Western University
Scholarship@Western
Electronic Thesis and Dissertation Repository
July 2013
ATRX regulates H3.3 incorporation and gene
expression at G-rich ancestral pseudoautosomal
genes
Michael A. Levy
The University of Western Ontario
Supervisor
Dr. Nathalie Berube
The University of Western Ontario
Graduate Program in Developmental Biology
A thesis submitted in partial fulfillment of the requirements for the degree in Doctor of Philosophy
© Michael A. Levy 2013
Follow this and additional works at: http://ir.lib.uwo.ca/etd
Part of the Molecular Genetics Commons
Recommended Citation
Levy, Michael A., "ATRX regulates H3.3 incorporation and gene expression at G-rich ancestral pseudoautosomal genes" (2013).
Electronic Thesis and Dissertation Repository. Paper 1347.
This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis
and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected].
ATRX REGULATES H3.3 INCORPORATION AND GENE EXPRESSION AT
G-RICH ANCESTRAL PSEUDOAUTOSOMAL GENES
(Thesis format: Integrated Article)
by
Michael Aaron Levy
Graduate Program in Biochemistry
A thesis submitted in partial fulfillment
of the requirements for the degree of
Doctor of Philosophy
The School of Graduate and Postdoctoral Studies
The University of Western Ontario
London, Ontario, Canada
© Michael Aaron Levy 2013
Abstract
Mutations in the human ATRX gene cause the ‘alpha thalassemia mental retardation X
linked’ syndrome or can enable cancer progression. ATRX encodes a Swi2/Snf2 chromatin
remodeling protein involved in deposition of the histone variant H3.3 at telomeres and
pericentromeric heterochromatin. Loss of ATRX leads to genomic instability, mitotic
defects, and increased apoptosis in the developing mouse brain. The aim of this study was to
determine the role of ATRX in the regulation of gene expression. I identified the ancestral
pseudoautosomal region (aPAR) genes as some of the most downregulated genes throughout
mouse forebrain development in the absence of ATRX. The pseudoautosomal regions
(PARs) are areas of homology between the ends of the otherwise dissimilar X and Y
chromosomes, and are exceptional in that they are rich in repetitive sequences and GC
content. During the evolutionary divergence between mice and humans, mouse PAR
homologs have translocated to various autosomes and are now called ancestral PAR genes.
Remarkably, mouse aPAR genes regulated by ATRX are located near telomeres. To
investigate the mechanism by which ATRX promotes aPAR gene expression, we focused on
the mouse aPAR gene ‘dehydrogenase/reductase (short-chain) X chromosome’ (Dhrsx).
Chromatin immunoprecipitation showed that ATRX and histone H3.3 occupy the Dhrsx gene
body in a guanine-rich DNA segment predicted to form secondary DNA structures called Gquadruplexes. In the absence of ATRX, I observed a significant decrease in H3.3 levels at
Dhrsx and at the other downregulated aPAR genes. Several other epigenetic marks are not
altered in and around the Dhrsx gene in the ATRX-null forebrain, and thus cannot provide an
explanation for transcriptional dysregulation. However, increased RNA polymerase II
occupancy at the ATRX/H3.3/G-rich region of Dhrsx indicates stalling of the polymerase in
the absence of ATRX, and suggests that ATRX normally promotes transcriptional
elongation. I conclude that ATRX facilitates the passage of the transcription machinery at Gquadruplex forming regions of a gene in a process that involves incorporation of the histone
variant H3.3. The identification of this mechanism of gene regulation by ATRX may lead to
a better understanding of the consequences of ATRX mutations in human patients.
ii
Keywords
ATRX, H3.3, Dhrsx, pseudoautosomal region, transcription elongation, G-quadruplex,
telomere, brain development.
iii
Co-Authorship Statement
I participated in the design and execution of all experiments, performed data analysis, and
prepared all written material, with the following exceptions:
In chapter two, RNA for P0.5 microarray analysis was isolated by Deanna Tremblay, and for
P17 microarray analysis by Corinna Zogel. Phylogenetic trees in Figure 2-3 and 2-5 were
generated by Andrew Fernandes. In section 2.3.6, shATRX HeLa cell lines were created by
Kieran Ritchie, and RNA purification and cDNA synthesis were performed by Kristin
Kernohan. Some mouse husbandry was conducted by Claudia Seah.
In chapter three, in section 3.3.2, E14 mouse forebrains for RNA-seq analysis were dissected
by Ashley Watson. For section 3.3.6, Yan Jiang performed bisulfite treatment on gDNA and
did two out of the three H3K27Me3 ChIP reactions. Most of the mouse husbandry and some
mouse dissections were done by Yan Jiang.
Nathalie Bérubé assisted with overall experimental design and direction, and in the
preparation of manuscripts.
iv
Acknowledgments
This tale grew in the telling, and there were many people who have helped me along the way.
First and foremost, I would like to thank my supervisor, Dr. Nathalie Bérubé, for her years of
guidance and support. I would also like to thank my advisors, Dr. Gabe DiMattia and Dr.
Susan Meakin, for their advice throughout my project, and the other professors at the
Victoria Research Laboratories whose guidance I have sought over the years.
I have been fortunate to work alongside some wonderful colleagues and make great friends in
the Bérubé lab and throughout the VRL. I wouldn’t have enjoyed my time in grad school
near as much, or been able to maintain my sanity without you. To my friends outside of grad
school and outside of London, thank you for the opportunities to take some breaks from my
work, and for being so understanding when I turned into somewhat of a hermit over the last
year or two.
