Am J Physiol Cell Physiol 287: C357–C364, 2004.
First published March 24, 2004; 10.1152/ajpcell.00068.2004.
TRPC4 forms store-operated Ca2⫹ channels in mouse mesangial cells
Xiaoxia Wang, Jennifer L. Pluznick, Peilin Wei, Babu J. Padanilam, and Steven C. Sansom
Department of Physiology and Biophysics, University of Nebraska Medical Center, Omaha, Nebraska 68198-5850
Submitted 4 February 2004; accepted in final form 18 March 2004
(14, 15) confirmed those initial studies and showed that cultured human mesangial cells possess SOC with high Ca2⫹/Na⫹
selectivity and single-channel conductance of 2 pS with Ba2⫹
as the charge carrier.
Several studies support the notion that the canonical subfamily of the transient receptor potential (TRPC) family of
proteins contains members that form Ca2⫹-selective and -nonselective cation channels in a variety of mammalian cells (23,
28, 29, 31, 47, 49). The purpose of this study was to identify
which among TRPC1–TRPC7 contribute to SOC in mouse
mesangial cells (MMC). Whereas mRNA and protein level
expression are evident for both TRPC1 and TRPC4 in cultured
MMC, immunostaining experiments showed that TRPC4 is the
only member localized in the plasma membrane and that it is
abundantly expressed in the glomeruli of mouse renal tissue
sections.
Several splice variants of TRPC4 have been revealed by
RT-PCR in a variety of species (19, 33, 35). However, the most
abundantly described transcripts have been designated
TRPC4-␣ and TRPC4-␤, which have an 84-amino acid deletion in the cytosolic COOH terminus (19). It was previously
determined that TRPC4-␣ transcripts are expressed in rat
kidney (33) and that both TRPC4-␣ and TRPC4-␤ are expressed in the human kidney (19). We therefore performed
RT-PCR to distinguish transcripts of TRPC4-␣ and TRPC4-␤
in MMC. Functional studies with the use of fura 2 ratiometry
and antisense were used to determine the role of TRPC4-␣ as
a SOC in MMC.
canonical transient receptor potential; TRPC4-␣; TRPC4-␤; TRPC1;
fura 2; glomerulus
MATERIALS AND METHODS
depletion of intracellular stores of Ca2⫹ causes a flux of Ca2⫹ into the cell until
the sarcoendoplasmic reticulum refills to its original Ca2⫹
concentration. This process of refilling Ca2⫹ stores has been
studied extensively in nonexcitable cells, in which it is often
the predominant mode of Ca2⫹ cell entry. The inward Ca2⫹
flux resulting from inositol 1,4,5-trisphosphate (IP3)-mediated
depletion of Ca2⫹ stores is designated Ca2⫹ release-activated
Ca2⫹ current (ICRAC) or store-operated Ca2⫹ (SOC) channel
(8, 25).
Glomerular mesangial cells, which are smooth muscle-like
cells involved in regulating the filtration surface area, contract
in response to vasoactive agonists such as angiotensin II, which
induces a G protein-coupled and IP3-mediated release of stored
Ca2⫹ (26). The first evidence for SOC in (rat) mesangial cells
was provided by Menè et al. (18), who used fura 2 fluorescence
techniques. More recently, with the use of patch-clamp techniques and fura 2 ratiometry, investigators at our laboratory
Cell culture procedures. The MMC cell line, which we purchased
from American Type Culture Collection (Manassas, VA), was cultured in Dulbecco’s modified Eagle’s medium (DMEM; Sigma, St.
Louis, MO) supplemented with 10 mM N-2-hydroxyethylpiperazineN⬘-2-ethanesulfonic acid (HEPES), 2.0 mM glutamine, 0.66 U/ml
insulin, 1.0 mM sodium pyruvate, 0.1 mM nonessential amino acids,
100 U/ml penicillin, 100 ␮g/ml streptomycin, and 5% fetal bovine
serum (pH 7.2–7.4) as described previously by our laboratory (36) and
by others (21).
RT-PCR. Total RNA was isolated from MMC, and primers were used
to determine the presence of TPRC1–TRPC7 by RT-PCR as previously
described (40, 46). In brief, 1 ␮g of total RNA, first isolated from MMC
with Trizol reagent (GIBCO-BRL, Grand Island, NY), was reverse
transcribed with the use of reverse transcriptase (Promega, Madison, WI).
The primer sequences for TRPC1–TRPC7 were published previously
(46). The primers used for glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) were forward 5⬘-CCCTTCATTGACCTCAACTACATGG3⬘ and reverse 5⬘-GAGGGGCCATCCACAGTCTTCTG-3⬘. The annealing temperatures were as follows: TRPC1, TRPC4, and TRPC5, 60°C for
1 min; TRPC2 and TRPC3, 54°C for 1 min; and TRPC6 and TRPC7,
58°C for 1 min. For all experiments, the denaturing temperature was
Address for reprint requests and other correspondence: S. C. Sansom, Univ.
of Nebraska Medical Center, 985850 Nebraska Medical Center, Omaha, NE
68198-5850 (E-mail: [email protected]).
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
IN BOTH EXCITABLE AND NONEXCITABLE CELLS,
http://www.ajpcell.org
0363-6143/04 $5.00 Copyright © 2004 the American Physiological Society
C357
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.1 on June 18, 2017
Wang, Xiaoxia, Jennifer L. Pluznick, Peilin Wei, Babu J.
