T Cell Modulation of Intimal Thickening After
Vascular Injury
The Bimodal Role of IFN-␥ in Immune Deficiency
Paul C. Dimayuga, Hongyan Li, Kuang-Yuh Chyu, Gunilla Nordin Fredrikson, Jan Nilsson,
Michael C. Fishbein, Prediman K. Shah, Bojan Cercek
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Background—Immune deficiency results in exuberant intimal thickening after arterial injury. The mechanisms involved
are not well defined. We investigated the role of T cells and IFN-␥ in the response to injury in normal and
immune-deficient Rag-1KO mice.
Methods and Results—Carotid arterial injury was induced in wild-type (WT), Rag-1KO mice, and Rag-1KO mice
reconstituted with T cell-enriched splenocytes. The exuberant intimal thickening in Rag-1KO mice compared with WT
mice 21 days after injury was reduced by T cell transfer (P⬍0.01). Exogenous IFN-␥ starting on the day of injury
inhibited intimal thickening in Rag-1KO mice. However, antibody neutralization of endogenous IFN-␥ in Rag-1KO
mice starting 7 days after injury decreased intimal thickening, indicating that late presence of IFN-␥ promoted intimal
thickening in Rag-1KO mice. Results further suggest that the effect of late IFN-␥ in Rag-1KO mice is mediated in part
by increased IRF-1 and iNOS expression, coupled with low SOCS1 expression.
Conclusion—T cells inhibit intimal thickening in the early stages of the response to injury through basal IFN-␥ secretion.
In the Rag-1KO mice, late IFN-␥ expression promotes intimal thickening. These findings add novel insight to conditions
of immune deficiency that affect intimal thickening. (Arterioscler Thromb Vasc Biol. 2005;25:2528-2534.)
Key Words: IFN-␥ 䡲 immune deficiency 䡲 intimal thickening 䡲 lymphocytes 䡲 Rag-1KO mice
V
1KO mice;12 yet, it is not known if T cell mediated inhibition
of intimal thickening is independent of B cell interaction. In
the current study, we continued the investigation by testing
the role of T cell-secreted cytokine IFN-␥ in intimal thickening after arterial injury by transferring T cells into Rag1KO mice. Administration of recombinant IFN-␥ to Rag1KO mice was used to assess the direct effects of the cytokine
on intimal thickening. We also investigated the mechanisms
of IFN-␥ dysregulation in the exuberant intimal thickening in
immune deficient mice after arterial injury.
arious states of immune deficiency result in increased
intimal thickening after arterial injury.1–3 The mechanisms involved are not completely understood. T cells are
widely believed to inhibit intimal thickening, an effect
attributed to IFN-␥.4 However, CD4⫹ T cell transfer increased
atherosclerosis in compound apolipoprotein E-deficient/
immune-deficient SCID mice,5 and IFN-␥ augmented native
atherosclerosis6 and graft arteriosclerosis.7
The effect of IFN-␥ on arterial response to injury in
conditions of immune-deficiency is unknown. There has been
speculation that increased serum IFN-␥ may contribute to
accelerated coronary artery disease in HIV-positive patients.8,9 In vitro studies have shown that IFN-␥ can promote
smooth muscle cell proliferation,10 likely through IFN regulatory factor-1 (IRF-1) regulation of inducible nitric oxide
synthase (iNOS) expression.11 These findings suggest a
complicated balance in the modulatory role of T cells in the
vascular response to injury, and a dichotomy of the effects of
IFN-␥.
We have previously reported that B cells inhibit arterial
injury-induced intimal thickening2 in immune-deficient Rag-
Methods
Injury of Wild-Type and Rag-1KO Mice
Cuff injury of the carotid artery was performed on 25-week-old male
mice (B6/129S-Rag-1⫺/⫺ and B6/129SF2 controls; Jackson Laboratory, Bar Harbor, Me) as previously described2 and euthanasia was
performed after 1, 3, 7, or 21 days. Blood was collected by
retro-orbital bleed. The Institutional Animal Care and Use Committee approved the experimental protocols used in this study.
T Cell Reconstitution
Splenocytes from age-matched wild-type (WT) mice were isolated as
previously described.2 Aliquots of the cells were cultured in RPMI/
Original received February 3, 2005; final version accepted September 28, 2005.
From Atherosclerosis Research Center (P.C.D., H.L., K.-Y.C., P.K.S., B.C.), Division of Cardiology, Department of Medicine, Cedars-Sinai Medical
Center and David Geffen School of Medicine at UCLA and the Department of Pathology (M.C.F.), David Geffen School of Medicine at UCLA, Los
Angeles, Calif; and Experimental Cardiovascular Research (G.N.F., JN.), Department of Medicine, Lund University, University Hospital MAS, Malmö,
Sweden.
Correspondence to Paul C. Dimayuga, PhD, Cedars-Sinai Medical Center, Davis 1064, 8700 Beverly Blvd, Los Angeles, CA 90048. E-mail
[email protected]
© 2005 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol. is available at http://www.atvbaha.org
2528
DOI: 10.1161/01.ATV.0000190606.41121.00
Dimayuga et al
Immune-Deficiency, IFN-␥, and Intimal Thickening
2529
10% FBS media for 18 hours to characterize basal IFN-␥ expression.
