From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Distinct Regulatory Mechanisms for Interferon-a/b (IFN-a/b)–
and IFN-g–Mediated Induction of Ly-6E Gene in B Cells
By Mehran M. Khodadoust, Khuda Dad Khan, Eun-ha Park, and Alfred L.M. Bothwell
The murine Ly6-E gene is transcriptionally induced by interferon-a/b (IFN-a/b) and IFN-g in a variety of distinct cell
types. The mechanism of IFN inducibility in B-cell lines was
investigated by deletion analysis of the promoter and by
identifying DNA binding proteins in mobility shift assays. A
region located in the distal part of the promoter at 22.3 kb
contributed to inducibility by both types of IFNs. This region
contains a novel element in addition to the previously
well-characterized IFN-stimulated response element (ISRE).
The probes containing ISRE detected IFN-inducible complexes in mobility shift assays and the signal transducer and
activator of transcripition–1 was found to be in these com-
plexes from cells treated with either type of IFN. An additional element present in the proximal part of the promoter
at position 2109 is also required for IFN-a/b–mediated
induction. These data suggested a cooperative interaction
between these physically disparate regulatory regions. A
crucial role for HMGI(Y) protein in this cooperative multiprotein complex is supported by the evidence that inhibition of
HMGI(Y) expression via antisense RNA results in the loss of
IFN-a/b–mediated induction of the Ly6-E gene. These results
show the complexity involved in achieving cell-type specificity in IFN-mediated gene regulation.
r 1998 by The American Society of Hematology.
I
characterized markers for the hematopoietic pluripotent stem cells in
fetal and adult mice.11
Given their suspected important roles in leukocyte development, it was reasonable to expect human homologues of some
of these molecules. In fact, recently the E48 gene homologous
to mouse ThB antigen12 and the 9804 gene homologous to
mouse differentiation antigen TSA-1/Sca-213 were characterized and found to be localized on human chromosome 8, the
syntenic locus of mouse chromosome 15, where the murine
Ly-6 genes have been mapped.14 Like some of their murine
counterparts, the 9804 gene is also responsive to IFNs.13
Interestingly, this gene is also inducible by retinoic acid during
differentiation of acute promyelocytic leukemia cells.15
The Ly-6E antigen is found to be associated with tyrosine
kinases in T cells16 and reduced expression of Ly-6E via
antisense RNA in a T-cell clone causes impairment of functional
responses as well as the inhibition of enzymatic activity of fyn
tyrosine kinase.17 Interaction of Ly-6E with tyrosine kinases
provides an explanation for signal transduction properties of
these molecules in lymphocytes. Cross-linking of the Ly-6E
molecules on murine B lymphocytes causes a marked increase
in the concentration of intracellular free calcium in the absence
of phosphatidylinositol turnover. This rise in calcium, in the
presence of a costimulator like interleukin-4, IFN-g,18 or
protein kinase C activator phorbol myristate acetate,19 provides
a signal for Ly-6E–mediated B-cell proliferation.
Because IFNs are the principal physiological inducers of the
NTERFERONS (IFNs) ARE a heterogenous family of
cytokines which regulate a number of cellular functions
including antiviral, antiproliferative, and immunoregulatory
activities. Most of these activities are accomplished by the
products of genes that are transcriptionally activated by IFNs.1
The study of the mechanism of activation of IFN-inducible
genes has led to the dramatic discovery of the JAK-STAT
pathway involved in signal transduction pathways of numerous
cytokines and growth factors. The latent transcription factors
termed ‘‘signal transducers and activators of transcription’’
(STATs) preexist in the cytoplasm2 and on stimulation with IFN
they are activated by tyrosine phosphorylation catalyzed by
Janus kinases (JAK).3 On activation they multimerize and
translocate to the nucleus where they bind to the target DNA
sequences and enhance the transcription of regulated genes.2
Two of the best characterized regulatory elements are IFNstimulated response element (ISRE)4 and IFN-g activation site
(GAS).5 IFN-a/b induces the formation of ISGF3 complex
which binds ISRE and is composed of three subunits: STAT1,
STAT2, and a 48-kD DNA binding protein (ISGF3g). IFN-g
treatment leads to the formation of g-activated factor (GAF)
that binds to the GAS element and is responsible for the
upregulation of the IFN-g–inducible primary response genes.
This response occurs within minutes and without synthesis of
intermediate signaling molecules. GAF is formed by the
dimerization of STAT1a subunits via SH2 domain-phosphotyrosine interactions.6 ISRE has been shown to be essential for
responsiveness to IFN-a/b2 but for certain genes such as major
histocompatibility complex (MHC) class I7 and Igk light chain,8
the response to IFN-g is also mediated by an ISRE. An
IFN-g–inducible complex containing STAT1 homodimers and
p48 (ISGF3g) has been shown to bind ISRE.9
Immunoregulatory functions of IFNs include induction of various
cell surface molecules crucial for cell-to-cell interactions, eg, MHC
class I and class II molecules. In addition to the essential interaction
between antigen receptors on T lymphocytes and MHC molecules
on antigen presenting cells, a number of accessory molecules are
also required for T-cell activation. Among these accessory molecules
expressed on T cells is the Ly-6A/E antigen, a member of a murine
multigene family. The Ly-6–encoded proteins are anchored on the
cell surface via a carboxyterminal phosphatidylinositol moiety10 and
various members are expressed at crucial times during hematopoiesis and immune responses. The Ly-6A/E is one of the best
Blood, Vol 92, No 7 (October 1), 1998: pp 2399-2409
From the Section of Immunobiology, Yale University School of
Medicine, New Haven, CT; and the Department of Medicine, Division
of Hematology and Oncology, Duke University Medical Center, Durham,
NC.
Submitted February 12, 1998; accepted May 24, 1998.
Supported by Public Health Service Grant No. GM40924 from the
National Institutes of Health.
Address reprint requests to Alfred L.M. Bothwell, PhD, Section of
Immunobiology, Yale University School of Medicine, 310 Cedar St, New
Haven, CT 06520-8011; e-mail: [email protected].
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734 solely to indicate
this fact.
r 1998 by The American Society of Hematology.
0006-4971/98/9207-0032$3.00/0
2399
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2400
KHODADOUST ET AL
protein is provided by the direct binding of HMGI(Y) to one of
the regulatory sequences and by the lack of IFN-a/b inducibility after inhibition of HMGI(Y) expression accomplished by
antisense RNA. In summary, distinct regulatory mechanisms
exist for the IFN-a/b– and IFN-g–mediated induction of Ly-6E
gene in B cells.
