Fish & Shellfish Immunology 33 (2012) 1149e1158
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology
journal homepage: www.elsevier.com/locate/fsi
Two novel short C-type lectin from Chinese mitten crab, Eriocheir sinensis,
are induced in response to LPS challenged
Xing-Kun Jin 1, Wei-Wei Li 1, Lin Cheng 1, Shuang Li, Xiao-Nv Guo, Ai-Qing Yu, Min-Hao Wu,
Lin He, Qun Wang*
School of Life Science, East China Normal University, No. 3663 North Zhong-Shan Road, Shanghai, China
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 12 June 2012
Received in revised form
27 August 2012
Accepted 30 August 2012
Available online 7 September 2012
The basic mechanism of host fighting against pathogens is pattern recognition receptors recognized
pathogen-associated molecular patterns. However, the specificity of recognition within the innate
immune molecular of invertebrates remains largely unknown. For this reason, we investigated the
immune functionality of two pattern recognition receptors, C-type lectin EsLecA and EsLecG, post
lipopolysaccharides (LPS) challenge in Chinese mitten crab (Eriocheir sinensis), which is a commercially
important and disease vulnerable aquaculture species. The cloning of full-length EsLecA and EsLecG
cDNA were based on the initial expressed sequence tags (EST) isolated from a hepatopancreatic cDNA
library via PCR. The EsLecA cDNA contained a 480-bp open reading frame that encoded a putative 159amino-acid protein, while EsLecG cDNA contained a 465-bp open reading frame that encoded a putative
154-amino-acid protein. Comparison, with other reported invertebrate and vertebrate sequences,
revealed the presence of carbohydrate recognition domains that were common among C-type lectin
superfamilies. EsLecA and EsLecG mRNA expression in E. sinensis were (a) both detected in all tissues,
including the hepatopancreas, gills, hemocytes, testis, accessory gland, ovary, muscle, stomach, intestine,
heart, thoracic ganglia and brain, and (b) responsive in hepatopancreas, gill, hemocytes post-LPS
immuno-challenge all appeared dramatically variation. Collectively, the data presented here demonstrate
the successful isolation of two novel C-type lectins from the Chinese mitten crab, and their role in the
innate immune system of an invertebrate.
Ó 2012 Elsevier Ltd. All rights reserved.
Keywords:
C-type lectin
Chinese mitten crab
Invertebrate innate immunity
LPS
1. Introduction
Invertebrate animals do not truely have an adaptative immune
response that is generated by memory and targeted immunoglobulin production, as in vertebrates [1]. Nonetheless invertebrate, such as crustaceans, are capable of effective innate immune
responses for protection against intruding pathogens [2]. In the
event of pathogens intruding, their conserved pathogenassociated molecular patterns (PAMPs), such as lipopolysaccharides (LPS), peptidoglycans and b-1, 3-glucans, i.e., which are
essential and unique components of virtually all microorganisms,
but absent in higher organisms [3] could be discriminated by
a wide range of pattern recognition receptors (PRRs) that are
highly conserved in evolution [4], then encountered a variety of
defense mechanisms.
* Corresponding author. Fax: þ86 21 62233754.
E-mail addresses: [email protected], [email protected] (Q. Wang).
1
These authors contributed equally to this work.
1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.fsi.2012.08.027
Lectins, an important member of PRRs, existed as transmembrane receptors or as soluble proteins in circulating fluids [5].
They plays crucial roles in innate immunity such as nonselfrecognition and clearance of invading microorganisms [6], via
recognizing and non-covalently binding to specific sugar moieties
and agglutinate pathogens by binding to cell surface glycoproteins
and glycoconjugates [7]. C-type lectins are the most diverse and
well studied among the lectin families. The term C-type lectin was
originally used to distinguish a group of Ca2þ-dependent (C-type)
carbohydrate-binding proteins from the other types of lectins [8].
This big gene family mediate sugar binding with diverse architecture contained homologous carbohydrate recognition domains
(CRDs) by which discriminate specific oligosaccharides at cell
surfaces, attach to circulating proteins and in the extracellular
matrix [9e11]. Although C-type lectin has been studied in vertebrates for many years, they have not been well characterized in
invertebrates.
The mitten crab (Eriocheir sinensis) (Henri Milne Edwards 1854),
which belongs to Crustacea, Decapoda, Varunidae, Eriocheir, is native
to China. This crab is a traditional savory food especially in the
1150
X.-K. Jin et al. / Fish & Shellfish Immunology 33 (2012) 1149e1158
Yangtze River Area, and comprises one of the most economically
important freshwater aquatic species of China [12]. With the
development of intensive E. sinensis culture which has expanded
rapidly over the last two decades, reached a yield of 4.0 105 t in
China in 2005 [13], various diseases caused by bacteria (especially
Gram-negative bacteria), viruses, or rickettsia-like organisms have
also begun to emerge and have resulted in enormous losses [14,15].
Therefore, an improved understanding of the innate immune
ability of crabs and their bio-defense mechanisms has become
a research priority. With this in mind, several research labs,
including our own, have begun screening immune-related genes
from Chinese mitten crab by constructing cDNA libraries [16e19],
with the aim of designing efficient strategies for disease control.
Among our cDNA library [18], two EST sequences identified as
EsLecA and EsLecG. (partial CDS) were found to be homologus to Ctype lectin. In this study we examined two novel C-type lectin
mRNA expression patterns in different tissues after cDNA fulllength cloning, and detected their transcription variation in three
major crustacean immune organs induced after LPS (Escherichia coli
0111:B4 origin) challenge.
