, Clair Gardiner, and Benny P.
Shum for help with preparing the manuscript; and Dr. Steven Marsh and
Patricia Mason for their assistance in searching the HLA database.
References
1. Marsh, S. G. E., P. Parham, and L. D. Barber. 2000. The HLA Factsbook. Academic Press, San Diego.
2. Robinson, J., M. J. Waller, P. Parham, J. G. Bodmer, and S. G. Marsh. 2001.
IMGT/HLA database: a sequence database for the human major histocompatibility complex. Nucleic Acids Res. 29:210.
3. Lardy, N. M., R. M. Bakas, A. R. van der Horst, E. van Twuyver, R. E. Bontrop,
and L. P. de Waal. 1992. Cis-acting regulatory elements abrogate allele-specific
HLA class I gene expression in healthy individuals. J. Immunol. 148:2572.
4. Balas, A., F. Garcia-Sanchez, F. Gomez-Reino, and J. L. Vicario. 1994. HLA
class I allele (HLA-A2) expression defect associated with a mutation in its enhancer B inverted CAT box in two families. Hum. Immunol. 41:69.
5. Ishikawa, Y., K. Tokunaga, H. Tanaka, M. Nishimura, M. Muraoka, Y. Fujii,
T. Akaza, K. Tadokoro, and T. Juji. 1996. HLA-A null allele with a stop codon,
HLA-A*0215N, identified in a homozygous state in a healthy adult. Immunogenetics 43:1.
6. Lienert, K., G. Russ, S. Lester, G. Bennett, X. Gao, and J. McCluskey. 1996.
Stable inheritance of an HLA-“blank” phenotype associated with a structural
mutation in the HLA-A*0301 gene. Tissue Antigens 48:187.
7. Hoyer, R. J., A. B. Hahn, M. Carrington, and C. K. Hurley. 1997. Identification
of a null HLA-B allele in a Caucasian family. Hum. Immunol. 55:35.
8. Laforet, M., N. Froelich, A. Parissiadis, B. Pfeiffer, A. Schell, B. Faller,
M. L. Woehl-Jaegle, J. P. Cazenave, and M. M. Tongio. 1997. A nucleotide
insertion in exon 4 is responsible for the absence of expression of an HLA-A*01
allele. Tissue Antigens 50:347.
9. Laforet, M., N. Froelich, A. Parissiadis, H. Bausinger, B. Pfeiffer, and
M. M. Tongio. 1997. An intronic mutation responsible for a low level of expression of an HLA-A*24 allele. Tissue Antigens 50:340.
10. Lardy, N. M., N. Otting, A. R. van der Horst, R. E. Bontrop, and L. P. de Waal.
1997. 5⬘ Regulatory nucleotide sequence of an HLA-A*0101 null allele. Immunogenetics 46:152.
11. Magor, K. E., E. J. Taylor, S. Y. Shen, E. Martinez-Naves, N. M. Valiante,
R. S. Wells, J. E. Gumperz, E. J. Adams, A. M. Little, F. Williams, et al. 1997.
Natural inactivation of a common HLA allele (A*2402) has occurred on at least
three separate occasions. J. Immunol. 158:5242.
12. Mine, H., Y. Ishikawa, M. Hojo, S. Imashuku, K. Tokunaga, T. Juji, H. Saji, and
S. Yokoyama. 1997. An HLA-B null allele (B*1526N) with a stop codon in exon
3 generated by a point mutation. Tissue Antigens 50:351.
13. Blasczyk, R., V. Rebmann, and H. Grosse-Wilde. 1998. A second HLA-B null
allele: HLA-B*5111N. Eur. J. Immunogenet. 25:7.
14. Curran, M. D., F. Williams, A. M. Little, B. K. Rima, J. A. Madrigal, and
D. Middleton. 1999. Aberrant splicing of intron 1 creates a novel null HLAB*1501 allele. Tissue Antigens 53:244.
15. Laforet, M., N. Froelich, A. Parissiadis, A. Schell, B. Pfeiffer, J. P. Cazenave, and
M. M. Tongio. 1999. A null HLA-A*68 allele in a bone marrow donor. Tissue
Antigens 53:573.
16. Poli, F., P. Bianchi, M. Scalamogna, L. Crespiatico, N. Ghidoli, G. Puglisi, and
G. Sirchia. 1999. A nucleotide deletion in exon 4 is responsible for an HLA-A
null allele (A*0105N). Tissue Antigens 54:300.