MATERIALS AND METHODS
Fig 1. Schematic representation of genomic deletion constructs
used to define the IFN responsive region in the 3.2-kb 58 flanking
sequence of the Ly-6E gene. The map shows the intact gene coding
for the Ly-6A antigen that was present in all these constructs. The
region between the two PstI sites is the PstI fragment used for further
subcloning. Restriction sites in the map are abbreviated as follows: H,
HindIII; S, SpeI; Ap, ApaI; Ps, PstI; Bs, BstEII; K, KpnI; Av, AvaI; R, EcoRI.
Ly-6E gene, we have been studying the underlying molecular
mechanism. We previously characterized a GAS element necessary for IFN-a/b– and IFN-g–mediated induction in fibroblasts.20,21 Almost all of the studies which have characterized
the IFN signal transduction pathway have been performed in
fibroblast and epithelial cell lines. Although the general biological effects of IFNs are quite similar, several observations
suggest some important differences in the mechanism of gene
activation by IFNs in different cell types. In some cell lines the
IFN-mediated induction of certain genes is a primary response
without the need for ongoing protein synthesis,22 whereas an
intermediate protein(s) needs to be synthesized for the induction
of the same genes in other cell types.23 Furthermore, the sizes of
proteins isolated from myeloid and lymphoid cells that bind to
the same ISRE were different.24 Unlike fibroblasts, the analysis
of Ly-6E gene expression in the B-cell line A20-2J by Northern
blots showed very delayed kinetics of induction by IFNs.
Moreover, a genomic construct lacking the GAS site of the
Ly-6E promoter was inducible by IFNs in this cell line.25 These
results suggested that distinct regulatory elements of the Ly-6E
promoter mediate IFN responsiveness in this cell line.
To define these elements we used a combination of genomic
deletions and a reporter gene linked to various fragments of the
Ly-6E promoter. This analysis has identified a 56-bp regulatory
region located at 22.3 kb that contains a functional ISRE and an
additional novel element necessary for the IFN-g responsiveness in A20-2J cells. This region binds IFN-a/b– and IFN-g–
inducible complexes which contain STAT1. However, for
IFN-a/b inducibility an additional element located in the
proximal part of the promoter at position 2109 is also required.
One interpretation of these results is that a cooperative interaction between the protein complexes binding to these physically
disparate regions is required for IFN-mediated induction of
Ly-6E gene in B cells. The supportive evidence for the assembly
of such a multiprotein complex promoted by the HMGI(Y)
Cell lines. A20-2J and BALB/3T3 cells were obtained from the
American Type Culture Collection (Rockville, MD). Murine B lymphoma (A20-2J) and fibroblast (BALB3T3) cell lines were grown in
Dulbecco’s modified Eagle’s medium (DMEM) supplemented with
10% fetal calf serum.
Cytokines. Recombinant murine IFN-g was purchased from GIBCOBRL (Gaithersburg, MD). Recombinant murine IFN-a/b was provided
by LEE Biomolecular (San Diego, CA).
Stable transfections. Stable transfection was achieved by cotransfection with 20 µg of the test plasmid and 2 µg of the pSV2neo plasmid.
Approximately 2 3 107 cells in phosphate-buffered saline (PBS)
containing 2 mmol/L b-mercaptoethanol were electroporated at 320 V
and 960 microfarads with a Bio-Rad Gene pulser (Hercules, CA). The
cells were then plated in DMEM containing 10% fetal bovine serum.
After 36 to 48 hours the cells were collected, counted, and replated in
Fig 2. IFN inducibility of transfected chimeric Ly-6A/E deletion
constructs (shown in Fig 1). Stable clones derived from A20-2J cells
were analyzed by cell surface staining with MoAb 34-11-3 directed
specifically against Ly-6A antigen. Cells were mock treated or treated
with IFN-a/b (1,000 U/mL for 24 hours) or IFN-g (500 U/mL for 24
hours). Plain lines indicate cells stained with secondary antibody only
as control (FITC-conjugated rabbit anti-mouse Ig); bold lines indicate
cells stained with 34-11-3 followed by secondary antibody.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
IFN REGULATION OF Ly-6E GENE IN B CELLS
2401
Table 1. Analysis of Stable A20-2J Transfectants
Construct
Neo R
Basal
IFN-a/b
IFN-g
Ly-6A/E
Ly-6A/E.3
Ly-6A/E.2
Ly-6A/E.19
Ly-6A/E.20
Ly-6A/E.18
8
5
11
13
11
8
0
0
0
0
0
0
8
4
0
7
0
0
8
4
0
7
0
0
Estimation of Ly-6A expression was performed by FACS analysis
and those clones that showed at least threefold induction were
considered inducible.
Abbreviations: NeoR, total number of clones analyzed; basal, the
number of clones that expressed basal levels of Ly-6A antigen; IFN-g,
the number of clones showing IFN-g–inducible Ly-6A; IFN-a/b, the
number of clones showing IFN-a/b–inducible Ly-6A expression.
fresh medium containing 3 mg/mL G418 in 96-well culture plates at a
density of 104 per well. After 2 weeks individual transfectants could be
expanded for analysis.
Transient transfections. Cells (3 3 106) were obtained and resuspended in 1 mL serum-free DMEM with 10 mmol/L HEPES, pH 7.4.
DNA (10 µg), DEAE-Dextran (250 µg/mL), and chloroquine (0.1
mmol/L) were added to the cells. After incubation at 37°C for 30
minutes the cells were washed twice with serum-free DMEM containing HEPES. The cells were resuspended in 10 mL complete DMEM and
split into two separate flasks, one for a control and the other for
treatment with IFN. Cells treated with IFN-g received 500 U/mL of IFN
20 hours after the transfection was initiated and assays were performed
after 48 hours. Assays for chloramphenicol acetyl transferase (CAT)
activity were as previously described.21 For luciferase assays the cells
were collected by centrifugation and rinsed twice in PBS. The cell
pellets were resuspended in 400 µL of 13 Lysis Reagent (Luciferase
Assay System; Promega Corp, Madison, WI) and the suspension was
incubated at room temperature for 15 minutes. The lysate was centriFig 3. Map of the distal regulatory region responsible for IFN inducibility of the Ly-6E promoter in B
cells. (A) Various constructs used to
characterize this region and their
response to IFN-g assayed by luciferase activity is shown as well as
the HaeIII 150-bp fragment showing maximum IFN inducibility. Computer analysis of this sequence identified potential sites for three DNA
binding proteins: a CAT box, NF-kB,
and a GMb site defined in the promoter of the GM-CSF gene. Constructs kB, kB*, 2kB, and GMb*
were designed to address their function. Astericks represent mutated
sites and 2kb construct lacks NF-kB
site. BG1 and BG2 sequences were
generated by PCR to further define
the functional sites. BG2 contains
additional 8 bp relative to BG1 and
an insertion of a nucleotide (C) 38 to
NlaIII site to generate SalI site. BG1
was fully inducible, whereas BG2
was completely devoid of inducibility. The increase in luciferase activity is shown on the right and is
representative of five experiments.