T cell enrichment was performed by negatively selecting splenocytes
using paramagnetic beads coated with anti-mouse B220 antibody and
a magnetic particle concentrator (Dynal) to deplete B cells and then
injected via the tail vein of Rag-1KO mice (2 to 4⫻107 cells per
mouse) 48 hours before injury. Cells were characterized with
anti-mouse CD4 and CD8 antibodies.
Splenocyte Homing
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Splenocyte homing in recipient mice was determined using the ␤-gal
transgenic ROSA26 mice (Jackson Laboratory) as donors. X-gal
(Sigma) staining13 was performed on arteries and spleens of recipient
mice 6 hours and 1, 3, and 7 days after injury. Polymerase chain
reaction (PCR) was performed on splenic DNA 21 days after injury,
with the following primers: AGCCGGAGATACCCAGTCCA
mouse Rag-1 forward primer, position 461; CAAGACTCCTTTACCACCAC mouse Rag-1 reverse primer, position 1890;14 and AGGTGAGATGACAGGAGATC pgk-neo reverse primer, position
1185 (GenBank accession: AF335419). The WT Rag-1 gene yields
a PCR product of 1429 bp long, whereas the Rag-1KO with the
pgk-neo insert yields a PCR product of ⬇963 bp.12 Presence of both
bands would indicate a mixture of the 2 genotypes.
IFN-␥ Treatment and Neutralization
Recombinant mouse IFN-␥ (rIFN-␥) (GIBCO/BRL) was administered to Rag-1KO mice at a dose of 100 ␮g/kg per day intravenous
starting on the day of injury and every other day for the first week
(short-term) or until euthanasia (long term). An additional group of
WT mice was treated with the same dose of rIFN-␥ starting 7 days
after injury. Monoclonal IFN-␥ neutralizing antibody (Calbiochem)
was administered to injured Rag-1KO mice beginning at 7 days after
injury (500 ␮g), and every 3 days (250 ␮g) for a total of 4
injections.15 A group of WT mice were treated with IFN-␥ mAb
before injury (500 ␮g) and once more 4 days after injury (250 ␮g).
Control mice received nonimmune IgG.
Morphometric Analysis and Immunostaining
Frozen sections 6- to 8-␮m thick were collected from 21-day injured
carotid arteries, as previously described.2 Immunostaining was performed using the following antibodies: SM ␣-actin (SIGMA),
MOMA-2 (BMA Biomedicals, Switzerland), mouse CD4 (BD
Pharmingen), PCNA, IRF-1, and iNOS (Santa Cruz).
Western Blot
Carotid arteries were harvested from Rag-1KO mice 3 days after
injury and snap frozen. Nuclear proteins were extracted as previously
described.16 Equal amounts of protein were subjected to Western
blot analysis with PCNA antibody. Loading was assessed by Ponceau S stain.
Enzyme-Linked Immunosorbent Assay
Serum immunoglobulin levels were determined using an enzymelinked immunosorbent assay kit (Southern Biotechnology Associates)2 with HRP-conjugated IgM and IgG (Pierce) antibodies, and
ABTS as substrate. Serum IFN-␥ was measured using a kit (Biosource International, Camarillo, Calif), following manufacturer’s
recommendations with modifications.
Reverse-Transcription PCR
Carotid artery and splenic RNA were extracted using TRIzol
(Invitrogen). Arteries were dissected under microscopy to remove
connective tissue, rinsed in saline, and snap-frozen. Four to 5 carotid
arteries were pooled for each time point. Two ␮g total RNA was
subjected to reverse-transcription using oligo-dT or random primers.
Equal aliquots were then subjected to PCR using primer pairs for the
following: ␤-actin for 29 cycles; T cell cytokines IFN-␥, interleukin
(IL)-4,17 IL-10,18 IFN-␥R␤,19 and suppressor of cytokine Signaling
(SOCS1)20 for 35 cycles; the T cell marker CD3⑀,21 IRF-1,22 and
iNOS (forward primer: ATGGCTTGCCCCTGGAAG; reverse
Figure 1. Minimal IFN-␥ mRNA expression (A, top panel) was
detected in uninjured arteries (UI), 1 and 3 days (D1 and D3)
after injury. A slight increase was observed 21 days (D21) after
injury. Spleen (S) was used as positive control. The T cell
marker CD3⑀ (fourth panel) was minimal in all time points tested.
Representative of 2 separate PCR reactions. IL-4 and IL-10
(second and third panels, respectively) were minimally detected.
␤-actin was used as reference (bottom panel). L⫽DNA ladder.
Intimal thickening 21 days after arterial injury of WT (B), Rag1KO mice (C), and Rag-1KO⫹T (D). Arrows indicate internal
elastic lamina. Bar⫽10 ␮m. IFN-␥ mRNA (E, top panel) and protein secretion in the condition medium (bottom panel) were
detected in the splenocytes used for transfer. Middle panel is
␤-actin mRNA.
primer: ATGCTCCATGGTCACCTCCA) for 36 cycles for arteries.
Cyclings for the spleens were as follows: IFN-␥ and ␤-actin for 28
cycles; IL-4 and IL-10 for 35 cycles, and CD3⑀ for 36 cycles. PCR
products were visualized on 1.5% agarose gels stained with ethidium
bromide and captured digitally for densitometric analysis. Results
were expressed as the ratio against ␤-actin.
Statistics
Data are presented as mean⫾SD deviation. Group comparisons were
performed with ANOVA followed by Neuman Keuls test, unless
noted otherwise.
