This information is current as
of June 18, 2017.
Absence of the Transcriptional Repressor
Blimp-1 in Hematopoietic Lineages Reveals
Its Role in Dendritic Cell Homeostatic
Development and Function
Yueh-Hsuan Chan, Ming-Feng Chiang, Yueh-Chiao Tsai,
Shin-Tang Su, Ming-Hsu Chen, Mau-Sheng Hou and Kuo-I
Lin
Supplementary
Material
References
Subscription
Permissions
Email Alerts
http://www.jimmunol.org/content/suppl/2009/11/13/jimmunol.090154
3.DC1
This article cites 48 articles, 30 of which you can access for free at:
http://www.jimmunol.org/content/183/11/7039.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2009 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
J Immunol 2009; 183:7039-7046; Prepublished online 13
November 2009;
doi: 10.4049/jimmunol.0901543
http://www.jimmunol.org/content/183/11/7039
The Journal of Immunology
Absence of the Transcriptional Repressor Blimp-1 in
Hematopoietic Lineages Reveals Its Role in Dendritic Cell
Homeostatic Development and Function1
Yueh-Hsuan Chan,*† Ming-Feng Chiang,*† Yueh-Chiao Tsai,† Shin-Tang Su,*†
Ming-Hsu Chen,† Mau-Sheng Hou,‡ and Kuo-I Lin2†
D
endritic cells (DCs)3 are a type of APCs that are present
in virtually all tissues. They are crucial for initiation and
regulation of immune responses against pathogens and
are important for maintaining steady-state self-tolerance. The maturation of DCs is initiated through pattern recognition receptors,
such as TLRs (1), upon Ag conjugation. By capturing, processing,
and presenting Ags, DCs move into local draining lymph nodes as
they mature, resulting in the initiation of T cell activation and
adaptive immune responses (2).
In mouse spleen and lymph nodes, DCs are heterogeneously
distributed but they are generally subdivided into two major
groups: conventional DCs (cDCs) and plasmacytoid DCs (3).
cDCs can be further divided into CD4⫹CD8⫺, CD4⫺CD8⫺,
and CD4⫺CD8⫹ subsets (4, 5). The developmental pathways
that regulate differentiation of DCs from hematopoietic stem
cells were recently deciphered. In mouse bone marrow, cDCs
and plasmacytoid DCs are derived from a common proliferative
DC-restricted progenitor that expresses surface fms-like ty*Graduate Institute of Life Sciences, National Defense Medical Center, Taipei, Taiwan; †Genomics Research Center, Academia Sinica, Taipei, Taiwan; and ‡Institute of
Molecular Biology, Academia Sinica, Taipei, Taiwan
Received for publication May 15, 2009. Accepted for publication October 2, 2009.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by Academia Sinica (to K.-I L.) and by National
Science Council grants (NSC96-2320-B-001-013-MY3 and NSC97-3112-B-001010) (to K.-I L.).
2
Address correspondence and reprint requests to Kuo-I Lin, Genomics Research
Center, Academia Sinica, 128 Academia Road, Sec. 2, Nankang District, Taipei,
Taiwan. E-mail address: [email protected]
3
Abbreviations used in this paper: DC, dendritic cell; cDC, conventional DC; Flt3,
fms-like tyrosine kinase-3; M-CSFR, M-CSF receptor; IRF, interferon-regulatory factor; Blimp-1, B lymphocyte-induced maturation protein-1; CKO, conditional knockout; Ctrl, littermate control; BMDC, bone marrow-derived DC; CBA, cytometric bead
assay; RT-QPCR, reverse transcription-quantitative PCR; ChIP, chromatin immunoprecipitation; Cre, cre-recombinase.
Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.0901543
rosine kinase-3 (Flt3) and M-CSF receptor (M-CSFR) (6 – 8). A
significant number of steady-state cDCs in the spleen are generated from immediate splenic cDC precursors (pre-cDCs),
which may be derived from bone marrow DC progenitors
through blood circulation (9). The expression of surface CD24
on splenic pre-cDCs segregates the developmental lineages of
CD8⫺ and CD8⫹ DCs (3, 9).
Many transcription factors and cytokines have been implicated
in regulation of cDC development. For example, CD8⫺ cDC generation is defective in mice lacking IFN-regulatory factor (IRF)-2
(10) and IRF-4 (11), and the number of CD8⫹ cDCs is reduced in
mice lacking IRF-8 (12). Flt3 ligand (13) and STAT3 (14) are
critical for multiple subsets of DC development. Thus, accumulating evidence suggests there is an important interplay between these
positive regulators in the general development of cDCs or development of specific DC subsets.
B lymphocyte-induced maturation protein-1 (Blimp-1), also
called PRDI-BF1, was discovered as a transcriptional repressor
of the IFN␤ promoter (15). Blimp-1 orchestrates plasma cell
differentiation by regulating cascades of gene expression (16 –
18), controls T cell homeostasis and tolerance (19, 20), and
triggers myeloid lineage differentiation (21). Blimp-1 expression can be activated in mature B cells in many ways, including
activation by TLR ligands (22–24). We wonder whether
Blimp-1 is involved in DC function as DC maturation is often
mediated by TLR activation. Thus, an animal system in which
the Blimp-1 gene, Prdm1, was conditionally deleted in the panhematopoietic lineage was generated. In addition to its known
roles in B and T cell lineages, we found that Blimp-1 negatively
regulates homeostatic development of the CD8⫺ cDC subset by
maintaining the numbers of immediate cDC precursors that acquire a CD8⫺ cDC fate in spleen. We also found that Blimp-1
is critical for DC maturation in response to several stimuli.
Together, we have identified two novel roles for Blimp-1 in DC:
homeostatic development and maturation in peripheral lymphoid tissues.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Dendritic cells (DCs) are important for the initiation and regulation of immune responses. In this study, we demonstrate that DC
homeostatic development in peripheral lymphoid organs is negatively regulated by the transcriptional repressor, Blimp-1, which
is critical for regulation of plasma cell differentiation and T cell homeostasis and function. Deletion of Prdm1, the gene encoding
Blimp-1, in mouse hematopoietic lineages resulted in an increase in the steady-state number of conventional DCs (cDCs). Specifically, Prdm1 deletion increased immediate CD8ⴚ cDC precursors in peripheral lymphoid organs, causing selective expansion
of the CD8ⴚ cDC population. Upon stimulus-induced maturation, Blimp-1 was up-regulated in bone marrow-derived DCs via the
p38 MAPK and NF-␬B pathways. Notably, Blimp-1-deficient DCs matured poorly upon stimulation in vitro and in vivo. Blimp-1
binds to the proinflammatory cytokine/chemokine genes, Il-6 and Ccl2, and negatively regulates their expression. Collectively, our
findings reveal two new roles for Blimp-1: negative regulation of a select subset of cDCs during homeostatic development, and
enhancement of DC maturation. The Journal of Immunology, 2009, 183: 7039 –7046.
7040
Materials and Methods
Mice and cell lines
Prdm1f/f mice, generated as described (18), were bred with Tie2-Cre mice,
B6, Tg(Tek-cre)12Flv/J (The Jackson Laboratory). Sex-matched Prdm1f/f
Tie2-Cre⫹ (conditional knockout, CKO) and littermate control (Ctrl) mice
(2- to 4-mo-old) were used for all experiments in this study. All mice were
maintained under specific pathogen free conditions in the animal facility of
the Institute of Cellular and Organismic Biology at Academia Sinica. The
Institute Animal Care and Utilization Committee of Academia Sinica approved all experiments. Mice were genotyped by genomic PCR using primers described in supplemental Table I.4 C57BL/6 and BALB/c mice were
purchased from the Laboratory Animal Center in Taiwan and used at 6⬃10
wk of age. For BrdU labeling in vivo, 1 ␮g BrdU (BD Biosciences) was
injected into Ctrl or CKO mice by i.p. at 1 day before sacrifice for flow
cytometric analysis of the percentage of BrdU-positive cells in splenic cDC
subsets. JAWS II cells purchased from American Type Culture Collection
were grown in MEM␣ medium (Invitrogen) supplemented with 20% FBS
(Invitrogen), 100 U/ml penicillin, and 100 ␮g/ml streptomycin, 4 mM Lglutamine, 1 mM sodium pyruvate, and 5 ng/ml murine GM-CSF
(eBioscience).