Padanilam, and Steven C. Sansom. TRPC4 forms store-operated
Ca2⫹ channels in mouse mesangial cells. Am J Physiol Cell Physiol
287: C357–C364, 2004. First published March 24, 2004; 10.1152/
ajpcell.00068.2004.—Studies were performed to identify the molecular component responsible for store-operated Ca2⫹ entry in murine
mesangial cells (MMC). Because the canonical transient receptor
potential (TRPC) family of proteins was previously shown to comprise Ca2⫹-selective and -nonselective cation channels in a variety of
cells, we screened TRPC1–TRPC7 with the use of molecular methods
and the fura 2 method to determine their participation as components
of the mesangial store-operated Ca2⫹ (SOC) channel. Using TRPCspecific primers and RT-PCR, we found that cultured MMC contained
mRNA for TRPC1 and TRPC4 but not for TRPC2, TRPC3, TRPC5,
TRPC6, and TRPC7. Immunocytochemical staining of MMC revealed predominantly cytoplasmic expression of TRPC1 and plasmalemmal expression of TRPC4. The role of TRPC4 in SOC was
determined with TRPC4 antisense and fura 2 ratiometric measurements of intracellular Ca2⫹ concentration ([Ca2⫹]i). SOC was measured as the increase in [Ca2⫹]i after extracellular Ca2⫹ was increased
from ⬍10 nM to 1 mM in the continued presence of thapsigargin. We
found that TRPC4 antisense, which reduced plasmalemmal expression
of TRPC4, inhibited SOC by 83%. Incubation with scrambled TRPC4
oligonucleotides did not affect SOC. Immunohistochemical staining
identified expressed TRPC4 in the glomeruli of mouse renal sections.
The results of RT-PCR performed to distinguish between TRPC4-␣
and TRPC4-␤ were consistent with expression of both isoforms in
brain but with only TRPC4-␣ expression in MMC. These studies
show that TRPC4-␣ may form the homotetrameric SOC in mouse
mesangial cells.
C358
TRPC4 CHANNELS IN MESANGIAL CELLS
AJP-Cell Physiol • VOL
60 min (23°C) in physiological salt solution (135 mM NaCl, 5 mM
KCl, 2 mM MgCl2, 1 mM CaCl2 , and 10 mM HEPES) containing 7
␮M fura 2-acetoxymethyl ester, 0.09 g/dl DMSO, and 0.018 g/dl
Pluronic F-127 (Molecular Probes). For all experiments, the initial
bathing solution contained (in mM) 135 NaCl, 5 KCl, 10 HEPES, and
1 CaCl2. Free [Ca2⫹] was reduced to ⬍10 nM by the addition of
EGTA.
SOC activity was measured as previously described by investigators at our laboratory (15) and by others (1). In brief, after stable
baseline [Ca2⫹]i was obtained, 1 ␮M thapsigargin was applied to the
bathing solution containing 1 mM Ca2⫹. After an initial rapid rise and
a subsequent plateau phase, the bath [Ca2⫹] was reduced to ⬍10 nM
by the addition of EGTA. When [Ca2⫹]i declined to the lowest level,
1 mM Ca2⫹ was returned to the bath. Once added, thapsigargin was
present throughout the experiment. The difference in [Ca2⫹]i
(⌬[Ca2⫹]i) in response to the return of 1 mM Ca2⫹ to the external
solution was used as the measurement of SOC.
TRPC4 antisense. To determine the function of TRPC4 in MMC,
the cells were pretreated for 48 h with TRPC4 antisense or scrambled
oligonucleotides (4 nM). The antisense and scrambled sequences were
TTTGTAATAGAACTGAGCCAT and CATTAGGATGCGTAACTTATA, respectively (corresponding to GenBank accession no.
NM_016984). ⌬[Ca2⫹]i values were determined by following the
same procedures as described above. The differences in ⌬[Ca2⫹]i
among the three groups (control, antisense, and scrambled) were
compared by performing ANOVA plus the Student-Newman-Keuls
test. Significance was established as P ⬍ 0.05.
Immunohistochemistry. For histological analyses, kidneys were
removed from 8-wk-old mice (C57BL/6). Coronal cross sections
containing the hilus were removed from kidneys, fixed in neutral
buffered formalin, embedded in paraffin, and mounted on glass slides.
For immunohistochemical analysis, 5-␮m sections of paraffin-embedded tissue were deparaffinized in two changes of xylene for 10 min
each. The sections were rehydrated in a series of graded alcohol
solutions (100, 90, 85, 50, and 30%) for 2 min each. Antigen was
retrieved by continuous boiling in 10 mM citrate buffer (pH 6.0) for
20 min. The sections were blocked with 3% H2O2 for 15 min followed
by 1% BSA for 15 min at 23°C. After blocking solution was removed,
the specimens were covered and incubated in a mixture of goat
anti-human TRPC4 antibody (1:50, 1% BSA/PBS; Santa Cruz Biotechnology) overnight at 4°C. The slides were then washed in PBS
three times for 5 min each. Each section was then covered and
incubated for 1 h at 23°C with sufficient HRP-conjugated donkey
anti-goat IgG (1:200; Santa Cruz Biotechnology). The slides were
washed again in PBS three times for 5 min each. Each section was
then covered with sufficient solution (liquid DAB substrate kit;
Zymed Laboratories, South San Francisco, CA) at 23°C for 2 min in
the dark and then counterstained with hematoxylin. Samples were
viewed with an Olympus BX50 microscope. Images were captured
with a Princeton Scientific Instruments digital camera and manipulated with the use of Adobe Photoshop software.
RESULTS
RT-PCR for TRPC RNA. Figure 1 shows the results of
experiments in which RT-PCR was performed and specific
primers were used to probe for TRPC1–TRPC7 RNA in MMC.
Figure 1A demonstrates the presence of RNA for TRPC1–
TRPC7 in mouse brain (positive controls). The sizes of the
bands correctly matched the expected lengths of the amplified
fragments of each TRPC (365, 297, 309, 304, 365, 309, 260,
and 469 bp for TRPC1, TRPC2, TRPC3, TRPC4, TRPC5,
TRPC6, TRPC7, and GAPDH, respectively).
As shown in Fig. 1B, only bands corresponding to TRPC1
and TRPC4 were amplified by RT-PCR and mRNA derived
from MMC. Bands representing TRPC2, TRPC3, TRPC5,
287 • AUGUST 2004 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.1 on June 18, 2017
94°C and the extension temperature was 72°C, and 35– 40 PCR cycles
were performed. The PCR products were visualized on 1.5% agarose gel
containing ethidium bromide under UV light.