(B) At the bottom, the minimal sequence required for IFN-g inducibility is shown.
fuged for 1 minute in a microfuge to pellet cell debris. After
measurement of protein concentration by Bradford assay, appropriate
aliquots of the cell lysate were mixed with 100 µL of the luciferase
substrate at room temperature and activity measured in a luminometer.
DNA mobility shift assays (DMSA). DMSA were performed with
nuclear extracts prepared as described (Khodadoust and Bothwell,
submitted). Probes were prepared using synthetic oligonucleotides or
restriction fragments and end labeled with 32P using Klenow DNA
polymerase. Desired fragments were gel purified on an 8% nondenaturing polyacrylamide gel and eluted by soaking in Tris EDTA (TE) buffer.
Nuclear extract (protein concentration, ,2 µg/µL) was incubated with
the probe in the presence of 1 µg of nonspecific competitor poly
(dI.dC):poly(dI.dC) duplex in a 10-µL binding reaction. The binding
buffer was 20 mmol/L HEPES (pH 7.9), 4% ficoll, 1 mmol/L MgCl2, 40
mmol/L KCl, 0.1 mmol/L EGTA, and 0.5 mmol/L dithiothreitol (DTT).
Bound complexes were separated from free probe by electrophoresis
for 2 hours at 180 V on a 4% nondenaturing polyacrylamide gel in
0.253 Tris-borate EDTA (TBE) buffer and identified by autoradiography. The sequences of the duplex oligonucleotides used for competition
were as follows (consensus sequences are underlined): for the highaffinity sis-inducible factor binding element (SIE), 58 GTCGACATTTC
CCGTAAATC 38 26; for the ISRE element (O15), 58 GATCCTTCAGTTTCGGTTTCCCT 38 27; for the G element, 58 AAGCTTCTGCTC
AGAATTTATGCATATTCCTGTAAGTGAGATCT38 (Khodadoust and
Bothwell, submitted). Bacterially derived rhuHMG-I was a gift from Dr
Nancy Ruddle (Yale University). Binding assays involving rhuHMG-I
consisted of about 15 ng of purified protein, 0.5 µg of Poly (dG-dC), and 1.25
µg of acetylated bovine serum albumin. In some experiments nuclear extracts
were incubated with anti-STAT1 or anti-STAT3 sera for 120 minutes at 4°C
before addition to the binding reactions.
Antibodies. Anti-STAT1 and anti-STAT3 peptide polyclonal antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA).
Cytofluorometric analysis. Transfected cells were analyzed for
surface expression of Ly-6A by immunofluorescence using a FACSscan
(Becton Dickinson, Mountain View, CA). Monoclonal antibody (MoAb)
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2402
KHODADOUST ET AL
34-11-3 recognizes Ly-6A antigen and MoAb SK70.94 recognizes
Ly-6E antigen. Binding was detected with fluorescein isothiocyanate
(FITC)-conjugated rabbit anti-mouse secondary antibody.
Intact gene deletion constructs. The intact gene described in Khan
et al20 was the parent construct for six deletions made in the 58 flanking
region with enzymes that cleaved the construct only once. Thus a
double digest followed by religation was used to generate the following
constructs diagrammed in Fig 1: Ly-6A/E.3, KpnI 1 AvaI produces a
850-bp deletion; Ly-6A/E.2, SpeI 1 KpnI produces a 1,150-bp deletion;
Ly-6A/E.1, SpeI 1 AvaI produces a 2,000-bp deletion; Ly-6A/E.19,
SpeI 1 ApaI produces a 379-bp deletion; Ly-6A/E.18, ApaI 1 BstEII
produces a 387-bp deletion; and Ly-6A/E.20, BstEII 1 KpnI produces a
383-bp deletion.
Reporter constructs. Construction of Ly-6E-CAT plasmids, which
are derivatives of pUC-CAT and contain deletions of the Ly-6E
promoter, was described previously.20 The TKCAT construct was
obtained from B.M. Peterlin28 and the pTKLuxbu1 was obtained from J.
Hambor (unpublished) and incorporated in the study by Gao and
Kavathas.29 Both contain the basal thymidine kinase promoter linked to
the reporter gene. Tri-TKCAT was derived by subcloning a DNA
fragment containing the trimer sequence20 into the HindIII-XbaI sites of
the polylinker of TKCAT upstream of the TK promoter. Five constructs
were made by polymerase chain reaction (PCR) using the HaeIII (150)
pTKLuxbu1 as template. The PCR products were cloned directly
into HindIII-BglII of pTKLuxbu1. All five constructs had the same 58
primer and differed by the following 38 primers: 58 wildtype1Xho
CTCAAGCTTAGGTTTCTGTTTCCCCTCGAGAGAACTCT, 38 1 kB
TCTAGATCTTAGGGGGATTCCAAGTG, 38 2 kB TCTAGATCTAAGTGTATCAGGTAGTTG, 38 GMb* TCTAGATCTAGGGGGATTCCAAGTGTATGTCGACGGTTATCAGAC, 38 BG1 TCTAGATCTGACTGCCAGTCACATGAT, 38 BG2 TCTAGATCTGGTT
ATCAGACTGCCAGTCGACATGATTT. BglII, XhoI, and SalI sites are
underlined. BG1 results in a deletion of sequence relative to BG2. BG2
contains a SalI site as a consequence of a single insertion of C residue.
CAT assay. Cell extracts were made from untreated and IFN-treated
cells and assayed for CAT activity as described by Gorman et al30 with
some modifications.20 Cells were treated with 1,000 U/mL of IFN-a/b
or 500 U/mL of IFN-g. Acetyl coenzyme A was from Sigma Chemical
Co (St Louis, MO) and [14C] chloramphenicol (60 mCi/mmol) from
Dupont NEN Products (Boston, MA).