Preparation and culture of cells from lymphoid organs
Bone marrow-derived DC (BMDC) cultures
Jo software (Tree Star). In some experiments, CD11chighCD8⫹,
CD11chighCD4⫹CD8⫺, or CD11chighCD4⫺CD8⫺cells from purified
splenic CD11c⫹ cells were sorted by FACSAria (BD Biosciences).
Western blotting and immunofluorescence staining
Western blotting with an anti-Blimp-1 mAb was performed as described
(27). For detection of cytoplasmic I␬B␣ degradation by rabbit anti-I␬B␣
Ab (Santa Cruz Biotechnology) or nuclear translocation of p50 subunit by
rabbit anti-p50 Ab (Santa Cruz Biotechnology), cytoplasmic and nuclear
extracts were prepared as described (22). Goat anti-lamin B Ab was purchased from Santa Cruz Biotechnology. For NF-␬B p65 subunit immunofluorescence staining, in brief, BMDCs were left unstimulated or stimulated with 100 ng/ml LPS for 2 h and prepared by cytospin at 500 rpm for
5 min. The cells were then fixed by 4% paraformaldehyde, permeabilized
with 0.1% triton X-100, and blocked with 1% BSA, followed by staining
with rabbit anti-p65 Ab (Santa Cruz Biotechnology) and Alexa Fluor 555conjugated goat anti-rabbit IgG (Molecular Probes). The nuclei were counterstained by 4⬘-6-diamidino-2-phenylindole (Sigma-Aldrich). The fluorescent images were examined under a fluorescence microscope (Leica
DM6000B).
Mixed lymphocyte reaction
Allogeneic T cell proliferation was measured using 105 splenic
CD3⫹CD4⫹ T cells from BALB/c as responders and various numbers of
BMDCs (1000, 3000, or 10000 cells) irradiated with 30 Gy as stimulators.
After 4 days in culture, cells were pulsed with 1 ␮Ci [3H]thymidine for
16 h. [3H]thymidine incorporation was quantified with a microplate-scintillation counter (TopCount NXT, Packard). Cell proliferation was measured in cpm.
In vivo DC maturation
Ctrl and CKO mice were subjected to i.p. injection of LPS (3 ␮g/g body
weight) solubilized in PBS. Control groups were injected with PBS alone.
Ten hours after injection, mice were sacrificed. Single cell suspensions
were prepared from mesenteric lymph nodes, stained, and subjected to flow
cytometric analysis.
Lentiviral vector preparation and transduction
pFUGW, pFUW-GFPBlimp1, pFUGWCtrli, and pFUGWBlimp1-3952i
have been described (27, 28). Generation of pseudotyped lentivirus was
performed essentially as described (27, 29). Targeted BMDCs and JAWS
II cells were infected at a multiplicity of infection of 5 in the presence of
8 ␮g/ml polybrene (Sigma-Aldrich).
Cytometric bead array (CBA), multiplex bead array assays,
and ELISA
GM-CSF culture of BMDCs was performed essentially as described (25).
Cells (2 ⫻ 105 cells/ml) were cultured in RPMI 1640 supplemented with
20 ng/ml murine GM-CSF (eBioscience), 10% FBS (BenchMark), 50 ␮M
2-ME, 100 U/ml penicillin, and 100 ␮g/ml streptomycin. After 8 days in
culture, nonadherent cells were harvested as immature BMDCs. The remaining cells were replated at a density of 1 ⫻ 106 cells/ml for stimulation
with 10 ng/ml (or other indicated doses) LPS, 0.5 ␮g/ml poly I:C, 50 ng/ml
CpG oligodeoxynucleotides 1826 (InvivoGen), or 10 ng/ml TNF-␣ (PeproTech) for 20 h. In some experiments, immature BMDCs harvested on day
8 were treated for 1 h with the NF-␬B inhibitor BAY 11– 0782 (Calbiochem), or the p38 MAPK inhibitor SB203580 (Calbiochem), followed by
LPS stimulation for 20 h. Flt3L-cultured BMDCs were prepared as described (26). Cells were seeded at 1 ⫻ 106 cells/ml and cultured in RPMI
1640, supplemented with 50 ng/ml murine Flt3L (R & D Systems), 10%
FBS (BenchMark), 50 ␮M 2-ME, 100 U/ml penicillin, and 100 ␮g/ml
streptomycin. Cells were left untreated or stimulated with 0.5 ␮g/ml poly
I:C or 0.3 ␮M CpG D19 (GGTGCATCGATGCAGGGGGG phosphorothioate-modified at sites underlined) on day 8 and harvested on day 9.
These procedures have been described (22). The gene specific Taqman
primer and probe sets, including Prdm1 (assay ID: Mm 00476128_ml) and
L32 (used for normalization, assay ID: Mm 00777741_sH) were purchased
from Applied Biosystems. The specific primer sets information was described in supplemental Table I.
Abs and flow cytometry
Chromatin immunoprecipitation (ChIP) assay
Single cell suspensions were stained with appropriate Abs as described
in supplemental Table II. For intracellular cytokine staining, T cells
were washed and stimulated with 50 ng/ml PMA and 1 ␮g/ml ionomycin (Sigma-Aldrich) in the presence of brefeldin A (Biolegend) for 6 h.
After fixation and permeabilization, cells were stained with anti-IFN␥-APC (Biolegend) and anti-IL-4-PE (Biolegend). All flow cytometric
analysis was performed using FACSCanto or FACSCalibur and results
were analyzed by FACS Diva software (BD Biosciences) or Flow
Blimp-1 binding in vivo was detected essentially as reported (28, 30) using
rabbit antiserum against Blimp-1 as described (31). In brief, 2⬃3 ⫻ 107
Ctrl or CKO BMDCs stimulated with LPS for 24 h were used per ChIP
experiment. The immunoprecipitated DNA was analyzed by real-time PCR
with SYBR green method on an ABI prism 7300 system. The primer sequences for ChIP assay were listed in the supplemental Table I.
4
The online version of this article contains supplementary material.
The Mouse Inflammation CBA Kit (BD Pharmingen) was used in accordance with the manufacturer’s protocol to measure select cytokines and
chemokines (IL-6, IL-10, MCP-1, IFN-␥, TNF-␣, and IL-12p70) in supernatants from BMDC cultures stimulated with 1 ␮g/ml LPS. Cytokines and
chemokines in sera were determined by the MILLIPLEX Mouse Cytokine/
Chemokine kit (Millipore) according to the manufacturer’s protocol and
analyzed by Luminex 200. IgM production in culture supernatants was
determined by ELISA essentially as described (22).