v
Table of Contents
Abstract ............................................................................................................................... ii
Co-Authorship Statement................................................................................................... iv
Acknowledgments............................................................................................................... v
Table of Contents ............................................................................................................... vi
List of Tables ...................................................................................................................... x
List of Figures .................................................................................................................... xi
List of Appendices ........................................................................................................... xiii
List of Abbreviations ....................................................................................................... xiv
Chapter 1 ............................................................................................................................. 1
1 Introduction .................................................................................................................... 1
1.1 General introduction ............................................................................................... 1
1.1.1
The history and discovery of ATRX ........................................................... 1
1.2 The ATRX gene and protein ................................................................................... 3
1.2.1
ATRX encodes a SWI2/SNF2 chromatin remodeling protein ................... 5
1.2.2
ATRX is part of a multi-protein complex ................................................... 6
1.2.3
Cellular and genomic localization of ATRX .............................................. 7
1.3 ATRX in development and disease....................................................................... 11
1.3.1
ATR-X and related syndromes ................................................................. 11
1.3.2
ATRX, cancer, and alternative lengthening of telomeres ......................... 13
1.3.3
ATRX in development .............................................................................. 15
1.4 Cellular functions of ATRX.................................................................................. 16
1.4.1
Mitosis and meiosis................................................................................... 16
1.4.2
DNA replication ........................................................................................ 16
1.4.3
Gene regulation ......................................................................................... 17
vi
1.5 Regulating the genome ......................................................................................... 22
1.5.1
DNA methylation ...................................................................................... 22
1.5.2
Chromatin remodeling proteins ................................................................ 23
1.5.3
The histone variant H3.3 and transcriptional elongation .......................... 23
1.6 Chromosome ends: the pseudoautosomal regions and telomeres ......................... 26
1.6.1
The pseudoautosomal region: ancient regions of homology between the X
and Y chromosomes .................................................................................. 26
1.6.2
Telomeres .................................................................................................. 29
1.6.3
G-quadruplexes ......................................................................................... 30
1.7 Thesis overview .................................................................................................... 31
1.8 References ............................................................................................................. 33
Chapter 2 ........................................................................................................................... 50
2 The SWI/SNF protein ATRX co-regulates pseudoautosomal genes that have
translocated to autosomes in the mouse genome ......................................................... 50
2.1 Introduction ........................................................................................................... 50
2.2 Materials and Methods .......................................................................................... 54
2.2.1
Mouse husbandry ...................................................................................... 54
2.2.2
Microarray analysis ................................................................................... 54
2.2.3
Quantitative reverse transcriptase PCR .................................................... 55
2.2.4
Bioinformatics analysis of novel ancestral PAR genes ............................ 55
2.2.5
Cell culture and RNA interference ........................................................... 56
2.2.6
Immunofluorescence ................................................................................. 57
2.3 Results ................................................................................................................... 57
2.3.1
Effects of ATRX deletion on forebrain gene expression .......................... 57
2.3.2
Ancestral pseudoautosomal genes are downregulated in the ATRX-null
mouse forebrain ........................................................................................ 58
2.3.3
Verification of gene expression changes .................................................. 61
vii
2.3.4
Identification of a novel arylsulfatase family mouse homolog ................. 63
2.3.5
Identification of an ASMTL-like gene ..................................................... 67
2.3.6
Expression of PAR genes regulated by ATRX in the mouse is unchanged
upon depletion of ATRX in non-murine cell lines ................................... 69
2.4 Discussion ............................................................................................................. 71
2.5 Supplementary Figures ......................................................................................... 75
2.6 Supplementary tables ............................................................................................ 80
2.7 References ............................................................................................................. 85
Chapter 3 ........................................................................................................................... 90
3 ATRX aids transcription elongation through G-rich gene segments in a process
involving histone H3.3 incorporation .......................................................................... 90
3.1 Introduction ........................................................................................................... 90
3.2 Materials and Methods .......................................................................................... 92
3.2.1
Mouse husbandry and genotyping ............................................................ 92
3.2.2
Mouse embryonic fibroblast isolation, culture and viral infection ........... 92
3.2.3
RNA isolation and transcriptional assays ................................................. 93
3.2.4
RNA dot blots ........................................................................................... 93
3.2.5
Bisulfite mutagenesis and sequencing ...................................................... 94
3.2.6
Chromatin immunoprecipitation ............................................................... 94
3.2.7
Next generation sequencing and analysis ................................................. 95
3.3 Results ................................................................................................................... 96
3.3.1
ATRX is required for the normal expression of Dhrsx and flanking noncoding RNAs in mouse cells ..................................................................... 96
3.3.2
ATRX deficiency in the mouse forebrain or in MEFs does not affect
TERRA levels ........................................................................................... 98
3.3.3
ATRX and H3.3 are enriched within the gene body of Dhrsx................ 101
3.3.4
Reduced levels of H3.3 at Dhrsx and other aPAR genes in the absence of
ATRX correlates with decreased gene expression.................................. 101
viii
3.3.5
H3.3 is enriched at telomeres and towards the ends of chromosomes, and
depleted from telomeres in the absence of ATRX .................................. 106
3.3.6
DNA methylation and histone modifications are not altered at Dhrsx in the
absence of ATRX .................................................................................... 109
3.3.7
Increased RNA polymerase II occupancy at the ATRX/H3.3/G-rich region
of Dhrsx in the absence of ATRX........................................................... 113
3.4 Discussion ........................................................................................................... 115
3.5 Supplementary figures ........................................................................................ 120
3.6 Supplementary tables .......................................................................................... 124
3.7 References ........................................................................................................... 125
Chapter 4 ......................................................................................................................... 132
4 General Discussion and Future Directions ................................................................. 132
4.1 Thesis summary .................................................................................................. 132
4.2 A role for ATRX in gene regulation ................................................................... 133
4.3 ATRX and structured DNA ................................................................................ 136
4.4 Histone chaperones and the genomic localization of histone H3.3 .................... 138
4.5 H3.3 the and regulation of aPAR genes .............................................................. 140
4.6 A model for gene regulation by ATRX .............................................................. 142
4.7 Concluding remarks ............................................................................................ 144
4.8 References ........................................................................................................... 145
Appendices ...................................................................................................................... 152
ix
List of Tables
Table 2-1: Downregulated genes in the ATRX-null forebrain at E13.5 and P0.5. ................. 60
Table 2-2 (supplementary): Conditions for quantitative real-time PCR................................. 80
Table 2-3 (supplementary): Significantly misregulated GO categories. ................................ 81
Table 2-4 (supplementary): Pairwise comparisons of arylsulfatase family members. ........... 84