17. Bettens, F., and J. M. Tiercy. 2000. Sequence of a new class I null allele within
the HLA-B44 specificity. Tissue Antigens 56:441.
18. Bunce, M., J. Procter, P. P. Dunn, S. Day, J. Ross, and K. I. Welsh. 2000.
Identification of the null HLA-A2 allele, A*0232N. Tissue Antigens 55:31.
19. Carter, V., P. P. Dunn, G. Cavanagh, S. Day, J. Ross, and C. Chapman. 2000. An
HLB-B null allele (B*0808N) caused by a nucleotide deletion in exon 3, found
in the family of a bone marrow transplant recipient. Tissue Antigens 55:61.
20. Tamouza, R., K. Sadki, V. Schaeffer, E. Carbonnelle, Z. Tatari, J. Chabod,
A. Toubert, C. Raffoux, C. Sayada, and D. Charron. 2000. A novel HLA-B null
allele (B*4022N) generated by a nonsense codon in the ␣1 domain. Tissue Antigens 55:378.
21. Elsner, H. A., J. Drabek, V. Rebmann, Z. Ambruzova, H. Grosse-Wilde, and
R. Blasczyk. 2001. Non-expression of HLA-B*5111N is caused by an insertion
into the cytosine island at exon 4 creating a frameshift stop codon. Tissue Antigens 57:369.
22. Sutton, V. R., B. K. Kienzle, and R. W. Knowles. 1989. An altered splice site is
found in the DRB4 gene that is not expressed in HLA-DR7,Dw11 individuals.
Immunogenetics 29:317.
23. Sutton, V. R., and R. W. Knowles. 1990. An aberrant DRB4 null gene transcript
is found that could encode a novel HLA-DR ␤ chain. Immunogenetics 31:112.
24. Zimmerman, P. A., L. L. Steiner, V. P. Titanji, P. N. Nde, J. E. Bradley,
T. Pogonka, and A. B. Begovich. 1996. Three new DPB1 alleles identified in a
Bantu-speaking population from central Cameroon. Tissue Antigens 47:293.
25. Lardy, N. M., N. Otting, A. R. van der Horst, R. E. Bontrop, and L. P. de Waal.
1997. Full-length cDNA nucleotide sequence of a serologically undetectable
HLA-DQA1 allele: HLA-DQA1*“LA.” Tissue Antigens 50:334.
26. Robbins, F., C. K. Hurley, T. Tang, H. Yao, Y. S. Lin, J. Wade, N. Goeken, and
R. J. Hartzman. 1997. Diversity associated with the second expressed HLA-DRB
locus in the human population. Immunogenetics 46:104.
27. Steiner, L. L., D. K. McCurdy, A. Cavalli, P. V. Moonsamy, and A. B. Begovich.
1997. Two new DPB1 alleles identified in a study of the genetics of susceptibility
to pauciarticular juvenile rheumatoid arthritis. Tissue Antigens 49:262.
28. Voorter, C. E., H. E. Roeffaers, E. D. du Toit, and E. M. van den Berg-Loonen.
1997. The absence of DR51 in a DRB5-positive individual DR2ES is caused by
a null allele (DRB5*0108N). Tissue Antigens 50:326.
29. Balas, A., P. Ocon, J. L. Vicario, and A. Alonso. 2000. HLA-DR51 expression
failure caused by a two-base deletion at exon 2 of a DRB5 null allele
(DRB5*0110N) in a Spanish gypsy family. Tissue Antigens 55:467.
30. Nagy, E., and L. E. Maquat. 1998. A rule for termination-codon position within
intron-containing genes: when nonsense affects RNA abundance. Trends Biochem. Sci. 23:198.
31. Czaplinski, K., M. J. Ruiz-Echevarria, C. I. Gonzalez, and S. W. Peltz. 1999.
Should we kill the messenger? The role of the surveillance complex in translation
termination and mRNA turnover. BioEssays 21:685.
32. Hentze, M. W., and A. E. Kulozik. 1999. A perfect message: RNA surveillance
and nonsense-mediated decay. Cell 96:307.
33. Jacobson, A., and S. W. Peltz. 2000. Destablization of nonsense containing transcripts in Saccharomyces cerevisiae. In Translational Control of Gene Expression. N. Sonenberg, J. W. B. Hershey, and M. Mathews, eds. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, p. 827.