RNA isolation and reverse transcription-quantitative PCR
(RT-QPCR)
DNA pull-down assay and EMSA
The DNA pull-down assay was performed essentially as described (32). In
brief, biotinylated wild-type or mutated oligonucleotides coupled with
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
For analysis of cell populations, lymphoid organs were treated with 0.02
mg/ml Liberase Blendzyme II (Roche Applied Science) for 20 min at room
temperature. Single cell suspensions were washed with RPMI 1640 (Invitrogen) containing 50 ␮g/ml DNase I (Roche Applied Science) and 3%
FCS (HyClone). RBCs were removed using RBC lysis buffer (SigmaAldrich). Splenic CD11c⫹ cells were isolated by positive selection using
an autoMACS separator (Miltenyi Biotec) and stimulated with 1 ␮g/ml
LPS (from Escherichia coli O26:B6, Sigma-Aldrich) or 100 ␮g/ml poly
I:C (Amersham Biosciences) for 1 day in some experiments. Splenic B
cells were cultured as described (22) and were stimulated with 2 ␮g/ml
LPS for indicated days. Splenic CD4⫹ T cells were isolated by flow
cytometry from total splenocytes cultured with 5 ␮g/ml anti-CD3
(eBioscience) and 10 ng/ml IL-2 (R&D Systems) for 3 days. The immediate splenic DC precursors (pre-cDCs) were defined as previously
described (9). In brief, splenocytes were separated by density using
Nycodenz (Axis-Shield), and cells of density between 1.076 and 1.084
were collected. B, T, and NK cells were excluded by staining with
specific Abs to CD3, CD19, and CD49b. The lymphocyte-excluded medium-density fraction was further analyzed by the following parameters: low side scatter and expression of CD11c, CD45RA, CD43,
SIRP-␣, and CD24.
THE ROLE OF Blimp-1 IN DCs
The Journal of Immunology
streptavidin-conjugated Dynabeads (Invitrogen) were incubated with 150
␮g precleared nuclear extract prepared from LPS-stimulated Ctrl and CKO
BMDCs. After 1 h incubation at room temperature, the complexes were
collected with a magnetic apparatus. Coprecipitated proteins were eluted
and fractionated by 8% SDS-PAGE, followed by Western blotting analysis. In the competition assay, a 200-fold excess of unlabeled oligonucleotides was added. EMSA was performed using 2.5 ␮g nuclear extract prepared from 293T cells transfected with Blimp-1 expression vector and the
LightShift chemiluminescent EMSA kit (Pierce) as described (22). For the
supershift assay, 1 ␮g of mouse anti-Blimp-1 Ab or control Ab (SigmaAldrich) was added to the described reactions and incubated on ice for 30
min. The oligonucleotides used in this study were described in supplemental Table III.
Luciferase assay
Statistical analysis
Statistical significance was measured using the two-tailed paired Student’s
t test. Data represent means ⫾ SD or means ⫾ SEM as indicated.
Results
Blimp-1 negatively regulates CD8⫺ cDC development
Prdm1f/f mice harboring Prdm1 alleles containing two LoxP sites
flanking exons 5 and 8 were generated previously (18) and have
been used to demonstrate the role of Blimp-1 in B cell differentiation and T cell homeostasis in vivo (18, 19). To further understand the role of Blimp-1 in the immune system, such as in DC
lineage development and function, we deleted Prdm1 in the hematopoietic system by crossing Prdm1f/f mice with mice expressing the cre-recombinase (Cre) transgene under the control of the
Tie2 regulatory element, Tie2-Cre (34). A three primer-based PCR
assay using genomic DNA from various tissues isolated from either CKO mice (Prdm1f/fTie2-Cre⫹) or littermate control (Ctrl)
mice (Prdm1f/fTie2-Cre⫺) demonstrated that the Prdm1 allele was
efficiently deleted in CKO lymph nodes, spleen, thymus, and bone
marrow (Fig. 1A). Only a small proportion of Prdm1 was deleted
in the brain, which is likely explained by endothelial and hematopoietic cells that are present in the brain. Prdm1 alleles were
almost completely deleted in purified CD3⫹ T cells, B220⫹ B
cells, and CD11c⫹ DCs isolated from CKO spleen (Fig. 1A).
Splenic B cells from Prdm1f/fCD19-Cre⫹ mice fail to differentiate when stimulated with mitogen-like LPS in vitro (18).
Induction of Blimp-1 protein was largely abolished after LPS
stimulation of CKO splenic B cells (Fig. 1B). As anticipated,
induction of the plasma cell surface marker CD138 and IgM production were defective when compared with Ctrl B cells (Fig. 1, C
and D), consistent with the notion that in vitro plasma cell differentiation is impaired in B cells lacking Blimp-1. The frequency of
CD44highCD62Llow effector T cells was increased in CKO spleen,
and we isolated increased numbers of stimulated CKO splenic
IFN-␥-producing T cells ex vivo (Fig. 1, E and F), consistent with
previous reports (19, 20).
We next examined the percentages and the total cell counts of
various immune cell subsets in secondary lymphpoid organs. Fig.
2A shows that the percentages of splenic CD3⫹ T cells, B220⫹ B
cells, and F4/80high macrophages were similar in Ctrl and CKO
mice. Surprisingly, greater frequency of CD11chigh cells was found in
CKO mice (Fig. 2B, left) compared with Ctrl mice. The number of
DCs found in CKO mice was even greater when we counted the total
CD11chigh splenic CDCs (Fig. 2B, middle). The CD11chigh populations in the peripheral lymph nodes of CKO mice were similarly augmented (Fig. 2B, right). Thus, increased DC populations in CKO mice
suggest a role for Blimp-1 in DC development.
Next, we found that the percentage of CD8⫺ cDCs was greater
in CKO spleen than in Ctrl spleen (Fig. 2C). Correspondingly, the
percentage of CD8⫹ cDCs was less in CKO spleen. However,
owing to the increased number of total cDCs in CKO mice, the
total number of CD8⫹ cDCs in CKO spleen remained similar to
that in Ctrl spleen, whereas the total number of CD8⫺ cDCs was
greatly increased in CKO mice (Fig. 2D). Among the CD8⫺ cDCs,
the distribution and total number of CD4⫹CD8⫺ cDCs were significantly increased in CKO mice compared with Ctrl mice (Fig. 2,
E and F). Despite a decrease in the relative percentage of
CD4⫺CD8⫺ cDCs in CKO spleen (Fig. 2E), the total number
of CD4⫺CD8⫺ cDCs was increased (Fig. 2F). Therefore, both the
CD4⫹ and CD4⫺ subpopulations of the CD8⫺ cDC population
were expanded in CKO mice.
The expanded steady-state total CD8⫺ cDC population in CKO
mice could result from increased numbers of bone marrow DC
progenitors, changes in the frequency of immediate splenic precursors of the DC subset, and/or changes in cell proliferation/survival. We examined the distribution of DC precursors (defined as
Lin⫺c-kit⫹Flt3⫹) (6) and the more restricted DC progenitor subpopulation (defined as Lin⫺c-kitintFlt3⫹IL-7R␣⫺M-CSFR⫹) (7, 8)
in Ctrl and CKO bone marrow cells (Fig. 3A). The relative percentage of the Lin⫺c-kit⫹Flt3⫹ and Lin⫺c-kitintFlt3⫹IL-7R␣⫺MCSFR⫹ populations was similar in Ctrl and CKO bone marrow
(Fig. 3B), suggesting that the increase in total DC population in
CKO mice may not be a consequence of increased generation of
DC progenitors from bone marrow hematopoietic stem cells. We
next examined splenic pre-cDCs, which are characterized as
CD11c⫹CD45RAlowCD43intSIRP-␣int (9). There was no difference in the frequency of splenic pre-cDCs between Ctrl and CKO
mice (Fig. 3C). The immediate splenic CD8⫺ cDC precursors were
examined by flow cytometric analysis of CD24low/int cells from
pre-cDCs (9, 35). The relative percentage of CD24low/int cells was
significantly increased in CKO mice (Fig. 3, C and D), indicating
that more CD8⫺cDC immediate precursors were present in CKO
spleen than Ctrl spleen. We also found higher steady-state Blimp-1
mRNA levels in CD8⫺ cDCs, including CD4⫹CD8⫺and
CD4⫺CD8⫺ cDCs (Fig. 3E), consistent with these findings that
CD8⫺ splenic cDCs were preferentially affected in CKO mice. In
fact, CD4⫹CD8⫺and CD4⫺CD8⫺ cDCs have amounts of steadystate Blimp-1 mRNA comparable to those in CD44highCD62Llow
effector CD4⫹ cells and B220⫹ B cells (Fig. 3E). The levels of
Blimp-1 mRNA in the induced state were also assessed. Like stimulated splenic CD4⫹ T cells and B cells, Blimp-1 mRNA levels
were induced by LPS in CD11chigh splenic cDCs (Fig. 3F).
