Reconstitution of T Cell-Specific
Transcription Directed by Composite
NFAT/Oct Elements
This information is current as
of June 18, 2017.
Andrew G. Bert, Joanna Burrows, Abbas Hawwari, Mathew
A. Vadas and Peter N. Cockerill
J Immunol 2000; 165:5646-5655; ;
doi: 10.4049/jimmunol.165.10.5646
http://www.jimmunol.org/content/165/10/5646
Subscription
Permissions
Email Alerts
This article cites 60 articles, 27 of which you can access for free at:
http://www.jimmunol.org/content/165/10/5646.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2000 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
References
Reconstitution of T Cell-Specific Transcription Directed by
Composite NFAT/Oct Elements1
Andrew G. Bert,2 Joanna Burrows,2 Abbas Hawwari, Mathew A. Vadas, and
Peter N. Cockerill3
C
ombinatorial regulation has been proposed as a powerful
mechanism for generating specificity in gene expression.
Just a few tissue-specific transcription factors with distinct tissue distributions have the potential to act in different combinations to direct many different patterns of gene expression.
Combinatorial regulation also enables very tight control over gene
expression, and there are many examples in which two distinct
transcription factors synergize to activate a composite DNA-binding element (reviewed in Refs. 1 and 2). One of the best-studied
such examples is that of composite NFAT/AP-1 sites, in which we
and others have demonstrated synergy in the function of these two
factors that bind cooperatively to activate cytokine gene expression
(3–10). Formal identification of factors that determine specificity of
complex promoters and enhancers is usually very difficult, however,
due to the high degree of redundancy in transcription factor use
employed by regulatory elements, and it is not always possible to
divide these elements into distinct functional units. Elements such
as the IFN-␤ enhancer assemble transcription factors to form discrete oligomeric structures termed enhanceosomes (11; reviewed
in Ref. 12) that are difficult to dissect without destroying activity.
Division of Human Immunology, Hanson Centre For Cancer Research, Institute for
Medical and Veterinary Science, Adelaide, Australia
Received for publication May 30, 2000. Accepted for publication August 22, 2000.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by the National Health and Medical Research Council of
Australia.
2
A.G.B. and J.B. contributed equally to this work and should be considered as first
authors.
3
Address correspondence and reprint requests to Dr. Peter Cockerill, Division of
Human Immunology, Hanson Center for Cancer Research, Institute for Medical and
Veterinary Science, P.O. Box 14, Rundle Mall Post Office, Adelaide 5000, Australia.
E-mail address: [email protected]
Copyright © 2000 by The American Association of Immunologists
Consequently, there are few, if any, examples in which it has been
clearly demonstrated that the combinatorial regulation of composite elements is sufficient to account for a specific pattern of gene
expression. Even in the well-documented area of NFAT and AP-1,
these factors regulate many differentially expressed genes and it is
difficult to determine the role played by NFAT in establishing specific patterns of gene expression.
To attempt to define the minimum requirements for combinatorial regulation of tissue-specific transcription in the immune system, we investigated regulatory elements controlling cytokine gene
expression. Cytokine genes are tightly regulated and are induced
by immune and proinflammatory signals in a wide variety of cell
types, and they exhibit many distinct but overlapping tissue-specific expression profiles (13). In T cells, cytokine genes such as
IL-2, IL-3, and GM-CSF are turned on via the Ca2⫹ and kinase
signaling pathways linked to the TCR. NFAT appears to play a
critical role in their regulation and is activated via the cyclosporin
A-suppressible Ca2⫹/calcineurin pathway (reviewed in Refs.
3–10). NFAT is a family of at least four related proteins that appears to regulate cytokine gene expression not only in T cells, but
also in myeloid cells and endothelial cells (5, 14, 15). NFAT does
not usually function alone, but in strict cooperation with other
factors, and contributes to many different patterns of combinatorial
regulation (7). NFAT and AP-1 bind cooperatively to the consensus sequence GGAAANNNTGANTCA, in which the arrangement
of NFAT and AP-1 sites is rigidly conserved (10). In the IL-3
enhancer, NFAT synergizes with Oct family proteins even in the
absence of cooperative binding (16).
We adopted the IL-3/GM-CSF locus as a model for studying
combinatorial regulation because these evolutionarily related cytokine genes are closely linked in the genome and are turned on by
the same TCR signaling pathways, yet they have distinct patterns
0022-1767/00/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
The complex nature of most promoters and enhancers makes it difficult to identify key determinants of tissue-specific gene
expression. Furthermore, most tissue-specific genes are regulated by transcription factors that have expression profiles more
widespread than the genes they control. NFAT is an example of a widely expressed transcription factor that contributes to several
distinct patterns of cytokine gene expression within the immune system and where its role in directing specificity remains undefined. To investigate distinct combinatorial mechanisms employed by NFAT to regulate tissue-specific transcription, we examined
a composite NFAT/AP-1 element from the widely active GM-CSF enhancer and a composite NFAT/Oct element from the T
cell-specific IL-3 enhancer. The NFAT/AP-1 element was active in the numerous cell types that express NFAT, but NFAT/Oct
enhancer activity was T cell specific even though Oct-1 is ubiquitous. Conversion of the single Oct site in the IL-3 enhancer to an
AP-1 enabled activation outside of the T cell lineage. By reconstituting the activities of both the IL-3 enhancer and its NFAT/Oct
element in a variety of cell types, we demonstrated that their T cell-specific activation required the lymphoid cofactors NIP45 and
OCA-B in addition to NFAT and Oct family proteins. Furthermore, the Oct family protein Brn-2, which cannot recruit OCA-B,
repressed NFAT/Oct enhancer activity. Significantly, the two patterns of combinatorial regulation identified in this study mirror
the cell-type specificities of the cytokine genes that they govern. We have thus established that simple composite transcription
factor binding sites can indeed establish highly specific patterns of gene expression. The Journal of Immunology, 2000, 165:
5646 –5655.
The Journal of Immunology
Materials and Methods
RNA analyses
RNA was prepared from unstimulated cells and cells stimulated for 9 h
with 20 ng/ml PMA and 1 ␮M A23187. IL-3, GM-CSF, and OCA-B transcripts were assayed by Northern blot hybridization analysis. 32P-labeled
probes contained the 480-bp BamHI/XmnI 3⬘ region of the human IL-3
gene, the 700-bp EcoRI/BamHI fragment of the human GM-CSF gene, and
the human OCA-B gene isolated as a 2-kb EcoRI/NotI fragment of the
expression plasmid pCDNA/OBF-1 (see below). Membranes were reprobed with the 400-bp EcoRI/HindIII fragment from the human GAPDH
gene to control for RNA integrity and uniformity of sample loading.
DH site analyses
GM-CSF and IL-3 enhancer DH sites in Jurkat cells, CEM cells, KG1a
cells, 5637 cells, K562 cells, and Raji cells were assayed as described
previously (9, 16, 17). For each cell line, a DNase I titration was performed
and samples that had optimal extents of DNase I digestion were selected
for Southern blot hybridization analysis of DH sites. The membrane containing BamHI-digested samples used in the analysis of the IL-3 enhancer
DH site was reprobed with a probe designed to detect a ubiquitous DH site
immediately downstream of the IL-3 gene (12, 15) to confirm that DH sites
could be detected in each sample.