34. Maquat, L. E. 2000. Nonsense-mediated RNA decay in mammalian cells: a splicing-dependent means to down-regulate the levels of mRNAs that prematurely
terminate translation. In Translational Control of Gene Expression.
N. Sonenberg, J. W. B. Hershey, and M. Mathews, eds. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, p. 849.
35. Maquat, L. E., and G. G. Carmichael. 2001. Quality control of mRNA function.
Cell 104:173.
36. Ruiz-Echevarria, M. J., C. I. Gonzalez, and S. W. Peltz. 1998. Identifying the
right stop: determining how the surveillance complex recognizes and degrades an
aberrant mRNA. EMBO J. 17:575.
37. Urlaub, G., P. J. Mitchell, C. J. Ciudad, and L. A. Chasin. 1989. Nonsense mutations in the dihydrofolate reductase gene affect RNA processing. Mol. Cell.
Biol. 9:2868.
38. Kessler, O., and L. A. Chasin. 1996. Effects of nonsense mutations on nuclear and
cytoplasmic adenine phosphoribosyltransferase RNA. Mol. Cell. Biol. 16:4426.
39. Zhang, J., X. Sun, Y. Qian, and L. E. Maquat. 1998. Intron function in the
nonsense-mediated decay of ␤-globin mRNA: indications that pre-mRNA splicing in the nucleus can influence mRNA translation in the cytoplasm. RNA 4:801.
40. Thermann, R., G. Neu-Yilik, A. Deters, U. Frede, K. Wehr, C. Hagemeier,
M. W. Hentze, and A. E. Kulozik. 1998. Binary specification of nonsense codons
by splicing and cytoplasmic translation. EMBO J. 17:3484.
41. Baserga, S. J., and E. J. Benz, Jr. 1992. ␤-Globin nonsense mutation: deficient
accumulation of mRNA occurs despite normal cytoplasmic stability. Proc. Natl.
Acad. Sci. USA 89:2935.
42. Zhang, J., X. Sun, Y. Qian, J. P. LaDuca, and L. E. Maquat. 1998. At least one
intron is required for the nonsense-mediated decay of triosephosphate isomerase
mRNA: a possible link between nuclear splicing and cytoplasmic translation.
Mol. Cell. Biol. 18:5272.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Variant alleles with PTCs in exons 6 and 7 encoding the cytoplasmic domain are expressed at the cell surface at normal levels
and differ solely in the length and sequence of their cytoplasmic
tails. Natural variants of this type have not been described, but that
does not mean they do not exist: neither the serological nor DNA
typing methods used to screen populations for HLA class I probe
for polymorphism in exons 5, 6, 7, and 8. It is difficult to assess the
possible functional effects of cytoplasmic tail mutants upon which
natural selection might operate, because so little is known of the
purpose of this part of the MHC class I molecule (80). Recently,
Cohen et al. (81) demonstrated that the cytoplasmic tail is necessary for the Nef-dependent down-regulation of HLA-A and B during HIV infection, illustrating how it can be used to a pathogen’s
advantage. This clearly raises the possibility that there are infections in which novel changes in the cytoplasmic tail of an MHC
class I molecule confer an advantage to the host. The normal, early
termination in HLA-G also supports this conjecture.
Variant alleles with PTCs in exon 5 have perhaps the potential
for the widest ranging effect. Mutation throughout this exon produces variant class I H chains that associate with ␤2m and bind
peptides. With the exception of the few 3⬘-most codons, all variants with PTCs in exon 5 will give rise to MHC class I molecules
that are soluble and secreted into the extracellular fluid. Such natural variants have not been described, but neither have they been
sought nor would routine serological or DNA typing methods detect them. Individuals carrying them would be expected to have
unusually high levels of soluble HLA class I Ag in the circulation.
DOWN-REGULATION OF HLA CLASS I BY PTC
The Journal of Immunology
63. Lawlor, D. A., J. Zemmour, P. D. Ennis, and P. Parham. 1990. Evolution of
class-I MHC genes and proteins: from natural selection to thymic selection. Annu.
Rev. Immunol. 8:23.
64. Geraghty, D. E., B. H. Koller, and H. T. Orr. 1987. A human major histocompatibility complex class I gene that encodes a protein with a shortened cytoplasmic segment. Proc. Natl. Acad. Sci. USA 84:9145.