RESULTS
Identification and localization of regulatory elements necessary for the IFN response of the Ly-6E gene in the A20-2J B
cells. The A20-2J B cells express no detectable endogenous
Ly6-E antigen on the cell surface in the absence of IFN, but
treatment with IFN-a/b or IFN-g for a period of about 16 hours
leads to very high levels of expression as can be shown by
staining with a MoAb. The Ly6-A is the allelic counterpart of
Ly-6E and differs from it by a single amino acid which can be
distinguished by specific MoAbs. To take advantage of this, we
constructed chimeric constructs containing various deletions of
the Ly-6E promoter linked with exons 2-4 of the Ly-6A
genomic clone (Fig 1). This allowed us to distinguish the
expression of the transfected Ly-6E/A chimeric gene from the
endogenous Ly-6E gene product. Stable A20-2J transfectants of
these genomic clones were generated and response to IFN was
assayed by cell surface expression of Ly6-A antigen by specific
MoAb 34-11-3. Previous analysis of the Ly-6E promoter in
fibroblasts had identified the region between 21760 and 2900
(KpnI-AvaI) to be required for induction by both types of
IFNs.19,20 By contrast, deletion of this region (Ly-6A/E.3
construct) had no adverse effect on the inducibility of the
Table 2. Cell-Type Specific IFN-g Responses
Cells
Type
A20-2J
M12
EL4
BW5147
J774
BALB3T3
B
B
T
T
MF
Fibroblast
Fold Induction
5.2-15
4-10
1.3, 2.3, 5.8
1.8, 4.6, 6.8
1.0, 1.2, 2.0
1.2, 1.4, 0.8
Experiments
11
6
3
3
3
3
Transient transfections were performed with either the HaeIII (150)
or BG1 luciferase reporter construct. No significant differences were
noted when these constructs were used.
transfected gene by IFN-a/b or IFN-g in A20-2J cells (Fig 2,
Table 1). On the other hand, the Ly-6A/E.2 construct which
contains a deletion between 22900 to 21760 (SpeI-KpnI)
showed no response to either IFN.
Because the region between 22900 and 21760 contained the
necessary elements for IFN responsiveness in A20-2J cells, it
was dissected further by deletion analysis. The deletion construct (Ly-6A/E.19) which lacks the region between 22900 to
22519 (SpeI-ApaI) was IFN inducible, whereas both deletion
constructs Ly-6A/E.20 and Ly6A/E.18 were unable to respond
to either IFN treatment. These results localized the crucial
sequences for IFN-a/b– and IFN-g–mediated induction between 22519 and 21760. The next question was whether this
region alone was sufficient for IFN inducibility. Because most
of this region is contained within a PstI fragment (22400 to
21800), this fragment was subcloned into plasmids TK-CAT
and pCAT-5 which contain viral thymidine kinase promoter and
the minimal Ly-6E promoter (2900) linked to a CAT reporter
gene,20 respectively. This fragment conferred IFN-g inducibility
to the heterologous TK promoter, but no induction was observed with IFN-a/b.25 However, when the same PstI fragment
was linked to the homologous Ly-6E minimal promoter sequence, a response to IFN-a/b was readily observed.25 These
results suggested that all the sequences required for IFN-g
response are localized in the PstI fragment, whereas the
additional element(s) required for IFN-a/b response is present
in the basal promoter region downstream of 2900. These
regions were further analyzed separately.
Analysis of the distal regulatory region to define the minimal
sequence essential for IFN-g inducibility. To characterize the
sequences for IFN-g response contained within the PstI fragment, several smaller fragments from this region were subcloned upstream of the TK promoter linked to a luciferase
reporter gene (TK-Luxbu1). These constructs were then analyzed in transient transfections in A20-2J cells. Among the
various fragments examined, only an HaeIII 150-bp fragment
was capable of a strong response to IFN-g (Fig 3). Computer
analysis of this region identified an ISRE, NF-kB, NF-GMb,
and CAT box sites (Fig 3). Several constructs were generated to
determine functional significance of each of these elements in
IFN responsiveness. Initially, we hypothesized the involvement
of NF-kB site in combination with ISRE. To test this we used
PCR to generate three different NF-kB site constructs: kB
contains ISRE and NF-kB site, kB* contains mutated NF-kB
site, and -kB construct lacks NF-kB site. As shown in Fig 3, the
HaeIII (150 bp) fragment showed 11-fold induction in response
to IFN-g. To our surprise, all three kB constructs showed very
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
IFN REGULATION OF Ly-6E GENE IN B CELLS
2403
Fig 4. INF-a/b– and INF-g–inducible complexes
detected in DMSA using BG1 probe and nuclear
extracts from BALB/3T3 or A20-2J cells. Cells were
treated with IFN-a/b or IFN-g for 15 minutes where
indicated. The specificity of these complexes is shown
by competition with O15 or SIE oligonucleotides. **,
Inducible complex.
similar inducible activities, which suggests the lack of any
contribution from NF-kB site to IFN-g response. Similarly
disruption of the NF-GMb site by substitution with a SalI site
did not cause any impairment of the IFN response.
Because both the constructs PstI-NlaIII and NlaIII-PvuII (Fig
3) lacked IFN inducibility, the region around NlaIII site seemed
to be crucial. The constructs BG1, BG2, and BG3 (Fig 3) were
used to further define the necessary element around NlaIII site.
The BG1 construct had full IFN-g inducibility, whereas the
BG2 construct was completely devoid of IFN-g responsiveness.
This result is quite significant considering the only difference
between the two constructs is the insertion of a single C
(underlined below) immediately 38 to the NlaIII site to create a
SalI site. This result confirmed the necessity of this sequence
located around the NlaIII site. The BG3 construct was generated
via a HindIII-Xho1 deletion of BG1 to eliminate the ISRE
sequence. Loss of IFN-g response confirmed the functional
importance of this ISRE. In summary, this extensive deletion
analysis identified a minimal 56-bp regulatory region of the
Ly-6E promoter for IFN-g inducibility in A20 cells. The
sequence of this region is shown below:
ISRE
58-GGTTTCTGTTTCCCCACCAGAGAACTCT
N1a3
CTGCTTAAAAATCATGTGACTGGCAGTC-38
(GTCGAC)
SalI site in BG2
The involvement of the ISRE in IFN-g responsiveness is not
surprising, but the need for an additional novel element in
A20-2J B cells is quite interesting. The cell-type specificity of
this region for IFN-g responsiveness was assessed by transient
transfections in other cell lines and results are summarized in
Table 2. Consistent strong responses were observed in two
B-cell lines, A20-2J and M12. Weaker but significant activity
was observed in two T-cell lines, BW5147 and EL-4. No
inducible activity was observed in J774 macrophage cell line or
BALB/3T3 fibroblast cell line.
Detection of IFN-a /b– and IFN-g–inducible nuclear factors
with probes derived from the distal regulatory region. DNA
mobility shift analysis was performed using the BG1 probe and
nuclear extracts from untreated, IFN-a/b–treated and IFN-g–
treated BALB/3T3 cells. This analysis identified induced complexes from both IFN-a/b– and IFN-g–treated cells (Fig 4). A
similar complex was also observed in IFN-a/b–treated A20-2J
nuclear extracts. Pretreatment of A20-2J cell with IFN-g (24
hours) before stimulating with IFN-a/b for 15 minutes resulted
in tremendous enhancement of this inducible complex. The
binding specificity of this complex was shown by the complete
inhibition of this complex in the presence of a competitor
sequence derived from the ISRE of the ISG-15 gene designated
O15 in Fig 4. ISG-15 ISRE is the highest affinity site known for
ISGF3g (p48). A sequence corresponding to the c-fos SIE did
not inhibit this complex. The electrophoretic mobility of the
induced complex detected by BG1 probe is identical to the
ISGF-3 complex that binds to the O15 probe (Fig 5). Crosscompetition with BG1 sequence inhibited the formation of
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2404
KHODADOUST ET AL
Fig 5. IFN-inducible DNA
binding complex detected by
BG1 probe of Ly-6E is identical to
the inducible complex detected
by O15 probe derived from
ISG-15 gene. Identity and specificity of the binding complex is
shown by the ability of these
sequences to cross-compete
with each other when present in
a 100-fold molar excess (lanes 6
and 9). Effect of anti-STAT1 and
anti-STAT3 antibodies on the formation of these complexes by
BG1 probe is also shown (lanes
10 and 11).