Table 3-1 (supplementary): Primer sequences and annealing temperatures. ........................ 124
x
List of Figures
Figure 1-1: Protein domains and binding partners of ATRX. .................................................. 4
Figure 1-2: G-quadruplexes. ..................................................................................................... 9
Figure 1-3: Gene regulation by ATRX. .................................................................................. 21
Figure 1-4: Evolution of the pseudoautosomal region. ........................................................... 27
Figure 2-1: Evolution of PAR genes in humans and mice...................................................... 52
Figure 2-2: Relative expression of ancestral PAR genes in ATRX-null mouse forebrains.... 62
Figure 2-3: Phylogenetic tree of arylsulfatase proteins. ........................................................ 64
Figure 2-4: Arsd/e transcriptional downregulation is recapitulated in ATRX-depleted cells. 66
Figure 2-5: Phylogenetic tree of ASMTL proteins. ................................................................ 68
Figure 2-6: PAR gene expression is unchanged in human and bovine cells. ......................... 70
Figure 2-7 (supplementary): Summary of microarray results................................................. 77
Figure 2-8 (supplementary): Amino acid alignment of a small portion of ARSD/E between
multiple species....................................................................................................................... 78
Figure 2-9 (supplementary): Amino acid alignment of the N terminal of ASMTL between
multiple species....................................................................................................................... 79
Figure 3-1: Expression of non-coding RNAs flanking Dhrsx is decreased in the Atrx-null
mouse forebrain. ..................................................................................................................... 97
Figure 3-2: TERRA expression is not altered in forebrain tissue or mouse embryonic
fibroblasts lacking ATRX. .................................................................................................... 100
Figure 3-3: ATRX and H3.3 enrichment at Dhrsx. .............................................................. 103
xi
Figure 3-4: ATRX and H3.3 enrichment at additional aPAR genes..................................... 105
Figure 3-5: H3.3 distribution along chromosomes and at telomeres. ................................... 107
Figure 3-6: DNA methylation at Dhrsx CpG islands is not changed in the P0.5 ATRX-null
mouse forebrain. ................................................................................................................... 110
Figure 3-7: Histone modifications are unchanged in the P17 ATRX-null mouse forebrain. 112
Figure 3-8: RNA Pol-II stalling in the absence of ATRX. ................................................... 114
Figure 3-9: A model for the regulation of transcription by ATRX....................................... 119
Figure 3-10 (supplementary): Adenoviral treatment of Atrx-floxed MEFs. ......................... 120
Figure 3-11 (supplementary): Comparison of H3.3 enrichment at Dhrsx in the mouse brain at
P0.5 and P17. ........................................................................................................................ 121
Figure 3-12 (supplementary): ATRX and H3.3 ChIP-Seq input tracks ............................... 122
Figure 3-13 (supplementary): DNA methylation at the Csf2ra promoter is not altered in the
neonatal ATRX-null mouse forebrain. ................................................................................. 123
xii
List of Appendices
Appendix A: Permission to reproduce previously published work ...................................... 152
Appendix B: Statement of permission for the use of animals for experimental research......152
xiii
List of Abbreviations
ADD
ATRX-DNMT3A/B-DNMT3L
µg
micrograms
µL
microlitres
32P
Phosphorus-32
Ad
adenovirus
ALT
alternative lengthening of telomeres
AMELX
amelogenin, X-linked (gene)
APB
ALT-associated PML nuclear body
aPAR
ancestral pseudoautosomal region
AR
androgen receptor
ARSD/E/F/H arylsulfatase d/e/f/g
ASMTL
acetylserotonin O-methyltransferase-like
ATP
adenosine triphosphate
ATR-16
alpha-thalasemia mental retardation, chromosome 16
ATRX
alpha-thalassemia mental retardation, X linked protein
ATR-X
alpha-thalassemia mental retardation, X linked protein syndrome
ATRXt
alpha-thalassemia mental retardation, X linked protein, truncated isoform
B-actin
Beta-actin
BLASTn
Basic Local Alignment Search, nucleotide
BLAT
BLAST-Like Alignment Tool
BLM
Bloom's syndrome helicase
bp
base pairs
BRCA1
breast cancer type 1
BRG1
Brahma-related Gene 1
BRIP1
BRCA1 interacting protein
BRM
Brahma
C
celcius
CD99
CD99 antigen
cDNA
complementary DNA
xiv
CenH3
centromeric histone H3
CENP-A
centromere protein A
CHD
chromodomain, helicase, DNA binding
ChIP
chromatin immunoprecipitation
ChIP-seq
chromatin immunoprecipitation sequencing
Ci
Curie
CMV
cytomegalovirus
CO2
carbon dioxide
Cre
cyclization recombinase
CRLF2
cytokine receptor-like factor 2
cRNA
complementary RNA
Csf2ra
colony stimulating factor 2 receptor, alpha
CTCF
CCCTC-binding factor
CTD
C-terminal domain (or RNA PolII)
dATRX
Drosophila ATRX
DAXX
death-domain associated protein
DHRSX
dehydrogenase/reductase short-chain dehydrogenase/reductase family, X
chromosome
DHX36
DEAH (Asp-Glu-Ala-His) box polypeptide 36
DMEM
Dulbecco's Modified Eagle Medium
DNA
deoxyribonucleic acid
DNMT
DNA methyltransferase
dsDNA
double stranded DNA
DYZ2
DNA Y-chromosome Z repeats 2
E13.5
embryonic day 13.5
ERCC6
excision repair cross-complementing rodent repair deficiency,
complementation group 6
ESC
embryonic stem cells
EST
expressed sequence tag
EYFP
enhanced yellow flourescent protein
EZH2
enhancer of zest
Foxg1
forkhead box G1
xv
Gapdh
glyceraldehyde-3-phosphate dehydrogenase
gDNA
genomic DNA
GFP
green flourescnet protein
GO
gene ontology
GQN1
G quartet nuclease 1
G-rich
guanine rich
GTPBP6
GTP binding protein 6
h
hour
H3K27Me3
histone 3 lysine 27 trimethylation
H3K36
histone 3 lysing 36
H3K4Me0
histone 3 lysine 4 unmethylated
H3K4Me3
histone 3 lysine 4 trimethylation
H4Ac
histone 4 acetylation
Hb h
Hemoglobin h
HIRA
histone cell cycle regulator
HP1
heterochromatin protein 1
IgG
immunoglobin G
IL3RA
interleukin 3 receptor, alpha (low affinity)
INO80
inositol requiring 80
IP
immunoprecipitation
ISWI
imitation switch
ITS
interstitial telomere sequences
kb
kilobases
kD
kilodaltons
LiCl
lithium chloride
loxP
locus of X-over P1
MAF
musculoaponeurotic fibrosarcoma
MEF
mouse embryonic fibroblasts
mH2A
macro H2A
mm9/mm10
mouse genome version 9/10
mmol
millimole
NCBI
National Center for Biotechnology Information
xvi
neor
neomycin resistance
P0.5/P17
postnatal day 0.5/17
p53
tumor protein p53
PanNET
pancreatic neuroendocrine tumors
PAR
pseudoautosomal region
PCH
pericentromeric heterochromatin
PHD
plant homeodomain
PLCXD1
phosphatidylinositol-specific phospholipase C, X domain containing 1
PML-NB
promyelocytic nuclear bodies
POT1
protection of telomeres 1
PPP2R3b/d
protein phosphatase 2, regulatory subunit B'', beta/delta
qRT-PCR
quantitative reverse transcriptase polymerase chain reaction
rDNA
ribosomal DNA
RefSeq
NCBI reference sequence database
RMA
Robust Multiarray Averaging
RNA
ribonucleic acid
RNA PolII
RNA polymerase II
RPA
replication protein A
S phase
DNA synthesis phase
SDS
sodium dodecyl sulfate
Ser2/5
serine 2/5
SHOX(2)
short stature homeobox (2)
shRNA
short hairpin RNA
siRNA
short interferring RNA
SMARCA2/4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin,
subfamily a, member 2/4
SNF2
sucrose non-fermenting
SSC
saline-sodium citrate
ssDNA
single stranded DNA
SWI2
mating type switching
TERRA
telomere repeat-containing RNA
UCSC
University of California, Santa Cruz
xvii
V
volts
WAG
Whelan And Goldman
WRN
Werner syndrome helicase
XCI
X chromosome inactivation
XH2
X-linked helicase 2
XNP
X-linked nuclear protein
xviii
1
Chapter 1
1
Introduction
1.1
General introduction
Studying the interplay between proteins linked to disease and the genes they regulate is
essential to understanding disease mechanisms, with the ultimate goal of developing
future treatments. The gene ATRX has been linked to two major disease conditions in
humans: its namesake that led to its discovery, alpha-thalassemia mental retardation Xlinked syndrome (ATR-X), and more recently, brain and pancreatic cancers. ATRX is
involved in multiple cellular processes: mitosis and meiosis, DNA replication,
nucleosome remodeling, and gene expression. It is a chromatin remodeling protein
initially found associated with heterochromatin, which suggests that ATRX might be a
negative regulator of gene expression. More recent studies have shown ATRX also
localizes to guanine-rich and repetitive regions of the genome, and the work presented in
this thesis aims to identify the mechanism by which ATRX acts as a positive regulator of
expression for a group of genes connected to these unique regions of the genome.
1.1.1
The history and discovery of ATRX
“Hemoglobin H disease and mental retardation: a new syndrome or a remarkable
coincidence?” This was the question asked by Weatherall et al in 1981 when they
published a report describing three families, each having a son with intellectual disability
and non-Mendelian (not inherited) haemoglobin H (Hb H) disease (Weatherall et al.,
1981). Hb H disease is caused when decreased α-globin expression leads to an excess of
β-globin. The excess β-globin forms β4 tetramers (called Hb H) instead of the usual α2/β2
tetramers. Hb H reduces the oxygen carrying capacity of blood cells, causing damage
and forming intracellular precipitates called Hb H inclusions which are visible under the
microscope (Chui et al., 2003). The cause of this new Hb H/intellectual disability
syndrome was found to be mutations within the α-globin gene cluster near the telomere
of chromosome 16, explaining the cause of the α-thalassemia and suggesting that this
region may also play a role in mental development (Weatherall et al., 1981).
2
Nine years later two studies published together described additional cases and features of
this same syndrome. One study described patients with large deletions of the α-globin
cluster on chromosome 16, and this syndrome was termed ‘α-thalassemia mental
retardation, chromosome 16’ (ATR-16). These patients had more severe Hb H disease
and less severe intellectual disability (Wilkie et al., 1990a). The second paper described
the more mysterious situation in which no mutations or deletions in the α-globin cluster
could be identified. These patients had milder Hb H disease but more severe intellectual
disability, along with a consistent spectrum of other symptoms such as microcephaly,
genital abnormalities, and a distinct facial appearance. It was suggested that a transacting factor may be responsible for this syndrome and that it may be X linked as all the
described cases were genotypically male (Wilkie et al., 1990b). Subsequent cases
supported the X-linkage hypothesis (Cole et al., 1991; Donnai et al., 1991; Harvey et al.,
1990) and the syndrome came to be called ‘α-thalassemia mental retardation, X-linked’
(ATR-X).