Loss of IRF-2, IRF-4, or IRF-8 alters CD8⫺ or CD8⫹ cDC
distribution in mice (10 –12). However, IRF-2, IRF-4, and IRF-8
mRNA levels in all splenic cDC subsets were similar in Ctrl and
CKO mice (supplemental Fig. 1A). c-myc, which plays a role in
cell proliferation, is a direct target of Blimp-1 in several cell lineages (28, 36). c-myc mRNA levels in each cell subpopulation
were similar in Ctrl and CKO mice (supplemental Fig. 1B). Further
investigation of proliferative CD11chigh splenic DC subsets in vivo
revealed that Ctrl and CKO mice had similar frequencies of BrdU
incorporation within CD8⫹ or CD8⫺ splenic DC subsets (supplemental Fig. 2A). Annexin V staining revealed similar survival rates
for CD8⫹ and CD8⫺ splenic cDC subpopulations freshly isolated
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Genomic fragments from ⫹69 to ⫹223 of murine Il-6, located in intron 1,
and from ⫺600 to ⫹64 of murine Ccl2 were amplified by PCR from
genomic DNA of primary mouse BMDCs derived from C57BL/6 mice and
cloned into SmaI/BglII-digested pGL3 promoter vector (Promega) and
KpnI/BglII-digested pGL3 basic vector (Promega), respectively. Detailed
primer information for luciferase reporter constructions was described in
supplemental Table I. JAWS II cells were cotransfected with 0.2⬃1 ␮g
luciferase reporter construct as mentioned above and various amounts (for
Il-6 reporter assays: 50, 150, and 450 ng; for Ccl2 reporter assays: 30, 100
and 300 ng) of Blimp-1 expression vector (pCMV-Blimp1) or control vector (pCMV-5b) using TransIT-TKO reagent (Mirus) (33). Luciferase activity measurement and fold repression calculation was performed as previously described (30).
7041
7042
from Ctrl and CKO mice (supplemental Fig. 2B). Collectively,
these results suggest that the increased number of steady-state
CD8⫺ cDCs in CKO spleen likely results from increased generation of immediate CD8⫺ cDC precursors.
Stimulus-induced Blimp-1 expression during DC maturation is
mediated by NF-␬B and p38 MAPK pathways
DCs can be generated by addition of GM-CSF in the bone marrow
progenitors in culture (37). We next measured the expression of
Blimp-1 in bone marrow cultures supplemented with GM-CSF and
evaluated whether its expression changed following stimulus-induced maturation. The Blimp-1 mRNA levels in sorted CD11c⫹
cells obtained from BMDCs were almost equivalent in cells cultured with GM-CSF for 4 and 8 days (Fig. 4A), whereas Blimp-1
was greatly induced in BMDCs cultured with LPS for 24 h (Fig.
4A). Similarly, maturation of GM-CSF-cultured BMDCs by
TNF-␣, CpG, or poly I:C induced Blimp-1 mRNA and protein
expression (Fig. 4, B and C). Using pharmacological inhibitors, we
examined the signaling pathway(s) required for Blimp-1 induction
in BMDCs. Induction of Blimp-1 by LPS was inhibited in a dose-
FIGURE 2. Blimp-1 negatively regulates CD8⫺ DC homeostasis. A,
Percentage of peripheral lymph node CD3⫹ T cells (n ⫽ 9), B220⫹ B cells
(n ⫽ 9), and F4/80high macrophages (n ⫽ 10) in Ctrl and CKO mice. B,
Percentage (left) and total number (middle) of splenic CD11chigh cDCs
(n ⫽ 12), and percentage of peripheral lymph node CD11chigh cDCs (n ⫽
8, right) in Ctrl and CKO mice. C, Percentage of CD8⫹ and CD8⫺ cDCs
in the CD11chigh gate in Ctrl and CKO spleens (n ⫽ 12). D, Total number
of splenic CD11chighCD8⫹ and CD11chighCD8⫺ DCs in Ctrl and CKO
mice (n ⫽ 12). E, Percentage of splenic CD11chighCD4⫹CD8⫺ and
CD11chighCD4⫺CD8⫺ cells in the CD11chighCD8⫺ gate from Ctrl and
CKO mice (n ⫽ 12). F, Total number of splenic CD11chighCD4⫹CD8⫺
and CD11chighCD4⫺CD8⫺ cells in Ctrl and CKO mice (n ⫽ 12). Data
represent means ⫾ SEM. ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01; ⴱⴱⴱ, p ⬍ 0.005; ⴱⴱⴱⴱ,
p ⬍ 0.001 vs Ctrl.
dependent manner by the NF-␬B inhibitor BAY 11-0782, and by
the p38 MAPK inhibitor SB203580 (Fig. 4D), but the JNK inhibitor SP600125, the ERK inhibitor PD98059, and the PI3K inhibitor
LY294002 had no effect (data not shown). Thus, during BMDC
maturation, Blimp-1 is induced by TLR ligands through the p38
MAPK and NF-␬B pathways.
Blimp-1 is required during DC maturation
We next examined whether BMDCs cultured with GM-CSF required Blimp-1. We verified impaired Blimp-1 induction by LPS
treatment of CKO BMDCs cultured with GM-CSF (Fig. 5A). The
maturation status of DCs, which was analyzed by the expression of
a panel of surface markers including CD25, CD40, CD86, and
MHCII(I-A/E), did not differ significantly between Ctrl and CKO
GM-CSF-cultured BMDCs after 8 days of culture (Fig. 5B), suggesting that Blimp-1 is not essential for DC development under
these conditions. Following stimulation with a variety of TLR ligands or by TNF-␣ for 24 h, induction of CD25, CD40, CD86, and
MHCII was partially impaired in CKO GM-CSF-cultured BMDCs
(Fig. 5B). Likewise, up-regulation of CD86 and MHCII in BMDCs
cultured with GM-CSF derived from C57BL/6 mice was blocked
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 1. The generation of CKO mice. A, PCR analysis of genomic
DNA isolated from tissues (peripheral lymph node (LN), spleen (Sp), thymus (Thy), bone marrow (BM), and brain), from cells (splenic CD3⫹ T
cells (T), B220⫹ B cells (B), and CD11c⫹ DCs (DC)) of Prdm1f/fTie2Cre⫺ and Prdm1f/fTie2-Cre⫹ mice. B, Western blotting of Blimp-1 in Ctrl
and CKO B cells treated with LPS for 3 days. ␣-tubulin was as a loading
control. C, Flow cytometric analysis of plasma cells generated from Ctrl
and CKO splenic B cells stimulated with LPS for 3 days. One representative experiment of three is shown. D, IgM levels in supernatants harvested from LPS-treated Ctrl and CKO B cells on days 3 and 5. Data
represent means ⫾ SD for one representative experiment of three. E, Flow
cytometric analysis of splenic CD4⫹ T cells from Ctrl and CKO mice.