To distinguish splice variants TRPC4-␣ and TRPC4-␤, isolated
mRNA was amplified by PCR with the use of a forward primer
(5⬘-CATTTCTAGCTTCCGCTTCG-3⬘) paired with a reverse primer
(5⬘-TCTTCCACCACCACCTTCTC-3⬘). Annealing was performed at
60°C for 1 min. All other cycle conditions were as described above.
Western blotting. For the detection of proteins by Western blot
analysis, MMC proteins were collected and isolated according to
standard protocols by sonication and centrifugation. Protein concentration was assayed with the use of Bio-Rad protein assay dye
(Bio-Rad, Hercules, CA), and proteins were loaded onto a 12.5%
polyacrylamide gel after being boiled in Laemmli sample buffer. After
electrophoresis, proteins were transferred to a polyvinylidene difluoride nitrocellulose membrane blocked in 5% milk in Tris-buffered
saline containing Tween 20 (TBST; 0.1% Tween 20) before exposure
to the primary antibody (TRPC1, 1:200, or TRPC4, 1:100; Santa Cruz
Biotechnology, Santa Cruz, CA). After being washed in TBST, the
membranes were exposed to a horseradish peroxidase (HRP)-conjugated secondary antibody and washed once again, and then the signal
was visualized with the use of SuperSignal West Femto substrate
(Pierce, Rockford, IL). Images were captured with a UVP bioimaging
system (EpiChemi II Darkroom; UVP, Upland, CA) and saved as
digital image files.
Immunocytochemical staining. For immunocytochemical staining,
MMC were plated on glass coverslips, fixed with 4% paraformaldehyde for 10 min at 23°C, and then washed briefly in PBS followed by
methanol (10 min at 23°C). Next, the cells were incubated with PBS
containing 1% BSA for 1 h at 23°C, incubated with primary antibodies overnight at 4°C, and then washed with PBS three times for 5 min
each. After this first incubation, the MMC were incubated for 1 h at
23°C with the secondary antibodies. For TRPC1, the primary antibody
used was rabbit anti-human TRPC1 (1:50), commercially available
from Santa Cruz Biotechnology. The secondary antibody was goat
anti-rabbit IgG (1:400) conjugated with Alexa Fluor 594 (Molecular
Probes, Eugene, OR). For TRPC4, the primary antibody used was
rabbit polyclonal anti-TRPC4 (1:100; Sigma) or goat polyclonal
anti-TRPC4 (1:50; Santa Cruz Biotechnology). The secondary antibody for TRPC4 was Alexa 594-conjugated donkey anti-rabbit IgG or
Alexa 488-conjugated donkey anti-goat (1:400; Molecular Probes).
The negative control was IgG incubated in the absence of the primary
antibody but at the same concentration. Samples were viewed with an
Olympus BX50 microscope. Images were captured with a digital
camera (Princeton Scientific Instruments, Monmouth Junction, NJ),
and the final layout of images was created with Adobe Photoshop
software.
Fura 2 ratiometry. For fura 2 ratiometric measurement of Ca2⫹,
cells were grown to confluence, passed onto 22 ⫻ 22-mm glass
coverslips (Fisher Scientific, Pittsburgh, PA), and studied within 48 h
at 23°C. Measurements of intracellular Ca2⫹ concentration ([Ca2⫹]i)
in MMC were obtained by fura 2 and dual excitation wavelength
fluorescence microscopy as previously described (4, 7). In brief, after
loading with fura 2, the glass coverslips with MMC were placed into
a perfusion chamber (Warner RC-20H; Warner Instruments, Hamden,
CT) and then mounted on the stage of a Nikon Diaphot 300 inverted
microscope. With light provided by a DeltaScan dual monochromator
system (Photon Technology International, Lawrenceville, NJ), the
cells were illuminated alternately at 340- and 380-nm wavelengths
(3-nm bandwidths). An adjustable optical sampling window was
positioned within the light path before detection with a photoncounting photomultiplier to monitor fluorescence emission (510 nm,
20-nm bandpass) from a single cell. Background-corrected data were
collected at a rate of 5 points/s and then stored and processed with the
use of the FeliX software package (Photon Technology International).
Calibration of the fura 2 signal was performed according to established methods (4, 7). Cells were loaded with fura 2 by incubation for
TRPC4 CHANNELS IN MESANGIAL CELLS
TRPC6, and TRPC7 were not detected. We conclude that
MMC contain mRNA for TRPC1 and TRPC4 but not for
TRPC2, TRPC3, TRPC5, TRPC6, and TRPC7.
Immunocytochemical localization of TRPC1 and TRPC4.
The localization of TRPC1 and TRPC4 in MMC was determined by immunocytochemistry with the use of anti-TRPC1
and anti-TRPC4, both of which were purchased from Santa
Cruz Biotechnology. The specificities of TRPC1 and TRPC4
antibodies were established by Western blot analysis of MMC
proteins. As shown in Fig. 2A, two distinct bands, at 90 and 50
kDa, were detected with anti-TRPC1. The molecular mass of
90 kDa is in the range (80 –95 kDa) previously reported for
TRPC1 protein (2, 9, 24, 32, 44, 47, 51). The 50-kDa band,
demonstrated previously with the use of a variety of TRPC1
antibodies, has been identified as the heavy chain of IgG (24).
Figure 2B shows a Western blot for TRPC4 using MMC
proteins in which a single band of ⬃115 kDa was detected.
This size is in agreement with previous reports regarding
TRPC4 (29, 39, 43).
As shown in Fig. 3, immunofluorescence staining of single
mesangial cells with anti-TRPC1 (Fig. 3B) and anti-TRPC4
(Fig. 3D) revealed a diffuse cytoplasmic pattern for TRPC1
and a distinct plasmalemmal pattern for TRPC4. Cytosolic
localization of TRPC1 was confirmed with the use of two other
antibodies (Alomone Laboratories, Jerusalem, Israel; a kind
gift from Dr. L. Tsiokas, Department of Cell Biology, University of Oklahoma Health Sciences Center, Oklahoma City,
OK). Minimal nonspecific staining was observed for TRPC1
and TRPC4 (Fig. 3, A and C).