The X linked nature of the syndrome was confirmed with linkage analysis placing the
disease causing locus at Xq12-q21.31. In addition to the male patients, phenotypically
normal female carriers were identified by the presence of rare Hb H inclusions and an
extremely skewed pattern of X chromosome inactivation (XCI), whereby the mutated X
chromosome was preferentially inactivated (Gibbons et al., 1992). The location of the
gene responsible for this condition was subsequently narrowed to chromosome Xq13 and
the was cloned in humans (XH2) (Stayton et al., 1994) and mice (Xnp) (Gecz et al.,
1994). XH2, a SNF2 helicase gene located at Xq13.3 was ultimately confirmed as being
responsible for the ATR-X syndrome by the identification of several mutations in this
gene in ATR-X patients (Gibbons et al., 1995), and XH2 was therefore renamed ATRX.
The initial 15 years of study into the ATR-X syndrome therefore identified an X-linked
transcription factor capable of affecting gene expression at the α-globin locus near the
telomere on chromosome 16, and showed that while some of the developmental
symptoms of the ATR-X syndrome arise from disruptions on chromosome 16 (based on
the moderate mental retardation seen in ATR-16), effects elsewhere in the genome are
also likely involved.
3
1.2
The ATRX gene and protein
The ATRX gene is located on the X chromosome at Xq13.3 (Gibbons et al., 1995) and
undergoes X chromosome inactivation (Gibbons et al., 1992; Stayton et al., 1994). ATRX
consists of 36 exons spanning 300 kb (Picketts et al., 1996). Two full length transcripts
(NM_000489 and NM_138270) generated by alternative splicing of exon 6 differ by 117
bp and are approximately 11 kb in length. They produce proteins of either 280
(NP_000480) or 265 kD (NP_612114) (Villard et al., 1997). A truncated form of ATRX
(Bérubé et al., 2000; McDowell et al., 1999) arises from a failure to splice intron 11 from
the primary transcript and use of a proximal intronic poly(A) signal, generating a 200 kD
protein from a 7 kb transcript and is called ATRXt (Garrick et al., 2004) (Figure 1-1A).
ATRX is ubiquitously expressed (Gecz et al., 1994; Stayton et al., 1994), while ATRXt
shows some variability in tissue expression. In particular, while ATRX is highly
expressed in human fetal brain ATRXt is not. In adults, ATRX is expressed at lower
levels in the brain but is high in adult skeletal muscle, heart, and somewhat higher in the
pancreas. In general, a relationship was found in which tissues expressing higher levels
of full length ATRX had lower levels of ATRXt (Garrick et al., 2004).
4
Figure 1-1: Protein domains and binding partners of ATRX.
(A) ATRX contains two highly conserved domains, the ADD and Swi2/Snf2 domains.
The ADD domain is subdivided into three smaller structural units. The bars and labels
above ATRX indicate domains that target ATRX to the specified factors. Nuc, nucleus.
ATRXt is a truncated form of ATRX lacking the Swi2/Snf2 domain. Numbers represent
amino acid positions in the human ATRX protein. (B) Binding partners of ATRX.
ATRX directly binds DAXX and HP1. Targeting to PCH is by direct recognition of
H3K9Me3/H3K4Me0 and enhanced indirectly through HP1. DAXX facilitates ATRX
localization to promyelocytic leukemia nuclear bodies (PML-NBs). ATRX binds H3.3H4 indirectly through DAXX.
5
1.2.1
ATRX encodes a SWI2/SNF2 chromatin remodeling protein
ATRX contains several protein domains, most notably two highly conserved regions
(Picketts et al., 1998): the ATRX-DNMT3-DNMT3L (ADD) domain (Aapola et al.,
2000) and the SWI2/SNF2 helicase domain (Picketts et al., 1996; Stayton et al., 1994)
(Figure 1-1A). SWItching defective/Sucrose NonFermenter (SWI/SNF) complexes are
powered by an ATPase catalytic domain (SNF2/SWI2 in yeast, BRG1/SMARCA4 or
BRM/SMARCA2 in humans) and can remodel nucleosomes to regulate gene expression
(Cote et al., 1994; Liu et al., 2011; Tang et al., 2010). DNA assembled into a nucleosome
generally displays a characteristic pattern of DNase I digestion, with the enzyme cutting
only the most exposed bases to generate a ladder of 10-11 bp intervals (Noll, 1974), and
in this conformation is said to be “rotationally phased”. When exposed to the SWI/SNF
complex this digestion pattern is largely abolished, demonstrating that the DNA-histone
interactions have been disrupted and the DNA phasing around the nucleosome has been
randomized (Cote et al., 1998). The ATRX complex is able to moderately enhance this
digestion pattern in an ATP-dependent manner, in particular at the DNA entry site into
the nucleosome, demonstrating that it has the ability to alter DNA-histone interactions
but not to randomize DNA phasing (Xue et al., 2003). DNA translocases are proteins
that use ATP hydrolysis to move along the DNA double helix. One way to demonstrate
this activity is to form a triple-helical DNA structure then assay whether the protein in
question is able to dissociate the third DNA strand as it moves down the DNA helix.
ATRX exhibits this so-called triple-helix displacement activity but not double-helix
displacement activity, demonstrating that ATRX is able to translocate across but not
unwind double stranded DNA (dsDNA), and is therefore a translocase but not a helicase
(Xue et al., 2003). In addition to translocating itself across naked dsDNA, ATRX is able
to assemble and mobilize nucleosomes (Lewis et al., 2010). Taken together, these studies
demonstrate that ATRX is able to remodel chromatin by altering the interactions between
DNA and histones, allowing it to deposit histones and reposition nucleosomes along
DNA.
Approximately 30% of ATR-X syndrome patient mutations are in the conserved ATRX
SWI2/SNF2 domain (Gibbons et al., 2008). When 21 different mutations in this domain
6
were tested, most caused decreased protein stability, but a few mutations specifically
disrupted the ATPase activity, helicase activity, or both. This demonstrates that patient
mutations in this region can cause the ATR-X syndrome by disrupting either the structure
or function of ATRX (Mitson et al., 2011). ATRXt lacks the SWI2/SNF2 chromatin
remodeling domain, suggesting that it likely has a different function from full length
ATRX (Garrick et al., 2004) (Figure 1-1A).
The ADD domain is named as such because of its significant similarity with de novo
methyltransferases DNMT3A/B and DNMT3L (Aapola et al., 2000). It encompasses
several smaller functional units: a C2C2-GATA-like zinc finger (Argentaro et al., 2007;
Picketts et al., 1998; Villard et al., 1997), a C4C4-plant homeodomain (PHD)-like zincfinger (Gibbons et al., 1997), and an α-helix domain (Argentaro et al., 2007; Picketts et
al., 1998) (Figure 1-1A). The ADD domain can bind naked dsDNA (Cardoso et al.,
2000), but more importantly it targets ATRX to heterochromatin by recognizing the
double histone marks of H3K9Me3/H3K4Me0 (Dhayalan et al., 2011; Eustermann et al.,
2011; Iwase et al., 2011).