Plasmid construction
All of the luciferase reporter gene constructs described in this work contained oligonucleotides or enhancers inserted upstream of a minimal promoter in pXPG-GM55 (18), which was made by cloning a minimal core
fragment of the human GM-CSF promoter (⫺55 to ⫹28) into the HindIII
site of the luciferase reporter plasmid pXPG (18). pXPG is a modified form
of pXP1 (19) that has the firefly luciferase gene replaced by the Luc⫹ gene
from pGL3 (Promega, Madison, WI), and the pBR322 ori converted to a
high copy ori. Like pXP1, pXPG has four upstream polyadenylation signals to block read-through transcription effects that in the past have affected
equivalent pGL3-based plasmids employed by us (16, 18).
pIL3E contained the 330-bp NruI/AccI fragment of the IL-3 enhancer
(16), and pGME contained the 425-bp BamHI/BalI fragment of the GMCSF enhancer (10). Mutations in the IL-3 enhancer were generated by
site-directed mutagenesis of the 330-bp IL-3 enhancer using oligonucleotides containing the following sequences: IL140 ⌬N, GGCAAGAACCCTT
GCTTTggCCACTGGGCCTTTCTT; IL190 ⌬N, GGGTGCTCCATGG
ccAATGCAAATCTACTTAACTGA; IL190 ⌬Oct, TCCATGGAAAATGC
ccATCTACTTAACTGA; IL280 ⌬N, GCTGTGAGCTACAGTTggCCAGC
CTCTAGAGCC; IL3-AP-1, CTCCATGGAAAATGagAgTCaACTTA
ACTGACTTT. (Altered bases shown in lower case.) pGM420 contained a
single copy of GM420 (10). Because IL190 is a weaker enhancer than GM420,
we created pIL190 by inserting three copies of IL190 into pXPG-GM55 to
increase the ability to detect residual activity in cells other than T cells.
pIL140/IL190 contains the sequence CGGCAAGAACCCTTGCTTTTTC
CACTGGGCCTTTCTTCCTCCCACCCTGAGGGTGCTCCATGGAAAAT
GCAAATCTACT. All DNA fragments were inserted in the same orientation relative to the promoters as they exist in the GM-CSF/IL-3 locus. The
NFATp expression plasmid pLGP-NFAT1c was a gift from A. Rao (Harvard Medical School, Boston, MA; Ref. 20), the human OCA-B expression
plasmid pCDNA/OBF-1 was a gift from P. Matthias (Friedrich Miescher
Institute, Basel, Switzerland), the Oct-1 expression plasmid pWS1 and the
Oct-2 expression plasmid pWS2 originated from W. Schaffner (21) and
were gifts from T. Wirth (Ulm University, Ulm, Germany), the mouse
NIP45 expression plasmid pCI-NIP45 was a gift of L. Glimcher (Harvard
Medical School, Ref. 22), and the Brn-2 expression plasmid pCDNA3.1/
Brn-2 was a gift of R. Sturm (University of Queensland, Brisbane, Australia).
Oligonucleotides
Previously described oligonucleotide duplexes (10, 16) used as probes and
competitors incorporated the following sequences: IL190, GGGTGCTC
CATGGAAAATGCAAATCTACT; GM420, CCATCTTTCTCATGGAA
AGATGACATCAGGG; GM430, TCACACATCTTTCTCATGGAAA
GATGA; octamer, CCTAATTTGCATG; AP-1, TGGATCACCCGCAG
CTTGACTCATCCTTGCA.
Cell culture
The Jurkat T leukemic cell line, CEM T leukemic cell line, Raji B leukemic
cell line, KG1a myeloid leukemic cell line, and K562 proerythroid/
megakaryotic CML cell line were cultured in RPMI containing 10% FCS.
The 5637 bladder carcinoma epithelial cell line was cultured in RPMI
containing 7% FCS.
Transient transfections and luciferase assays
All cells were transfected with CsCl-purified plasmid DNA by electroporation, cultured for 20 –24 h, stimulated with 20 ng/ml PMA and 1 ␮M
calcium ionophore A23187 for 9 h, and assayed for luciferase reporter gene
activities, as previously described (16). In all transfections, 5 ␮g of luciferase reporter plasmid was used. In cotransfection experiments, 5 ␮g of
each expression plasmid or parent vector was also transfected.
Gel EMSAs
Nuclear extracts were prepared and EMSAs performed as previously described (9), except that assays employed 4 ␮g of nuclear extract and 2 ␮g
of poly(dI-dC) in a 15 ␮l volume. EMSAs employed nuclear extracts prepared from unstimulated cells and cells stimulated for 2–3 h with 20 ng/ml
PMA and 2 ␮M A23187. Some assays included specific antisera. The
Brn-2 antisera raised against the C terminus of human Brn-2 (23) and the
Oct-1 Ab (24) were gifts from R. Sturm. The Oct-2 antisera raised against
the N terminus of mouse Oct-2 was a gift from L. Corcoran (Walter and
Eliza Hill Institute, Melbourne, Australia).
Results
4
The IL140, IL190, GM330, GM420, and GM550 elements can each function independently as efficient enhancer elements (10, 16) in T cells. The GM170 and IL280
NFAT/AP-1 elements appear to play little role in enhancer function because they lack
the organization required for cooperative binding of NFAT and AP-1. Although the
weak IL70 NFAT lacks enhancer function, the high affinity IL140 NFAT site can
function alone as an enhancer element (16).
5
Abbreviations used in this paper: DH, DNase I-hypersensitive; TCF, T cell-specific
factor.
Differential regulation of the IL-3 and GM-CSF genes
Before studying the tissue-specific regulation of the IL-3/GM-CSF
locus, it was necessary to establish a well-defined model system
that included a range of cell types that reflected the different properties of the two genes, and mirrored the activities of normal cells.
To this end, we assayed IL-3 and GM-CSF gene expression in a
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
of gene expression (4, 8, 13). IL-3 expression is restricted primarily to activated T cells, while GM-CSF expression can be induced
in a wide range of tissues that include T cells, myeloid cells, endothelial cells, epithelial cells, and fibroblasts (13). The IL-3/GMCSF locus is regulated by two separate inducible enhancers situated 14 kb upstream of the IL-3 gene and 3 kb upstream of the
GM-CSF gene (9, 10, 14 –16). These enhancers have distinct tissue-specific activities that mirror IL-3 and GM-CSF expression
patterns. IL-3 enhancer function has only been detected in T cells
(16), while the GM-CSF enhancer is known to function in T cells,
endothelial cells, and myeloid cells (9, 10, 15). Although they
differ in their composite nature, the IL-3 and GM-CSF enhancers
have a similar organization, as they both contain an array of four
NFAT sites (Fig. 1A),4 and in each case the central two sites exist
within an inducible cyclosporin A-suppressible DNase I-hypersensitive (DH)5 site. NFAT has been implicated in the chromatinremodeling events responsible for DH site formation, and this activity may contribute to the strong synergy in function observed
between NFAT and other factors (9, 10, 16).
In this study, we investigated the mechanisms underlying the
differential regulation of the IL-3 and GM-CSF genes and identified two patterns of combinatorial regulation involving NFAT that
mirror the expression patterns for IL-3 and GM-CSF. A composite
NFAT/AP-1 site from the GM-CSF enhancer functions like the
intact GM-CSF enhancer and supports transcription in the same
range of cell types that express NFAT and GM-CSF. A composite
NFAT/Oct element from the IL-3 enhancer functions like the intact IL-3 enhancer and directs T cell-specific transcription. The T
cell specificity of the NFAT/Oct element was accounted for in this
study by its dependence upon specific cofactors in addition to
NFAT and Oct family proteins.
5647
RECONSTITUTION OF T CELL-SPECIFIC TRANSCRIPTION
variety of hemopoietic and nonhemopoietic cell lines following
stimulation with a combination of the phorbol ester PMA and the
calcium ionophore A23187 (Fig. 1B). These signals directly activate the protein kinase C and calcium pathways in T cells and are
known to synergize in the activation of IL-3 and GM-CSF gene
expression. For consistency, the same activation protocol was
adopted for each of the cell types employed in this study. As anticipated, the Jurkat and CEM human T cell lines both expressed
IL-3 and GM-CSF mRNA in a highly inducible fashion. The myeloblastic cell line KG1a, the epithelial cell line 5637, and the
CML cell line K562 all expressed GM-CSF, but not IL-3 in response to stimulation with PMA and A23187. These signals did
not elicit expression of either gene in the Raji human B cell line.
The ubiquitously expressed GAPDH gene was used as a control in
this study to enable comparison of mRNA levels in the different
cell lines.
To assess the activation status of the endogenous IL-3 and GMCSF enhancers in the same panel of cells, we assayed the enhancer
regions for the presence of inducible DH sites (top two panels, Fig.