ISGF-3 complex by O15 probe. Furthermore, formation of the
complex by Ly-6E BG1 probe was specifically inhibited by
anti-STAT1 antibody (Fig 5). No inhibition was observed with
anti-STAT3 antibody (Fig 5) or anti-STAT2 antibody (data not
shown). No complexes having the expected mobility of IRF-1
or IRF-2 were observed and no supershifts were observed with
anti–IRF-1 or anti–IRF-2 antibodies (data not shown).
The constitutive DNA protein interactions observed with
BG1 probe are lost as a consequence of the BG2 mutation, but
inducible ISRE binding proteins are still detected with BG2
probe (Fig 6). Because the BG2 mutation lacks functional
responsiveness, the constitutive proteins that bind to this region
might play a role in IFN inducibility.
Binding of HMGI(Y) protein to the distal regulatory region.
Our analysis of the Ly-6E gene in T cells led to the identification
of a distinct regulatory region (designated G region) which
contains a binding site for high-mobility group protein HMGI(Y)
as well as a GAS and octamer sites (Khodadoust and Bothwell,
submitted). To investigate its role in B cells, conditions
favorable for detection of HMGI(Y)-like protein binding were
used in DNA mobility shift assays. A fast migrating complex
charasteristic of HMGI(Y) was detected with BG1 probe from
nuclear extracts of A20-2J cells (Fig 7). This complex can be
specifically competed by oligonucleotides corresponding to the
HMGI(Y) binding site from the G region active in T cells.
Presence of HMGI(Y) binding site in the BG1 probe was further
confirmed by the specific binding of a recombinant human
HMGI(Y) protein in DMSA. Recombinant protein was used to
further localize the binding site by two different probes derived from
this region. HindIII-SalI probe was bound whereas HindIII-XhoI
probe which contains ISRE failed to bind rhuHMGI(Y) protein (Fig
7). Hence, HMGI(Y) binding sequence exists in a 23-bp fragment
immediately 38 to the ISRE between XhoI and SalI sites. The
above-mentioned G region DNA sequence competed with this
interaction as well in a dose-dependent manner.
Identification of an additional IFN-a/b–responsive element
within the Ly-6E minimal promoter. Comparison of the results
of constructs containing distal regulatory region (PstI fragment)
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
IFN REGULATION OF Ly-6E GENE IN B CELLS
2405
Fig 6. Lack of effect of BG2 mutation on the
binding of IFN-inducible complex in DMSA. The
constitutive proteins, detected by BG1 probe, do not
bind the mutated BG2 probe.
linked to homologous minimal Ly-6E promoter with that of
heterologous TK promoter suggested an additional element for
IFN-a/b responsiveness in the minimal promoter downstream
of 2900. Chimeric constructs containing successive deletions
of the Ly-6E promoter linked to CAT gene were used to derive
stable transfectants of A20-2J cells. Individual clones were used
for basal and IFN-inducible expression. Figure 8 and Table 3
show comparison of CAT activities from extracts of untreated,
IFN-a/b– and IFN-g– treated cells. All the chimeric constructs
with deletions from 2900 to 2113 were inducible by IFN-a/b
but not by IFN-g.
There is an element (TGGAAAAGGTTAAG) with homology to the ISRE located between 2109 and 295 of the Ly-6E
promoter. To determine whether this element was responsible
for the observed IFN-a/b–mediated induction, a recombinant
construct containing three tandem repeats of the sequence
between 2113 and 288 fused to the same TK promoter
(TK-CAT) was generated. Plasmids TK-CAT and Tri-TK-CAT
were used in stable transfections. Although there was some
clonal variation in the transfectants derived from TK-CAT, none
of the clones showed any significant induction by either
IFN-a/b or IFN-g treatment. All the clones transfected with
Tri-TK-CAT showed marked inducibility after treatment with
IFN-a/b only; none of them responded to IFN-g (Fig 9 and
Table 3). In summary, this analysis identified a functional
element for IFN-a/b response in A20-2J cells located between
2113 and 288 of the Ly-6E promoter. Similar results were
obtained in M12 B-cell line as well (data not shown). However,
none of the deletion constructs containing sequences from
2900 to 2113 of the Ly-6E promoter or the Tri-TK-CAT
showed any responsiveness to IFN-a/b in BALB/3T3 fibroblast
or BW5147 T-cell lines in transient or stable transfections (data
not shown).
Transfection of A20-2J cells with antisense HMGI-C construct prevents IFN-a/b inducibility of the endogenous Ly-6E
gene. HMGI(Y) protein is essential for the transcriptional
activity and IFN inducibility of the Ly-6E gene in T cells
(Khodadoust and Bothwell, submitted). We suspected a functional role for the HMGI(Y) protein in B cells as well because of
its binding site in the distal regulatory region necessary for IFN
inducibility. The synthesis of HMGI(Y) proteins can be successfully blocked by using an antisense cDNA construct.31 This
construct was used to derive stable transfectants of A20-2J B
cells and cell surface expression of endogenous Ly-6E antigen
was analyzed by fluorescence-activated cell sorting (FACS)
(Fig 9). In 5 out of 11 clones IFN-g inducibility of the Ly-6E
gene was normal but IFN-a/b inducibility was completely
abolished (Table 3).
Because IFN-g was able to induce endogenous Ly-6E genes
in five clones, it is very unlikely that these results are due to
some nonspecific effects of antisense RNA on some other aspect
of Ly-6 gene expression. The specific loss of IFN-a/b inducibil-
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2406
KHODADOUST ET AL
DISCUSSION
Fig 7. Localization of HMG-I binding region. (A) Detection of an
HMGI(Y)-like protein by BG1 probe from nuclear extracts of A20-2J
cells. Competition with increasing amounts (30- and 100-fold molar
excess) of unlabeled G region oligonucleotide shows specificity of the
retarded band. (B) Recombinant human HMGI(Y) protein binds only
to the HindIII-SalI probe (sequence shown in Fig 3) derived from the
regulatory region. HindIII-XhoI probe containing ISRE was unable to
bind rhHMGI(Y) protein. Competition with unlabeled G region oligonucleotide inhibited the complex in a dose-dependent fashion.
ity is quite interesting because only this response requires two
distinct elements located more than 2 kb apart in the Ly-6E
promoter. Assembly of a multiprotein complex between proteins binding to these elements mediated by the binding of
HMGI(Y) protein is suggested.