1.2.2
ATRX is part of a multi-protein complex
Mammalian SWI/SNF complexes contain nine to 12 proteins with subunit composition
dependent on cell type and specific complex function (Euskirchen et al., 2012; Wang et
al., 1996). While ATRX is a SWI2/SNF2-like protein, it is not a member of a typical
SWI/SNF complex. It is however found in complexes with several other proteins, the
most well studied being heterochromatin protein 1 (HP1), death-domain associated
protein (DAXX), and the histone variant H3.3 (Figure 1-1B). HP1 was the first
interacting partner of ATRX to be identified (Bérubé et al., 2000; Le Douarin et al.,
1996). HP1 is able to directly bind ATRX and it enhances the localization of ATRX to
pericentromeric heterochromatin (PCH) by recognizing additional H3K9Me3 residues
(Eustermann et al., 2011; Kourmouli et al., 2005). The chromatin remodeling ability of
ATRX was first recognized through analysis of a protein complex containing ATRX and
DAXX (Xue et al., 2003), a protein previously identified as both a suppressor and
activator of apoptosis (Salomoni and Khelifi, 2006). DAXX plays a dual role with
ATRX: it targets ATRX to promyelocytic leukemia nuclear bodies (PML-NBs) (Ishov et
7
al., 2004; Tang et al., 2004), and acts with ATRX as a histone chaperone complex to
deposit the histone variant H3.3 at PCH (Drane et al., 2010) and telomeres (Lewis et al.,
2010). DAXX binds H3.3 through the histone’s globular structure (Lewis et al., 2010),
and while ATRX recognizes H3.3’s tail domain, this secondary interaction is dispensable
for targeting H3.3 to telomeres (Wong et al., 2010). As opposed to the PML targeting by
DAXX, localization of the ATRX-DAXX-H3.3 complex to telomeres is directed by
ATRX itself (Goldberg et al., 2010; Lewis et al., 2010), demonstrating that the
combination of ATRX and DAXX allows chromatin remodeling at multiple cellular and
genomic regions. The interaction of ATRX with H3.3 is an unexpected finding given
that ATRX usually associates with repressive chromatin domains while H3.3 is
traditionally a marker of active transcription (Ahmad and Henikoff, 2002; Schwartz and
Ahmad, 2005).
1.2.3
Cellular and genomic localization of ATRX
ATRX is a nuclear protein due to a centrally located nuclear localization signal domain
(Berube et al., 2007). Within the nucleus, ATRX localizes to specific cellular and
genomic regions where it is found with its various protein partners. ATRX frequently
localizes to heterochromatin with HP1, including PCH (Kourmouli et al., 2005;
McDowell et al., 1999), telomeres (Wong et al., 2010), and the condensed chromosomes
during mitosis (Bérubé et al., 2000). ATRX is found at telomeres in mouse ESCs (Law
et al., 2010; Wong et al., 2010), mouse neuroprogenitors (Watson et al., 2013) and human
erythroid cells (Law et al., 2010). It is responsible for depositing H3.3 at both PCH and
telomeres (Drane et al., 2010; Goldberg et al., 2010; Wong et al., 2010). Interestingly,
despite the localization of ATRX at telomeres in the terminally differentiated human
erythroid cells (Law et al., 2010), it is lost from telomeres of mouse ESCs after neuronal
differentiation (Wong et al., 2010). ATRX is found on the inactive X chromosome after
initiation of inactivation (Baumann and De La Fuente, 2008) and along the Y
chromosome (which is largely heterochromatic) in spermatogonial cells (Baumann et al.,
2008). Targeting of ATRX to heterochromatin is mediated by binding of the ADD
domain to the heterochromatic histone mark H3K9 tri-methylation (and to a lesser extent
di-methylation) in the absence of H3K4 methylation and this targeting is enhanced by
8
HP1 which binds ATRX and recognizes additional H3K9Me3 marks (Dhayalan et al.,
2011; Eustermann et al., 2011; Iwase et al., 2011). However, ATRX can also be found at
euchromatin. It is found in decondensed chromatin of growing oocytes (De La Fuente et
al., 2004), and Drosophila ATRX (dATRX), which lacks the ADD domain, localizes to
sites of active transcription (Schneiderman et al., 2009).
ATRX also has a preference for repetitive G-rich sequences including ribosomal DNA
(rDNA) repeats (Gibbons et al., 2000; Law et al., 2010; McDowell et al., 1999), G-rich
tandem repeats, the G-rich strand of telomeres (comprised of TTAGGG repeats), and half
of all ATRX binding sites in humans and mice overlap with CpG islands (Law et al.,
2010). ATRX is enriched at subtelomeres in humans but not mice due to the presence of
high GC levels in this region on human but not mouse chromosomes, demonstrating that
ATRX targets high GC regions rather than subtelomeres in particular (Law et al., 2010).
Enrichment of ATRX at these repetitive G-rich repeats may be mediated by the ability of
ATRX to bind G-quadruplexes (Law et al., 2010). G-quadruplexes are short sequences
containing four guanine triplicates. They form a four stranded secondary structure upon
DNA denaturation during replication or transcription and are particularly enriched within
telomeres (Biffi et al., 2013; Duquette et al., 2004) (Figure 1-2) (See section 1.6.3 for
more details).
9
Figure 1-2: G-quadruplexes.
(A) Typical pattern of potential G-quadruplex forming sequences (top), and the G-rich
telomeric strand sequence, which has a propensity to form G-quadruplexes (bottom). (B)
G-quadruplexes forming during DNA replication or transcription can inhibit passage of
the DNA polymerase (blue triangles) or RNA polymerase (green triangle), respectively.
Newly synthesized DNA is indicated in purple and newly synthesized RNA is in red.
10
PML-NBs are nuclear structures associated with up to 100 proteins. They are implicated
in diverse cellular functions such as protein sequestration, transcription activation and
repression, DNA repair and recombination, cancer, and response to viral infection
(reviewed in (Lallemand-Breitenbach and de The, 2010)). PML-NBs form spherical,
highly organized structures during interphase (Lang et al., 2010). The outer layers
consist of the PML protein itself and ‘nuclear antigen speckled 100 kDa’ (Sp100) (Lang
et al., 2010; Luciani et al., 2006). ‘Small ubiquitin-like modifier’ (SUMO) is found
mostly in these outer layers (Lang et al., 2010; Luciani et al., 2006) and is responsible for
sumoylation of PML which is necessary for the formation of the spherical PML-NB
organization (Ishov et al., 1999; Zhong et al., 2000). Major components of the inner
layers include DAXX, ATRX, and HP1 (Lang et al., 2010; Luciani et al., 2006).
Centromeric DNA is associated with PML-NBs during the G2 phase of the cell cycle
(Everett et al., 1999; Luciani et al., 2006), and telomeres are associated with PML-NBs
during S phase (Chang et al., 2013).
ATRX is targeted to PML-NBs largely by DAXX (Ishov et al., 2004; Tang et al., 2004;
Xue et al., 2003), but also through a C terminal PML-targeting domain (Berube et al.,
2007). The localization of ATRX to PML-NBs appears to be important for the ATRXmediated deposition of H3.3 onto telomeres. Deposition occurs during S phase which is
when both ATRX and telomeres have been shown to associate with PML-NBs. In
addition, depletion of PML causes a reduction of telomeric ATRX and H3.3 (Chang et
al., 2013; Wong et al., 2010). Movement of ATRX between cellular regions may depend
on phosphorylation, as unphosphorylated ATRX displays a speckled nuclear pattern
during interphase (presumably while at PML-NBs) then is phosphorylated and found at
condensed chromatin during mitosis (Bérubé et al., 2000).
ATRXt displays different cellular localization than full-length ATRX; it co-localizes with
ATRX at PCH but not at PML-NBs (Garrick et al., 2004), likely on account of a loss of
the DAXX interacting domain and/or the C terminal PML targeting domain in ATRXt.
Disruptions to the N terminal of ATRX, such as ADD domain mutations seen in some
ATR-X patients, leads to a more diffuse cellular localization (Cardoso et al., 2000).