Numbers in the quadrants indicate the percentage of naive
(CD62LhighCD44low) and effector (CD62LlowCD44high) T cells. F, Total
splenocytes from Ctrl and CKO mice were cultured with PMA plus ionomycin in the presence of brefeldin A for 6 h for intracellular cytokine
staining and subsequent flow cytometric analysis. Numbers in the quadrants indicate the percentage of IFN-␥- and IL-4-producing cells.
THE ROLE OF Blimp-1 IN DCs
The Journal of Immunology
7043
by lentiviral vectors expressing short hairpin RNAs against
Blimp-1 (Fig. 5C), suggesting that impaired maturation of CKO
BMDCs is a specific effect. We excluded the possibility that defective BMDC maturation in CKO mice was caused by changes in
the levels of various TLR mRNAs (supplemental Fig. 3A), the
kinetics of I␬B␣ degradation, or nuclear translocation of the
NF-␬B subunits p50 and p65 that is mediated by TLR4 receptor
signaling (supplemental Fig. 3, B and C).
Using a MLR assay, we demonstrated that LPS, poly I:C, CpG,
and TNF-␣ stimulation of BMDCs from CKO mice resulted in a
partially reduced ability to induce allogeneic T cell proliferation,
when compared with Ctrl BMDCs (Fig. 5D). The significance of
Blimp-1 in DC maturation was further strengthened by in vivo
experiments. Ten hours after LPS injection of Ctrl mice, CD40,
CD54 and CD86 were up-regulated in mesenteric lymph node DCs
(Fig. 5E). By contrast, CKO DCs were resistant to up-regulation of
several tested maturation markers following in vivo LPS injection
(Fig. 5E). Interestingly, it has been shown that mesenteric lymph
node DCs which generally have higher levels of MHCII are more
mature than splenic DCs (38, 39). This is in agreement with our
data that lower basal MHCII levels were found in CKO mesenteric
lymph node DCs that are less mature (Fig. 5E).
Il-6 and Ccl2 were suppressed directly by Blimp-1
We also measured cytokine/chemokine production to assay the
function of GM-CSF-cultured BMDCs from Ctrl and CKO mice
(Fig. 6A). After LPS stimulation for 1 day, CKO cultures produced
more IL-6 and MCP-1 (encoded by Ccl2) than Ctrl cultures, as
determined by CBA (Fig. 6A), and this increase occurred at the
transcription level (supplemental Fig. 4A). IL-6 and MCP-1
mRNA levels were also increased in LPS- and poly I:C-stimulated
splenic CD11c⫹ DCs cultured from CKO mice (supplemental Fig.
4B). We thus hypothesized that Il-6 and Ccl2 expressed in the DC
lineage are subject to Blimp-1 regulation. Il-6 contains three potential Blimp-1 binding sites: one in intron 1 and two in intron 3.
The Ccl2 promoter region contains one potential Blimp-1 binding
site, as revealed based on known Blimp-1 consensus sites (31)
(Fig. 6B). A ChIP assay using a Blimp-1-specific Ab showed that
endogenous Blimp-1 bound to the Il-6 intron 1 and Ccl2 promoter
sites in Ctrl BMDCs stimulated with LPS, and that Blimp-1 did not
bind significantly to either site in LPS-stimulated CKO BMDCs
(Fig. 6C). In support of this finding, DNA pull-down assay demonstrated that Blimp-1 in nuclear extracts harvested from LPSstimulated Ctrl BMDCs could bind to biotinylated oligonucleotides containing wild-type but not mutated Il-6 or Ccl2 sites (Fig.
6D), and that competition assays using unlabeled oligonucleotides
containing a known Blimp-1 binding site in the c-myc promoter
(36) largely reduced the binding (Fig. 6D). In contrast, nuclear
proteins isolated from LPS-stimulated CKO BMDCs bound much
less to wild-type Il-6 or Ccl2 biotinylated oligonucleotides (Fig.
6D). Accordingly, EMSA showed that oligonucleotides containing
these sites were shifted by nuclear protein extracts containing exogenously expressed Blimp-1 (supplemental Fig. 5, A and B). The
shifted complex was disrupted by addition of excess unlabeled
probe corresponding to the c-myc site (supplemental Fig. 5, A and
B) and was supershifted by a Blimp-1-specific mAb (supplemental
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 3. Increased percentage of CD8⫺ cDC immediate precursors in CKO mice. A, Analysis of bone marrow DC progenitors in Ctrl and CKO mice.
Single cell suspensions of bone marrow cells were stained and analyzed by flow cytometry. The distribution of Lin⫺c-kit⫹Flt3⫹ progenitors (gate 1 plus
gate 2, left contour plots) or Lin⫺c-kitintFlt3⫹IL-7R␣⫺M-CSFR⫹ distinct DC progenitors (gate 3, right contour plots) are indicated in successive gates. One
representative experiment of five is shown. B, Percentage of Lin⫺c-kit⫹Flt3⫹ (left, n ⫽ 6) in the Lin⫺ gate and Lin⫺c-kitintFlt3⫹IL-7R␣⫺M-CSFR⫹ (right,
n ⫽ 5) progenitors in the Lin⫺c-kitintFlt3⫹ gate in Ctrl and CKO bone marrow cells. C, Distribution of splenic CD8⫺ DC progenitors in Ctrl and CKO
mice. CD11cintCD45RAlowCD43intSIRP-␣intCD24low/int cells corresponding to CD8⫺ DC progenitors were analyzed by successive gates as indicated. D,
The percentage of CD24low/int cells that correspond to CD8⫺ DC progenitors in Ctrl and CKO mice (n ⫽ 3). E, Relative levels of Blimp-1 transcripts in
various immune cell types. Purified C57BL/6 splenic B220⫹ B cells, naive (CD62LhighCD44low) CD4⫹ T cells, effector (CD62LlowCD44high) T cells, and
various indicated CD11chigh subsets were subjected to RT-QPCR analysis of Blimp-1 mRNA level. F, Relative levels of Blimp-1 transcripts in various
immune cell types following stimulation. RT-QPCR was used to determine Blimp-1 mRNA levels in purified splenic B cells ⫾ LPS stimulation for 3 days,
CD11chigh DCs ⫾ LPS stimulation for 1 day, and CD4⫹ T cells ⫾ anti-CD3⫹IL-2 stimulation for 3 days. Results in E and F were calculated relative to
nonstimulated B cells. Data represent means ⫾ SEM. ⴱ, p ⬍ 0.05 vs Ctrl.
7044
THE ROLE OF Blimp-1 IN DCs
Fig. 5, A and B). By contrast, mutated oligonucleotides or control
isotype Ab did not affect the mobility of the shifted complex (supplemental Fig. 5, A and B). Furthermore, ectopic Blimp-1 expression was sufficient to suppress the expression of endogenous IL-6
and MCP-1 in JAWS II cells, a murine immature DC line (33)
(Fig. 6E). Finally, we used a construct consisting of a minimal
basal promoter fused with an intron 1 fragment of Il-6 containing
the Blimp-1 binding site and the luciferase gene, and a similar
construct containing the Ccl2 promoter fragment. We observed
dose-dependent Blimp-1 suppression of luciferase expression with
both constructs (Fig. 6F). Taken together, these data indicate that
Il-6 and Ccl2 are direct targets for Blimp-1 and that Blimp-1 negatively regulates these genes in DCs.