Results
Arterial Cytokine Expression After Injury
Low IFN-␥ mRNA expression in arteries was detected before
and at early time points after injury, with a slight increase at
day 21 (Figure 1, top panel). IL-10 and IL-4 were minimal at
all time points (second and third panels). Presence of CD3⑀
mRNA, a T cell marker, was minimal in all time points tested
(fourth panel). ␤-actin mRNA served as reference (bottom
panel). Macrophage immunoreactivity was minimal 3 and 21
2530
Arterioscler Thromb Vasc Biol.
TABLE 1.
Serum IFN-g
WT
Rag-1KO
December 2005
Uninjured
Day 1
Day 3
Day 21
217⫾158
(n⫽6)
88⫾175
(n⫽4)
272⫾196
(n⫽3)
112⫾131
(n⫽6)
54⫾45*
(n⫽7)
25⫾43
(n⫽4)
198⫾164
(n⫽4)
164⫾118†
(n⫽6)
Values are in pg/mL.
*P⬍0.05 vs WT; †P⬍0.05 vs uninjured Rag-1KO.
days after injury. CD4 staining was not detectable in all time
points (not shown).
Temporal Profile of Serum IFN-␥ After Injury
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Basal serum IFN-␥ was detected before injury in the WT
mice, which was reduced 1 day after cuff placement (Table
1). Rag-1KO mice had very low levels of IFN-␥ before injury
(P⬍0.05 versus WT mice) and remained low at the day 1
time point. Three days after injury, serum IFN-␥ started to
increase in both the WT and Rag-1KO mice. Serum IFN-␥
levels in the Rag-1KO mice 21 days after injury was
increased compared with pre-injury (P⬍0.05) and comparable with WT levels.
Cell Proliferation and Intimal Thickening
Proliferating cell nuclear antigen–positive medial cells in the
Rag-1KO mice were significantly increased compared with
WT mice 3 days after injury (25.3⫾3.9, n⫽4 versus
10.3⫾3.3 cells/section, n⫽5; P⬍0.01). Twenty-one days
after injury, intimal thickening was markedly increased in the
Rag-1KO compared with WT mice (P⬍0.001; Figure 1C and
1B; Table 2). Intima-to-media ratio (I/M) was significantly
increased in the Rag-1KO compared with WT mice
(P⬍0.05). External elastic lamina area (EEL) was similar in
both groups (not shown).
T Cell Transfer in Rag-1KO Mice
Splenocytes isolated from WT donor mice showed basal
IFN-␥ mRNA expression (Figure 1E) and IFN-␥ in the
condition media (n⫽3). The cell enrichment procedure
yielded ⬎90% T cell purity, 73.6⫾2.4% were CD4⫹ and
15.9⫾1.3% were CD8⫹ (n⫽4). Transfer of T cell-enriched
splenocytes from WT mice to Rag-1KO mice (Rag-1KO⫹T)
variably increased basal serum IFN-␥ before injury compared
with Rag-1KO mice (259⫾317 pg/mL, n⫽9 versus 54⫾45
pg/mL, respectively; P⫽0.1, t test). Proliferating medial cells
were reduced significantly in the Rag-1KO⫹T group compared with Rag-1KO mice 3 days after injury (16.0⫾3.0, n⫽3
versus 25.3⫾3.9 cells/section, n⫽5; P⬍0.05). The transfer
resulted in significantly reduced intimal thickening (P⬍0.01;
Figure 1C and 1D; Table 2), and reduced I/M ratio (P⬍0.01;
TABLE 2.
Intimal Thickening After Injury
Intimal
Area, mm2
Intima/
Media Ratio
WT (n⫽11)
0.010⫾0.003
0.36⫾0.10
Rag-1KO (n⫽14)
0.024⫾0.012*
0.53⫾0.21†
Rag-1KO⫹T (n⫽13)
0.011⫾0.007‡
0.28⫾0.17‡
*P⬍0.001 vs WT; †P⬍0.05 vs WT; ‡P⬍0.01 vs. Rag-1KO.
Figure 2. Reverse-transcription PCR analysis of T cell cytokines
IFN-␥ (A, top panel), IL-4 (second panel), and IL-10 (third panel)
in the spleen 21 days after injury. Densitometric analysis for
IL-10 was standardized to ␤-actin (bottom panel), and graphed
(B) as relative densitometric units (RDU). For IFN-␥ and IL-4
analysis, please see http://atvb.ahajournals.org. WT, wild type;
Rag-1KO⫹T, Rag-1KO ⫹ adoptive T cell transfer; nⱖ 4 each;
*P⬍0.05 vs WT. Intimal area (C) of injured Rag-1KO mice was
significantly reduced by IFN-␥ treatment for 1 week (Rag1KO⫹IFNst, n⫽7, diagonal striped bar) and until euthanasia
(Rag-1KO⫹IFNlt, n⫽5, horizontal striped bar) compared with
untreated mice (black bar). *P⬍0.05 vs untreated Rag-1KO;
†P⬍0.001 vs untreated Rag-1KO. Monoclonal IFN-␥ antibody
treatment (D) of Rag-1KO mice (Rag-1KO⫹IFN Ab; open bar;
n⫽4) starting 7 days after injury reduced intimal thickening compared with control Rag-1KO mice treated with nonimmune IgG
(Rag-1KO⫹nIgG; black bar, n⫽6). †P⬍0.05 vs untreated Rag1KO, Student t test.