65. Shimizu, Y., B. Koller, D. Geraghty, H. Orr, S. Shaw, P. Kavathas, and
R. DeMars. 1986. Transfer of cloned human class I major histocompatibility
complex genes into HLA mutant human lymphoblastoid cells. Mol. Cell. Biol.
6:1074.
66. Parham, P., C. J. Barnstable, and W. F. Bodmer. 1979. Use of a monoclonal
antibody (W6/32) in structural studies of HLA-A, B, C antigens. J. Immunol.
123:342.
67. Little, A. M., E. Nossner, and P. Parham. 1995. Dissociation of ␤2-microglobulin
from HLA class I heavy chains correlates with acquisition of epitopes in the
cytoplasmic tail. J. Immunol. 154:5205.
68. Sugden, B., K. Marsh, and J. Yates. 1985. A vector that replicates as a plasmid
and can be efficiently selected in B-lymphoblasts transformed by Epstein-Barr
virus. Mol. Cell. Biol. 5:410.
69. Shimizu, Y., D. E. Geraghty, B. H. Koller, H. T. Orr, and R. DeMars. 1988.
Transfer and expression of three cloned human non-HLA-A,B,C class I major
histocompatibility complex genes in mutant lymphoblastoid cells. Proc. Natl.
Acad. Sci. USA 85:227.
70. McCutcheon, J. A., J. Gumperz, K. D. Smith, C. T. Lutz, and P. Parham. 1995.
Low HLA-C expression at cell surfaces correlates with increased turnover of
heavy chain mRNA. J. Exp. Med. 181:2085.
71. Ott, M., C. Seidl, U. Westhoff, K. Stecker, E. Seifried, P. A. Fischer, and
H. Grosse-Wilde. 1998. Soluble HLA class I and class II antigens in patients with
multiple sclerosis. Tissue Antigens 51:301.
72. Little, A.-M., and P. Parham. 1993. HLA class I gene and protein sequence
polymorphism. In Histocompatibility Testing, A Practical Approach.
P. A. Dyer and D. Middleton, eds. IRL, Oxford, p. 159.
73. Brown, C. M., M. E. Dalphin, P. A. Stockwell, and W. P. Tate. 1993. The
translational termination signal database. Nucleic Acids Res. 21:3119.
74. Sun, X., P. M. Moriarty, and L. E. Maquat. 2000. Nonsense-mediated decay of
glutathione peroxidase 1 mRNA in the cytoplasm depends on intron position.
EMBO J. 19:4734.
75. Trowsdale, J. 1995. “Both man & bird & beast”: comparative organization of
MHC genes. Immunogenetics 41:1.
76. Connor, A., C. Collins, L. Jiang, M. McMaster, and M. J. Shulman. 1993. Isolation of new nonsense and frameshift mutants in the immunoglobulin ␮ heavychain gene of hybridoma cells. Somatic Cell Mol. Genet. 19:313.
77. Ishitani, A., and D. E. Geraghty. 1992. Alternative splicing of HLA-G transcripts
yields proteins with primary structures resembling both class I and class II antigens. Proc. Natl. Acad. Sci. USA 89:3947.
78. Zemmour, J., B. H. Koller, P. D. Ennis, D. E. Geraghty, D. A. Lawlor, H. T. Orr,
and P. Parham. 1990. HLA-AR, an inactivated antigen-presenting locus related to
HLA-A: implications for the evolution of the MHC. J. Immunol. 144:3619.
79. Messer, G., J. Zemmour, H. T. Orr, P. Parham, E. H. Weiss, and J. Girdlestone.
1992. HLA-J, a second inactivated class I HLA gene related to HLA-G and
HLA-A: implications for the evolution of the HLA-A-related genes. J. Immunol.
148:4043.
80. Gur, H., T. D. Geppert, M. C. Wacholtz, and P. E. Lipsky. 1999. The cytoplasmic
and the transmembrane domains are not sufficient for class I MHC signal transduction. Cell. Immunol. 191:105.
81. Cohen, G. B., R. T. Gandhi, D. M. Davis, O. Mandelboim, B. K. Chen,
J. L. Strominger, and D. Baltimore. 1999. The selective down-regulation of class
I major histocompatibility complex proteins by HIV-1 protects HIV-infected cells
from NK cells. Immunity 10:661.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
43. Zhang, J., and L. E. Maquat. 1996. Evidence that the decay of nucleus-associated
nonsense mRNA for human triosephosphate isomerase involves nonsense codon
recognition after splicing. RNA 2:235.