2. Materials and methods
2.1. Animal immune challenge and sample collection
Healthy adult Chinese mitten crabs (n ¼ 140; 100 20 g wet
weight) were collected from the Tongchuan aquatic product market
in Shanghai, China. After acclimated for one week at 20e25 C in
filtered, aerated freshwater, crabs were placed in an ice bath for 1e
2 min until each was lightly anesthetized. Hemolymph was draw
from the hemocoel in arthrodial membrane of the last pair of
walking legs using a syringe (approximately 2.0 ml per crab) with
an equal volume of anticoagulant solution (glucose: 2.05 g, citrate:
0.8 g, NaCl: 0.42 g, double distilled water: add to 100 ml ) added,
and centrifuged at 800 g at 4 C to isolate hemocytes. The other
tissues (hepatopancreas, gills, testis, accessory gland, ovary, muscle,
stomach, intestine, heart, thoracic ganglia and brain) were harvested, snap frozen in liquid nitrogen, and stored at 80 C prior to
nucleic acid analysis. For cloning and expression analysis, tissues
from 10 crabs were pooled, and ground with a mortar and pestle
prior to extraction.
For LPS stimulation, 120 crabs were divided equally into two
groups: experimental group crabs were injected into the arthrodial
membrane of the last pair of walking legs with approximately
100 ml of LPS (Sigma-Aldrich, L2630) resuspended (500 mg/ml) in
PBS, while control group with 100 ml PBS (pH ¼ 7.4). Five crabs were
randomly selected at each time interval of 0 (as blank control), 2, 4,
8, 12, 24, 48 and 72 h post-injection. Hepatopancreas, gills and
hemocytes were harvested according to methods above, and were
stored at 80 C, after the addition of 1 ml Trizol reagent (Invitrogen, CA, USA) for subsequent RNA extraction. Except the 40 crabs
were sacrificed for tissue collection respectively, experimental
group had 11 individuals death, and then control group had
0 individuals death until 72 h post challenged.
2.2. Total RNA extraction and first-strand cDNA synthesis
Total RNA was extracted from E. sinensis tissues sampled from
Section 2.1 using TrizolÒ reagent (RNA Extraction Kit, Invitrogen,
CA, USA) according to the manufacturer’s protocol. The total RNA
concentration and quality were estimated using spectrophotometry at an absorbance at 260 nm and agarose-gel electrophoresis
respectively.
Total RNA (5 mg) isolated from hepatopancreas was reverse
transcribed using the SMARTerÔ RACE cDNA Amplification kit
(Clonetech, USA) for cDNA cloning. For RT-PCR and qRT-PCR
expression analysis, total RNA (4 mg) was reverse transcribed
using the PrimeScriptÔ Real-time PCR Kit (TaKaRa, Japan).
2.3. EST analysis and cloning of full-length Es-lectin cDNA
A cDNA library was previously constructed using the hepatopancreas of the Chinese mitten crab, from which 3355 successful
sequencing reactions were obtained using a T3 primer [18]. The
E. sinensis C-type lectin partial cDNA sequence was extended using
50 and 30 RACE (SMARTerÔ RACE cDNA Amplification kit, Clontech),
and a total of two gene-specific primers (Table 1) based on the
original EST sequence. The 30 RACE PCR reaction was carried out in
a total volume of 50 ml containing 2.5 ml (800 ng/ml) of the firststrand cDNA reaction as a template, 5 ml of 10 Advantage 2 PCR
buffer, 1 ml of 10 mM dNTPs, 5 ml (10 mM) gene-specific primer
(EsLecA-30 RACE, Table 1), 1 ml of Universal Primer A Mix (UPM;
Clonetech, USA), 34.5 ml of sterile deionized water, and 1 U 50
Advantage 2 polymerase mix (Clonetech, USA). For the 50 RACE,
UPM was used as forward primers in PCR reactions in conjunction
with the reverse gene-specific primers (EsLecA-50 RACE, EsLecG50 RACE, Table 1). PCR amplification conditions for both the 30 and 50
RACE were as follows: 5 cycles at 94 C for 30 s, 72 C for 3 min; 5
cycles at 94 C for 30 s, 70 C for 30 s, and 72 C for 3 min; 20 cycles
at 94 C for 30 s, 68 C for 30 s, and 72 C for 3 min. PCR amplicons
were size separated and visualized on an ethidium bromide stained
1.2% agarose gel. Amplicons of expected sizes were purified with
WizardÒ SV Gel and PCR Clean-Up System (Promega, USA), and
inserted into a pMD19T Vector (Takara, Japan). Positive clones
containing inserts of an expected size were sequenced using T7 and
SP6 primers (Table 1).
2.4. Sequence analysis and phylogenetic analysis
Eriocheir sinensis C-type lectin full-length cDNAs and deduced
amino acid sequences were compared against sequences from
other representative vertebrates and invertebrates reported in the
GenBank of NCBI, using the BLAST program (http://blast.ncbi.nlm.
nih.gov). These analyses were completed by multiple sequence
alignment using ClustalX and ClustalW2 (http://www.ebi.ac.uk/
Tools/msa/clustalw2/). An unrooted neighbor-joining phylogenetic tree was constructed with MEGA5.0. The homologous
conserved domains and signal peptides were identified by SMART
Table 1
Primer sequences.