Table 2) compared with Rag-1KO mice. EEL was similar to
WT and Rag-1KO. The intima consisted of predominantly
smooth muscle ␣-actin positive cells in all groups. Macrophage immunoreactivity was minimal in both Rag-1KO and
Rag-1KO⫹T groups 3 days and 21 days after injury (not
shown), similar to a previous report.2 Minimal IgM and IgG
were observed in the Rag-1KO⫹T group at euthanasia (not
shown), indicating minimal presence of contaminating B
cells.
Splenocyte homing was assessed by ␤-gal activity from
ROSA26 donor cells, which was not detected in the injured
arterial wall of recipient Rag-1KO mice at any time point, but
was detected in the spleen (not shown). PCR analysis of
splenic DNA (please see http://atvb.ahajournals.org) detected
the presence of the intact Rag-1 gene in WT mice and the
pgk-neo insertion in Rag-1KO mice. Both bands were detected in the Rag-1KO⫹T, indicating the presence of both
WT and Rag-1KO DNA.
Splenic Cytokine mRNA
Splenic IFN-␥ expression was similar between WT, Rag1KO, and Rag-1KO⫹T mice as verified by reversetranscription PCR (Figure 2A, top panel). IL-4 expression
(second panel) was variable in all groups. IL-10 expression
(third panel) was significantly higher in the WT compared
with Rag-1KO⫹T and Rag-1KO mice (Figure 2B). Densitometric measurements were standardized against ␤-actin (Figure 2A, bottom panel and Figure 2B; please also see
http://atvb.ahajournals.org).
IFN-␥ Treatment and Neutralization
Administration of rIFN-␥ to Rag-1KO mice for the 21-day
injury period (rIFN-␥lt; n⫽6) significantly reduced intimal
Dimayuga et al
Immune-Deficiency, IFN-␥, and Intimal Thickening
2531
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
thickening compared with untreated Rag-1KO mice
(P⬍0.001; Figure 2C). Medial area and EEL were similar to
Rag-1KO mice. I/M ratio was significantly reduced by
rIFN-␥ treatment (0.13⫾0.04 versus 0.53⫾0.21; P⬍0.001).
Serum IFN-␥ level at day 3 was 217⫾9 pg/mL (n⫽2) and at
day 21 was 189⫾24 pg/mL (n⫽4). Macrophage immunoreactivity was minimal 3 days and 21 days after injury. Splenic
mRNA expression by rIFN-␥ treated Rag-1KO mice was
similar to untreated Rag-1KO mice (not shown). Treatment
with rIFN-␥ only for the first week (rIFN-␥st; n⫽7) also
resulted in reduced intimal thickening (P⬍0.05, Figure 2C)
and I/M ratio (0.37⫾0.09; P⬍0.05) compared with untreated
Rag-1KO mice. rIFN-␥ treatment reduced medial cell proliferation (11.9⫾7.5 cells/section, n⫽3; P⬍0.01) and nuclear
PCNA expression (please see http://atvb.ahajournals.org)
compared with untreated Rag-1KO mice 3 days after injury.
Administration of rIFN-␥ in WT mice starting 7 days after
injury did not increase intimal thickening (not shown).
IFN-␥ neutralizing antibody was administered to Rag-1KO
mice starting 7 days after injury, based on the late increase in
serum IFN-␥ levels. Intimal area in Rag-1KO mice treated
IFN-␥ antibody was significantly decreased compared with
mice that received nonimmune IgG (P⬍0.05, Figure 2D).
Medial area and EEL were similar between the 2 groups.
Neutralization of IFN-␥ in WT mice during the first week of
injury did not affect intimal thickening (not shown).
Arterial IRF-1 and iNOS Expression
To determine the pathway of IFN-␥–mediated augmentation
of intimal thickening in Rag-1KO mice, mRNA expression of
IRF-1 and iNOS in the injured arteries were assessed. Seven
days after injury, IRF-1 and iNOS expression were higher in
Rag-1KO mice compared with WT mice, which persisted
until 21 days (Figure 3A). WT mice also had less iNOS
immunostaining compared with Rag-1KO mice (not shown).
Because IFN-␥ receptor ␤ mediates IFN-␥ signaling,23 its
expression was assessed. IFN␥R␤ mRNA expression was
higher in the Rag-1KO compared with WT mice (Figure 3A).
To further investigate the effect of IFN-␥ neutralization in
Rag-1KO mice, immunostaining for IRF-1 was performed.
Rag-1KO mice treated with IFN-␥ neutralizing antibody
(Figure 3C) had reduced IRF-1 stain compared with Rag1KO mice treated with control IgG 21 days after injury
(Figure 3B). Reduced IRF-1 staining was associated with
significantly reduced iNOS stain area (P⬍0.05) in the Rag1KO mice treated with IFN-␥ neutralizing antibody compared with Rag-1KO mice treated with control IgG
(2.6⫾1.3% versus 10.5⫾2.7%; n ⱖ3; Figure 3E and 3D,
respectively).