Distinguishing TRPC4-␣ and TRPC4-␤. RT-PCR performed
with primers to amplify a region encompassing the 84-amino
acid deletion for TRPC4-␤ amplified 329- and 581-bp products
in the positive control (mouse brain) (Fig. 4A). These products
were the expected sizes for TRPC4-␤ and TRPC4-␣, respectively. However, the 581-bp product, but not the 329-bp
product, was amplified from MMC RNA (Fig. 4B). An additional product of ⬃620 bp was amplified (Fig. 4B). It is not
known whether this 620-bp band is a new splice variant or a
nonspecific product of the RT-PCR. For a future project, we
are obtaining the full-length sequence of the mesangial
TRPC4. In this study, we concluded that MMC contain tranAJP-Cell Physiol • VOL
scripts consistent with the expression of TRPC-␣ but not
TRPC4-␤.
Antisense determination of SOC role of TRPC4. Immunocytochemical staining was used to establish the effectiveness of
TRPC4 antisense. As shown in Fig. 5, antisense reduced the
expression of TRPC4 in the plasma membrane. However, the
intensity of cytoplasmic staining of TRPC1 was unaffected by
TRPC4 antisense.
Fura 2 ratiometric analysis and antisense experiments were
conducted to determine whether TRPC4 is involved in the
function of SOC in MMC. Figure 6A shows a typical experiment in which SOC was determined by fura 2 ratiometric
measurement of [Ca2⫹]i. In control experiments, 1 ␮M thapsigargin caused an initial elevation of cytosolic [Ca2⫹] due to
inhibition of Ca2⫹-ATPase in the sarcoplasmic reticulum.
After an initial thapsigargin-induced peak elevation in [Ca2⫹]i,
the [Ca2⫹]i relaxed to a lower level. After removal of external
Ca2⫹, [Ca2⫹]i decreased to 50 nM. The return of 1 mM Ca2⫹
resulted in a 160-nM increase in [Ca2⫹]i. This increase in
[Ca2⫹]i after the bath [Ca2⫹] was increased from ⬍10 nM to 1
mM in the presence of thapsigargin was previously shown to
be a measure of SOC (15). When cells were pretreated with
TRPC4 antisense for 48 h, the first (thapsigargin-induced) peak
was not affected; however, SOC (the second peak) was reduced to 30 nM (Fig. 6B). The scrambled oligonucleotides did
not affect SOC (Fig. 5C).
As shown in Fig. 7, the first peak was not affected by TRPC4
antisense or by scrambled oligonucleotides. However, SOC
was reduced by ⬃83% with TRPC4 antisense treatment. Treating MMC with TRPC4 scrambled oligonucleotides did not
affect SOC. These results show that TRPC4 is a contributor to
SOC in MMC.
Immunohistochemical analysis of in vivo TRPC4 expression.
Immunohistochemical techniques were used to determine
whether TRPC4 was expressed in glomerular sections from
C57BL/6 mice. Figure 8B shows that the glomeruli were
stained with anti-TRPC4 antibody (brown areas), consistent
with mesangial expression. In contrast to the negative control,
the anti-TRPC4-stained sections showed that mesangial cells
express an abundance of TRPC4 in vivo. Note that TRPC4 also
Fig. 2. Immunoblot analysis of TRPC1 (A) and TRPC4 (B) in MMC with
rabbit anti-TRPC1 polyclonal IgG (1:200). A: 90- and 50-kDa bands were
consistent with sizes for TRPC1 and heavy chain of IgG (IgGH), respectively.
B: lone ⬃115-kDa band is consistent with previous reports in which TRPC4
was detected.
287 • AUGUST 2004 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.1 on June 18, 2017
Fig. 1. RT-PCR amplification of canonical transient receptor potential (TRPC)
isozymes with the use of specific primers designed for TRPC1–TRPC7. A:
bands in 1.5% agarose gel correspond to sizes for amplified products of
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and TRPC1–TRPC7 in
mouse brain. B: amplification of RNA corresponding to TRPC1 and TRPC4
but not TRPC2, TRPC3, TRPC5, TRPC6, and TRPC7 in mouse mesangial
cells (MMC).
C359
C360
TRPC4 CHANNELS IN MESANGIAL CELLS
Fig. 3. Immunocytochemical identification of TRPC1 and
TRPC4 in MMC with use of immunofluorescent microscopy
(magnification, ⫻400). A and C: negative controls for TRPC1
(A) and TRPC4 (C). B: TRPC1 staining predominantly in the
cytosol. D: TRPC4 staining in the plasma membrane.
DISCUSSION
In this study, RT-PCR revealed the presence of TRPC1 and
TRPC4 mRNA in MMC; however, immunocytochemistry
showed that only TRPC4 resided in the plasma membrane. In
functional experiments, TRPC4 antisense reduced the SOC
response measured by fura 2 ratiometry. TRPC4 was identified
in the glomeruli of renal sections obtained from mice with the
use of immunohistochemical techniques.
Fig. 4. Products of RT-PCR amplification of a region encompassing the
84-amino acid deletion for TRPC4-␤. The expected products, shown in the
positive control (brain), were 329 bp for TRPC-␤ (brain, bottom band) and 581
bp for TRPC4-␣ (brain, top band). In MMC, a product of expected size was
evident for TRPC4-␣ but not for TRPC4-␤. Whether the larger band is a
nonspecific product is not known.