Primers name
Sequences (50 e30 )
RACE
EsLecA-30 RACE
EsLecA-50 RACE
EsLecG-50 RACE
LongUP
ShortUP
TTTCTGAACGGTGACCCTGTGCC
CACCGTTCAGAAACTCCCAGGCAC
CTGAGGGTGTAGTTGAGGAGTGGGATG
CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
CTAATACGACTCACTATAGGGC
qRT-PCR
EsLecA-F
EsLecA-R
EsLecG-F
EsLecG-R
b-actin-F
b-actin-R
ATGGGTGGAAGCGGTAGCC
TCGGGTGCCAGAAGGGAAT
TCTCGTTGAAGGACAGTGGAAGTG
CTGACAGATGGCGTAGTG
CTCCTGCTTGCTGATCCACATC
GCATCCACGAGACCACTTACA
Sequencing
T7
SP6
TAATACGACTCACTATAGG
ATTTAGGTGACACTATAGAA
X.-K. Jin et al. / Fish & Shellfish Immunology 33 (2012) 1149e1158
(Simple Modular Architecture Reseach Tool, http://smart.emblheidelberg.de) program.
2.5. Tissue transcription analysis by RT-PCR
RT-PCR was performed in a final volume of 25 ml, and contained
2.5 ml of 10 PCR buffer, 2 ml of 10 mM dNTP mix, 1 ml of 10 mM
primer pairs, 18.7 ml of sterile deionized water, 0.2 ml EX TaqÔ HS
DNA polymerase (TaKaRa, Japan) and 2 ml of first-strand cDNA
synthesised in Section 2.2 as template. PCR conditions were as
follows: 30 cycles at 94 C for 30 s, 60 C for 30 s, and 72 C for
1 min. Internal control PCR reactions for b-actin were performed in
a separate tube, as described above with the exception of an
alternative gene-specific primer pair (Table 1), which was designed
based upon a cloned E. sinensis b-actin cDNA fragment to produce
1151
a 276 bp amplicon. All RT-PCR reactions were completed in triplicate using independently extracted RNA. RT-PCR products were
size separated on an ethidium bromide stained 1.5 % agarose gel,
visualized under ultraviolet light, and images were captured with
a Gel Doc 2000 System (Tannon, China).
2.6. Transcription analysis post-LPS challenged by qRT-PCR
Real-time qRT-PCR was conducted using the CFX96TM RealTime System (Bio-Rad). Gene-specific primers (Table 1) were
designed based upon the cloned C-type lectin cDNA EsLecA and
EsLecG to produce 233 bp and 184 bp amplicon respectively.
Samples were run in triplicate and normalized to the control gene
b-actin, EsLecA and EsLecG expression levels were calculated by the
2DDCt comparative CT method [20]. Real-time qPCR amplification
Fig. 1. Nucleotide and deduced amino acid sequences of EsLecA. The nucleotide sequence is numbered from the first base at the 50 end. The first methionine (M) is numbered as the
first deduced amino acid. Bold underling indicates the location of the signal peptides (1e19aa). The carbohydrate recognition domain, CRD is shaded (24e156aa). The activity motif
of “QPD” and “FAD” were bold.
1152
X.-K. Jin et al. / Fish & Shellfish Immunology 33 (2012) 1149e1158
reactions were carried out in a final volume of 25 ml, which contained 12.5 ml 2 SYBR Premix Ex Taq (TaKaRa, Japan), 0.5 ml
(500 ng/ml) diluted cDNA template from hepatopancreas, gill and
hemocytes at each time interval post-LPS injection, 11.0 ml PCRGrade water (RNase free, TaKaRa, Japan), and 1 ml of primer pairs
(10 mM). PCR conditions were as follows, 95 C for 30 s; followed by
40 cycles of 95 C, and a 0.5 C/5 s incremental increase from 60 C
to 95 C that lasted 30 s per cycle. Resultant data was analyzed
using the CFX ManagerÔ software (Version 1.0).
2.7. Statistical analysis
Statistical analysis was performed using SPSS software (Ver11.0).
The data are represented as the mean standard error (S.E.).
Statistical significance was determined by one-way ANOVA [21]
and post-hoc Duncan multiple range tests. Significance was set at
P < 0.05.
3. Results
3.1. Characterization of EsLecA and EsLecG
The obtained E. sinensis C-type lectin full-length cDNA were
desighed as EsLecA (GenBank accession numbers JF799933) and
EsLecG (GenBank accession numbers JF799934), respectively. The
full-length sequence of EsLecA was 1192 bp, containing a 480-bp
ORF that encoded a 159-amino-acid protein, a 16-bp 50 UTR, and
a 480-bp 30 UTR (Fig. 1). The full-length sequence of EsLecG was
791 bp, containing a 465-bp ORF that encoded a 154-amino-acid
protein, a 94-bp 50 UTR, and a 232-bp 30 UTR (Fig. 2). Under the
analysis of deduced amino acid sequence by the SMART program,
EsLecA was predicted have a putative signal peptide contained 19
amino acid residues, and a single carbohydrate recognition domain
(CRD) contained 133 amino acid residues (Fig. 1); EsLecG was
predicted have a putative signal peptide contained 19 amino acid
residues, and a single carbohydrate recognition domain (CRD)
contained 129 amino acid residues (Fig. 2).
ClustalW2 alignment results with homologous sequences from
the results of Protein Blast shows that EsLecA had a “QPD” motif,
while EsLecG had an “EPE” motif instead of typical “EPN” (Fig. 3).
3.2. Phylogenetic analysis of EsLecA and EsLecG
NJ-phylogenetic trees were produced based on phylogenetic
analysis of EsLecA and EsLecG with representative invertebrate and
vertebrate sequences from Protein Blast results. The lectin tree
contained two distinct clades distinguishing intertebrate (crustaceans) from vertebrate. EsLecA and EsLecG together with other four
E. sinensis Lectin (in bold branch lines) shared in the same clade of
invertebrate, but in distinct subclades (Fig. 4).