1C). This approach identifies chromatin-remodeling events and
typically provides the first indication that a locus is undergoing
activation. To confirm that we had selected appropriate DNase
I-digested samples for this analysis, we also assayed the same sam-
ples for a ubiquitous constitutive DH site immediately downstream
of the IL-3 gene (IL-3 ⫹2.8 kb, Fig. 1C (15). A strong correlation
between the induction of DH sites in the enhancers and the activation of gene expression was observed for both genes. The IL-3
enhancer DH site was restricted to activated T cells (Jurkat and
CEM), while the GM-CSF enhancer DH site was also induced in
KG1a cells and K562 cells, but not in Raji cells. Although 5637
cells expressed moderate levels of GM-CSF, they did not contain
a DH site within the GM-CSF enhancer. However, 5637 cells do
exhibit a strong constitutive DH site in the GM-CSF promoter
(15), and the GM-CSF promoter is highly inducible in transfected
5637 cells (15). These results infer that the GM-CSF gene is activated via enhancer-dependent mechanisms in cells such as Jurkat,
CEM, and KG1a, which express NFAT, but enhancer-independent
mechanisms in 5637 cells, allowing us to employ 5637 cells as a
useful control in subsequent studies.
To correlate enhancer function with the above structural and
expression data, the two enhancers were placed upstream of a minimal promoter in a luciferase reporter gene plasmid and tested in a
representative group of four of the six cell lines (Fig. 2A). Enhancer activity was assessed in transfected cells stimulated with
PMA and A23187. The IL-3 and GM-CSF enhancers were both
very active in the two T cell lines, increasing promoter activity by
up to 80-fold. However, the two enhancers behaved very differently in KG1a cells in which the IL-3 enhancer was completely
FIGURE 1. Structure and function of the IL-3/GM-CSF locus. A, Organization of previously defined enhancers and accompanying inducible
DH sites. B, Northern blot analysis of GM-CSF, IL-3, and GAPDH gene
expression in unstimulated cells (⫺) and cells stimulated for 9 h with 20
ng/ml PMA and 1 ␮M A23187 (⫹). (The analysis of unstimulated CEM
cells was repeated elsewhere using an independent sample to confirm the
absence of IL-3 and GM-CSF mRNA.) C, Enhancer DH sites in DNase
I-digested nuclei isolated from either unstimulated cells (⫺) or cells stimulated with 20 ng/ml PMA and 2 ␮M A23187 for 4 h (⫹), as in B. A
constitutive DH site located downstream of the IL-3 gene was also included as a control (IL-3 ⫹2.8 kb) (9, 12). As these sites have been described previously, only the bands of interest are displayed.
FIGURE 2. Tissue-specific regulation of enhancers and NFAT sites in
the IL-3/GM-CSF locus. Enhancers and composite NFAT elements were
linked to a luciferase reporter gene and tested for enhancer function in
transiently transfected cells stimulated for 9 h with 20 ng/ml PMA and 1
␮M A23187. A, Luciferase activities of the IL-3 and GM-CSF enhancer
plasmids pIL3E and pGME. B, Luciferase activities of pIL190 and
pGM420. In each panel, error bars represent the SEM of at least six transfections, and enhancer activity is expressed as relative luciferase activity in
which the promoter alone has an activity of 1.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
5648
The Journal of Immunology
inactive, while the GM-CSF enhancer increased promoter activity
by 110-fold. The two enhancers were both inactive in 5637 cells,
in contrast to the full-length GM-CSF promoter and the SV40
enhancer that are both highly active when analyzed in 5637 cells
by the same procedure in parallel assays (15). Hence, the activities
of the two transfected enhancers directly paralleled the appearance
of DH sites within the endogenous enhancers, reinforcing the direct link between chromatin remodeling and cytokine gene activation. These data are also consistent with other published and
unpublished studies, demonstrating that the GM-CSF enhancer is
active and the IL-3 enhancer is inactive in endothelial cells (15, 16)
and mast cells (data not shown). All of the enhancer activities
reported in this work represented inducible activity, as no significant luciferase activity was detected in any instance in the absence
of stimulation (data not shown).
Composite NFAT sites have activities that mirror their
enhancers of origin
⫺33 to include just the TATA box. The NFAT/AP-1 element was
sufficient to convert the TATA box to an inducible promoter in
both Jurkat cells and endothelial cells. In contrast, the NFAT/OctTATA construct functioned in Jurkat cells, but not endothelial
cells (data not shown). These observations not only confirmed the
results in Fig. 2B, but defined a single composite NFAT site linked
to a TATA box as an entity sufficient to constitute an inducible
tissue-specific promoter.
Mechanisms of IL-3 enhancer activation
To formally identify the DNA elements responsible for IL-3 enhancer activation in T cells, we performed site-directed mutagenesis on each of the three NFAT sites known to be able to function
as enhancer elements and assayed these altered enhancers for function in transfection assays (Fig. 3, A and C). Mutations in either the
Oct or the NFAT motif of the IL190 element reduced the activity
of the enhancer in Jurkat cells by 60 –70%. Mutation of the adjacent high affinity IL140 NFAT similarly reduced enhancer activity
by 60%. In contrast, a mutation in the IL280 NFAT/AP-1 site had
no effect, but this was not unexpected, as this is a weak enhancer
element with a poor AP-1 site. When an array of three copies of the
IL280 element was tested in pXPG-GM55, it was only 5–10% as
active as equivalent arrays of IL140 or IL190 elements (data not
shown). This low activity may be due to the fact that the IL280
AP-1 site is 1 bp further apart from the NFAT site than is observed
for sites that bind NFAT and AP-1 cooperatively (10, 16), and
previous studies of the GM-CSF enhancer have found that lack of
cooperativity in binding equates to lack of function (10).
Having demonstrated that the closely linked IL140 and IL190
elements were critical for enhancer activity, we next assessed
FIGURE 3. Mutagenic analysis of the IL-3 enhancer in Jurkat T cells.
Relative luciferase activity of plasmids containing IL-3 enhancer fragments
was determined after stimulation of the cells for 9 h with 20 ng/ml PMA
and 1 ␮M A23187 and calculated on the basis that pIL3E had an activity
of 1. A, Site-directed mutagenesis of NFAT and Oct elements in the IL-3
enhancer plasmid pIL3E. Error bars represent the SEM of at least seven
transfections. B, Deletion analysis of the IL-3 enhancer. Error bars represent the SEM of at least four transfections. C, Schematic diagram showing the
presence or absence (by mutation) of the NFAT, Oct, and AP-1 elements in
each of the constructs used in the above experiments and in Fig. 6C.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Having established that the IL-3 and GM-CSF enhancers had inducible activities that paralleled the activities of the endogenous
genes, we sought the mechanisms that enabled activation of both
enhancers in T cells, but just the GM-CSF enhancer in other cell
types. As both enhancers consist primarily of arrays of NFAT
sites, we focused on the properties of the two distinct classes of
composite NFAT sites found within these two enhancers (Figs. 1A
and 2B). To select an example of a composite NFAT/AP-1 site, we
chose the GM420 element from the GM-CSF enhancer. The
GM420 element is the most active element in the enhancer and the
only functional NFAT site with the capacity to bind NFAT independently of AP-1 (10). The GM420 element is located within the
minimum enhancer core region associated with the DH site and is
likely to contribute to cyclosporin A-sensitive chromatin-remodeling events within the enhancer. From the IL-3 enhancer, we selected the IL190 NFAT/Oct element that has overlapping NFAT
and Oct elements that are both essential to its function as an enhancer element (16). The IL190 element is also the feature that
best distinguishes the IL-3 enhancer from the GM-CSF enhancer.
Although the IL-3 enhancer also contains a composite NFAT/AP-1
element (IL280, Fig. 1A), it was not regarded as significant in this
analysis, as it does not fit the preferred consensus needed for cooperativity (16), and it did not contribute to overall enhancer activity (see below).