ATRX localization differs between male and female germ cells; it is associated with
11
chromosomes throughout meiosis in oocytes but not in spermatocytes (Baumann et al.,
2008).
1.3
ATRX in development and disease
Mutations in the ATRX gene were initially identified as the cause of a condition causing
both α-thalassemia and intellectual disability (Gibbons et al., 1995; Weatherall et al.,
1981) but have since been implicated in several human conditions.
1.3.1
ATR-X and related syndromes
Mutations in ATRX result in a diversity of clinical abnormalities collectively known as
the ATR-X syndrome (clinical phenotype reviewed in (Gibbons, 2006; Gibbons and
Higgs, 2000)). A moderate to profound cognitive deficit is the most common feature,
with 95% of patients exhibiting profound intellectual disability. Related common
neurological symptoms include delayed and limited expressive language skills,
microcephaly, and seizures. A distinctive facial appearance is seen in almost all cases
and includes telecanthus (wide-set eyes), epicanthic folds (skin folds of the upper eyelid
covering the inner corner of the eye), flat nasal bridge and small triangular upturned nose,
and a tented upper lip. A wide range of relatively mild musculoskeletal abnormalities
include hypotoia (low muscle tone), fixed flexion deformity (inability to properly
straighten or bend) of the fingers, short, bent or conjoined fingers, and flat or clubbed
feet. Short stature is seen in 65% of cases. Gastrointestinal difficulties such as recurrent
vomiting, regurgitation, and gut dysmotility are seen in 75% of cases. Genital
abnormalities are seen in 80% of patients and range from undescended testes to
pseudohermaphrodism. Lastly, α-thalassemia (decreased α-globin production) is seen in
nearly 90% of patients and is diagnosed by the presence of Hb H inclusions.
At the molecular level ATR-X patients show aberrant DNA methylation at repetitive
sequences: loss of rDNA methylation, greatly increased methylation of the
heterochromatic Y-chromosome DYZ2 repeats, and slightly altered methylation at
subtelomeric sequences. Interestingly, no changes in methylation were found at other
repetitive sequences including telomeres (Gibbons et al., 2000) despite ATRX being
found at both rDNA and telomeres. Approximately 150 mutations and 200 cases of
12
ATR-X syndrome have been identified. Most mutations are found within either the ADD
or helicase-SWI2/SNF2 domain, reiterating the importance of these conserved regions
(Gibbons, 2006; Gibbons et al., 2008).
Given the X-linked nature of ATRX, the syndrome generally affects males while females
exhibit little or no symptoms due to extremely skewed inactivation of the X chromosome
containing the mutated ATRX allele (Gibbons et al., 1992; Yntema et al., 2002).
Mutations inherited from carrier mothers are the cause of 85% of ATR-X syndrome cases
(Badens et al., 2006a; Gibbons and Higgs, 2000). If the mutated ATRX allele is not
properly inactivated then female carriers will exhibit ATR-X syndrome phenotypes
(Badens et al., 2006b; Wada et al., 2005). The exact cause of skewed XCI in female
carriers is unclear. When Atrx is deleted from various types of mouse embryonic
progenitor cells XCI skewing occurs, while postnatal deletion (even in replicative cell
types) does not cause XCI, demonstrating that in progenitor cells, those expressing wildtype ATRX may outcompete mutant cells (Muers et al., 2007). Upon mouse embryonic
deletion of Atrx, skewed XCI appears only after the earliest stages of development
(Muers et al., 2007), and ATRX is associated with the inactive X chromosome only after
onset of random X inactivation, suggesting a role for ATRX in maintenance but not
initiation of XCI (Baumann and De La Fuente, 2008). Extraembryonic tissue exhibits
imprinted XCI of the paternal X chromosome (Takagi and Sasaki, 1975). ATRX is
associated with the paternally inactive mouse X chromosome in this tissue (Baumann and
De La Fuente, 2008). When Atrx is deleted from early mouse embryos in a parent-oforigin manner so that only the mutated (maternal) Atrx should be active in these tissues,
some embryos are able to escape this imprinted XCI allowing expression of wild-type
Atrx and rescue of embryonic development (Garrick et al., 2006). It has been proposed
that reactivation of the paternal allele could be due to either incomplete initial paternal
inactivation allowing the few remaining wild-type cells to overtake the population
(Garrick et al., 2006), or that paternal XCI is not maintained due to loss of ATRX, given
the potential role for ATRX in maintaining XCI (Baumann and De La Fuente, 2008).
Taken together, these studies show that ATRX may be playing a dual role in XCI:
expression of the mutated Atrx allele may lead to both a decrease in cell viability and a
failure to maintain the XCI status of the given cell.
13
ATRX mutations that lead to intellectual disability in the absence of α-thalassemia have
been given several syndrome names (e.g. Juberg-Marsidi (Villard et al., 1996),
Carpenter-Waziri (Abidi et al., 1999), Smith-Fineman-Myers (Villard et al., 2000),
Chudley-Lowry (Abidi et al., 2005)) and are collectively known as ‘mental retardationhypotonic facies syndrome, X-linked’ (OMIM 309580). Alternatively, somatic mutations
leading to defects in erythropoiesis in the absence of cognitive or other symptoms cause
α-thalassemia myelodysplasia syndrome (Gibbons et al., 2003; Steensma et al., 2005).
Lastly, ATRX overexpression was recently identified in a Drosophila model of
Huntington’s disease, a neurodegenerative disorder caused by mutations in the
Huntington gene. Increased levels of ATRX led to larger PML-NBs and increased
condensation of PCH (Lee et al., 2012).
1.3.2
ATRX, cancer, and alternative lengthening of telomeres
Over the last few years, genomic sequencing and immunohistochemistry have identified
ATRX mutations in pancreatic neuroendocrine tumors (de Wilde et al., 2012; Heaphy et
al., 2011; Jiao et al., 2011) and brain cancer (Cheung Nv and et al., 2012; Heaphy et al.,
2011; Jiao et al., 2012; Khuong-Quang et al., 2012; Molenaar et al., 2012;
Schwartzentruber et al., 2012). Tumorigenic cells lacking ATRX expression typically
exhibit alternative lengthening of telomeres (ALT) (Cheung Nv and et al., 2012; de
Wilde et al., 2012; Heaphy et al., 2011; Jiao et al., 2012; Schwartzentruber et al., 2012), a
recombination process that maintains telomere length and proliferative capacity in the
absence of the telomerase enzyme (reviewed in (Cesare and Reddel, 2010)). The cause
of the excessive recombination leading to ALT is uncertain, but seems to require proteins
involved in recombination (e.g. the meiotic recombination complex (Jiang et al., 2005))
along with the loss of proteins involved in telomere maintenance (e.g. the Werner
Syndrome protein WRN, which is required for proper replication of telomeres (Crabbe et
al., 2004; Laud et al., 2005)). It has been hypothesized that ATRX’s association with
telomeric G-quadruplexes may assist in telomere replication, and that loss of ATRX
could therefore lead to stalled replication forks which trigger DNA damage and
homologous recombination (Clynes and Gibbons, 2013).
14
Loss of ATRX is frequently associated with ALT in cell lines (Bower et al., 2012;
Lovejoy et al., 2012), but artificial depletion of ATRX does not itself lead to ALT
(Lovejoy et al., 2012), suggesting that ATRX helps repress ALT and that additional
events must occur for its initiation. One of the additional events may be loss of p53, as
p53 can inhibit telomere recombination (Razak et al., 2004) and ALT occurs more readily
in p53-null cells (Laud et al., 2005). Correspondingly, many ATRX-null ALT-positive
tumors also have p53 mutations (Jiao et al., 2012; Kannan et al., 2012). Therefore, loss
of ATRX may cause telomere replication fork stalling leading to the telomeric DNA
damage seen in ATRX-null muscle (Huh et al., 2012) and brain (Watson et al., 2013),
while the addition of a p53 mutation may be needed to activate ALT as seen in ATRXnull tumors. Mutations in DAXX and H3.3 are also associated with ATRX-null and
ALT-positive tumors, further demonstrating a role for the ATRX-DAXX-H3.3 axis in
telomere maintenance (Schwartzentruber et al., 2012). Interestingly, cells that exhibit
ALT have larger than normal PML-NBs, called ALT-associated PML-NBs (APBs)
(Chung et al., 2012). These enlarged PML-NBs may play a role in ALT by acting as sites
of telomere accumulation allowing for increased recombination (Draskovic et al., 2009).