Discussion
FIGURE 5. Impaired DC maturation in CKO mice. A, Western blotting of Blimp-1 in GM-CSF-cultured immature (im) and LPS-stimulated BMDCs
from Ctrl and CKO mice. B, Cell surface markers of BMDCs cultured with GM-CSF. Ctrl (shaded histogram) or CKO (open histogram) CD11c⫹ BMDCs
and LPS-, poly I:C-, CpG-, or TNF-␣-stimulated BMDCs were analyzed for surface marker expression by flow cytometry. One representative experiment
of at least three is shown. C, Blimp-1 knockdown BMDCs are less mature. GM-CSF-cultured BMDCs were transduced with lentiviral vectors expressing
short hairpin RNAs for Blimp-1 (Blimp1-3952i) or a control shRNA (Ctrli) after 8 days in culture. Surface expression of CD86 and I-A/E was examined
in GFP⫹ cells 4 days after transduction. D, Allogeneic MLR elicited by stimulation of Ctrl or CKO BMDCs, as indicated. Data represent means ⫾ SEM
of three independent experiments. E, CKO DCs are refractory to maturation in vivo. The expression of indicated surface markers was analyzed from the
CD11chigh gate of mesenteric lymph node cells. Results represent the mean fluorescence intensity (MFI) ⫾ SEM for each marker (n ⫽ 5 in each group).
ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01; ⴱⴱⴱ, p ⬍ 0.005 vs Ctrl.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 4. Blimp-1 expression is increased upon maturation mediated
by NF-␬B and p38 MAPK pathways. A, Relative Blimp-1 mRNA levels in
CD11c⫹ cells sorted by flow cytometry from BMDCs cultured with GMCSF for 4 or 8 days. Cells sorted after 8 days in culture were further
stimulated with LPS for 1 day and subjected to RT-QPCR analysis of
Blimp-1 mRNA. B, RT-QPCR analysis of Blimp-1 mRNA in immature
(im) BMDCs and LPS-, TNF-␣-, CpG-, or poly I:C-stimulated BMDCs
cultured in the presence of GM-CSF. Data represent means ⫾ SD of three
experiments. C, Western blotting of Blimp-1 in immature BMDCs and
LPS-, TNF-␣-, CpG-, or poly I:C-stimulated BMDCs cultured with GMCSF. D, After 8 days in culture with GM-CSF, BMDCs were treated with
a NF-␬B inhibitor, BAY 11-0782, or p38 MAPK inhibitor, SB203580, for
1 h, followed by LPS for 20 h. Cell lysates were analyzed for Blimp-1
expression by Western blotting.
A role for Blimp-1 in B cell and T cell lineages has been reported
(18 –20). In this study, we found increased DC populations in mice
lacking Blimp-1. Specifically, the number of CD8⫺ cDCs was
affected in CKO mice. Higher Blimp-1 expression is found in
CD8⫺ cDC subpopulations. Our results suggest that Blimp-1
may function in CD8⫺ cDC homeostasis by providing a balance
that prevents excessive expansion of CD8⫺ cDCs by certain
positive regulators. Blimp-1 also regulates DC maturation, and
therefore we have identified a novel role for Blimp-1 in the DC
lineage that is functionally relevant to innate immunity.
Similar to mice lacking Prdm1 specifically in the B or T cell
lineage (18 –20), in vitro plasma cell differentiation is defective
and T cell homeostasis is dysregulated in CKO mice. One striking
phenotype found in T cell-specific deletion of Prdm1 in mice is
severe colitis and body weight loss (19). Autoimmune disease
symptoms were not observed in CKO mice up to 5 mo of age (data
not shown), although these mice displayed increased steady-state
effector T cell populations. These discrepancies may have resulted
from the use of a different lineage-specific Cre in the different
systems. In particular, DC function was altered in our animals,
The Journal of Immunology
7045
which may have impaired the initiation of the inflammatory response. In contrast, we think that the altered levels of CD8⫺ cDCs
in this study are probably not attributable to an indirect effect resulting from changes in cytokine levels from T and B cell lineages,
for the following reasons. First, Ctrl and CKO mice do not differ
significantly with respect to steady-state serum cytokine/chemokine levels as determined by multiplex bead array assays (supplemental Fig. 6). Second, cDC homeostasis is unaffected by deletion
of Prdm1 in the mouse B cell lineage (data not shown). 3) T cellspecific Blimp-1 transgenic mice have normal distribution and
numbers of splenic CD11chigh cDCs when compared with control
littermates (Y.-H. Chan and K.-I Lin, unpublished observation). In
addition, the mice used in our study also harbored a Prdm1 deletion in endothelial cells, but Blimp-1 expression in endothelial
cells is not functionally relevant during embryonic development
(40). The numbers and frequencies of T cells, B cells, and precDCs were normal or minimally affected in CKO spleen or peripheral lymphoid organs, suggesting that Blimp-1 deficiency in
blood vessel endothelial cells does not interfere with the trafficking
of newly generated hematopoietic cells into peripheral lymphoid
tissues.
In this study, we demonstrated the expression of Blimp-1 transcripts in steady state murine splenic cDCs and BMDCs cultured
with GM-CSF, and that Blimp-1 is induced following stimulusinduced maturation of BMDCs. What are the signals/molecules
involved in regulating Blimp-1 expression in DC lineages during
either steady state or maturation? We determined that various TLR
ligands induce Blimp-1 expression in BMDCs, consistent with previous findings that conjugation of TLR4, TLR2, or TLR9 results in
Blimp-1 activation in the B cell lineage (22–24). Blimp-1 induction through TLR signaling is dependent on p38 MAPK and
NF-␬B signaling pathways. Essential roles for these two pathways
in DC maturation have been described in vitro (41, 42). These
findings are concordant with our finding that Blimp-1 is critical for
BMDC maturation because it acts downstream of p38 MAPK and
NF-␬B. Blimp-1 transcripts in B cells are also regulated by AP-1
and STAT3 (43, 44). A JNK inhibitor did not influence Blimp-1
expression during BMDC maturation (data not shown), thus it is
unlikely that AP-1 is involved in regulation of Blimp-1 expression
in the DC lineage. The role of STAT3 in Blimp-1 induction during
BMDC maturation remains to be determined. Whether p38 MAPK
and NF-␬B pathways regulate steady state Blimp-1 expression in
splenic CD8⫺ cDCs also awaits further investigation. Because
CD8⫺ cDCs are found largely in the marginal zone of spleen or the
subsinusal layer of peripheral lymph nodes (45, 46), the microenvironment of these areas may provide signals for steady state
Blimp-1 expression.
Blimp-1 negatively regulates homeostatic development of cDC
subsets in vivo, and it also positively regulates DC maturation.
CKO GM-CSF-supplemented BMDCs are less able to up-regulate
MHCII in response to stimulation, which may explain why stimulation of BMDCs from CKO mice did not induce efficient allogeneic T cell proliferation. Accordantly, the induction of CD25,
CD40, CD86, and MHCII surface markers was reduced in Flt3Lcultured CKO CD11c⫹CD11b⫹ BMDCs following either poly I:C
or CpG stimulation (supplemental Fig. 7), suggesting that Blimp-1
may regulate genes generally important for response to DC maturation. Further identification of Blimp-1 targets in DC lineages
may improve our understanding of the underlying causes of defective CKO BMDC maturation. Blimp-1-mediated suppression of
Il-6 in the DC lineage may provide a clue. Il-6 knockout mice have
a greater number of mature DCs in vivo and pretreatment with
IL-6 suppresses BMDC maturation (47), suggesting that defective
DC maturation in CKO mice or cultures may result from enhanced
IL-6 production, at least in part.