Fig. 2. Nucleotide and deduced amino acid sequences of EsLecG. The nucleotide sequence is numbered from the first base at the 50 end. The first methionine (M) is numbered as the
first deduced amino acid. Bold underling indicates the location of the signal peptides (1e19aa). The carbohydrate recognition domain, CRD is shaded (24e152aa). The activity motif
of “EPE” was bold.
X.-K. Jin et al. / Fish & Shellfish Immunology 33 (2012) 1149e1158
1153
Fig. 3. Multiple alignment of the EsLecA and EsLecG amino acid sequences with C-type lectins showed high similarity upon BLASTp homology search results. Identical (*) and
similar (. or :) residues are indicated. Gaps (-) were introduced to maximize the alignment. Es, Eriocheir sinensis; Fc, Fenneropenaeus chinensis; Mj, Marsupenaeus japonicus.
3.3. Tissue distribution of EsLecA and EsLecG
As determined by RT-PCR, EsLecA and EsLecG expression were
widely observed in all the detected tissues of E. sinensis, and
consistently in hepatopancreas, gills, accessory gland, ovary, muscle
and thoracic ganglia. The expression of EsLecA was higher in testis,
stomach, intestine and heart, but lower among hemocytes and
brain comparing with EsLecG (Fig. 5).
3.4. Temporal expression of EsLecA and EsLecG post-LPS immune
challenged
Based on the results of real-time qRT-PCR measurements,
EsLecA and EsLecG expression in E. sinensis were induced in
hepatopancreas, gill and hemocytes, post-LPS challenged. EsLecA
expression in hepatopancreas was significantly less than the blank
control after 4, 8, 12 and 24 h post-LPS stimulation (P < 0.05),
1154
X.-K. Jin et al. / Fish & Shellfish Immunology 33 (2012) 1149e1158
Fig. 4. Unrooted neighbor-joining phylogenetic tree of EsLecA (labeled with black triangle) and EsLecG (labeled with black square) amino acid sequences with C-type lectins
showed high similarity upon BLASTp homology search results. The branches of Eriocheir sinensis lectins were in bold.
peaking up to 1.9 times above the blank control after 72 h (Fig. 6).
EsLecG expression in hepatopancreas was up-regulated at 2 and
8 h, but dropped down at 2, 12 and 24 h post challenged (Fig. 7).
EsLecA expression in gills was significantly up-regulated at 2, 8, 12
and 24 h post-injection (Fig. 8). EsLecG expression levels in gill
increased twice before and after 24 h post-injection (Fig. 11). Both
EsLecA and EsLecG expression in hemocytes had two up-regulated
phases: 0e12 h and 24e72 h post-LPS challenged, consistently
X.-K. Jin et al. / Fish & Shellfish Immunology 33 (2012) 1149e1158
1155
Fig. 5. Tissue-dependent EsLecA, EsLecG and internal control b-actin mRNA expression in hepatopancreas, gills, hemocytes, testis, accessory gland, ovary, muscle, stomach,
intestine, heart, thoracic ganglia and brain.
C-type lectin is a large group of gene family with multifunctions participating in cell adhesion, endocytosis, pathogen
neutralization, glycoperotein clearance and phagocytosis [7,22,23].
In invertebrate, lectins have been reported to contribute in innate
immune response, such as prophenoloxidase activation [24,25],
enhancement of encapsulation [6,26,27], nodulation of hemocytes
[28], opsonization [29], antibacterial activity [30], antifungal
activity [31] and maybe contribute to injury healing [32]. Compared
to vertebrate lectins, the molecular features and fuctions of lectins
in crustaceans are just at the beginning of becoming understood
[33]. In the NCBI Genebank, 59 amino acids sequences of lectin
were recorded from Decapoda, including Penaeidae: Marsupenaeus
(16), Fenneropenaeus (10), Litopenaeus (8), Penaeus (7); Metapenaeus (1); Cambaridae (5); Portunidae: Portunus (3), Scylla (2);
Astacidae (1); Alvinocarididae (1); Varunidae: Eriocheir sinensis (5).
Three C-type lectins have been reported in E. sinensis for their
antibacterial response [19,34]. This suggests that there is a high
potential for generating many C-type lectins, perhaps with
different ligand specificities.
Base on our previously constructed E. sinensis hepatopanreatic
cDNA EST library [18], we cloned two full-length C-type lectin
cDNAs named EsLecA and EsLecG. Alignment of their deduced
amino acid sequences demonstrated that the carbohydrate recognition domain (CRD) is a relatively conserved, nevertheless variations in some motifs still existed. EsLecA has a key “QPD” (Gln-Pro-
Asp) motif, while EsLecG has a key “EPE” (Glu-Pro-Glu) motif
instead of typical “EPN” which had been predicted to be ligandbinding specific for galactose or mannose, respectively [11]. These
domains contain a characteristic double-loop stabilized by highly
conserved disulphide bridges, Ca2þ-binding sites and carbohydrate-binding sites [11]. Along with other four E. sinensis Lectins,
EsLecA and EsLecG shared the same clade of invertebrate branch,
but distinguishing subclades in the NJ-phylogenetic trees. This
result suggests that these lectins must play diverse roles in the crab
immunity. As determined by RT-PCR, EsLecA and EsLecG expression
were broad observed in all the detected tissues of E. sinensis, and
consistently with the EsCTLDcp-2, Es-Lectin [19,34], but quite
differently from most shrimps’ hepatopancreas specific expression
patterns [35e38]. In consideration of lacking dual- or multi-CRD
such like that found in shrimps, crabs’ C-type lectins must functioned in a different way.