Arterial SOCS1 Expression
SOCS1 modulates IFN-␥ signaling.24 We therefore determined SOCS1 expression in WT and Rag-1KO mice. One
day after arterial cuffing, SOCS1 expression was less in
Rag-1KO mice compared with WT mice (Figure 4A). The
difference in expression levels persisted through 7 and 21
days after injury (Figure 4B). To determine whether the effect
of rIFN-␥ in Rag-1KO mice was mediated through a similar
pathway, IRF-1, iNOS, and SOCS1 expression were assessed
Figure 3. IRF-1 (A, top panel), iNOS (second panel), and IFN␥R␤ (third panel) mRNA expression in carotid arteries from WT
and Rag-1KO mice 7 (D7) and 21 days (D21) after injury. IRF-1
was detected by immunostaining in 21-day injured Rag-1KO
mice treated with control IgG (B), which was reduced in Rag1KO mice treated with monoclonal IFN-␥ antibody (C). iNOS
staining was reduced in Rag-1KO mice treated with monoclonal
IFN-␥ antibody (E) compared with control IgG-treated Rag-1KO
mice (D). Arrows indicate internal elastic lamina. Bar⫽0.01 mm.
at day 3. Rag-1KO mice treated with rIFN-␥ had reduced
iNOS expression and increased SOCS1 expression compared
with Rag-1KO mice treated with saline. IRF-1 expression
was similar between the 2 groups (Figure 4C).
Discussion
Immune deficiency exacerbates the formation of stenotic
lesions in arterial tissue.1–3 The exaggerated intimal thickening does not seem to depend on the background strain
because Rag-1KO mice on the C57Bl6/J background respond
in a similar manner (unpublished results). The mechanism
that drives the exuberant intimal thickening in immune
deficiency is undefined. However, transfer of CD4⫹ T cells
resulted in the worsening of plaque burden in SCID/apolipoprotein E double knockout mice5 and IFN-␥ augmented
graft arteriosclerosis.7 Serum IFN-␥ levels are elevated in
HIV-infected patients and are postulated to contribute to
accelerated coronary artery disease.8,9 To define the mechanism(s) involved in the exuberant intimal thickening associ-
2532
Arterioscler Thromb Vasc Biol.
December 2005
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Figure 4. SOCS1 mRNA expression in injured carotid arteries (A
and B, top panels) from Rag-1KO mice were less compared
with WT mice at 1 day (A), 7, and 21 days after injury (B). Bottom panels are ␤-actin. Effect of treatment with rIFN-␥ (C) on
IRF-1 (top panel), iNOS (second panel), and SOCS1 (third panel)
mRNA expression in injured arteries of Rag-1KO mice 3 days
after injury. Bottom panel is ␤-actin.
ated with immune deficiency, we investigated the role of T
cells and IFN-␥ in the response to arterial injury.
We provide evidence that during early stages of arterial
repair, T cell secreted IFN-␥ inhibits intimal thickening. In
contrast, delayed IFN-␥ expression after injury in Rag-1KO
mice contributes to the exuberant intimal thickening. The
effects of T cells do not appear to be caused by a predominantly localized immune response. CD4⫹ T cells were not
detected in the arteries of WT mice at any time point checked.
The minimal presence of T cell marker CD3⑀ mRNA,
observed in the uninjured arteries, did not increase after
injury. Low IFN-␥ expression detected in the uninjured
arteries did not increase until the 21-day time point, and IL-4
and IL-10 were minimally detectable. Transferred T cells
from the ROSA26 mice could not be detected in the arteries
of the injured Rag-1KO recipients. However, low CD3⑀ and
IFN-␥ mRNA detected in the arterial wall before injury
suggest the combination of local and systemic regulation of
the early response to injury. A recent study using arterial
injury in rats supports the notion of some degree of localized
T cell immune response.25 Although minimally present before
injury, the lack of clear evidence of increased T cell localization to the site after injury in the mouse has been observed
by others as well.3 This lack of medial infiltration is attributed
to the immunoprivileged state of the media of elastic arteries,
likely caused by the lack of vasa vasorum in mice.26
Basal serum IFN-␥ in WT mice was shown to regulate
endothelial MHC class I expression.27 Rag-1KO mice, lacking functional T and B cells, have only minimal levels of
basal IFN-␥. Reconstitution of Rag-1KO mice with T cells
alone resulted in increased basal IFN-␥ levels and reduction
of intimal thickening. It has been reported that lack of T cells
was associated with increased intimal thickening,1 but it was
unclear whether T cells function independently of B cells.
Our results suggest that T cell secreted IFN-␥ played a
significant role in inhibiting intimal thickening, independent
of B cells. Because Rag-1KO mice had significantly increased intimal thickening compared with WT and Rag1KO⫹T, these data suggest that IFN-␥ presence during early
stages of repair after injury inhibits intimal thickening.
␤-gal activity and genotyping provided evidence that the
transferred cells homed-in to the recipients’ spleens. IFN-␥
mRNA was detected in the WT, Rag-1KO and Rag-1KO⫹T
mice 21 days after injury. The increased splenic IFN-␥
mRNA in the Rag-1KO mice paralleled the IFN-␥ in the
serum. IL-4 mRNA expression was low in spleens of all 3
groups of mice and IL-10 was significantly increased in WT
mice.
Treatment of Rag-1KO mice with IFN-␥ starting on the
day of injury significantly inhibited intimal thickening. Reduced nuclear PCNA expression 3 days after injury in the
arteries of treated mice suggests that control of proliferation
is one of the mechanisms for the early effects of IFN-␥. In a
previous study, a treatment duration of as short as 4 days was
also effective in rats,4 suggesting that early administration of
IFN-␥ is crucial in controlling intimal thickening. Our results
with the short term IFN-␥ treatment concur with that study.