44. Cheng, J., P. Belgrader, X. Zhou, and L. E. Maquat. 1994. Introns are cis effectors
of the nonsense-codon-mediated reduction in nuclear mRNA abundance. Mol.
Cell. Biol. 14:6317.
45. Cheng, J., and L. E. Maquat. 1993. Nonsense codons can reduce the abundance
of nuclear mRNA without affecting the abundance of pre-mRNA or the half-life
of cytoplasmic mRNA. Mol. Cell. Biol. 13:1892.
46. Belgrader, P., J. Cheng, and L. E. Maquat. 1993. Evidence to implicate translation by ribosomes in the mechanism by which nonsense codons reduce the nuclear level of human triosephosphate isomerase mRNA. Proc. Natl. Acad. Sci.
USA 90:482.
47. Belgrader, P., J. Cheng, X. Zhou, L. S. Stephenson, and L. E. Maquat. 1994.
Mammalian nonsense codons can be cis effectors of nuclear mRNA half-life.
Mol. Cell. Biol. 14:8219.
48. Belgrader, P., and L. E. Maquat. 1994. Nonsense but not missense mutations can
decrease the abundance of nuclear mRNA for the mouse major urinary protein,
while both types of mutations can facilitate exon skipping. Mol. Cell. Biol. 14:
6326.
49. Carter, M. S., S. Li, and M. F. Wilkinson. 1996. A splicing-dependent regulatory
mechanism that detects translation signals. EMBO J. 15:5965.
50. Carter, M. S., J. Doskow, P. Morris, S. Li, R. P. Nhim, S. Sandstedt, and
M. F. Wilkinson. 1995. A regulatory mechanism that detects premature nonsense
codons in T-cell receptor transcripts in vivo is reversed by protein synthesis
inhibitors in vitro. J. Biol. Chem. 270:28995.
51. Lozano, F., B. Maertzdorf, R. Pannell, and C. Milstein. 1994. Low cytoplasmic
mRNA levels of immunoglobulin ␬ light chain genes containing nonsense codons
correlate with inefficient splicing. EMBO J. 13:4617.
52. Dietz, H. C., D. Valle, C. A. Francomano, R. J. Kendzior, Jr., R. E. Pyeritz, and
G. R. Cutting. 1993. The skipping of constitutive exons in vivo induced by nonsense mutations. Science 259:680.
53. Aoufouchi, S., J. Yelamos, and C. Milstein. 1996. Nonsense mutations inhibit
RNA splicing in a cell-free system: recognition of mutant codon is independent
of protein synthesis. Cell 85:415.
54. Li, S., D. Leonard, and M. F. Wilkinson. 1997. T cell receptor (TCR) mini-gene
mRNA expression regulated by nonsense codons: a nuclear-associated translation-like mechanism. J. Exp. Med. 185:985.
55. Iborra, F. J., D. A. Jackson, and P. R. Cook. 2001. Coupled transcription and
translation within nuclei of mammalian cells. Science 293:1139.
56. Maquat, L. E. 1995. When cells stop making sense: effects of nonsense codons on
RNA metabolism in vertebrate cells. RNA 1:453.
57. Shyu, A. B., and M. F. Wilkinson. 2000. The double lives of shuttling mRNA
binding proteins. Cell 102:135.
58. Lykke-Andersen, J., M. D. Shu, and J. A. Steitz. 2000. Human Upf proteins target
an mRNA for nonsense-mediated decay when bound downstream of a termination codon. Cell 103:1121.
59. Applequist, S. E., M. Selg, C. Raman, and H. M. Jack. 1997. Cloning and characterization of HUPF1, a human homolog of the Saccharomyces cerevisiae nonsense mRNA-reducing UPF1 protein. Nucleic Acids Res. 25:814.
60. Czaplinski, K., M. J. Ruiz-Echevarria, S. V. Paushkin, X. Han, Y. Weng,
H. A. Perlick, H. C. Dietz, M. D. Ter-Avanesyan, and S. W. Peltz. 1998. The
surveillance complex interacts with the translation release factors to enhance
termination and degrade aberrant mRNAs. Genes Dev. 12:1665.
61. Culbertson, M. R. 1999. RNA surveillance: unforeseen consequences for gene
expression, inherited genetic disorders and cancer. Trends Genet. 15:74.
62. Li, S., and M. F. Wilkinson. 1998. Nonsense surveillance in lymphocytes? Immunity 8:135.
6911