Ly-6 genes are regulated in a complex fashion, as shown by
the diversity of both the tissues and the various developmental
stages in which these antigens are expressed. This complexity is
further highlighted by the recent discovery of human homologues of some of these antigens. The human E48 antigen
homologue of mouse ThB antigen is involved in keratinocyte
cell-cell adhesion and is expressed at high levels in squamous
cell carcinomas.12 The other homologous gene 9804 is not only
inducible by IFNs, but interestingly, is expressed in acute
promyelocytic leukemia cells after they are induced to differentiate by retinoic acid.15 These characteristics of the Ly-6 gene
expression make them an interesting model for studying gene
regulation.
We previously characterized a GAS-containing region of the
Ly-6E promoter located at 21.2 kb responsible for induction by
both IFN-a/b and IFN-g in murine fibroblasts.20,21 To our
surprise, this region of the Ly-6E promoter was dispensable for
IFN-mediated induction in A20-2J B lymphocytes as shown by
genomic deletions.25 In this study we have identified two novel
overlapping regulatory mechanisms in the A20-2J B cells used
by the Ly-6E gene for IFN-a/b and IFN-g inducibility. A distal
regulatory region located at 22.3 kb is important for response
to both types of IFNs and contains two functional elements: an
ISRE that plays a role in inducibility by either IFN, and a novel
element that is necessary only for IFN-g–mediated induction.
Further analysis of the promoter identified a third element with
homology to ISRE in the proximal minimal promoter for
IFN-a/b responsiveness in B cells. An interaction between the
proteins binding to these physically disparate elements was
suggested by the presence of a binding site for high-mobility
group HMGI(Y) protein in the distal regulatory region. The
functional significance of this protein for the IFN-a/b inducibility of Ly-6E gene in A20-2J cells was investigated by antisense
RNA–mediated inhibition of HMGI(Y) expression. Interestingly, the induction of endogenous of Ly-6E gene by IFN-a/b
was completely abrogated, whereas the response to IFN-g was
preserved as analyzed by FACS staining of surface expression
of the protein on stable transfectants.
IFN-g inducibility. Genomic deletion analysis in the A20-2J
cell line has shown that a region spanning from 22519 to
21760 of the Ly-6E promoter is necessary for both IFN-a/b
and IFN-g inducibility. By reporter gene analysis a minimal
region of 56 bp essential for IFN-g inducibility was localized at
position 22300. This region contains two functional elements,
an ISRE at its 58 end and a novel element at its 38 end. The
sequence of this ISRE GGTTTCTGTTTTC is very similar to
the consensus sequence YAGTTTCNNTTTYY.32,33 This region
detected IFN-a/b– and IFN-g–inducible complexes from nuclear
extracts. These complexes can be competed by a typical ISRE
site derived from ISG-15 gene. The presence of STAT-1 in this
complex is shown by the ability of anti-STAT1 antibody to
disrupt this complex. However, the sequence derived from a
conventional STAT1 binding site was not able to compete,
illustrating the lack of direct DNA binding of STAT1 in this
region. Presence of STAT1 has been reported previously in a
number of complexes (eg, GAF, IRBFa, IRBFg, and FCRFg)
involved in IFN-g responsiveness.34
As expected, deletion of the ISRE resulted in the loss of
IFN-g inducibility of the reporter gene and abolished the
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
IFN REGULATION OF Ly-6E GENE IN B CELLS
2407
Fig 8. Localization of an IFNa/b–responsive element within
the Ly-6E minimal promoter.
Comparison of CAT activities
from representative stable clones
derived from transfection of
A20-2J cells with constructs containing fragments of Ly-6E promoter linked to CAT reporter
gene. Plasmids pCAT-4 and
pCAT-2 contain sequences up to
2420 and 2167, respectively.
Plasmids pCAT-8 and pCAT-1 contain sequences up to 2113 and
281, respectively. Tri-TK-CAT has
a triple repeat of the sequence
between 2113 and 288.
binding of IFN-g–inducible complex as well. Our functional
data is consistent with previous reports showing that IFN-g
inducibility of MHC class I, 9-27, and guanylate-binding
protein (GBP) genes require an ISRE element. However, for
these genes IFN-g inducibility was attributed to the binding of
IRF-1 and no IFN-g–inducible complexes have been reported
for these genes.7,35-37 The consensus core recognition sequence,
considered necessary for the binding of IRF-1 and IRF-2, is not
present in the Ly-6E ISRE element. In addition, no complexes
having the expected mobilities of IRF-1 or IRF-2 were detected
with probes from this region in DMSA and antibodies against
IRF-1 and IRF-2 failed to cause any supershifts (data not
shown). The most likely explanation for these data is that the
Ly-6E ISRE is detecting an IFN-g–inducible complex consisting of STAT1 homodimers and DNA-binding subunit p48 as
described.9 This conclusion is supported by the ability of Ly-6
BG1 oligonucleotide to inhibit the binding of ISGF-3 complex
to the ISG-15 ISRE–containing probe.
The role of an additional novel element present at the 38 end
of this distal regulatory region for IFN-g response in B cells
remains unclear, but its functional importance cannot be
ignored because insertion of a single nucleotide in this element
Table 3. Analysis of Stable A20-2J Transfectants
CAT Expression
Construct
pCAT-5 (2900)
pCAT-4 (2420)
pCAT-2 (2167)
pCAT-3 (2138)
pCAT-8 (2113)
pCAT-1 (281)
TK-CAT
Tri-TK-CAT
Neo R
Basal
IFN-a/b
IFN-g
11
5
4
4
5
3
9
6
9
4
4
4
4
3
7
6
9
4
4
4
4
0
0
6
0
0
0
0
0
0
0
0
0
5
Ly-6E expression
HMGI-C antisense
11
0
Quantitative stimulation of CAT activity was performed by densitometric scanning of autoradiographs and only those clones which
showed at least threefold induction were considered inducible. Estimation of Ly-6E expression was performed by FACS analysis.
Abbreviations: NeoR, total number of clones analyzed; basal, the
number of clones that expressed basal CAT activity; IFN-g, the number
of clones showing IFN-g–inducible CAT activity; IFN-a/b, the number
of clones showing IFN-a/b–inducible CAT activity.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2408
KHODADOUST ET AL
Fig 9. Effect of antisense HMGI-C on IFN inducibility of endogenous Ly-6E gene in A20-2J cells. Wildtype cells and clones stably transfected with antisense plasmid DNA were analyzed by cell surface
staining with Sca-1 antibody. Plain lines indicate
control cells stained with secondary antibody (FITCconjugated rabbit anti-rat Ig) only; bold lines indicate
cells stained with Sca-1 before secondary antibody.
completely abolished IFN-g inducibility. This element failed to
detect any IFN-inducible complex, but it is the site for the
binding of specific constitutive proteins in DMSA. Further
characterization of this element might provide insights in
cell-type specificity observed in the IFN-g response of Ly-6E
gene.