One pathway involved at the early stage of injury is likely
mediated by a known regulator of cytokine expression,
SOCS1. SOCS1 is tightly regulated by the STAT family of
transcription factors28 and is intricately involved in modulating IFN-␥ response, as evidenced by the exaggerated IFN-␥
signaling in socs1⫺/⫺ mice.24 In our study, arterial SOCS1
expression was less in Rag-1KO mice compared with WT.
The difference in expression was apparent as early as 1 day
after injury, suggesting that the presence of IFN-␥ early in the
injury response is key to SOCS1 expression to regulate IFN-␥
signaling. Treatment of Rag-1KO mice with rIFN-␥ increased
SOCS1 expression 3 days after injury, further supporting a
regulatory role for early presence of IFN-␥ in the response to
injury.
Treatment of WT mice with rIFN-␥ starting at 7 days after
injury did not augment intimal thickening, further supporting
the notion that presence of endogenous IFN-␥ at the start of
injury in WT mice was sufficient to limit intimal thickening.
Transplant arteriosclerosis in immune deficient mice was
increased by IFN-␥ treatment initiated 7 days after surgery.7
Variable effects of IFN-␥ on cultured smooth muscle cell in
vitro have also been reported,10,29 suggesting that IFN-␥ has
phenotype-dependent effects on smooth muscle cells. Neutralization of IFN-␥ in WT mice in our study did not affect
intimal thickening. We have previously shown that B cells
alone inhibit intimal thickening. Although IFN-␥ may be
blocked by antibody treatment, as was shown in Rag-1KO
mice, B cells in WT mice likely were sufficient to control
exuberant intimal thickening.
In the late stage after injury, at 21 days, the IFN-␥ levels
were comparable in WT and Rag-1KO mice. The cells that
secrete IFN-␥ in Rag-1KO mice in the absence of functional
T cells are likely NK cells and macrophages.30 As the
Dimayuga et al
Immune-Deficiency, IFN-␥, and Intimal Thickening
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Rag-1KO mice have exuberant intimal thickening after injury, these data suggest that IFN-␥, when present predominantly in the late stages, promotes intimal thickening. Cell
responsiveness to IFN-␥ is dependent on the presence of both
subunits of the IFN-␥ receptor. IFN␥R␣, the ligand binding
unit, is ubiquitously expressed whereas IFN␥R␤ is tightly
regulated and mediates signaling.23 We show that IFN␥R␤
mRNA expression in injured arteries of Rag-1KO mice
remained elevated compared with WT mice, suggesting
increased propensity for IFN-␥ signaling. Ligand-induced
downregulation of IFN␥R␤ expression has been previously
reported.23 The role of IFN-␥ in the exuberant intimal
thickening after arterial injury in Rag-1KO mice was further
defined by the neutralizing IFN-␥ antibody treatment of
Rag-1KO mice, beginning 7 days after injury. The treatment
significantly decreased intimal thickening compared with
control Rag-1KO mice. Neutralization of IFN-␥ in an allogeneic graft model reported recently also resulted in reduced
intimal thickening.31 These data support the notion that IFN-␥
present only during the later stage of arterial repair promotes
intimal thickening in a condition of combined immune
deficiency.
The effect of the late increase of IFN-␥ on intimal
thickening appears to be linked to increased iNOS expression,
consistent with a report showing significant increase in iNOS
expression in Rag-1KO mice.30 IRF-1 is a known transcriptional activator of iNOS.11 We have reported a proproliferative role for iNOS in cuff-injury induced intimal
formation using iNOS KO mice.16,32,33 The signaling pathway
for iNOS mediated cell proliferation involves redoxresponsive gene reducing factor-1 (Ref-1) and thioredoxin
control of AP-1 activation.32 Our study shows that late
increase in IFN-␥ in Rag-1KO mice results in increased
IRF-1 and iNOS expression. This pathway was partially
interrupted by the neutralizing antibody to IFN-␥. A recent
report similarly showed NOS dysfunction induced by IFN-␥
resulted in increased intimal thickening.34 Interestingly,
IRF-1 and iNOS expression are upregulated in socs1⫺/⫺ mice
caused by exaggerated IFN-␥ signaling.28
The inhibitory effect of B cells on intimal thickening that
we previously reported2 likely works through a different
mechanism. IFN-␥ is predominantly produced by T cells and
NK cells and not B cells. Experiments are underway to test
the role of B cells and immunoglobulins. The current study
did not identify the type of T cells responsible for limiting
intimal thickening. A previous report suggests that CD4⫹ T
cells are pro-inflammatory5 and may therefore contribute to
tissue damage. In addition, other T cell subsets, such as NKT
and T regs may play a role in the response to injury. We are
currently investigating the role of specific T cell subsets in
arterial injury.
In summary, the present report suggests that T cellmediated inhibition of intimal thickening is independent of B
cells. Thus, the studies suggest that host response to vascular
injury occur at various levels with redundancy of roles; in this
case limiting intimal thickening. It is also possible that
various immune mechanisms cooperate to control the process. The effect of T cells appears to be mediated by basal
IFN-␥ secretion and SOCS1. The late increase in IFN-␥ in
2533
Rag-1KO mice significantly contributes to intimal thickening, mediated in part by increased iNOS expression through
IRF-1. The exaggerated IFN-␥ response is caused in part by
increased IFN-␥R␤ and reduced SOCS1 expression in injured
arteries of Rag-1KO mice. These findings add novel insight
in understanding the role of IFN-␥ in vascular disease.35
Acknowledgments
The work was supported by grants from the Swedish Heart-Lung
Foundation (P.D.) and the Eisner Foundation (B.C.). The authors
thank Juliana Yano for technical assistance.