The two different composite NFAT elements were assayed for
enhancer function in the same system used above to test the fulllength enhancers (Fig. 2B). Oligonucleotides containing either the
IL190 NFAT/Oct site or the GM420 NFAT/AP-1 site were introduced upstream of the promoter in the luciferase reporter gene
plasmid. As observed with the full-length IL-3 enhancer, the IL190
element was very active in Jurkat and CEM T cells, but had little
activity in KG1a or 5637 cells. Likewise, the GM420 element had
the same profile of activity as the GM-CSF enhancer, as it was
active in Jurkat, CEM, and KG1a cells, but generated little activity
in 5637 cells. Additional analyses demonstrated that the IL190
element was also inactive in endothelial cells and mast cells under
conditions in which the GM420 element was highly inducible
(data not shown). To extend the observations made with GM420 to
other composite NFAT/AP-1 sites, we performed similar assays
with the GM550 element (Fig. 1A) (10), which also functioned as
an inducible enhancer in both Jurkat cells and KG1a cells (data not
shown).
To ensure that the pXPG-GM55 promoter was not partly responsible for the tissue specificity of pIL190 and pGM420, similar
studies were performed linking just one copy of either an NFAT/
AP-1 site or an NFAT/Oct site to a promoter construct truncated at
5649
5650
6
Note that the Raji cells employed in this study were selected as a useful model of
a lymphoid cell line that expresses AP-1 and Oct-2, but not NFAT, GM-CSF, or IL-3,
even though some other sources of Raji cells do express NFAT (e.g., Ref. 25).
FIGURE 4. Regulation of the IL-3 enhancer by inducible and tissuespecific transcription factors. A, Gel EMSA of transcription factors present
in nuclear extracts prepared from either unstimulated cells (⫺) or cells
stimulated for 3 h with 20 ng/ml PMA and 2 ␮M A23187 (⫹). The GM430
probe used to identify the presence of NFATp represents just the NFATbinding component of the GM420 element. An AP-1 site from the stromelysin gene was used as an AP-1 probe, and an Oct consensus sequence was
used as a probe for Oct family proteins. As these complexes have been
described in previous studies, only the specific bands of interest are shown.
B, Identification of specific Oct family proteins. Nuclear extracts from
unstimulated cells were assayed as in A, but in the presence or absence of
Abs for Brn-2 or Oct-2. An Oct-1 Ab was used with the Raji extract to
verify that the ubiquitous species was Oct-1. C, Northern blot analysis of
OCA-B mRNA. RNA was made from either unstimulated cells (⫺) or cells
stimulated for 9 h with 20 ng/ml PMA and 1 ␮M A23187 (⫹). Filters were
reprobed with GAPDH to verify RNA integrity (not shown). D, Activation
of the IL190 element in Jurkat T cells by cotransfection of pIL190 with
transcription factor expression plasmids. Cells were cotransfected with the
Oct-1 plasmid WS1, the Oct-2 plasmid WS2, the OCA-B plasmid pCDNA/
OBF-1, the Brn-2 plasmid pCDNA3.1/Brn-2, the NFATp plasmid pLGPNFAT1c, or the NIP45 plasmid pCI-NIP45. Luciferase activity was determined after stimulation of the cells for 9 h with 20 ng/ml PMA and 1 ␮M
A23187. In each case, luciferase activity is expressed relative to the pIL190
construct cotransfected with a parent vector. Error bars represent the SEM
of at least four transfections.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
whether the IL140/IL190 region was sufficient for enhancer function. A 79-bp DNA fragment encompassing just the IL140 and
IL190 elements (Fig. 3C) was found to be even more active than
the 330-bp IL-3 enhancer fragment, indicating that this region does
indeed represent the core of the enhancer. The higher apparent
activity of the IL140/IL190 region could indicate the existence of
a repressor in the proximal region of the enhancer, but we suspect
that this increase in activity is more likely the result of positioning
the enhancer core 150 bp closer to the minimal promoter. Similar
increases in activity have been observed in parallel studies of the
GM-CSF enhancer in this system when proximal deletions of nonessential sequences bring the enhancer core closer to the minimal
promoter (data not shown).
The above findings implied that the NFAT and Oct elements
were not only necessary, but perhaps sufficient for the T cell-specific activity of the IL-3 enhancer. However, as the Oct family
protein Oct-1 is ubiquitous and NFAT controls both the IL-3 and
the GM-CSF enhancer, we assumed that additional factors would
be required to drive the T cell-specific activation of the IL-3 enhancer. To identify potential regulators of the IL-3 and GM-CSF
enhancers, we conducted gel mobility shift analyses of NFAT,
AP-1, and Oct family proteins present in nuclear extracts prepared
from the six cell lines employed in the above studies (Fig. 4A). In
each case, AP-1-like proteins were induced by PMA and A23187.
Strong induction of NFAT-like proteins was detected in three cell
lines in which the GM-CSF enhancer was active (Jurkat, CEM,
and KG1a), whereas K562 expressed very low levels and no
NFAT was detected in Raji6 or 5637 cells. As expected, all of the
cells expressed Oct-1 ubiquitously, and Raji B cells also expressed
substantial amounts of Oct-2. However, we were surprised to also
detect another Oct-like factor that comigrated with the N-Oct-3
complex derived from the human Brn-2 Oct family protein that is
expressed in the brain and in melanoma (26, 27). Brn-2 was expressed at a high level in Jurkat cells and at low levels in CEM and
K562 cells. The identities of the Oct-1, Oct-2, and Brn-2 factors
seen in Fig. 4A were confirmed in this study using a combination
of Oct family Abs that eliminated the specific complexes described
above and generated supershifted complexes above the Oct-1 band
(Fig. 4B). In addition, this analysis revealed that CEM cells also
expressed a small amount of Oct-2. A minor species resembling
Oct-2 in Jurkat, KG1a, and 5637 cells was not considered further,
as it did not react with any of the Abs and may represent a simple
artifact. The properties of the NFAT and AP-1 complexes have
been described previously (10) and were not analyzed further.
Note, however, that the GM420 AP-1 site can also associate with
the closely related cAMP response element binding protein/activating transcription factor family of proteins (10).
The lymphoid-specific Oct cofactor OCA-B (28), otherwise
known as OBF-1 (29) or Bob-1 (30), was also considered as a
potential tissue-specific activator of the IL-3 enhancer. OCA-B is
known to be expressed constitutively in B cells and is induced in
activated T cells (31, 32). In T cells, the inducible activity of
OCA-B is also dependent on serine phosphorylation via an inducible kinase (31). We assessed OCA-B mRNA expression by Northern blot analysis (Fig. 4C). As anticipated, OCA-B was expressed
ubiquitously in Raji B cells and was induced to similar levels in
activated Jurkat and CEM T cells. OCA-B mRNA was also expressed at very low levels in activated KG1a cells, but not in 5637
or K562 cells.
RECONSTITUTION OF T CELL-SPECIFIC TRANSCRIPTION
The Journal of Immunology
Reconstitution of T cell-specific Oct/NFAT-dependent
transcription
The above studies indicated that at least two distinct transcription
factors plus their specific cofactors were necessary for efficient
activation of the IL190 NFAT/Oct element. In a bid to recapitulate
the environment of a T cell, we introduced OCA-B, NFAT, and
NIP45 expression plasmids in cotransfections of K562 cells that
express high levels of Oct-1, but low levels of NFAT and no detectable OCA-B. Following activation with PMA and A23187, the
combination of NFATp, NIP45, and OCA-B gave rise to a striking
50-fold increase in the activity of pIL190, which had previously
supported an activity indistinguishable from that of a plasmid containing just the core promoter (Fig. 5A). The effects of these three
factors were specific for the IL190 element, as they had no influence on the plasmid containing just the promoter. The restoration
of IL190 activity was highly dependent upon OCA-B, as the combination of NFATp and NIP45 had negligible effect, while OCA-B
alone increased pIL190 activity by 10-fold.
The Raji B cells employed in this study presented a distinctly
different model for reconstituting IL190 activity, as they expressed
Oct-1, Oct-2, and the Oct cofactor OCA-B, but not NFAT. In
cotransfections of Raji cells, NFATp and NIP45 synergized to increase the activity of pIL190 by 10-fold (Fig. 5B). NIP45 clearly
needed its DNA-binding partner NFATp to play any role in this
study, as no change in activity was detected after cotransfection of
just NIP45. NFATp and NIP45 also synergized to activate the
IL140 and GM420 NFAT elements in Raji cells (data not shown),
but had no effect on the promoter alone (Fig. 5B).