Lipopolysaccharides (LPS) from Gram-negative bacteria have
been evaluated for use in aquaculture as immunostimulants. It is
recognized that LPS could enhance the host defense system against
pathogens by increasing phagocytosis and the chemiluminescent
response and by superoxide anion production [39]. Hepatopancreas, gills and hemocytes of crustacean are regarded as the most
important tissues involved in crustacean immunity [40e42]. In this
study, we observed E. sinensis acute infection symptoms (lose
mobility) in about 24 h post-LPS challenged, and also found the
counts of drawn out hemocytes severely decreased, finally resulted
in 18.3% motality compared with control 0% motality after 72 h.
During this acute infection period, we detected that in the
hepatopancreas, EsLecA was down regulated differently from the
EsLecG up- and-down-regulated. Diverse crustacean C-type lectins
with structural and functional variation were mainly expressed in
Fig. 6. Temporal EsLecA mRNA expression of hepatopancreas in response to LPS
challenge (black bars). Hepatopancreas collected from crabs injected with LPS (black
bars) or vehicle control (gray bars), were compared with respect to EsLecA mRNA
expression (relative to b-actin) using Students t-tests. Bars represent mean S.E.
(n ¼ 6). Statistical significance is indicated with an asterisk (P < 0.05).
Fig. 7. Temporal EsLecG mRNA expression of hepatopancreas in response to LPS
challenge (black bars). Hepatopancreas collected from crabs injected with LPS (black
bars) or vehicle control (gray bars), were compared with respect to EsLecG mRNA
expression (relative to b-actin) using Students t-tests. Bars represent mean S.E.
(n ¼ 6). Statistical significance is indicated with an asterisk (P < 0.05).
peaked in 12 h (Figs. 10 and 11). Control reactions, in which were
induced with PBS, yielded no significant variation in expression
levels (gray bars in Figs. 6e11).
4. Discussion
1156
X.-K. Jin et al. / Fish & Shellfish Immunology 33 (2012) 1149e1158
Fig. 8. Temporal EsLecA mRNA expression of gills in response to LPS challenge (black
bars). Gills collected from crabs injected with LPS (black bars) or vehicle control (gray
bars), were compared with respect to EsLecA mRNA expression (relative to b-actin)
using Students t-tests. Bars represent mean S.E. (n ¼ 6). Statistical significance is
indicated with an asterisk (P < 0.05).
hepatopancreas, and constitute a pathogen-recognition network
against invading bacteria and virus [43]. In the shrimps, such as
Chinese white shrimp, a lectin distinct from other shrimps’, FcLec4
initially down-regulated post Vibrio anguillarum challenged which
induced the new FcLec4 protein production and then secreted into
the plasma to resist the invading bacteria as opsonins [44]. In
Litopenaeus vannamei, LvLT expression was early decreased which
on account of the translation of constitutive transcripts at the initial
stage [45]. In P. monodon, PmLT transcript level decreased in the
first 1e2 h and slightly increasing 4e6 h post WSSV infection which
might attributed to translation of the gene product to recognize
WSSV particles [46]. In the insect Manduca sexta, the homologous
organ of hepatopancreas: fat body could also produce lectin-like
molecules in response to pathogen infection. The lectin-like
protein is produced as a pathogen-recognition protein and
released into the hemolymph of insects post pathogen infection
[6,24e27]. In the Chinese mitten crabs, EsCTLDcp-1 and EsCTLDcp2 were both down-regulated expressed post Aeromonas hydrophila
challenged, but both up-regulated expressed post-LPS (from E. coli
055:B5) challenged [19]. Interestingly, in our study, EsLecA was
initially down-regulated post PBS injection, which possibly due to
an emergency response stimulated by injection. The other PRRs,
Fig. 9. Temporal EsLecG mRNA expression of gills in response to LPS challenge (black
bars). Gills collected from crabs injected with LPS (black bars) or vehicle control (gray
bars), were compared with respect to EsLecG mRNA expression (relative to b-actin)
using Students t-tests. Bars represent mean S.E. (n ¼ 6). Statistical significance is
indicated with an asterisk (P < 0.05).
Fig. 10. Temporal EsLecA mRNA expression of hemocytes in response to LPS challenge
(black bars). Hemocytes collected from crabs injected with LPS (black bars) or vehicle
control (gray bars), were compared with respect to EsLecA mRNA expression (relative
to b-actin) using Students t-tests. Bars represent mean S.E. (n ¼ 6). Statistical
significance is indicated with an asterisk (P < 0.05).
LGBP gene in shrimps L. vannamei and Fenneropenaeus chinensis,
also had down-regulated expression pattern post saline challenge
similar to that recorded in this study [47,48]. In the other study,
a novel pathogen-binding gC1qR homolog, FcgC1qR transcript
levels firstly down-regulated both after WSSV and PBS injection in
2 h, and then dramatically up-regulation after 6 h [49]. In the
procedure of crab acute immune response, gene transcription could
be widely regulated by various external and internal factors. The
significant up-regulation expression of EsLecG in hepatopancreas
after 2 h and 8 h in LPS challenge, possibly caused by PAMPs
stimulation hence tremendous transcription of EsLecG synthesized
then translated to mature functional proteins to distinguish them.
However, the down-regulation expression of EsLecG in hepatopancreas after 4 h in LPS challenge, might implied that this transient period was necessary for the recovery of crab immune system.