References
1. Hansson GK, Holm J, Holm S, Fotev Z, Hedrich HJ, Fingerle J. T
lymphocytes inhibit the vascular response to injury. Proc Natl Acad Sci
U S A. 1991;88:10530 –10534.
2. Dimayuga P, Cercek B, Oguchi S, Fredrikson GN, Yano J, Shah PK,
Jovinge S, Nilsson J. Inhibitory effect on arterial injury-induced neointimal formation by adoptive B-cell transfer in Rag-1 knockout mice.
Arterioscler Thromb Vasc Biol. 2002;22:644 – 649.
3. Zhu B, Reardon CA, Getz GS, Hui DY. Both apolipoprotein E and
immune deficiency exacerbate neointimal hyperplasia after vascular
injury in mice. Arterioscler Thromb Vasc Biol. 2002;22:450 – 455.
4. Hansson GK, Holm J. Interferon-gamma inhibits arterial stenosis after
injury. Circulation. 1991;84:1266 –1272.
5. Zhou X, Nicoletti A, Elhage R, Hansson GK. Transfer of CD4(⫹) T cells
aggravates atherosclerosis in immunodeficient apolipoprotein E knockout
mice. Circulation. 2000;102:2919 –2922.
6. Whitman SC, Ravisankar P, Elam H, Daugherty A. Exogenous
interferon-gamma enhances atherosclerosis in apolipoprotein E⫺/⫺
mice. Am J Pathol. 2000;157:1819 –1824.
7. Tellides G, Tereb DA, Kirkiles-Smith NC, Kim RW, Wilson JH,
Schechner JS, Lorber MI, Pober JS. Interferon-gamma elicits arteriosclerosis in the absence of leukocytes. Nature. 2000;403:207–211.
8. Fuchs D, Hausen A, Reibnegger G, Werner ER, Werner-Felmayer G,
Dierich MP, Wachter H. Interferon-gamma concentrations are increased
in sera from individuals infected with human immunodeficiency virus
type 1. J Acquir Immune Defic Syndr. 1989;2:158 –162.
9. Eylar EH, Lefranc C, Baez I, Colon-Martinez SL, Yamamura Y,
Rodriguez N, Yano N, Breithaupt TB. Enhanced interferon-gamma by
CD8⫹ CD28- lymphocytes from HIV⫹ patients. J Clin Immunol. 2001;
21:135–144.
10. Shimokado K, Yokota T, Kato N, Kosaka C, Sasaguri T, Masuda J, Ogata
J, Numano F. Bidirectional regulation of smooth muscle cell proliferation
by IFN-gamma. J Atheroscler Thromb. 1994;1:S29 –S33.
11. Martin E, Nathan C, Xie QW. Role of interferon regulatory factor 1 in
induction of nitric oxide synthase. J Exp Med. 1994;180:977–984.
12. Mombaerts P, Iacomini J, Johnson RS, Herrup K, Tonegawa S,
Papaioannou VE. RAG-1-deficient mice have no mature B and T lymphocytes. Cell. 1992;68:869 – 877.
13. Hu Y, Mayr M, Metzler B, Erdel M, Davison F, Xu Q. Both donor and
recipient origins of smooth muscle cells in vein graft atherosclerotic
lesions. Circ Res. 2002;91:e13– e20.
14. Schatz DG, Oettinger MA, Baltimore D. The V(D)J recombination activating gene, RAG-1. Cell. 1989;59:1035–1048.
15. Nicoletti F, Zaccone P, Di MR, Di MM, Magro G, Grasso S, Mughini L,
Meroni P, Garotta G. The effects of a nonimmunogenic form of murine
soluble interferon-gamma receptor on the development of autoimmune
diabetes in the NOD mouse. Endocrinology. 1996;137:5567–5575.
16. Anazawa T, Dimayuga PC, Li H, Tani S, Bradfield J, Chyu KY, Kaul S,
Shah PK, Cercek B. Effect of exposure to cigarette smoke on carotid
artery intimal thickening: the role of inducible NO synthase. Arterioscler
Thromb Vasc Biol. 2004;24:1652–1658.
17. Lee TS, Yen HC, Pan CC, Chau LY. The role of interleukin 12 in the
development of atherosclerosis in ApoE-deficient mice. Arterioscler
Thromb Vasc Biol. 1999;19:734 –742.
18. Ulett GC, Ketheesan N, Hirst RG. Cytokine gene expression in innately
susceptible BALB/c mice and relatively resistant C57BL/6 mice during
infection with virulent Burkholderia pseudomallei. Infect Immun. 2000;
68:2034 –2042.
2534
Arterioscler Thromb Vasc Biol.
December 2005
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
19. Truchet S, Wietzerbin J, Debey P. Mouse oocytes and preimplantation
embryos bear the two sub-units of interferon-gamma receptor. Mol
Reprod Dev. 2001;60:319 –330.
20. Trop S, De Sepulveda P, Zuniga-Pflucker JC, Rottapel R. Overexpression
of suppressor of cytokine signaling-1 impairs pre-T-cell receptor-induced
proliferation but not differentiation of immature thymocytes. Blood.
2001;97:2269 –2277.