AJP-Cell Physiol • VOL
Expression of TRPC isoforms in MMC. Because mesangial
cells have a smooth muscle-like phenotype, it is not surprising
that TRPC1, previously identified in smooth muscle (24, 37,
38, 51), was also found in MMC. However, TRPC1 was
predominately expressed in the cytoplasm of MMC and therefore would not serve as a component of SOC, which occurs in
membranes. Because the cytoplasmic localization of TRPC1
was a surprising result, we used three different TRPC1 antibodies (sc-20110, Santa Cruz Biotechnology; ACC-010,
Alomone Laboratories; a gift from Dr. L. Tsiokas) and seven
fixation methods to ensure the accuracy of this result. In each
experiment, we found the localization of TRPC1 to be intracellular. The localization of TRPC1 in the cytoplasm is not
understood and is somewhat contradictory to studies showing
that TRPC1 is endogenously localized in the plasma membranes of some cells. For example, TRPC1 associates with
caveolin-1 in the plasma membrane region of human submandibular glands (13, 41) and sperm cells (42). In the MMC used
in this study, we did not find clear evidence of plasma membrane localization of TRPC1; however, we are unable to
conclude that TRPC1 is not in the plasma membrane. It
remains possible that TRPC1 is localized to the plasma membrane but is not resolvable by our methods. Interestingly,
Philipp et al. (29) also found transcripts of both TRPC1 and
TRPC4 in adrenal cells. That TRPC4 antisense reduced ICRAC
in adrenal cells led to the conclusion that TRPC4 was at least
one of the proteins forming SOC. However, it was not determined whether TRPC1 was also a component of ICRAC in the
Philipp et al. study.
Function of TRPC4 in native cells. In the absence of pharmacological inhibitors of specific isoforms of TRPC, antisense
knockdown technology has been used extensively to study the
function of TRPC channels in native environments. Antisense
methods provided the first compelling evidence that TRP
287 • AUGUST 2004 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.1 on June 18, 2017
is abundantly expressed in some extraglomerular structures.
These experiments show that TRPC4 SOC is expressed both in
vivo and in vitro and is due not merely to a biochemical change
in the cultured environment.
TRPC4 CHANNELS IN MESANGIAL CELLS
C361
Fig. 5. Effects of TRPC4 antisense on expression levels of
TRPC1 and TRPC4 in MMC. A: TRPC1 staining; B: TRPC1
treated with TRPC4 antisense; C: TRPC4 staining; D: TRPC4
with TRPC4 antisense. Magnification, ⫻400.
stores with thapsigargin. That TRPC4 antisense did not affect
expression of TRPC1, which has 35% amino acid identity with
TRPC4, demonstrates the specificity of this particular knockdown strategy.
RNA transcripts of TRPC4 were previously described in a
variety of tissues, including brain, kidney, lung, heart, testis,
ovary, and adrenal glands (6, 20, 33). Consistent with our
results, transcripts of TRPC4 have been discovered in rat (33)
and human (19) kidney. However, a study of bovine adrenal
cells may have been the first to describe a functional role for
TRPC4 in its native environment (29). More recent studies
with TRPC4 knockout mice showed that TRPC4, although not
necessary for survival, has an important role in regulating
blood flow and vascular permeability (5, 40). Freichel et al. (5)
demonstrated that TRPC4⫺/⫺ expressed with impaired agonistdependent vasorelaxation and concluded that TRPC4 forms the
Fig. 6. Representative measurements of Ca2⫹ by fura-2 ratiometry demonstrating effects of TRPC4 antisense on store-operated
Ca2⫹ (SOC) channel. A: control tracing showing an initial increase in [Ca2⫹]i in response to 1 ␮M thapsigargin (arrow). After
relaxation of [Ca2⫹]i toward baseline, Ca2⫹ was removed from the external solution. The readdition of 1 mM Ca2⫹ to the external
solution led to a second peak elevation in [Ca2⫹]i (SOC). B: same experimental protocol using a cell treated with TRPC4 antisense
before experiment. C: same protocol using a cell treated with scrambled oligonucleotides. [Ca2⫹]o, Ca2⫹ concentration in external
solution.
AJP-Cell Physiol • VOL
287 • AUGUST 2004 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.1 on June 18, 2017
homologs were involved in SOC activity (52). After the Zhu et
al. (52) study, Wu et al. (50) used antisense to show that human
TRPC1 is a functional component of SOC in human embryonic
kidney (HEK)-293 cells. TRPC1 antisense oligonucleotides
successfully inhibited SOC in endothelial cells (3) and in
salivary glands (12). Patch-clamp experiments showed that
TRPC4 antisense silenced SOC in bovine adrenal cortical cells
(29). Thus antisense is a proven method of establishing the
SOC function of specific isoforms of TRPC in their native
environment.
By performing fura 2 ratiometry in the present study, we
demonstrated that TRPC4 antisense reduced SOC by 83%
(from 213 to 36 nM), a value close to the 20 ␮M La3⫹
reduction that inhibited SOC by 93% [also determined with
fura 2 techniques (15)]. Thus TRPC4-antisense appears to be
effective in silencing the SOC response to releasing Ca2⫹
C362
TRPC4 CHANNELS IN MESANGIAL CELLS
SOC channels necessary for Ca2⫹ stimulation of nitric oxide
synthase in endothelial cells. More recently, Tiruppathi et al.
(40) showed that lung vascular endothelial cells of TRPC4⫺/⫺
mice lack the thrombin-induced endothelial cell retraction
response. These studies show that in some cells, TRPC4 is a
crucial component not only of maintaining intracellular Ca2⫹
stores but also of Ca2⫹-regulated physiological responses.
Properties of mesangial TRPC4 channels. The membranespanning structure of TRPC channels is similar to the molecules that form tetrameric ion-selective channels in the plasma
membranes of cells. Therefore, it has been concluded that
TRPC isoforms can form either heterotetrameric or homotetrameric channels. Because only TRPC4 was localized in the
plasma membrane of MMC, our study results imply that the
mesangial SOC is a homotetramer formed by only TRPC4.
However, we cannot rule out the possibility that other membrane-associated TRPCs exist that were not detected with our
methods. Clearly, further studies are necessary to clarify the
role of TRPC4 in store-operated Ca2⫹ entry. Although several
studies have reported SOC currents at the whole-cell level, few
studies have reported single-channel currents. Our (15) previous results showed that thapsigargin-induced SOC was expressed in cultured human mesangial cells as a small, La3⫹sensitive, Ca2⫹-selective, 2-pS channel with Ba2⫹ as the current carrier. The present study shows that the same channels,
when examined with fura 2 methods, are silenced by TRPC4
antisense.
Fig. 8. Immunohistochemical identification of TRPC4 in
MMC. Kidney sections were stained with anti-TRPC4 antibody. In contrast to the negative control (A), the anti-TRPC4
staining (B; brown areas) showed that glomeruli contain an
abundance of TRPC4. Note that TRPC4 is also abundantly
expressed in some tubular structures. Magnification, ⫻400.