The pIL190 plasmid was next assayed in cotransfections of
KG1a myeloid cells, which express high levels of Oct-1 and
NFAT, but relatively low levels of OCA-B compared with Jurkat,
CEM, and Raji. In this instance, OCA-B and NIP45 cooperated to
increase inducible pIL190 activity 6-fold (Fig. 5C), whereas
OCA-B alone increased activity 3-fold and NIP45 alone increased
activity 2-fold. The actions of these factors were again seen to be
specific for the IL190 element, as they had no effect on the promoter alone. As in Jurkat cells (Fig. 4D), Brn-2 was also implicated as an antagonist of Oct/OCA-B-dependent transcription in
KG1a cells (Fig. 5C). Cotransfection of a Brn-2 expression plasmid suppressed the weak inducible enhancer activity supported by
the IL190 element in KG1a cells, and suppressed its activation by
cotransfection of either OCA-B or NIP45 (Fig. 5C).
The otherwise inactive IL190 element was similarly activated
by the combination of OCA-B and NIP45 in mast cells and endothelial cells that express Oct-1 and NFAT, but not OCA-B (data
not shown).
The above transfections of pIL190 (containing an array of three
Oct/NFAT elements) (Fig. 5) produced some Oct-dependent activities that were not observed below with the native IL-3 enhancer, which contains just one Oct element (Fig. 6). Assays of
pIL190 in K562 and Raji cells indicated that three linked Oct/
NFAT elements were sufficient to support a modest degree of activity in the presence of just Oct-1 and OCA-B, but required NFAT
for maximum effect (Fig. 5, A and C). Even in the absence of any
cotransfected factors, the IL190 plasmid had some activity in Raji
B cells that express Oct-1, Oct-2, and OCA-B constitutively (Fig.
5C). In contrast to the normally inducible native IL-3 enhancer, the
weak pIL190 activity seen in Raji cells in the absence of cotransfection was entirely constitutive, while the increased activity seen
after NFATp cotransfection was inducible (data not shown).
NFAT and Oct factors and cofactors are sufficient to activate
the intact IL-3 enhancer outside of T cells
Having shown that an array of NFAT/Oct elements could be activated by a specific combination of factors, it was now necessary
to determine whether the same group of four factors was sufficient
to activate the native IL-3 enhancer that contains an array of NFAT
sites, but only one Oct element. This question was addressed by
assaying the activity of pIL3E in K562 and Raji cells that had been
cotransfected with the NFAT, NIP45, and OCA-B expression vectors and stimulated with PMA and A23187, as above. In the absence of cotransfected factors, the IL-3 enhancer was completely
inactive in both K562 and Raji cells (Fig. 6, A and B). However,
the activity of the IL-3 enhancer was restored in K562 cells by the
combination of NFATp, NIP45, and OCA-B (Fig. 6A) and in Raji
cells by NFATp and NIP45 (Fig. 6B). As was the case with
pIL190, NIP45 and NFATp synergized in the activation of pIL3E
and, as expected, NIP45 was highly dependent on NFAT for its
ability to activate. This restoration of IL-3 enhancer activity required just the core IL140/IL190 region because a similar 19-fold
activation of pIL140/IL190 was observed in transfected Raji cells
overexpressing NFATp and NIP45 (data not shown).
The above studies implied that the NFAT/Oct element was the
significant site that distinguished the IL-3 enhancer from the GMCSF enhancer and dictated its T cell specificity. To determine
whether a single site in a complex enhancer could in fact govern
cell specificity, we performed the simple operation of converting
the Oct site to an AP-1 site to recreate an element resembling the
NFAT/AP-1 sites present in the GM-CSF enhancer (pIL3-AP1,
Fig. 3C). Remarkably, this mutation was sufficient to generate an
enhancer that could now function in KG1a cells, whereas the native IL-3 enhancer is completely inactive in the cells (Fig. 6C).
From these studies, we conclude that NFAT can activate transcription by at least two distinct mechanisms (Fig. 6D): a T cell-specific
pathway in which NFAT recruits or assists binding of Oct factors
and the cofactors NIP45 and OCA-B, and a more general pathway
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
The preceding analyses of the factors and cofactors present in T
cells highlighted Oct-1, Oct-2, Brn-2, OCA-B, and NFAT family
proteins as potential activators of the IL-3 enhancer. An additional
cofactor that had to be considered as a candidate was the NFATbinding cofactor NIP45 that is expressed predominantly in lymphoid cells (22). However, the NIP45 expression pattern in the cell
lines employed in this study was not determined, as a human
NIP45 probe was unavailable, and we were unsuccessful in our
attempts to detect NIP45 using a mouse NIP45 probe.
The roles of these potential regulators of the IL-3 enhancer were
investigated by introducing them on expression plasmids in cotransfections with the pIL190 luciferase plasmid containing three
copies of the IL190 element (Fig. 4D). In activated Jurkat cells,
Oct-1, OCA-B, and NFAT were the most potent activators of
pIL190, increasing its inducible activity by 5– 8-fold, whereas
Oct-2 increased expression by about 2-fold. The NFAT cofactor
NIP45 also increased pIL190 activity 2-fold and had the capacity
to cooperate with NFAT in this process to increase the degree of
enhancement to 8-fold compared with the 5-fold activation seen
with NFAT alone. In contrast, Brn-2 was a strong repressor of
pIL190. Parallel assays in CEM T cells confirmed that Brn-2 was
a repressor of the IL190 element in cells, in which it was normally
active, as overexpression of Brn-2 reduced activity by 60% and
transfection of a Brn-2 antisense RNA expression plasmid increased IL190 activity by 40% (data not shown). Along these lines,
it was also interesting to note that Jurkat cells produced the highest
levels of Brn-2 and that the IL-3 enhancer was less active in Jurkat
cells than CEM cells. Hence, the activation of the IL190 NFAT/
Oct element in T cells is likely to involve a complex assembly of
at least four distinct factors, with Brn-2 working to dampen Octdependent activation.
5651
5652
RECONSTITUTION OF T CELL-SPECIFIC TRANSCRIPTION
in which NFAT activates transcription by recruiting the ubiquitous
transcription factor AP-1 with no apparent need for additional tissue-specific cofactors.
Discussion
The compact IL-3/GM-CSF locus is a valuable model for studying
the combinatorial regulation of genes that are activated via the
same pathways in one cell type, but differentially regulated in others. The IL-3 and GM-CSF enhancers only function in cells in
which their DH sites can form, and the IL-3 and GM-CSF genes
are completely silenced when NFAT binding and DH site induction are blocked by the NFAT inhibitor cyclosporin A (9, 15, 16).
In this study, we identified distinct classes of composite NFAT
sites from the IL-3 and GM-CSF enhancers that differentially regulate the IL-3 and GM-CSF genes. Composite NFAT sites are a
common feature of cytokine genes, and NFAT appears to be highly
versatile in the mechanisms it employs to synergize with other
factors. In addition to directly recruiting factors such as AP-1,
NFAT is likely to play a major role in decondensing chromatin and
mediating the formation of DH sites, because DH site formation
within the IL-3 and GM-CSF enhancers (9, 16) is Ca2⫹ dependent
and cyclosporin A sensitive. Our own unpublished studies suggest
that NFAT may be sufficient to form a DH site even in the absence
of a linked AP-1 site (data not shown). Furthermore, it is known
that NFAT can recruit the histone acetyl transferase CBP/p300 (33,
34), which may contribute to NFAT-dependent chromatin remodeling. Hence, NFAT is not just a docking site for factors such as
AP-1, but is likely to play a significant role in indirectly recruiting
transcription factors by increasing access to their binding sites
within chromatin. Conversely, NFAT may rely on recruiting partners that can interact directly with the polymerase complex before
it can activate transcription. In the case of NFAT/Oct elements, it
is known that OCA-B forms a link between Oct factors and components of the TFIID complex that interacts with the TATA box
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 5. Reconstitution of IL190 NFAT/Oct enhancer function in cells other than T cells. pIL190 was cotransfected with plasmids expressing
NFATp, NIP45, or OCA-B, as in Fig. 4D. Relative luciferase activity was determined following 9-h stimulation with 20 ng/ml PMA and 1 ␮M A23187,
and expressed on a scale in which pIL90 cotransfected with a parent vector had an activity of 1. A model indicates in each case, the transcription factors
present in the cell line before and after cotransfections leading to maximal activity from the IL190 element. A, Mean of at least five transfections in K562
cells. B, Mean of at least three transfections in Raji B cells. C, Mean of at least four transfections in KG1a cells. In each case, error bars represent the SEM.