21. Barda-Saad M, Shav-Tal Y, Rozenszajn AL, Cohen M, Zauberman A,
Karmazyn A, Parameswaran R, Schori H, Ashush H, Ben-Nun A, Zipori
D. The mesenchyme expresses T cell receptor mRNAs: relevance to cell
growth control. Oncogene. 2002;21:2029 –2036.
22. Horiuchi M, Yamada T, Hayashida W, Dzau VJ. Interferon regulatory
factor-1 up-regulates angiotensin II type 2 receptor and induces apoptosis.
J Biol Chem. 1997;272:11952–11958.
23. Bach EA, Aguet M, Schreiber RD. The IFN gamma receptor: a paradigm
for cytokine receptor signaling. Annu Rev Immunol. 1997;15:563–591.
24. Brysha M, Zhang JG, Bertolino P, Corbin JE, Alexander WS, Nicola NA,
Hilton DJ, Starr R. Suppressor of cytokine signaling-1 attenuates the
duration of interferon gamma signal transduction in vitro and in vivo.
J Biol Chem. 2001;276:22086 –22089.
25. Xing D, Miller A, Novak L, Rocha R, Chen YF, Oparil S. Estradiol and
progestins differentially modulate leukocyte infiltration after vascular
injury. Circulation. 2004;109:234 –241.
26. Dal Canto AJ, Swanson PE, O’Guin AK, Speck SH, Virgin HW.
IFN-gamma action in the media of the great elastic arteries, a novel
immunoprivileged site. J Clin Invest. 2001;107:R15–R22.
27. Goes N, Urmson J, Hobart M, Halloran PF. The unique role of
interferon-gamma in the regulation of MHC expression on arterial endothelium. Transplantation. 1996;62:1889 –1894.
28. Krebs DL, Hilton DJ. SOCS proteins: negative regulators of cytokine
signaling. Stem Cells. 2001;19:378 –387.
29. Hansson GK, Hellstrand M, Rymo L, Rubbia L, Gabbiani G. Interferon
gamma inhibits both proliferation and expression of differentiationspecific alpha-smooth muscle actin in arterial smooth muscle cells. J Exp
Med. 1989;170:1595–1608.
30. Rottenberg ME, Gigliotti RA, Gigliotti D, Ceausu M, Une C, Levitsky V,
Wigzell H. Regulation and role of IFN-gamma in the innate resistance to
infection with Chlamydia pneumoniae. J Immunol. 2000;164:4812– 4818.
31. Wang Y, Burns WR, Tang PC, Yi T, Schechner JS, Zerwes HG, Sessa
WC, Lorber MI, Pober JS, Tellides G. Interferon-gamma plays a nonredundant role in mediating T cell-dependent outward vascular remodeling
of allogeneic human coronary arteries. FASEB J. 2004;18:606 – 608.
32. Chyu KY, Dimayuga PC, Zhao X, Nilsson J, Shah PK, Cercek B. Altered
AP-1/Ref-1 redox pathway and reduced proliferative response in iNOSdeficient vascular smooth muscle cells. Vasc Med. 2004;9:177–183.
33. Chyu KY, Dimayuga P, Zhu J, Nilsson J, Kaul S, Shah PK, Cercek B.
Decreased neointimal thickening after arterial wall injury in inducible
nitric oxide synthase knockout mice. Circ Res. 1999;85:1192–1198.
34. Koh KP, Wang Y, Yi T, Shiao SL, Lorber MI, Sessa WC, Tellides G,
Pober JS. T cell-mediated vascular dysfunction of human allografts
results from IFN-gamma dysregulation of NO synthase. J Clin Invest.
2004;114:846 – 856.
35. Harvey EJ, Ramji DP. Interferon-gamma and atherosclerosis: pro- or
anti-atherogenic? Cardiovasc Res. 2005;67:11–20.
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
T Cell Modulation of Intimal Thickening After Vascular Injury: The Bimodal Role of
IFN- γ in Immune Deficiency
Paul C. Dimayuga, Hongyan Li, Kuang-Yuh Chyu, Gunilla Nordin Fredrikson, Jan Nilsson,
Michael C. Fishbein, Prediman K. Shah and Bojan Cercek
Arterioscler Thromb Vasc Biol. 2005;25:2528-2534; originally published online October 13,
2005;
doi: 10.1161/01.ATV.0000190606.41121.00
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2005 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/25/12/2528
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2005/10/20/01.ATV.0000190606.41121.00.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
On line supplement:
Figure I:
Transferred splenocyte homing to the spleens of Rag-1KO+T mice 21
days after injury. PCR products from the spleen of WT mice show intact Rag-1 gene
(arrowhead). The partially deleted Rag-1 gene from the spleen of Rag-1KO mice is
indicated by the arrow. PCR products from spleens of T cell recipient Rag-1KO mice
(+T) have both bands present indicating both WT (from donors) and Rag-1KO
genotypes.
A
B
Figure II.
Densitometric analysis of RT-PCR (Manuscript Figure 2A) for
IFN-γ (A) and IL-4 (B) standardized to β-actin and expressed as Relative
Densitometric Units (RDU). WT=wild type; Rag-1KO+T=Rag-1KO + adoptive
T cell transfer. n>4 each.
Figure III.
Arterial PCNA expression of Rag-1KO mice was determined using
Western blotting of nuclear proteins (C=control, IFN=interferon treated mice) 3 days
after injury. Loading was assessed using Ponceau Red.