AJP-Cell Physiol • VOL
287 • AUGUST 2004 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.1 on June 18, 2017
Fig. 7. Bar graph summarizing effects of TRPC4 antisense on SOC. The first
peak (thapsigargin evoked) increase in [Ca2⫹]i was unaffected by TRPC4
antisense or scrambled oligonucleotides. SOC was significantly attenuated by
TRPC4 antisense but not by scrambled oligonucleotides. Values are means ⫾
SE; control, n ⫽ 5; TRPC4-antisense, n ⫽ 5; TRPC4 scrambled, n ⫽ 6. *P ⬍
0.05, ANOVA plus Student-Newman-Keuls test.
In agreement with our findings, previous studies showed that
bovine TRPC4 (formerly CCE1), which is closely homologous
to mTRPC4-␣, was Ca2⫹ selective and activated by store
depletion when heterologously expressed in HEK-293 or Chinese hamster ovary cells (27, 48). However, our findings are in
disagreement with the described properties in many studies
which heterologously overexpress TRPC4 (34, 35). It was
shown that TRPC4 channels, presumably expressed as homotetramers, formed receptor-operated, nonselective cation
channels activated independently of IP3 or store depletion (17,
30, 34). The single-channel conductance of these nonselective
TRPC4 channels was much higher (41 pS) (34) than we found
in our previous study (15). It was therefore suggested that
TRPC4 did not form ICRAC, which was originally described as
Ca2⫹ selective, inwardly rectifying, and having a small singlechannel conductance (8, 16). However, Philipp et al. (29)
showed that the endogenous TRPC4 in adrenal cells is a
Ca2⫹-selective SOC. These data are consistent with studies
showing that TRPC4⫺/⫺ mice lack a highly Ca2⫹-selective,
store-dependent current in endothelial cells (5, 40). This large
discrepancy between the overexpressed and the endogenous
TRPC4 is not surprising in light of a recent study by Vazquez
et al. (45), who found that TRPC3 functioned as a SOC when
expressed at low levels in chicken DT40 B lymphocytes.
However, when expressed at higher levels, TRPC3 no longer
formed a SOC but could be activated by receptor-coupled
phospholipase C. Thus the native TRPC4 may be interacting
with another endogenous protein that influences its properties.
It is now known that several types of channels have accessory
subunits that influence the biophysical, pharmacological, and
regulatory properties of the pore-forming subunit (11, 22). It
will be interesting to determine whether TRPC channels are
similarly influenced by accessory subunits.
Splice variants of TRPC4. Although there are multiple splice
variants of TRPC4 (30), isoforms TRPC4-␣ and TRPC4-␤
have been shown to be the most abundantly expressed in
tissues (19, 34, 35). Northern blot analysis revealed an abundance of both TRPC4-␣ and TRPC4-␤ RNA in human renal
tissue (19). Satoh et al. (33) also showed that TRPC4-␣
transcripts were specifically expressed in rat kidney. Because
Satoh et al. found both TRPC4-␣ and TRPC4-␤ in rat brain, we
used mouse brain as a positive control. Our results revealed
amplified transcripts consistent with TRPC-␣ but not TRPC-␤
expression in MMC. That TRPC4-␣ forms the SOC channel in
TRPC4 CHANNELS IN MESANGIAL CELLS
MMC is consistent with a study by Mery et al. (19), who
showed, using the yeast two-hybrid method, a strong interaction between human TRPC4-␣ (but not TRPC4-␤) and the
intracellular Ca2⫹ release channel (IP3R). An association between TRP and IP3R is the sine qua non of the conformational
coupling hypothesis regarding activation of SOC (10).
In summary, we have found that both TRPC1 and TRPC4
are expressed in MMC. TRPC4 was clearly localized in the
plasma membrane of glomerular MMC, where it may form a
homotetrameric SOC. Recent studies with TRPC4⫺/⫺ mice
revealed important roles for TRPC4 SOC in the normal function of cardiovascular and pulmonary systems. It therefore will
be interesting to examine the renal function of TRPC4⫺/⫺ mice
at the cellular and integrative levels.
We thank Drs. Leonidas Tsiokas and Rong Ma from the Department of Cell
Biology, University of Oklahoma Health Sciences Center, Oklahoma City,
OK, for their generous gift of mouse anti-TRPC1.
GRANTS
This work was supported by an American Heart Association Affiliate
Grant-in-Aid (to S. C. Sansom), National Institute of Diabetes and Digestive
and Kidney Diseases Grant R01 DK-49561 (to S. C. Sansom), and National
Heart, Lung, and Blood Institute Grant IT32 HL-0788 (to J. L. Pluznick).
REFERENCES
1. Altenberg GA, Subramanyam M, and Reuss L. Muscarinic stimulation
of gallbladder epithelium. II. Fluid transport, cell volume, and ion permeabilities. Am J Physiol Cell Physiol 265: C1613–C1619, 1993.
2. Brereton HM, Harland ML, Auld AM, and Barritt GJ. Evidence that
the TRP-1 protein is unlikely to account for store-operated Ca2⫹ inflow in
Xenopus laevis oocytes. Mol Cell Biochem 214: 63–74, 2000.
3. Brough GH, Wu S, Cioffi D, Moore TM, Li M, Dean N, and Stevens
T. Contribution of endogenously expressed Trp1 to a Ca2⫹-selective,
store-operated Ca2⫹ entry pathway. FASEB J 15: 1727–1738, 2001.
4. Carmines PK, Fowler BC, and Bell PD. Segmentally distinct effects of
depolarization on intracellular [Ca2⫹] in renal arterioles. Am J Physiol
Renal Fluid Electrolyte Physiol 265: F677–F685, 1993.
5. Freichel M, Suh SH, Pfeifer A, Schweig U, Trost C, Weissgerber P,
Biel M, Philipp S, Freise D, Droogmans G, Hofmann F, Flockerzi V,
and Nilius B. Lack of an endothelial store-operated Ca2⫹ current impairs
agonist-dependent vasorelaxation in TRP4⫺/⫺ mice. Nat Cell Biol 3:
121–127, 2001.