The Journal of Immunology
5653
and RNA polymerase (35, 36). In the case of NFAT/AP-1 elements, AP-1 is a strong activator of the TFIID complex. The
NFAT/AP-1 complex has even greater potential to remodel chromatin because AP-1 can also directly disrupt nucleosome organization (37). The IL-2 promoter is likely to be another example in
which NFAT participates in chromatin remodeling and AP-1
recruitment because it also encompasses an array of composite
NFAT/AP-1 sites and an inducible cyclosporin A-sensitive DH
site (38, 39).
Contributions of NFAT and Oct elements to tissue-specific gene
expression
There are many examples in which NFAT and Oct elements contribute to activation of tissue-specific gene expression, but their
role in directing a specific pattern of expression has not previously
been determined. The T cell-specific IL-2 promoter contains an
array of four composite NFAT/AP-1 elements (39) that, while essential for its activity, cannot account for its T cell specificity.
When introduced into transgenic mice, the distal IL-2 NFAT/AP-1
element was sufficient to support activation of transcription, but its
activity was not confined to T cells (40). The IL-4 promoter depends on interactions between NFAT and AP-1 (41), but this is
insufficient for T cell-specific expression as it also requires factors
such as c-maf (42).
Our studies have highlighted the importance of Oct elements in
T cell-specific transcription, and the replacement of the sole Oct
element by an AP-1 element was sufficient to relieve restrictions
on the activity of the IL-3 enhancer. The T cell-specific IL-2, IL-3,
and IL-4 promoters each contain Oct elements in addition to
NFAT and AP-1 elements (43– 47; unpublished data). Hence, the
combination of NFAT, AP-1, Oct, NIP45, and OCA-B proteins
may provide a general mechanism for activating the T cell-specific
expression of a subset of cytokine genes.
Oct elements also contribute to B cell-specific transcription (reviewed in Ref. 48), and they are conserved features of the promoters of B cell-specific Ig genes. An isolated Oct element linked
to a TATA box supports transcription in B cells, but not fibroblasts
(49), and OCA-B is essential for Oct-dependent transcription in B
cells (50). However, although the predominantly lymphoid proteins Oct-2 and OCA-B have both been proposed as mediators of
B cell-specific transcription (28 –30, 51), neither protein is necessary or sufficient for activation of B cell-specific promoters. Ig
genes are still expressed in both OCA-B and Oct-2-deficient B
cells (32, 52), and Oct-2 expression has been detected in a variety
of hemopoietic cell types (53). In the case of the IgH enhancer, the
octamer is dispensable for enhancer function as a tripartite unit
comprising sites for Ets-1, TFE3, and PU.1 and is sufficient to
reconstitute enhancer activity in B cells, but not fibroblasts (reviewed in Ref. 54). These observations highlight the degree of
redundancy employed in the combinatorial regulation of Ig genes.
The activity of Oct elements may also be regulated by the ratio
in the expression of different Oct family proteins, and in this study
the IL-3 enhancer had a greater relative activity in the T cell line
that expressed the least amount of Brn-2 relative to Oct-1. Unlike
Oct-1 and Oct-2, Brn-2 lacks the ability to recruit OCA-B (30).
Hence, we hypothesize that Brn-2 may in some situations function
as a repressor of Oct elements by serving as a competitive inhibitor
of the Oct/OCA-B complex.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 6. Reconstitution of IL-3 enhancer activity in cells other than T cells by cotransfection and mutagenesis. Cells were transfected with luciferase
plasmids and stimulated for 9-h stimulation with 20 ng/ml PMA and 1 ␮M A23187. Relative luciferase activity was calculated on a scale in which pIL3E
had an activity of 1. A, K562 cells were transfected with pXPG-GM55 or pIL3E and cotransfected with NFATp-, NIP45-, and OCA-B-expressing plasmids
or with parent vector. Error bars represent the SEM of at least three transfections. B, Raji B cells were transfected with pXPG-GM55 or pIL3E and
cotransfected with NFATp- and NIP45-expressing plasmids or with parent vector. Error bars represent the SEM of at least four transfections. C, KG1a cells
were transfected with either pXPG-GM55, pIL3E, or pIL3AP-1, in which the Oct element in the enhancer was changed to an AP-1 site (Fig. 3C). Error
bars represent the SEM of at least four transfections. D, Model of differential regulation of the IL-3 and GM-CSF enhancers in different cell types.
5654
RECONSTITUTION OF T CELL-SPECIFIC TRANSCRIPTION
Mechanisms of T cell-specific transcription
Combinatorial regulation maintains tight control over gene
expression
The IL-3 locus is regulated via several distinct mechanisms
Although the combination of NFAT, Oct, NIP45, and OCA-B is
able to activate the IL-3 enhancer, it is not sufficient to activate the
whole IL-3 locus, as the endogenous IL-3 gene remained silent
upon cotransfection of these factors into a variety of non-T cell
types (data not shown). The enhancer may not even be essential for
IL-3 expression, as OCA-B-deficient T cells still express normal
levels of IL-2 and IL-3 (32). Similar to the situation in Ig genes
(54), the IL-3 locus appears to be controlled by a complex and
redundant set of mechanisms. Activation of the IL-3 locus outside
of T cells also requires activation of the T cell-specific IL-3 promoter, which has binding sites for AML-1 and GATA proteins in
addition to NFAT, Oct, and AP-1 sites.
In the IL-3 locus, the IL-3 enhancer responds to TCR signals
when an immune response is elicited, but we believe this only
represents the end stage of a complex series of events that begin
much earlier in T cell development. An array of constitutive T
cell-specific DH sites extends up to 5 kb upstream of the IL-3 gene
(9). Because they exist even in primitive T cell lines such as Molt4
that do not express IL-3 and in which the IL-3 enhancer is inactive
(unpublished data), we suggest that they function as a chromatinopening domain that primes the locus for subsequent activation via
the TCR. This developmental pathway resembles the chromatin
remodeling that occurs in the IFN-␥ and IL-4 genes during the
course of T cell differentiation (59). When naive T cells differentiate down distinct pathways, DH sites appear in the IL-4 locus in
Th2 T cells and in the IFN-␥ locus in Th1 T cells, where these
genes gain the potential to be induced via the TCR.
Given the complexity of the IL-3 locus, it is not surprising then
that activation of the IL190 element alone was insufficient to activate IL-3 gene expression outside of T cells. This is in contrast to
studies of the IL-4 locus, in which association of NFAT, NIP45,
and c-maf with proximal elements of the promoter was sufficient to
induce expression of the endogenous IL-4 gene in B lymphoma
cells (22). Although our studies have not identified a mechanism
that is sufficient to drive IL-3 expression, they have clearly identified an important mechanism driving T cell-specific transcription
that may be widely used.
In this study, we demonstrated that complex enhancers can be
broken down to simple composite elements that retain the properties of the intact enhancers. In doing so, we have provided an
example of the power of combinatorial regulation to fix patterns of
gene expression. Composite NFAT/Oct and NFAT/AP-1 elements
retained the inducible tissue-specific properties of their parent enhancers, and these patterns were essentially the same as those of
the endogenous IL-3 and GM-CSF genes to which they were
linked. The IL190 element represented the minimal unit that could
function as a T cell-specific enhancer, but in the context of the
native IL-3 enhancer it appeared to function in concert with the
closely linked IL140 NFAT site. An array of IL190 elements was
not as active as the IL140/IL190 enhancer core region, suggesting
that correct enhancer function may require assembly of a specific
enhanceosome-like complex. Such a complex could also include
architectural proteins such as HMGI(Y) because NFAT binding is
promoted by HMGI(Y) (60) and the NFAT and Oct sites in the
IL-3 enhancer encompass A/T-rich segments likely to favor
HMGI(Y) binding.