In conclusion, we have established two new roles for the transcriptional repressor Blimp-1 in the immune system: (1) maintenance of CD8⫺ cDC homeostasis and (2) promotion of DC
maturation or function. Our studies provide insights into the mechanisms governing maintenance of homeostatic cDC development
and also provide a molecular basis for designing agents to modulate immune tolerance or immunogenic responses.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 6. Blimp-1 regulates Il-6 and Ccl2 in DCs. A, CBA analysis of inflammatory cytokines in the supernatants of GM-CSF-cultured Ctrl or CKO
BMDCs stimulated with LPS. One representative experiment of three is shown. Changes in the levels of IL-6 and MCP-1 were quantified in three
independent experiments. Data are means ⫾ SEM. B, Shown are the putative Blimp-1 binding sites in Il-6, between 3 kb upstream and 3 kb downstream
of the transcription start site; also shown is the putative Blimp-1 binding site in the Ccl2 promoter. C, Blimp-1 binds to Il-6 and Ccl2 sites in vivo. Ctrl
or CKO BMDCs were stimulated with LPS for 24 h, followed by ChIP analysis using primer sets designed to amplify the indicated gene loci. Snail1 was
used as a negative control locus for Blimp-1 binding, as described (48). D, Western blotting analysis of Blimp-1 captured in DNA pull-down assays in which
biotinylated probes coupled to streptavidin-coated magnetic beads were incubated with nuclear extracts from LPS-stimulated Ctrl and CKO BMDCs. E,
Ectopic expression of Blimp-1 by pFUW-GFPBlimp-1 suppresses levels of IL-6 and MCP-1 transcripts as determined by RT-QPCR in JAWS II cells. F,
Blimp-1 suppresses luciferase activity driven by an Il-6 intron 1 fragment containing the Blimp-1 binding site and a minimal promoter, as well as luciferase
activity driven by a promoter fragment containing the Blimp-1 binding site in the Ccl2 promoter in JAWS II cells. Results in C, E, and F are means ⫾
SEM (n ⫽ 3). ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01; ⴱⴱⴱⴱ, p ⬍ 0.001.
7046
Acknowledgments
We thank I-Ying Lin, Hui-Kai Kuo, and Dr. Li-En Shao for technical
assistance.
Disclosures
The authors have no financial conflict of interest.
References
24. Genestier, L., M. Taillardet, P. Mondiere, H. Gheit, C. Bella, and T. Defrance.
2007. TLR agonists selectively promote terminal plasma cell differentiation of B
cell subsets specialized in thymus-independent responses. J. Immunol. 178:
7779 –7786.
25. Lutz, M. B., N. Kukutsch, A. L. Ogilvie, S. Rossner, F. Koch, N. Romani, and
G. Schuler. 1999. An advanced culture method for generating large quantities of
highly pure dendritic cells from mouse bone marrow. J. Immunol. Methods 223:
77–92.
26. Gilliet, M., A. Boonstra, C. Paturel, S. Antonenko, X. L. Xu, G. Trinchieri, A.
O’Garra, and Y. J. Liu. 2002. The development of murine plasmacytoid dendritic
cell precursors is differentially regulated by FLT3-ligand and granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 195: 953–958.
27. Lin, F. R., H. K. Kuo, H. Y. Ying, F. H. Yang, and K. I. Lin. 2007. Induction of
apoptosis in plasma cells by B lymphocyte-induced maturation protein-1 knockdown. Cancer Res. 67: 11914 –11923.
28. Magnusdottir, E., S. Kalachikov, K. Mizukoshi, D. Savitsky, A. IshidaYamamoto, A. A. Panteleyev, and K. Calame. 2007. Epidermal terminal differentiation depends on B lymphocyte-induced maturation protein-1. Proc. Natl.
Acad. Sci. USA 104: 14988 –14993.
29. Lin, K. I., and K. Calame. 2004. Introduction of genes into primary murine
splenic B cells using retrovirus vectors. Methods Mol. Biol. 271: 139 –148.
30. Su, S. T., H. Y. Ying, Y. K. Chiu, F. R. Lin, M. Y. Chen, and K. I. Lin. 2009.
Involvement of histone demethylase LSD1 in Blimp-1-mediated gene repression
during plasma cell differentiation. Mol. Cell Biol. 29: 1421–1431.
31. Kuo, T. C., and K. L. Calame. 2004. B lymphocyte-induced maturation protein
(Blimp)-1, IFN regulatory factor (IRF)-1, and IRF-2 can bind to the same regulatory sites. J. Immunol. 173: 5556 –5563.
32. Ebert, B. L., and H. F. Bunn. 1998. Regulation of transcription by hypoxia requires a multiprotein complex that includes hypoxia-inducible factor 1, an adjacent transcription factor, and p300/CREB binding protein. Mol. Cell Biol. 18:
4089 – 4096.
33. Awasthi, S., and R. A. Cox. 2003. Transfection of murine dendritic cell line
(JAWS II) by a nonviral transfection reagent. BioTechniques 35: 600 – 602, 604.
34. Constien, R., A. Forde, B. Liliensiek, H. J. Grone, P. Nawroth, G. Hammerling,
and B. Arnold. 2001. Characterization of a novel EGFP reporter mouse to monitor Cre recombination as demonstrated by a Tie2 Cre mouse line. Genesis 30:
36 – 44.
35. Caton, M. L., M. R. Smith-Raska, and B. Reizis. 2007. Notch-RBP-J signaling
controls the homeostasis of CD8⫺ dendritic cells in the spleen. J. Exp. Med. 204:
1653–1664.
36. Lin, Y., K. Wong, and K. Calame. 1997. Repression of c-myc transcription by
Blimp-1, an inducer of terminal B cell differentiation. Science 276: 596 –599.
37. Inaba, K., M. Inaba, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Muramatsu,
and R. M. Steinman. 1992. Generation of large numbers of dendritic cells from
mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 176: 1693–1702.
38. Henri, S., D. Vremec, A. Kamath, J. Waithman, S. Williams, C. Benoist,
K. Burnham, S. Saeland, E. Handman, and K. Shortman. 2001. The dendritic cell
populations of mouse lymph nodes. J. Immunol. 167: 741–748.
39. Wilson, N. S., D. El-Sukkari, G. T. Belz, C. M. Smith, R. J. Steptoe, W. R. Heath,
K. Shortman, and J. A. Villadangos. 2003. Most lymphoid organ dendritic cell
types are phenotypically and functionally immature. Blood 102: 2187–2194.
40. Robertson, E. J., I. Charatsi, C. J. Joyner, C. H. Koonce, M. Morgan, A. Islam,
C. Paterson, E. Lejsek, S. J. Arnold, A. Kallies, et al. 2007. Blimp1 regulates
development of the posterior forelimb, caudal pharyngeal arches, heart and sensory vibrissae in mice. Development 134: 4335– 4345.
41. Arrighi, J. F., M. Rebsamen, F. Rousset, V. Kindler, and C. Hauser. 2001. A
critical role for p38 mitogen-activated protein kinase in the maturation of human
blood-derived dendritic cells induced by lipopolysaccharide, TNF-␣, and contact
sensitizers. J. Immunol. 166: 3837–3845.
42. Rescigno, M., M. Martino, C. L. Sutherland, M. R. Gold, and P. Ricciardi-Castagnoli. 1998. Dendritic cell survival and maturation are regulated by different
signaling pathways. J. Exp. Med. 188: 2175–2180.
43. Vasanwala, F. H., S. Kusam, L. M. Toney, and A. L. Dent. 2002. Repression of
AP-1 function: a mechanism for the regulation of Blimp-1 expression and B
lymphocyte differentiation by the B cell lymphoma-6 protooncogene. J. Immunol.
169: 1922–1929.
44. Reljic, R., S. D. Wagner, L. J. Peakman, and D. T. Fearon. 2000. Suppression of
signal transducer and activator of transcription 3-dependent B lymphocyte terminal differentiation by BCL-6. J. Exp. Med. 192: 1841–1848.