APBs can be artificially induced by treating cells with the viral protein ICP0 (Draskovic
et al., 2009), a protein that can inhibit DAXX function (Lukashchuk and Everett, 2010)
and H3.3 deposition (Newhart et al., 2012). DAXX normally targets ATRX to PML-NBs
(Ishov et al., 2004; Tang et al., 2004), where ATRX and DAXX then associate with
telomeres to deposit H3.3 to maintain telomere integrity (Chang et al., 2013; Delbarre et
al., 2012). These studies reinforce the idea that the ATRX-DAXX-H3.3 axis is essential
to telomere maintenance, and that PML-NBs are a key mediator of this process.
Mutations in DAXX have been found in pancreatic neuroendocrine tumors (Heaphy et al.,
2011; Jiao et al., 2012), and mutations in either DAXX or H3.3 have been found in brain
cancers (Khuong-Quang et al., 2012; Liu et al., 2012; Schwartzentruber et al., 2012). No
ATRX mutations or disruptions of ATRX expression were found in gastric, colorectal or
prostate cancers (Je et al., 2012), suggesting that ATRX may be a required tumor
suppressor in some tissues but not others.
15
1.3.3
ATRX in development
Given the myriad of disease states caused by ATRX mutations, several mouse models
have been used to identify the role ATRX plays in normal development. It was
demonstrated early on that Atrx has widespread expression during early embryogenesis
but a more restricted expression pattern at later timepoints (Gecz et al., 1994; Stayton et
al., 1994). By E13, expression in the brain is mostly restricted to the telencephalon
(primitive forebrain), and in newborn mice is highest in the olfactory bulb and
hippocampus, regions of ongoing adult neurogenesis, with lower levels in the cortex.
This suggested a role for ATRX in early development and neurogenesis (Gecz et al.,
1994; Stayton et al., 1994). The expression pattern seen in the newborn brain is
maintained in the adult mice (Bérubé et al., 2005).
Deletion of Atrx in mouse ESCs causes reduced proliferation, and GATA1-Cre-mediated
conditional deletion at the 8- to 16-cell stage is embryonic lethal in most cases due to
defects in trophoblast development, demonstrating the importance of ATRX in the
earliest stages of development. A small number of female embryos are able to survive by
selectively inactivating the X chromosome containing the mutated Atrx allele, similar to
what is seen in human female carriers of ATRX mutations (Garrick et al., 2006). Several
roles for ATRX in brain development have been identified. Constitutive overexpression
causes neural tube defects, disorganization of the neuroepithelial cell layer, and increased
embryonic and perinatal lethality (Bérubé et al., 2002). Constitutive deletion was
embryonic lethal, while Foxg1-Cre-mediated conditional deletion in the embryonic
forebrain beginning at E8.5 caused a significant increase in p53 mediated apoptosis,
reduced neuronal migration, and mitotic defects in cortical neuroprogenitor cells. These
defects likely combine to cause the smaller forebrain size, disruption of the hippocampus
with loss of the dentate gyrus, and perinatal lethality seen in these mice (Bérubé et al.,
2005; Ritchie et al., 2008; Seah et al., 2008).
Several patients with a milder form of ATR-X syndrome have been identified with a
mutation in exon 2 leading to reduced expression of a truncated form of ATRX from an
alternative downstream initiation site (Abidi et al., 2005; Guerrini et al., 2000; Howard et
al., 2004). Deletion of exon 2 in mice mirrored this ATRX expression pattern, and
16
caused no noticeable anatomical or reproductive symptoms. However, it led to
behavioural deficits associated with memory and learning (functions of the hippocampus)
due to reduced phosphorylation of a glutamate receptor leading to reduced neuronal
signaling (Nogami et al., 2011).
ATRX is also involved in terminal differentiation of neurons in the retina (Medina et al.,
2008), muscle cell development and regeneration (Huh et al., 2012), and gonad
development in both males and females (Bagheri-Fam et al., 2011; Huyhn et al., 2011).
1.4
1.4.1
Cellular functions of ATRX
Mitosis and meiosis
The first study to look at the cellular localization of ATRX found it associated with both
interphase and metaphase chromosomes (McDowell et al., 1999). The finding that
ATRX is phosphorylated as it transitions from its interphase to mitotic locations
suggested distinct roles for ATRX at different phases of the cell cycle (Bérubé et al.,
2000). A role for ATRX in cell division has been confirmed by demonstrating that loss
of ATRX leads to improper chromosome congression, cohesion, and segregation during
mitosis, with misaligned chromosomes seen at the metaphase plate in both HeLa cells
and embryonic forebrain. Loss of ATRX therefore leads to slower mitosis because
chromosomes take longer to align to the metaphase plate leading to activation of the
mitotic spindle checkpoint (Ritchie et al., 2008). Similar defects are seen during meiosis.
Loss of ATRX leads to improper metaphase II chromosome alignment (Baumann et al.,
2010; De La Fuente et al., 2004) leading to aneuploidy and decreased fertility (Baumann
et al., 2010). Loss of ATRX was also shown to cause genome instability leading to
delayed mitotic progression through S phase in muscle (Huh et al., 2012).
1.4.2
DNA replication
A role for ATRX in DNA replication is mainly believed to involve the replication of
difficult to process DNA, such as regions that are repetitive and/or contain secondary
DNA structures (reviewed in (Clynes and Gibbons, 2013)). ATRX is enriched at
repetitive G-rich sequences including rDNA repeats (Gibbons et al., 2000; Law et al.,
17
2010; McDowell et al., 1999), the G-rich strand of telomeres (comprised of TTAGGG
repeats), and G-rich tandem repeats throughout the genome (Law et al., 2010), all regions
that can form G-quadruplexes (Law et al., 2010; Lipps and Rhodes, 2009). As a
secondary DNA structure, G-quadruplexes present a barrier to replication requiring
specialized proteins for their resolution and bypass (Lopes et al., 2011; Paeschke et al.,
2011; Schwab et al., 2013). ATRX may therefore assist in DNA replication by resolving
these structures to allow passage of the DNA replication machinery. Supporting this, loss
of ATRX causes DNA damage and dysfunction at telomeres (Huh et al., 2012; Watson et
al., 2013; Wong et al., 2010), and delayed progression through the S phase of the cell
cycle (Huh et al., 2012; Watson et al., 2013). Resolution of G-quadruplexes by ATRX
may involve deposition of H3.3, as ATRX associates with telomeres and deposits H3.3
during S phase (Wong et al., 2010).
1.4.3
Gene regulation
SWI/SNF proteins have long been known to be regulators of gene expression and were
initially identified as transcriptional activators (Winston and Carlson, 1992). As a
member of the SWI2/SNF2 subfamily of proteins ATRX has therefore been speculated to
be a regulator of gene expression ever since its sequence was originally determined
(Stayton et al., 1994). The presence of a PHD domain added to this early speculation, as
PHD fingers were thought to regulate transcription through interactions with chromatin
(Aasland et al., 1995). The PHD finger of ATRX was later found to be a subcomponent
of the ADD domain, a domain shared with the DNMT3A/B/L de novo methyltransferase
genes (Aapola et al., 2000). DNMT3A and DNMT3B can repress transcription through
DNA methylation (Bachman et al., 2001) and ATR-X syndrome patients have aberrant
methylation at several repetitive regions of the genome (Gibbons et al., 2000), suggesting
a role for ATRX in DNA methylation, a common epigenetic method of regulating gene
expression (see section 1.5.1 for more details). However, a direct mechanism relating
ATRX to DNA methylation has not yet been identified.