Composite NFAT sites also represent points at which major signaling pathways converge, thus ensuring very tight regulation of
cytokine gene expression. Furthermore, NFAT/AP-1 complexes
and OCA-B each require both a calcium and a kinase signal to
efficiently activate transcription (5, 31). This presents a requirement for additional specific kinases to phosphorylate proteins such
as Jun and OCA-B. The complexity and interdependence of the
signaling pathways and factors involved means that cytokine genes
require correctly delivered signals in the right cell type for gene
activation to occur.
Acknowledgments
We are greatly indebted to L. Corcoran, L. Glimcher, P. Matthias, A. Rao,
R. Sturm, and T. Wirth for generously providing DNA plasmids and antisera and contributing valuable advice. We thank J. Gamble for providing
endothelial cells. We thank C. Bonifer for stimulating discussions and constructive comments, and Tom Gonda for comments on the manuscript.
References
1. Chen, L. 1999. Combinatorial gene regulation by eukaryotic transcription factors.
Curr. Opin. Struct. Biol. 9:48.
2. Wolberger, C. 1998. Combinatorial transcription factors. Curr. Opin. Genet. Dev.
8:552.
3. Jain, J., P. G. McCaffrey, Z. Miner, T. K. Kerpola, J. N. Lambert, G. L. Verdine,
T. Curran, and A. Rao. 1993. The T-cell transcription factor NFATp is a substrate
for calcineurin and interacts with Fos and Jun. Nature 365:352.
4. Rao, A. 1994. NF-ATp: a transcription factor required for the coordinate induction of several cytokine genes. Immunol. Today 15:274.
5. Rao, A., C. Luo, and P. G. Hogan. 1997. Transcription factors of the NFAT
family: regulation and function. Annu. Rev. Immunol. 15:707.
6. Northrop, J. P., K. S. Ullman, and G. R. Crabtree. 1993. Characterization of the
nuclear and cytoplasmic components of the lymphoid-specific nuclear factor of
activated T cells (NFAT) complex. J. Biol. Chem. 268:2917.
7. Crabtree, G. R. 1999. Generic signals and specific outcomes: signalling through
Ca2⫹, calcineurin, and NF-AT. Cell 96:611.
8. Masuda, E. S., Y. Naito, K. Arai, and N. Arai. 1993. Expression of lymphokine
genes in T cells. The Immunologist 1:198.
9. Cockerill, P. N., M. F. Shannon, A. G. Bert, G. R. Ryan, and M. A. Vadas. 1993.
The granulocyte-macrophage colony-stimulating factor/interleukin 3 locus is regulated by an inducible cyclosporin A sensitive enhancer. Proc. Natl. Acad. Sci.
USA 90:2466.
10. Cockerill, P. N., A. G. Bert, F. Jenkins, G. R. Ryan, M. F. Shannon, and
M. A. Vadas. 1995. Human granulocyte-macrophage colony-stimulating factor
enhancer function is associated with cooperative interactions between AP-1 and
NFATp/c. Mol. Cell. Biol. 15:2071.
11. Thanos, D., and T. Maniatis. 1995. Virus induction of human IFN␤ gene expression requires the assembly of an enhanceosome. Cell 83:1091.
12. Carey, M. 1998. The enhanceosome and transcriptional synergy. Cell 92:5.
13. Nicola, N. A. 1989. Hemopoietic cell growth factors and their receptors. Annu.
Rev. Biochem. 58:45.
14. Cockerill, G. W., A. G. Bert, G. R. Ryan, J. R. Gamble, M. A. Vadas, and
P. N. Cockerill. 1995. Regulation of granulocyte-macrophage colony-stimulating
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Although we have presented the first clear mechanism for inducible T cell-specific transcription, there are other examples of
developmentally regulated T cell-specific enhancers, and individual transcription factors that contribute to programs of T
cell-specific gene regulation (reviewed in Refs. 55 and 56). The
best example is the TCR ␣ enhancer, which contains an array of
individual binding sites for the transcription factors ATF (activating transcription factor), AML-1, and Ets-1, and the architectural proteins lymphocyte enhancer-binding factor-1 or T
cell-specific factor-1 (TCF-1) that are required for the assembly
of an enhanceosome (reviewed in Refs. 12 and 55). In this
instance, T cell specificity is also derived from combinatorial
regulation as the predominantly lymphoid factors Ets-1, lymphocyte enhancer-binding factor-1, and TCF-1 cooperate with
AML-1, which is expressed by T cells and myeloid cells, but
not B cells. Interestingly, AML-1 also regulates the activities of
the IL-3 promoter (57) and the GM-CSF promoter and enhancer
(58), and thereby has the potential to contribute to the T cellspecific activation of IL-3 in T cells and the activation of GMCSF expression in both T cells and myeloid cells.
The Journal of Immunology
15.
16.
17.
18.
19.
20.
21.
22.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37. Ng, K. W., P. Ridgway, D. R. Cohen, and D. J. Tremethick. 1997. The binding
of a Fos/Jun heterodimer can completely disrupt the structure of a nucleosome.
EMBO J. 16:2072.
38. Siebenlist, U., D. B. Durand, P. Bressler, N. J. Holbrook, C. A. Norris,
M. Kamoun, J. A. Kant, and G. R. Crabtree. 1986. Promoter region of interleukin-2 gene undergoes chromatin structure changes and confers inducibility on
chloramphenicol acetyltransferase gene during activation of T cells. Mol. Cell.
Biol. 6:3042.
39. Rooney, J. W., Y. L. Sun, L. H. Glimcher, and T. Hoey. 1995. Novel NFAT sites
that mediate activation of the interleukin-2 promoter in response to T-cell receptor stimulation. Mol. Cell. Biol. 15:6299.
40. Verweij, C. L., C. Guidos, and G. R. Crabtree. 1990. Cell type specificity and
activation requirements for NFAT-1 (nuclear factor of activated T cells) transcriptional activity determined by a new method using transgenic mice to assay
transcriptional activity of an individual nuclear factor. J. Biol. Chem. 15:15788.
41. Rooney, J. W., T. Hoey, and L. H. Glimcher. 1995. Coordinate and cooperative
roles for NF-AT and AP-1 in the regulation of the murine IL-4 gene. Immunity
2:473.
42. Ho, I.-C., M. R. Hodge, J. W. Rooney, and L. H. Glimcher. 1996. The protooncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell
4:973.
43. Chuvpilo, S., C. Schomberg, R. Gerwig, A. Heinfling, R. Reeves, F. Grummt, and
E. Serfling. 1993. Multiple closely linked NFAT/octamer and HMGI(Y) binding
sites are part of the interleukin-4 promoter. Nucleic Acids Res. 21:5694.
44. Davies, K., E. C. TePas, D. G. Nathan, and B. Mathey-Prevot. 1993. Interleukin-3
expression by activated T cells involves an inducible, T-cell-specific factor and
an octamer binding protein. Blood 81:928.
45. Kamps, M. P., L. Corcoran, J. H. Lebowitz, and D. Baltimore. 1990. The promoter of the human interleukin-2 gene contains two octamer-binding sites and is
partially activated by the expression of Oct-2. Mol. Cell. Biol. 10:5464.
46. Pfeuffer, I., S. Klein-Hessling, A. Heinfling, S. Chuvpilo, C. Escher, T. Brabletz,
B. Hentsch, H. Schwarzenbach, P. Matthias, and E. Serfling. 1994. Octamer
factors exert a dual effect on the IL-2 and IL-4 promoters. J. Immunol. 153:5572.