45. Dudziak, D., A. O. Kamphorst, G. F. Heidkamp, V. R. Buchholz,
C. Trumpfheller, S. Yamazaki, C. Cheong, K. Liu, H. W. Lee, C. G. Park, et al.
2007. Differential antigen processing by dendritic cell subsets in vivo. Science
315: 107–111.
46. Lopez-Bravo, M., and C. Ardavin. 2008. In vivo induction of immune responses
to pathogens by conventional dendritic cells. Immunity 29: 343–351.
47. Park, S. J., T. Nakagawa, H. Kitamura, T. Atsumi, H. Kamon, S. Sawa,
D. Kamimura, N. Ueda, Y. Iwakura, K. Ishihara, et al. 2004. IL-6 regulates in
vivo dendritic cell differentiation through STAT3 activation. J. Immunol. 173:
3844 –3854.
48. Martins, G. A., L. Cimmino, J. Liao, E. Magnusdottir, and K. Calame. 2008.
Blimp-1 directly represses Il2 and the Il2 activator Fos, attenuating T cell proliferation and survival. J. Exp. Med. 205: 1959 –1965.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
1. Iwasaki, A., and R. Medzhitov. 2004. Toll-like receptor control of the adaptive
immune responses. Nat. Immunol. 5: 987–995.
2. Randolph, G. J., J. Ochando, and S. N. S. Partida. 2008. Migration of dendritic
cell subsets and their precursors. Annu. Rev. Immunol. 26: 293–316.
3. Shortman, K., and S. H. Naik. 2007. Steady-state and inflammatory dendritic-cell
development. Nat. Rev. Immunol. 7: 19 –30.
4. Vremec, D., M. Zorbas, R. Scollay, D. J. Saunders, C. F. Ardavin, L. Wu, and
K. Shortman. 1992. The surface phenotype of dendritic cells purified from mouse
thymus and spleen: investigation of the CD8 expression by a subpopulation of
dendritic cells. J. Exp. Med. 176: 47–58.
5. Martin, P., G. M. del Hoyo, F. Anjuere, S. R. Ruiz, C. F. Arias, A. R. Marin, and
C. Ardavin. 2000. Concept of lymphoid versus myeloid dendritic cell lineages
revisited: both CD8␣⫺ and CD8␣⫹ dendritic cells are generated from CD4low
lymphoid-committed precursors. Blood 96: 2511–2519.
6. D’Amico, A., and L. Wu. 2003. The early progenitors of mouse dendritic cells
and plasmacytoid predendritic cells are within the bone marrow hemopoietic
precursors expressing Flt3. J. Exp. Med. 198: 293–303.
7. Onai, N., A. Obata-Onai, M. A. Schmid, T. Ohteki, D. Jarrossay, and
M. G. Manz. 2007. Identification of clonogenic common Flt3⫹M-CSFR⫹ plasmacytoid and conventional dendritic cell progenitors in mouse bone marrow. Nat.
Immunol. 8: 1207–1216.
8. Naik, S. H., P. Sathe, H. Y. Park, D. Metcalf, A. I. Proietto, A. Dakic, S. Carotta,
M. O’Keeffe, M. Bahlo, A. Papenfuss, et al. 2007. Development of plasmacytoid
and conventional dendritic cell subtypes from single precursor cells derived in
vitro and in vivo. Nat. Immunol. 8: 1217–1226.
9. Naik, S. H., D. Metcalf, A. van Nieuwenhuijze, I. Wicks, L. Wu, M. O’Keeffe,
and K. Shortman. 2006. Intrasplenic steady-state dendritic cell precursors that are
distinct from monocytes. Nat. Immunol. 7: 663– 671.
10. Honda, K., T. Mizutani, and T. Taniguchi. 2004. Negative regulation of IFN-␣/␤
signaling by IFN regulatory factor 2 for homeostatic development of dendritic
cells. Proc. Natl. Acad. Sci. USA 101: 2416 –2421.
11. Suzuki, S., K. Honma, T. Matsuyama, K. Suzuki, K. Toriyama, I. Akitoyo,
K. Yamamoto, T. Suematsu, M. Nakamura, K. Yui, and A. Kumatori. 2004.
Critical roles of interferon regulatory factor 4 in CD11bhighCD8␣⫺ dendritic cell
development. Proc. Natl. Acad. Sci. USA 101: 8981– 8986.
12. Aliberti, J., O. Schulz, D. J. Pennington, H. Tsujimura, C. Reis e Sousa, K. Ozato,
and A. Sher. 2003. Essential role for ICSBP in the in vivo development of murine
CD8␣⫹ dendritic cells. Blood 101: 305–310.
13. McKenna, H. J., K. L. Stocking, R. E. Miller, K. Brasel, T. De Smedt,
E. Maraskovsky, C. R. Maliszewski, D. H. Lynch, J. Smith, B. Pulendran, et al.
2000. Mice lacking flt3 ligand have deficient hematopoiesis affecting hematopoietic progenitor cells, dendritic cells, and natural killer cells. Blood 95:
3489 –3497.
14. Laouar, Y., T. Welte, X. Y. Fu, and R. A. Flavell. 2003. STAT3 is required for
Flt3L-dependent dendritic cell differentiation. Immunity 19: 903–912.
15. Keller, A. D., and T. Maniatis. 1991. Identification and characterization of a
novel repressor of ␤-interferon gene expression. Genes Dev. 5: 868 – 879.
16. Shaffer, A. L., K. I. Lin, T. C. Kuo, X. Yu, E. M. Hurt, A. Rosenwald,
J. M. Giltnane, L. Yang, H. Zhao, K. Calame, and L. M. Staudt. 2002. Blimp-1
orchestrates plasma cell differentiation by extinguishing the mature B cell gene
expression program. Immunity 17: 51– 62.
17. Lin, K. I., C. Tunyaplin, and K. Calame. 2003. Transcriptional regulatory cascades controlling plasma cell differentiation. Immunol. Rev. 194: 19 –28.
18. Shapiro-Shelef, M., K. I. Lin, L. J. McHeyzer-Williams, J. Liao, M. G.
McHeyzer-Williams, and K. Calame. 2003. Blimp-1 is required for the formation
of immunoglobulin secreting plasma cells and pre-plasma memory B cells. Immunity 19: 607– 620.
19. Martins, G. A., L. Cimmino, M. Shapiro-Shelef, M. Szabolcs, A. Herron,
E. Magnusdottir, and K. Calame. 2006. Transcriptional repressor Blimp-1 regulates T cell homeostasis and function. Nat. Immunol. 7: 457– 465.
20. Kallies, A., E. D. Hawkins, G. T. Belz, D. Metcalf, M. Hommel, L. M. Corcoran,
P. D. Hodgkin, and S. L. Nutt. 2006. Transcriptional repressor Blimp-1 is essential for T cell homeostasis and self-tolerance. Nat. Immunol. 7: 466 – 474.
21. Chang, D., C. Angelin-Duclos, and K. Calame. 2000. BLIMP-1: trigger for differentiation of myeloid lineage. Nat. Immunol. 1: 169 –176.
22. Lin, K. I., Y. Y. Kao, H. K. Kuo, W. B. Yang, A. Chou, H. H. Lin, A. L. Yu, and
C. H. Wong. 2006. Reishi polysaccharides induce immunoglobulin production
through the TLR4/TLR2-mediated induction of transcription factor Blimp-1.
J. Biol. Chem. 281: 24111–24123.
23. John, S. A., J. L. Clements, L. M. Russell, and L. A. Garrett-Sinha. 2008. Ets-1
regulates plasma cell differentiation by interfering with the activity of the transcription factor Blimp-1. J. Biol. Chem. 283: 951–962.
THE ROLE OF Blimp-1 IN DCs