IFN-a /b inducibility. The above-mentioned ISRE located
in the distal regulatory region of the Ly-6E promoter was found
to be required for IFN-a/b inducibility as well. An IFN-a/b–
induced protein complex bound this region and could be
competed with a sequence derived from the ISRE of ISG-15
gene. Furthermore, anti-STAT1 antibody was able to disrupt
this complex. Quite unexpectedly, this distal region was unable
to confer IFN-a/b inducibility to a heterologous TK promoter.
However, linking this fragment with minimal proximal Ly-6E
promoter restored responsiveness to IFN-a/b. This result suggested a necessary cooperative interaction between the distal
ISRE and an additional element within the minimal promoter of
the Ly-6E gene. This second element was identified by stable
transfections of A20-2J cells with recombinant plasmids containing progressive 58 deletions of the Ly-6E promoter linked to a
reporter CAT gene.
All the constructs with sequences from 2900 to 2113 bp
were inducible with IFN-a/b. Sequence comparison showed a
stretch of homology to the ISRE at 2109 to 295 bp. To address
the functional significance of this element, a triple repeat of the
sequence between 2113 and 288 was linked to the same TK
promoter. This trimerized element conferred strong IFN-a/b
inducibility to TK promoter in B cells only. The deletion
constructs containing the sequences downstream of 2900,
which include this ISRE-like region or the Tri-TK-CAT plasmid, were not inducible by IFN-a/b in the two fibroblast cell
lines BALB/3T3 and Ltk220 and the BW5147 T-cell line.
This extensive analysis of the Ly-6E promoter identified two
elements, one distal and one proximal, essential for IFN-a/b
inducibility in B cells. The distal element is present in the
context of a broad regulatory region. This regulatory region is
comprised of at least three distinct functional elements: an ISRE
at its 58 end required for response to both types of IFNs, a novel
element at its 38 end necessary only for IFN-g inducibility, and a
site for HMGI(Y) binding in the middle. Because the two
elements required for IFN-a/b inducibility are physically
located more than 2 kb from each other in the Ly-6E promoter, a
cooperative interaction between the proteins binding to these
elements might be mediated by protein-protein interactions.
The presence of an HMGI(Y) binding site in the distal
regulatory region was curious because it had been shown to
mediate such interactions by bending DNA to bring physically
disparate regions in close proximity.38 Moreover, our analysis of
the Ly-6E gene in T cells also defined the need for the binding of
HMGI(Y) protein for the assembly of an enhanceosome-like
complex required for IFN-inducible expression (Khodadoust
and Bothwell, submitted). To test its function in B cells,
inhibition of expression of HMGI(Y) protein was achieved by
antisense HMGI-C RNA in A20-2J cells as described.31 Surprisingly, this led to the specific loss of IFN-a/b–mediated induction of the endogenous Ly-6E gene while leaving IFN-g
responsiveness intact. The preservation of IFN-g responsiveness in the same stable clones argues strongly against any
nonspecific effects of antisense RNA on some other aspect of
Ly-6 gene expression. This result provides support for the
hypothesis that assembly of a multiprotein complex mediated
by HMGI(Y)-like protein is required for IFN-a/b inducibility
of Ly-6E gene in B lymphocytes. These data highlight the
complex fashion in which multiple constitutive and inducible
proteins binding to different regulatory elements interact with
each other to achieve cell-type specific IFN-regulated transcription of a single gene.
ACKNOWLEDGMENT
We thank Ray Reeves for the recombinant HMGI protein and Alfredo
Fusco for the antisense HMGI-C plasmid.
REFERENCES
1. Lengyel P: Biochemistry of interferons and their actions. Annu
Rev Biochem 51:251, 1982
2. Darnell JE Jr, Kerr IM, Stark GR: Jak-STAT pathways and
transcriptional activation in response to IFNs and other extracellular
signaling proteins. Science 264:1415, 1994
3. Valazquez L, Fellous M, Stark GR, Pellegrini S: A protein tyrosine
kinase in interferon alpha/beta signaling pathway. Cell 70:313, 1992
4. Fu XY, Kessler DS, Veals SA, Levy DE, Darnell JE Jr: ISGF3, the
transcriptional activator induced by interferon a consists of multiple
interacting polypeptide chains. Proc Natl Acad Sci USA 87:8555, 1990
5. Decker T, Lew DJ, Mirkovitch J, Darnell JE Jr: Cytoplasmic
activation of GAF, an IFN-g regulated DNA-binding factor. EMBO J
10:927, 1991
6. Shuai K, Horvath CM, Tsai Huang LH, Qureshi SA, Cowburn D,
Darnell JE: Interferon activation of the transcriptional factor Stat91
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
IFN REGULATION OF Ly-6E GENE IN B CELLS
involves dimerization through SH2-phosphotyrosyl peptide interactions. Cell 76:821, 1994
7. Israel A, Kimura A, Fournier A, Fellous M, Kourilsky P:
Interferon response sequence potentiates activity of an enhancer in the
promoter region of a mouse H-2 gene. Nature 322:743, 1986
8. Damore M, Omori SA, Wall R: IFN-g induces the k intron
enhancer via an IFN-stimulated response element. J Immunol 156:2451,
1996
9. Bluyssen HAR, Muzaffar R, Vlieststra R, Van Der Made AC,
Leung S, Stark GR, Kerr IM, Trapman J, Levy DE: Combination
association and abundance of components of interferon-stimulated gene
factor 3 dictate the selectivity of interferon responses. Proc Natl Acad
Sci USA 92:5645, 1995
10. Su B, Bothwell ALM: Biosynthesis of a phosphatidylinositolglycan linked membrane protein: Signals for posttranslational processing of the Ly-6E antigen. Mol Cell Biol 9:3369, 1989