47. Szabo, S. J., J. S. Gold, T. L. Murphy, and K. M. Murphy. 1993. Identification
of cis-acting regulatory elements controlling interleukin-4 gene expression in T
cells: roles for NF-Y and NF-ATc. Mol. Cell. Biol. 13:4793.
48. Henderson, A., and K. Calame. 1998. Transcriptional regulation during B cell
development. Annu. Rev. Immunol. 16:163.
49. Wirth, T., L. Staudt, and D. Baltimore. 1987. An octamer oligonucleotide upstream of a TATA motif is sufficient for lymphoid-specific promoter activity.
Nature 329:174.
50. Laumen, H., P. J. Nielson, and T. Wirth. 2000. The BOB.1/OBF.1 co-activator is
essential for octamer-dependent transcription in B cells. Eur. J. Immunol. 2000:
458.
51. Muller, M. M., S. Ruppert, W. Schaffner, and P. Matthias. 1988. A cloned octamer transcription factor stimulates transcription from lymphoid-specific promoters in non-B cells. Nature 336:544.
52. Corcoran, L. M., and M. Karvelas. 1994. Oct-2 is required early in T cell-independent B cell activation for G1 progression and for proliferation. Immunity
1:635.
53. Cockerill, P. N., and S. P. Klinken. 1990. Octamer-binding proteins in diverse
hemopoietic cells. Mol. Cell. Biol. 10:1293.
54. Ernst, P., and S. T. Smale. 1995. Combinatorial regulation of transcription II: the
immunoglobulin ␮ heavy chain gene. Immunity 2:427.
55. Clevers, H., and P. Ferrier. 1998. Transcriptional control during T-cell development. Curr. Opin. Immunol. 10:166.
56. Kuo, C. T., and J. M. Leiden. 1999. Transcriptional regulation of T lymphocyte
development and function. Annu. Rev. Immunol. 17:149.
57. Taylor, D. S., J. P. Laubach, D. G. Nathan, and B. Mathey-Prevot. 1996. Cooperation between core binding factor and adjacent promoter elements contributes
to the tissue-specific expression of interleukin-3. J. Biol. Chem. 271:14020.
58. Cockerill, P. N., C. S. Osborne, A. G. Bert, and R. J. M. Grotto. 1996. Regulation
of GM-CSF gene transcription by core-binding factor. Cell Growth Differ. 7:917.
59. Agarwal, S., and A. Rao. 1998. Modulation of chromatin structure regulates
cytokine gene expression during T cell differentiation. Immunity 9:765.
60. Shang, C., J. Attema, D. Cakouros, P. N. Cockerill, and M. F. Shannon. 1999.
Nuclear factor of activated T cells contributes to the function of the CD28 response region of the granulocyte-macrophage colony-stimulating factor promoter. Int. Immunol. 11:1945.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
23.
factor and E-selectin expression in endothelial cells by cyclosporin A and the T
cell transcription factor NFAT. Blood 86:2689.
Cockerill, P. N., A. G. Bert, D. Roberts, and M. A. Vadas. 1999. The human
granulocyte-macrophage colony-stimulating factor gene is autonomously regulated in vivo by an inducible tissue-specific enhancer. Proc. Natl. Acad. Sci. USA
96:15097.
Duncliffe, K. D., A. G. Bert, M. A. Vadas, and P. N. Cockerill. 1997. A T
cell-specific enhancer in the interleukin-3 locus is activated cooperatively by Oct
and NFAT elements within a DNaseI-hypersensitive site. Immunity 6:175.
Cockerill, P. N. 2000. Identification of DNaseI hypersensitive sites within nuclei.
Methods Mol. Biol. 130:29.
Bert, A. G., J. Burrows, C. S. Osborne, and P. N. Cockerill. 2000. Generation of
an improved luciferase reporter gene plasmid that employs a novel mechanism
for high copy replication. Plasmid 44:173.
Nordeen, S. K. 1988. Luciferase reporter gene vectors for analysis of promoters
and enhancers. BioTechniques 6:454.
Luo, C., E. Burgeon, J. A. Carew, P. G. McCaffrey, T. M. Badalian, W. S. Lane,
P. G. Hogan, and A. Rao. 1996. Recombinant NFAT1 (NFATp) is regulated by
calcineurin in T cells and mediates transcription of several cytokine genes. Mol.
Cell. Biol. 16:3955.
Muller-Immergluck, M. M., W. Schaffner, and P. Matthias. 1990. Transcription
factor Oct-2A contains functionally redundant activating domains and works selectively from a promoter but not from an enhancer position in non-lymphoid
(HeLa) cells. EMBO J. 9:1625.
Hodge, M. R., H. J. Chun, J. Rengarajan, A. Alt, R. Lieberson, and
L. H. Glimcher. 1996. NF-AT-driven interleukin-4 transcription potentiated by
NIP45. Science 274:1903.
Smith, A. G., G. Brightwell, S. E. Smit, P. G. Parsons, and R. A. Sturm. 1998.
Redox regulation of Brn-2/N-Oct-3 POU domain DNA binding activity and proteolytic formation of N-Oct-5 during melanoma cell nuclear extraction. Melanoma Res. 8:2.
Sturm, R. A., G. Das, and W. Herr. 1988. The ubiquitous octamer-binding protein
Oct-1 contains a POU domain with a homeobox subdomain. Genes Dev. 2:1582.
Yaseen, N. R., A. L. Maizel, F. Wang, and S. Sharma. 1993. Comparative analysis of NFAT (nuclear factor of activated T cells) complex in human T and B
lymphocytes. J. Biol. Chem. 268:14285.
Schreiber, E., A. Tobler, U. Malipiero, W. Schaffner, and A. Fontana. 1993.
cDNA cloning of human N-Oct-3, a nervous-system specific POU domain transcription factor binding to the octamer motif. Nucleic Acids Res. 21:253.
Thomson, J. A. F., P. G. Parsons, and R. A. Sturm. 1993. In vivo and in vitro
expression of octamer binding proteins in human melanoma metastases, brain
tissue and fibroblasts. Pigm. Cell. Res. 6:13.
Luo, Y., and R. G. Roeder. 1995. Cloning, functional characterization, and mechanism of action of the B-cell-specific transcriptional coactivator OCA-B. Mol.
Cell. Biol. 15:4115.
Strubin, M., P. Newell, and P. Matthias. 1995. OBF-1, a novel B cell-specific
coactivator that stimulates immunoglobulin promoter activity through association
with octamer-binding proteins. Cell 80:497.
Gstaiger, M., L. Knoepfel, O. Georgiev, W. Schaffner, and M. C. Hovens. 1995.
A B cell coactivator of octamer-binding transcription factors. Nature 373:360.
Zwilling, S., A. Diechman, P. Pfisterer, P. Angel, and T. Wirth. 1997. Inducible
expression and phosphorylation of coactivator BOB.1/OBF.1 in T cells. Science
277:221.
Sauter, P., and P. Matthias. 1997. The B cell-specific coactivator OBF-1 (OCA-B,
Bob-1) is inducible in T cells and its expression is dispensable for IL-2 gene
expression. Immunobiology 198:207.
Avots, A., M. Buttmann, S. Chuvpilo, C. Escher, U. Smola, A. J. Bannister,
U. R. Rapp, T. Kouzarides, and E. Serfling. 1999. CBP/p300 integrates Raf/Racsignaling pathways in the transcriptional induction of NF-ATc during T cell
activation. Immunity 10:515.
Garcia-Rodriguez, C., and A. Rao. 1998. Nuclear factor of activated T cells
(NFAT)-dependent transactivation regulated by the coactivators p300/CREBbinding protein (CBP). J. Exp. Med. 187:2031.
Luo, Y., S. Stevens, H. Xiao, and R. G. Roeder. 1998. Coactivation by OCA-B:
definition of critical regions and synergism with general factors. Mol. Cell. Biol.
18:3803.
Wolstein, O., A. Silkov, M. Revach, and R. Dikstein. 2000. Specific interaction
of TAFII105 with OCA-B is involved in activation of octamer-dependent transcription. J. Biol. Chem. 275:16459.
5655