The expression patterns analysis of EsLecA and EsLecG in hepatopancreas post-LPS challenge illustrated that EsLecG has a frequent
transcripts and functioned earlier than EsLecA. These possibly
account for EsLecG took part in the initial recognition of PAMPs,
while EsLecA finally facilitated the clearance of intruding PAMPs,
hence together participated in crab innate immunity.
Fig. 11. Temporal EsLecG mRNA expression of hemocytes in response to LPS challenge
(black bars). Hemocytes collected from crabs injected with LPS (black bars) or vehicle
control (gray bars), were compared with respect to EsLecG mRNA expression (relative
to b-actin) using Students t-tests. Bars represent mean S.E. (n ¼ 6). Statistical
significance is indicated with an asterisk (P < 0.05).
X.-K. Jin et al. / Fish & Shellfish Immunology 33 (2012) 1149e1158
Crustaceans’ gills are capable of forming a physical permeability
barrier, with epithelial cell layer and the thick cutin membrane, and
the gill leaves are bathed in hemocoel to efficiently complete the
materials transportation [50]. Structural damage to this barrier
would impair or disable the active transport and osmoregulatory
functions of the gills. In crayfish Cherax quadricarinatus, electron
microscopy observation showed gills aberrations of cell structure
and function post WSSV infection. The mitochondria were damaged
with disintegrating membranes and cristae, which reduced the
capacity of mitochondrial ATP synthesis, and finally impacted the
basic energy metabolism and other physiological activities
requiring energy in the gills [51]. A wide range of microbial cell wall
components like lipopolysaccharides (LPS), b-1, 3-glucans or
peptidoglycans could be recognized by the immune system to
distinguish infectious nonself from noninfectious self [4]. In this
study, both the EsLecA and EsLecG were significantly up-regulated
post-LPS challenged in gills, which might because gills are the first
barrier against external environment with the most sensitive
defense mechanism. In the consideration of decrease of circulating
hemocyte counts, that could be a consequence of hemocytes
immobilization in the gills, which resulted in the lectin highly
expression in gills, as FcLec4 in shrimps [43].
The crustacean has an incompletely closed vascular system,
where oxygen transportation processing via oxygen transport
pigments of the hemocyanin in plasma. The crustacean circulatory
system also provides different type of hemocytes which involved in
immunity towards intruding pathogens and wound healing [52].
Hence, crustacean hemocytes could not only mediate rapid
immune reactions such as melanization and coagulation in
response to microbial polysaccharides, but also synthesize and
exocytose a battery of bioactive molecules [53]. In Chinese white
shrimps, the mRNA encoding Fclectin was mainly found in the
hemocytes, and the expression profile of which was increased
significantly post-LPS stimulated in hemocytes at different intervals [54]. In the Chinese mitten crab, another C-type lectin, EsLectin was found mainly expressed in hemocytes, and initially
stimulated to increase over 2-fold after A. hydrophila infection
between 1.5 h and 48 h post-challenge [34]. In this study, both
EsLecA and EsLecG displayed two continuous up-regulated phases:
0e12 h and 24e72 h post-LPS challenged in hemocytes, consistently peaked in 12 h. And that was in agreement with the theory
that hemocytes from the tissue initially recruited after challenge
with microbial polysaccharides, and decrease the rate of apoptosis,
indicating that more cells are directed along differentiation pathways instead of undergoing apoptosis [52,55]. Crustacean hemocytes are thought to be functionally analogous to vertebrate
leukocytes and involved primarily in the recognition and removal
of foreign materials, and the first distinct phase of the immune
response in crustaceans is approximately in the first 12 h after
challenge [56].
The collective results indicate that EsLecA and EsLecG are
constitutive and inducible acute-phase genes involved in defense
response against LPS challenge. Hence, the current study provided
new insights in the characteristics and function of C-type lectin in
the innate immune response of invertebrates.
5. Conclusions
In the present study, we report the cloning, sequence analysis,
tissue-specific distribution, and immune responsiveness of two
novel C-type lectins in E. sinensis. The conservation of key motifs
and sequence types between taxa support their common functionality, respectively. Further research, with respect to the mechanisms within the innate immune system of EsLecA and EsLecG,
may elucidate the exact immunological actions, providing a vehicle
1157
for the prevention of viral and bacterial infections among aquaculture stocks.
Acknowledgments
This research was supported by grants from the National Natural
Science Foundation of China (nos. 31172393) and National Science
and Technology Support Program of China (2012BAD26B04-04).
References
[1] Du Pasquier L. The immune system of invertebrates and vertebrates.
Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular
Biology 2001;129:1e15.
[2] Sarathi M, Ahmed VPI, Venkatesan C, Balasubramanian G, Prabavathy J,
Hameed ASS. Comparative study on immune response of Fenneropenaeus
indicus to Vibrio alginolyticus and white spot syndrome virus. Aquaculture
2007;271:8e20.
[3] Janeway Jr CA. Approaching the asymptote? Evolution and revolution in
immunology. Cold Spring Harbor Symposia on Quantitative Biology 1989;54:
1e13.
[4] Janeway Jr CA, Medzhitov R. Innate immune recognition. Annual Review of
Immunology 2002;20:197e216.
[5] Christophides GK, Zdobnov E, Barillas-Mury C, et al. Immunity-related genes
and genes families in Anopheles gambiae. Science 2002;298:159e65.
[6] Yu XQ, Kanost MR. Immulectin-2, a pattern recognition receptor that
stimulates haemocyte encapsulation and melanization in the tobacco
hornworm, Manduca sexta. Developmental & Comparative Immunology
2004;28:891e900.
[7] Lis H, Sharon N. Lectins: carbohydrate-specific proteins that mediate cellular
recognition. Chemical Reviews 1998;98:1283e97.