6. Garcia RL and Schilling WP. Differential expression of mammalian
TRP homologues across tissues and cell lines. Biochem Biophys Res
Commun 239: 279 –283, 1997.
7. Grynkiewicz G, Poenie M, and Tsien RY. A new generation of Ca2⫹
indicators with greatly improved fluorescence properties. J Biol Chem
260: 3440 –3450, 1985.
8. Hoth M and Penner R. Depletion of intracellular calcium stores activates
a calcium current in mast cells. Nature 355: 353–356, 1992.
9. Huang L, Wolska BM, Montgomery DE, Burkart EM, Buttrick PM,
and Solaro RJ. Increased contractility and altered Ca2⫹ transients of
mouse heart myocytes conditionally expressing PKC␤. Am J Physiol Cell
Physiol 280: C1114 –C1120, 2001.
10. Kiselyov K, Xu X, Mozhayeva G, Kuo T, Pessah I, Mignery G, Zhu X,
Birnbaumer L, and Muallem S. Functional interaction between InsP3
receptors and store-operated Htrp channels. Nature 396: 478 – 482, 1998.
11. Kudlacek PE, Pluznick JL, Ma R, Padanilam B, and Sansom SC. Role
of h␤1 in activation of human mesangial BK channels by cGMP kinase.
Am J Physiol Renal Physiol 285: F289 –F294, 2003.
12. Liu X, Wang W, Singh BB, Lockwich T, Jadlowiec J, O’Connell B,
Wellner R, Zhu MX, and Ambudkar IS. Trp1, a candidate protein for
the store-operated Ca2⫹ influx mechanism in salivary gland cells. J Biol
Chem 275: 3403–3411, 2000.
AJP-Cell Physiol • VOL
13. Lockwich TP, Liu X, Singh BB, Jadlowiec J, Weiland S, and Ambudkar IS. Assembly of Trp1 in a signaling complex associated with caveolin-scaffolding lipid raft domains. J Biol Chem 275: 11934 –11942, 2000.
14. Ma R, Kudlacek PE, and Sansom SC. Protein kinase C␣ participates in
activation of store-operated Ca2⫹ channels in human glomerular mesangial cells. Am J Physiol Cell Physiol 283: C1390 –C1398, 2002.
15. Ma R, Smith S, Child A, Carmines PK, and Sansom SC. Store-operated
Ca2⫹ channels in human glomerular mesangial cells. Am J Physiol Renal
Physiol 278: F954 –F961, 2000.
16. McDonald TV, Premack BA, and Gardner P. Flash photolysis of caged
inositol 1,4,5-trisphosphate activates plasma membrane calcium current in
human T cells. J Biol Chem 268: 3889 –3896, 1993.
17. McKay RR, Szymeczek-Seay CL, Lievremont JP, Bird GS, Zitt C,
Jungling E, Luckhoff A, and Putney JW Jr. Cloning and expression of
the human transient receptor potential 4 (TRP4) gene: localization and
functional expression of human TRP4 and TRP3. Biochem J 351: 735–
746, 2000.
18. Menè P, Teti A, Pugliese F, and Cinotti GA. Calcium release-activated
calcium influx in cultured human mesangial cells. Kidney Int 46: 122–128,
1994.
19. Mery L, Magnino F, Schmidt K, Krause KH, and Dufour JF. Alternative splice variants of hTrp4 differentially interact with the C-terminal
portion of the inositol 1,4,5-trisphosphate receptors. FEBS Lett 487:
377–383, 2001.
20. Mori Y, Takada N, Okada T, Wakamori M, Imoto K, Wanifuchi H,
Oka H, Oba A, Ikenaka K, and Kurosaki T. Differential distribution of
TRP Ca2⫹ channel isoforms in mouse brain. Neuroreport 9: 507–515,
1998.
21. Nagamine K, Kudoh J, Minoshima S, Kawasaki K, Asakawa S, Ito F,
and Shimizu N. Molecular cloning of a novel putative Ca2⫹ channel
protein (TRPC7) highly expressed in brain. Genomics 54: 124 –131, 1998.
22. Nimigean CM and Magleby KL. The ␤ subunit increases the Ca2⫹
sensitivity of large conductance Ca2⫹-activated potassium channels by
retaining the gating in the bursting states. J Gen Physiol 113: 425– 440,
1999.
23. Nowicki S, Kruse MS, Brismar H, and Aperia A. Dopamine-induced
translocation of protein kinase C isoforms visualized in renal epithelial
cells. Am J Physiol Cell Physiol 279: C1812–C1818, 2000.
24. Ong HL, Chen J, Chataway T, Brereton H, Zhang L, Downs T,
Tsiokas L, and Barritt G. Specific detection of the endogenous transient
receptor potential (TRP)-1 protein in liver and airway smooth muscle cells
using immunoprecipitation and Western-blot analysis. Biochem J 364:
641– 648, 2002.
25. Parekh AB and Penner R. Store depletion and calcium influx. Physiol
Rev 77: 901–930, 1997.
26. Pfeilschifter J. Protein kinase C from rat renal mesangial cells: its role in
homologous desensitization of angiotensin II-induced polyphosphoinositide hydrolysis. Biochim Biophys Acta 969: 263–270, 1988.
27. Philipp S, Cavalie A, Freichel M, Wissenbach U, Zimmer S, Trost C,
Marquart A, Murakami M, and Flockerzi V. A mammalian capacitative calcium entry channel homologous to Drosophila TRP and TRPL.
EMBO J 15: 6166 – 6171, 1996.
28. Philipp S, Hambrecht J, Braslavski L, Schroth G, Freichel M, Murakami M, Cavalie A, and Flockerzi V. A novel capacitative calcium
entry channel expressed in excitable cells. EMBO J 17: 4274 – 4282, 1998.