11. Spangrude GJ, Brooks DM: Mouse strain variability in the
expression of the hematopoietic stem cell antigen Ly-6A/E by bone
marrow cells. Blood 82:3327, 1993
12. Brakenhoff RH, Gerretsen M, Knippels EMC, van Dijk M, H.
vE, Weghuis DO, Sinke RJ, Snow GB, van Dongen GAMS: The human
E48 antigen, highly homologous to the murine Ly-6 antigen ThB, is a
GPI-anchored molecule apparently involved in keratinocyte cell-cell
adhesion. J Cell Biol 129:1677, 1995
13. Shan X, Bourdeau A, Rhoton A, Wells DE, Cohen EH, Landgraf
BE, Palfree RGE: Characterization and mapping to human chromosome
8q24.3 of Ly-6-related gene 9804 encoding an apparent homologue of
mouse TSA-1. J Immunol 160:197, 1998
14. LeClair KP, Rabin M, Nesbitt M, Pratcheva D, Ruddle FH,
Palfree RGE, Bothwell ALM: Murine Ly-6 multigene family is located
on chromosome 15. Proc Natl Acad Sci USA 84:1638, 1987
15. Mao M, Yu M, Tong J, Ye J, Zhu J, Huang Q, Fu G, Yu L, Zhao S,
Waxman S, Lanotte M, Wang Z, Tan J, Chan S, Chen Z: RIG-E, a
human homolog of the murine Ly-6 family, is induced by retinoic acid
during the differentiation of acute promyelocytic leukemia cell. Proc
Natl Acad Sci USA 93:5910, 1996
16. Stefanova I, Horejsi V, Ansotegui IJ, Knapp W, Stockinger H:
GPI-anchored cell-surface molecules complexed to protein tyrosine
kinases. Science 254:1016, 1991
17. Lee S-K, Su B, Maher SE, Bothwell ALM: Ly-6A is required for
antigen-specific T cell responses and expression of T cell receptors.
EMBO J 13:2167, 1994
18. Codias EK, Malek TR: Regulation of B lymphocyte responses to
IL-4 and IFN-g by activation through Ly-6A/E molecules. J Immunol
144:2197, 1990
19. Snapper CM, Yamaguchi H, Urban JF Jr, Finkelman FD:
Induction of Ly-6A/E expression by murine lymphocytes after in vivo
immunization is strictly dependent upon the action of IFN-a/b and/or
IFN-g. Int Immunol 3:845, 1991
20. Khan KD, Lindwall G, Maher SE, Bothwell ALM: Characterization of promoter elements of an interferon-inducible Ly-6E/A differentiation antigen, which is expressed on activated T cells and hematopoietic stem cells. Mol Cell Biol 10:5150, 1990
21. Khan KD, Shuai K, Lindwall G, Maher SE, Darnell JE Jr,
Bothwell ALM: Induction of the Ly-6A/E gene by both interferon a/b
and g requires a single DNA element to which a tyrosine phosphorylated 91 kDa protein binds. Proc Natl Acad Sci USA 90:6806, 1993
2409
22. Basta PV, Sherman PA, Ting JP: Detailed delineation of an
interferon-g-responsive element in human HLA-DRA gene expression
in a glioblastoma multiform line. Proc Natl Acad Sci USA 85:8618,
1988
23. Blanar MA, Boettger EC, Flavell RA: Transcriptional activation
of HLA-DRa by interferon g requires a trans-acting protein. Proc Natl
Acad Sci USA 85:4672, 1988
24. Wedrychowski A, Seong D, Paslidis N, Johnson E, Howard
OMZ, Sims S, Talpaz M, Kantarjian H, Hester J, Turpin J, LopezBerestein G, Gutterman J, Freirich EJ, Deisseroth A: Characterization
of nuclear proteins which bind to interferon-inducible transcriptional
enhancers in hematopoietic cells. J Biol Chem 265:21433, 1990
25. Khan KD: Distinct regulatory elements for the tissue specific
interferon-inducible expression of the Ly-6A/E gene. PhD dissertation,
Yale University, New Haven, CT, 1992
26. Wagner BJ, Hayes TE, Hoban CJ, Cochran BH: The SIF binding
element confers sis/PDGF inducibility onto the c-fos promoter. EMBO
J 9:4477, 1990
27. Levy DE, Kessler DS, Pine R, Darnell JE Jr: Cytoplasmic
activation of ISGF-3, the positive regulator of interferon-a-stimulated
transcription, reconstituted in vitro. Genes Dev 3:1362, 1989
28. Tsang SY, Nakanishi M, Peterlin BM: B-cell-specific and
interferon-g-inducible regulation of the HLA-DRa gene. Proc Natl
Acad Sci USA 85:8598, 1988
29. Gao M-H, Kavathas PB: Functional importance of the cyclic
AMP response element-like decamer motif in the CD8a promoter. J
Immunol 150:4376, 1993
30. Gorman CM, Moffat LF, Howard BH: Recombinant genomes
which express chloramphenicol acetyltransferase in mammalian cells.
Mol Cell Biol 2:1044, 1982
31. Berlingieri MT, Manfioletti G, Santoro M, Bandiera A, Visconti
R, Giancotti V, Fusco A: Inhibition of HMGI-C protein synthesis
suppresses retrovirally induced neoplastic transformation of rat thyroid
cells. Mol Cell Biol 15:1545, 1995
32. Kessler DE, Levy DE, Darnell JE Jr: Two interferon-induced
nuclear factors bind a single promoter element in interferon-stimulated
genes. Proc Natl Acad Sci USA 85:8521, 1988
33. Cohen B, Vaiman D, Chebath J: Enhancer functions and in vitro
protein binding of native and mutated interferon responsive sequences.
Nucleic Acids Res 4:1679, 1989
34. Haque SJ, Williams RG: Identification and characterization of an
interferon (IFN)-stimulated response element-IFN-stimulated gene factor 3-independent signalling pathway for IFN-a. J Biol Chem 269:
19523, 1994
35. Au WC, Raj NBK, Pine R, Pitha PM: Distinct activation of
murine interferon-a promoter region by IRF-1/ISGF-2 and virus
infection. Nucleic Acids Res 11:2877, 1992
36. Harada H, Takahashi E-I, Itoh S, Harada K, Hori T-A, Taniguchi
T: Structure and regulation of the human interferon regulatory factor
(IRF-1) and IRF-2 genes: Implications for a gene network in the
interferon system. Mol Cell Biol 14:1500, 1994
37. Reis LF, Harada HL, Wolchok JD, Taniguchi T, Vilcek J: Critical
role of a common transcription factor, IRF-1, in the regulation of IFN-b
and IFN-inducible genes. EMBO J 11:185, 1992
38. Falvo JV, Thanos D, Maniatis T: Reversal of intrinsic DNA
bends in the IFN-b gene enhancer by transcription factors and the
architectural protein HMGI(Y). Cell 83:1100, 1995
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1998 92: 2399-2409
Distinct Regulatory Mechanisms for Interferon-α/β (IFN-α/β)− and IFN-γ−
Mediated Induction of Ly-6E Gene in B Cells
Mehran M. Khodadoust, Khuda Dad Khan, Eun-ha Park and Alfred L.M. Bothwell
Updated information and services can be found at:
http://www.bloodjournal.org/content/92/7/2399.full.html
Articles on similar topics can be found in the following Blood collections
Immunobiology (5489 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.