[8] Drickamer K. Two distinct classes of carbohydrate-recognition domains in
animal lectins. Journal of Biological Chemistry 1988;263:9557e60.
[9] Weis WI, Kahn R, Fourme R, et al. Structure of the calcium-binding protein
determined by MAD phasing. Science 1991;254:1608e15.
[10] Drickamer K, Taylor ME. Biology of animal lectins. Annual Review of Cell and
Developmental Biology 1993;9:237e64.
[11] Zelensky AN, Gready JE. The C-type lectin-like domain superfamily. FEBS
Journal 2005;272:6179e217.
[12] Chen D-W, Zhang M, Shrestha S. Compositional characteristics and nutritional
quality of Chinese mitten crab (Eriocheir sinensis). Food Chemistry 2007;103:
1343e9.
[13] Gai Y, Zhao J, Song L, Li C, Zheng P, Qiu L, et al. A prophenoloxidase from the
Chinese mitten crab Eriocheir sinensis: gene cloning, expression and activity
analysis. Fish & Shellfish Immunology 2008;24:156e67.
[14] Wang W, Gu Z. Rickettsia-like organism associated with tremor disease and
mortality of the Chinese mitten crab Eriocheir sinensis. Disease of Aquatic
Organisms 2002;48:149e53.
[15] Wang W, Zhu N, Gu Z, Du K, Xu Z. Study on the transmission of tremor disease
(TD) in the Chinese mitten crab, Eriocheir sinensis (Crustacea: decapoda).
Journal of Invertebrate Pathology 2002;81:202e4.
[16] Zhao D, Song S, Wang Q, Zhang X, Hu S, Chen L. Discovery of immune-related
genes in Chinese mitten crab (Eriocheir sinensis) by expressed sequence tag
analysis of haemocytes. Aquaculture 2009;287:297e303.
[17] Gai Y, Wang L, Zhao J, Qiu L, Song L, Li L, et al. The construction of a cDNA
library enriched for immune genes and the analysis of 7535 ESTs from
Chinese mitten crab Eriocheir sinensis. Fish & Shellfish Immunology 2009;27:
684e94.
[18] Jiang H, Cai Y-M, Chen L-Q, Zhang X-W, Hu S-N, Wang Q. Functional annotation and analysis of expressed sequence tags from the hepatopancreas of
mitten crab (Eriocheir sinensis ). Marine Biotechnology 2009;11:317e26.
[19] Guo HZ, Zou PF, Fu JP, Guo Z, Zhu BK, Nie P, et al. Characterization of two Ctype lectin-like domain (CTLD)-containing proteins from the cDNA library of
Chinese mitten crab Eriocheir sinensis. Fish & Shellfish Immunology 2010;30:
515e24.
[20] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2-[Delta][Delta]CT method. Methods 2001;25:
402e8.
[21] Snedecor G, Cochran W. Statistical methods. Ames, Iowa: The Iowas State
University Press; 1971.
[22] Dodd RB, Drickamer K. Lectin-like proteins in model organisms:
implications for evolution of carbohydrate-binding activity. Glycobiology
2001;11:71Re9R.
[23] Kerrigan AM, Brown GD. C-type lectins and phagocytosis. Immunobiology
2009;214:562e75.
[24] Yu XQ, Kanost MR. Immulecti-2, a lipopolysaccharide-specific lectin from an
insect, Manduca sexta, is induced in response to gram-negative bacteria.
Journal of Biological Chemistry 2000;275:37,373e37,381.
[25] Yu XQ, Gan H, Kanost MR. Immulectin, an induction C-type lectin from an
insect, Manduca sexta, stimulates activation of plasma prophenoloxidase.
Insect Biochemistry and Molecular Biology 1999;29:585e97.
1158
X.-K. Jin et al. / Fish & Shellfish Immunology 33 (2012) 1149e1158
[26] Yu XQ, Tracy ME, Ling E, et al. A novel C-type immulectin-3 from Manduca
sexta is translocated from hemolymph into the cytoplasm of hemocytes.
Insect Biochemistry and Molecular Biology 2005;35:285e95.
[27] Ling E, Yu XQ. Cellular encapsulation and melanization are enhanced by
immulectins, pattern recognition receptors from the tobacco hornworm
Manduca sexta. Developmental & Comparative Immunology 2006;30:289e99.
[28] Koizumi N, Imamura M, KadotaniT, et al. The lipopolysaccharide-binding
protein participating in haemocyte nodule formation in the silkworm Bombyx
mori is a novel member of the C-type lectin superfamily with two different
tandem carbohydrate-recognition domains. FEBS Letters 1999;443:139e43.
[29] Jomori T, Natori S. Functional of the lipopolysaccharide-binding protein of
Periplaneta americana as an opsonin. FEBS Letters 1992:283e6.
[30] Schroder HC, Ushijima H, Krasko A, et al. Emergence and disappearance of an
immune molecule, an antimicrobial lectin, in basal metazoan. Atachylectinrelated protein in the sponge Suberites domuncula. Journal of Biological
Chemistry 2003;278:32,810e32,817.
[31] Willment JA, Brown GD. C-type lectin receptors in antifungal immunity.
Trends in Microbiology 2008;16:27e32.
[32] Zhu L, Song LS, Xu W, et al. Molecular cloning and immune responsive
expression of a novel C-type lectin gene from bay scallop Argopecten irradians.
Fish & Shellfish Immunology 2008;25:231e8.
[33] Cerenius L, Jiravanichpaisal P, Liu H, Irene Söderhäll. Crustacean Immunity.
Invertebrate Immunity, chapter 13.