29. Philipp S, Trost C, Warnat J, Rautmann J, Himmerkus N, Schroth G,
Kretz O, Nastainczyk W, Cavalie A, Hoth M, and Flockerzi V. TRP4
(CCE1) protein is part of native calcium release-activated Ca2⫹-like
channels in adrenal cells. J Biol Chem 275: 23965–23972, 2000.
30. Plant TD and Schaefer M. TRPC4 and TRPC5: receptor-operated
Ca2⫹-permeable nonselective cation channels. Cell Calcium 33: 441– 450,
2003.
31. Putney JW Jr. TRP, inositol 1,4,5-trisphosphate receptors, and capacitative calcium entry. Proc Natl Acad Sci USA 96: 14669 –14671, 1999.
32. Rosado JA and Sage SO. Activation of store-mediated calcium entry by
secretion-like coupling between the inositol 1,4,5-trisphosphate receptor
type II and human transient receptor potential (hTrp1) channels in human
platelets. Biochem J 356: 191–198, 2001.
33. Satoh E, Ono K, Xu F, and Iijima T. Cloning and functional expression
of a novel splice variant of rat TRPC4. Circ J 66: 954 –958, 2002.
34. Schaefer M, Plant TD, Obukhov AG, Hofmann T, Gudermann T, and
Schultz G. Receptor-mediated regulation of the nonselective cation channels TRPC4 and TRPC5. J Biol Chem 275: 17517–17526, 2000.
287 • AUGUST 2004 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.1 on June 18, 2017
ACKNOWLEDGMENTS
C363
C364
TRPC4 CHANNELS IN MESANGIAL CELLS
AJP-Cell Physiol • VOL
44. Tsiokas L, Arnould T, Zhu C, Kim E, Walz G, and Sukhatme VP.
Specific association of the gene product of PKD2 with the TRPC1
channel. Proc Natl Acad Sci USA 96: 3934 –3939, 1999.
45. Vazquez G, Wedel BJ, Trebak M, St John BG, and Putney JW Jr.
Expression level of the canonical transient receptor potential 3 (TRPC3)
channel determines its mechanism of activation. J Biol Chem 278: 21649 –
21654, 2003.
46. Walker RL, Hume JR, and Horowitz B. Differential expression and
alternative splicing of TRP channel genes in smooth muscles. Am J
Physiol Cell Physiol 280: C1184 –C1192, 2001.
47. Wang W, O’Connell B, Dykeman R, Sakai T, Delporte C, Swaim W,
Zhu X, Birnbaumer L, and Ambudkar IS. Cloning of Trp1␤ isoform
from rat brain: immunodetection and localization of the endogenous Trp1
protein. Am J Physiol Cell Physiol 276: C969 –C979, 1999.
48. Warnat J, Philipp S, Zimmer S, Flockerzi V, and Cavalie A. Phenotype
of a recombinant store-operated channel: highly selective permeation of
Ca2⫹. J Physiol 518: 631– 638, 1999.
49. Wes PD, Chevesich J, Jeromin A, Rosenberg C, Stetten G, and
Montell C. TRPC1, a human homolog of a Drosophila store-operated
channel. Proc Natl Acad Sci USA 92: 9652–9656, 1995.
50. Wu XY, Babnigg G, and Villereal ML. Functional significance of
human trp1 and trp3 in store-operated Ca2⫹ entry in HEK-293 cells. Am J
Physiol Cell Physiol 278: C526 –C536, 2000.
51. Xu SZ and Beech DJ. TrpC1 is a membrane-spanning subunit of
store-operated Ca2⫹ channels in native vascular smooth muscle cells. Circ
Res 88: 84 – 87, 2001.
52. Zhu X, Jiang M, Peyton M, Boulay G, Hurst R, Stefani E, and
Birnbaumer L. trp, a novel mammalian gene family essential for agonistactivated capacitative Ca2⫹ entry. Cell 85: 661– 671, 1996.
287 • AUGUST 2004 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.1 on June 18, 2017
35. Schaefer M, Plant TD, Stresow N, Albrecht N, and Schultz G. Functional differences between TRPC4 splice variants. J Biol Chem 277:
3752–3759, 2002.
36. Stockand JD and Sansom SC. Role of large, Ca-activated K channels in
regulation by nitroprusside and ANP of mesangial contraction. Am J
Physiol Cell Physiol 270: C1773–C1779, 1996.
37. Sweeney M, McDaniel SS, Platoshyn O, Zhang S, Yu Y, Lapp BR, Zhao
Y, Thistlethwaite PA, and Yuan JX. Role of capacitative Ca2⫹ entry in
bronchial contraction and remodeling. J Appl Physiol 92: 1594–1602, 2002.
38. Sweeney M, Yu Y, Platoshyn O, Zhang S, McDaniel SS, and Yuan JX.
Inhibition of endogenous TRP1 decreases capacitative Ca2⫹ entry and
attenuates pulmonary artery smooth muscle cell proliferation. Am J
Physiol Lung Cell Mol Physiol 283: L144 –L155, 2002.
39. Tang Y, Tang J, Chen Z, Trost C, Flockerzi V, Li M, Ramesh V, and
Zhu MX. Association of mammalian Trp4 and phospholipase C isozymes
with a PDZ domain-containing protein, NHERF. J Biol Chem 275:
37559 –37564, 2000.
40. Tiruppathi C, Freichel M, Vogel SM, Paria BC, Mehta D, Flockerzi V,
and Malik AB. Impairment of store-operated Ca2⫹ entry in TRPC4⫺/⫺
mice interferes with increase in lung microvascular permeability. Circ Res
91: 70 –76, 2002.
41. Toews ML, Ustinova EE, and Schultz HD. Lysophosphatidic acid
enhances contractility of isolated airway smooth muscle. J Appl Physiol
83: 1216 –1222, 1997.
42. Trevino CL, Serrano CJ, Beltran C, Felix R, and Darszon A. Identification of mouse trp homologs and lipid rafts from spermatogenic cells
and sperm. FEBS Lett 509: 119 –125, 2001.
43. Trost C, Bergs H, Himmerkus N, and Flockerzi V. The transient
receptor potential, TRP4, cation channel is a novel member of the family
of calmodulin binding proteins. Biochem J 355: 663– 670, 2001.