[34] Zhang H, Chen L, Qin J, Zhao D, Wu P, Qin C, et al. Molecular cloning, characterization and expression of a C-type lectin cDNA in Chinese mitten crab,
Eriocheir sinensis. Fish & Shellfish Immunology 2011;31:358e63.
[35] Sun YD, Fu LD, Jia YP, Du XJ, Wang Q, Wang YH, et al. A hepatopancreasspecific C-type lectin from the Chinese shrimp Fenneropenaeus chinensis
exhibits antimicrobial activity. Molecular Immunology 2008;45:348e61.
[36] Zhang XW, Xu WT, Wang XW, Mu Y, Zhao XF, Yu XQ, et al. A novel C-type
lectin with two CRD domains from Chinese shrimp Fenneropenaeus chinensis
functions as a pattern recognition protein. Molecular Immunology 2009;46:
1626e37.
[37] Wang XW, Xu WT, Zhang XW, Zhao XF, Yu XQ, Wang JX. A C-type lectin is
involved in the innate immune response of Chinese white shrimp. Fish &
Shellfish Immunology 2009;27:556e62.
[38] Xu WT, Wang XW, Zhang XW, Zhao XF, Yu XQ, Wang JX. A new C-type lectin
(FcLec5) from the Chinese white shrimp Fenneropenaeus chinensis. Amino
Acids 2010;39:1227e39.
[39] Sakai M. Current research status of fish immunostimulants. Aquaculture 1998;
172:63e92.
[40] Jiravanichpaisal P, Lee BL, Söderhäll K. Cell-mediated immunity in arthropods:
hematopoiesis, coagulation and opsonization. Immunobiology 2006;211:
213e36.
[41] Smith VJ, Ratcliffe NA. Cellular defence reactions of the shore crab, Carcinus
maenas: in vivo hemocytic and histopathological responses to injected
bacteria. Journal of Invertebrate Pathology 1980;35:65e74.
[42] Gross PS, Bartlett TC, Browdy L, et al. Immune gene discovery by expressed
sequence tag analysis of hemocytes and hepatopancreas in the Pacific White
shrimp, Litopenaeus vannamei and the Atlantic White shrimp, L. setiferus.
Developmental & Comparative Immunology 2001;25:565e77.
[43] Li F, Xiang J. Recent advances in researches on the innate immunity of shrimp
in China. Developmental & Comparative Immunology, http://dx.doi.org/10.
1016/j.dci.2012.03.016; 2012.
[44] Wang XW, Zhang XW, Xu WT, Zhao XF, Wang JX. A novel C-type lectin
(FcLec4) facilitates the clearance of Vibrio anguillarum in vivo in Chinese white
shrimp. Developmental & Comparative Immunology 2009;33:1039e47.
[45] Ma THT, Tiu SHK, He JG, Chan SM. Molecular cloning of a C-type lectin (LvLT)
from the shrimp Litopenaeus vannamei: early gene down-regulation after
WSSV infection. Fish & Shellfish Immunology 2007;23:430e7.
[46] Ma THT, Benzie JAH, He JG, Chan SM. PmLT, a C-type lectin specific to hepatopancreas is involved in the innate defense of the shrimp Penaeus monodon.
Journal of Invertebrate Pathology 2008;99:332e41.
[47] Cheng W, Liu CH, Tsai CH, Chen JC. Molecular cloning and characterisation of
a pattern recognition molecule, lipopolysaccharide- and b-1,3-glucan binding
protein (LGBP) from the white shrimp Litopenaeus vannamei. Fish & Shellfish
Immunology 2005;18:297e310.
[48] Du XJ, Zhao XF, Wang JX. Molecular cloning and characterization of a lipopolysaccharide and b-1,3-glucan binding protein from fleshy prawn (Fenneropenaeus chinensis). Molecular Immunology 2007;44:1085e94.
[49] Li XC, Du ZQ, Lan JF, Zhang XW, Mu Y, Zhao XF, et al. A novel pathogenbinding gC1qR homolog, Fc gC1qR, in the Chinese white shrimp, Fenneropenaeus chinensis. Developmental & Comparative Immunology 2012;36:
400e7.
[50] Du NS. Crustaceans zoology (in Chinese). Beijing: Science Press; 1993. p.
703e4.
[51] Wang DL, Zuo D, Wang LM, Sun T, Wang Q, Zhao YL. Effects of white spot
syndrome virus infection on immuno-enzyme activities and ultrastructure in
gills of Cherax quadricarinatus. Fish & Shellfish Immunology 2012;32:645e50.
[52] Lin X, Söderhäll I. Crustacean hematopoiesis and the astakine cytokines. Blood
2011;117:6417e24.
[53] Smith VJ, Chisholm JRS. Non-cellular immunity in crustaceans. Fish & Shellfish
Immunology 1992;2:1e31.
[54] Liu YC, Li FH, Dong B, Wang B, Luan W, Zhang XJ, et al. Molecular cloning,
characterization and expression analysis of a putative C-type lectin (Fclectin)
gene in Chinese shrimp Fenneropenaeus chinensis. Molecular Immunology
2007;44:598e607.
[55] Jin XK, Li WW, He L, Lu W, Chen LL, Wang Y, et al. Molecular cloning, characterization and expression analysis of two apoptosis genes, caspase and
nm23, involved in the antibacterial response in Chinese mitten crab, Eriocheir
sinensis. Fish & Shellfish Immunology 2011;30:263e72.
[56] Söderhäll K, Cerenius L. Role of the prophenoloxidase-activating
system in invertebrate immunity. Current Opinion in Immunology
1998;10:23e8.