Besides having particular protein domains, ATRX is also implicated in gene regulation
on account of its protein binding partners. ATRX was shown to bind EZH2 by yeast
two-hybrid and in vitro binding assays (Cardoso et al., 1998), although no subsequent
18
studies confirming in vivo binding have yet to be published. EZH2 is the catalytic
subunit of the polycomb repressive complex 2 that represses chromatin through histone
methylation (O'Meara and Simon, 2012). ATRX’s binding to HP1 supported its role as a
potential regulator of heterochromatin. HP1 proteins (HP1α, HP1β, HP1ɤ) have
traditionally been associated with heterochromatin and gene silencing, but mounting
evidence shows additional roles in gene activation (Kwon and Workman, 2011). ATRX
binds DAXX at PML-NBs. Both PML-NBs and DAXX have been implicated in
numerous cellular functions, including gene regulation (Dundr, 2012; Salomoni and
Khelifi, 2006) but it is unclear exactly how or if ATRX could play a role in general gene
regulation through these proteins.
While the above indirect evidence is highly suggestive of a role for ATRX in regulating
gene expression, the identification of specific genes regulated by ATRX has cemented
this position. The recognition that ATR-X syndrome patients have decreased α-globin
but not β-globin expression suggested that ATRX may regulate genes in particular
genomic regions. The two globin genes exist in very different chromatin environments,
with α-globin being near a telomere in a region of high GC content and constitutively
open chromatin (Figure 1-3A) (Gibbons et al., 1995). Evidence from studies of viral
infection has demonstrated the ability for ATRX and DAXX working at PML to repress
expression of viral genes by blocking recruitment of RNA polymerase II (RNA PolII) to
the promoter (Newhart et al., 2012; Schreiner et al., 2013; Tsai et al., 2011). An
additional study of promoter regulation showed that if ATRX is targeted to a promoter it
can inhibit transcription (Tang et al., 2004; Valadez-Graham et al., 2012), and that
DAXX can alleviate this repression likely by sequestering ATRX to PML-NBs (Tang et
al., 2004). Alternatively, in a mouse testis cell line it was shown that ATRX interacts
with the androgen receptor (AR) protein, binds the promoter of the AR target gene
Rhox5, and promotes instead of represses expression (Bagheri-Fam et al., 2011),
demonstrating that ATRX can both activate or repress gene expression by binding to
promoters depending on context, such as its binding partner and cell type (Figure 1-3B).
ATRX can also regulate gene expression by binding to regulatory regions. It binds to
imprinting control regions where it regulates the recruitment of CTCF and the cohesin
19
complex to silence nearby imprinted genes, possibly by facilitating chromosome looping
(Kernohan et al., 2010) (Figure 1-3C).
Several lines of evidence have shown interactions of ATRX with PCH or telomeres, and
it has also been seen that, along with regulating transcription of specific genes, as already
discussed, ATRX can regulate expression of transcripts from these repetitive regions.
ATRX deposits the histone variant H3.3 at both PCH and telomeres, and in the absence
of ATRX, H3.3 is lost from both of these sites. It is interesting to note then that while
expression from PCH is decreased upon ATRX (and therefore H3.3) loss (Drane et al.,
2010), expression of telomere repeat-containing RNA (TERRA) increases (Figure 1-3D)
(Goldberg et al., 2010). Increasing evidence over the last few years has continued to
demonstrate this dual nature of H3.3’s role in gene expression (Elsaesser et al., 2010;
Szenker et al., 2011).
Drosophila ATRX can assemble heterochromatin to repress nearby genes (Figure 1-3E)
(Bassett et al., 2008; Emelyanov et al., 2010), while a different study found that dATRX
is found mostly at sites of active transcription and that both overexpression and deletion
of dAtrx can cause derepression of gene silencing (Schneiderman et al., 2009). dATRX
lacks the ATRX ADD domain, and Drosophila have no PML protein, so ATRX and
dATRX likely play similar but different roles in regulating gene expression
(Schneiderman et al., 2009). For example, dATRX may lack some of the targeting ability
of ADD-containing ATRX, while maintaining the same chromatin remodeling abilities.
Taken together, it is clear that ATRX can act as either a repressor or activator of gene
expression through several different mechanisms.
20
21
Figure 1-3: Gene regulation by ATRX.
(A) The α-globin gene cluster contains intergenic potential G-quadruplex forming tandem
repeats (TRs) thought to inhibit DNA replication. In the absence of ATRX (top), this
may lead to a downregulation of nearby genes. This repression is enhanced by proximity
to TRs or increased TR length. In the presence of ATRX (bottom), ATRX facilitates
replication through the G-quadruplex forming regions, allowing proper gene expression.
(B) ATRX can act at promoters. ATRX can bind the androgen receptor (AR) to cooperatively activate the Rhox5 promoter (top), or it can inhibit expression by blocking
RNA polymerase II (PolII) (bottom left). In the latter scenario, DAXX can sequester
ATRX to PML-NBs (PML) to remove the ATRX promoter blocking (bottom right). (C)
Binding of ATRX to the H19 imprinting control region recruits CTCF and cohesin to
silence genes by altering DNA looping. (D) ATRX recruits histone H3.3 to activate
transcription from repetitive pericentromeric heterochromatin (PCH) or to repress
transcription of telomere repeat-containing RNA (TERRA). (E) In Drosophila, ATRX
binds to HP1 and is required for heterochromatin gene silencing, presumably by
assembling heterochromatin through ATRX’s and HP1’s ability to bind the repressive
chromatin mark H3K9Me3. ATRX is purple throughout, and green arrows represent
relative levels of transcription within each section of the figure.
22
1.5
1.5.1
Regulating the genome
DNA methylation
Methylation of cytosines within eukaryotic DNA, and the idea that it could act as a
cellular regulatory mechanism, was proposed over 35 years ago. In particular, it was
suggested that DNA methylation could change the affinity of DNA binding proteins, and
that DNA methylation played a role in X chromosome inactivation. At the time,
however, DNA methylation was thought to activate rather than repress genes (Riggs,
1975). It was subsequently determined that DNA methylation does in fact affect protein
binding and gene expression, when MeCP2 was found to bind methylated DNA, leading
to transcriptional repression through recruitment of a histone deacetylase (Jones et al.,
1998; Nan et al., 1998). More recently, it has been seen that MeCP2 can bind both
methylated and unmethylated DNA, and either repress or activate gene expression,
depending on context (Hansen et al., 2010). DNA methylation, however, seems to be
largely associated with transcriptional repression (DNA methylation and its regulation of
transcription reviewed in (Deaton and Bird, 2011)). DNA methylation occurs throughout
the genome at CpG dinucleotides. While most individual CpG’s are methylated, areas of
high CpG concentration called CpG islands are often found within gene promoters and
are generally unmethylated. When methylation of CpG island promoters does occur, it
acts as a stable repressor of transcription. This de novo CpG methylation is mediated by
the DNA methyltransferases DNMT1, DNMT3A, and DNMT3B (reviewed in (Klose and
Bird, 2006)). Promoter methylation can repress transcription either by directly blocking
transcriptional activators from binding, or by attracting methyl binding proteins to inhibit
transcription, such as with MeCP2 as described above. CpG islands found outside
promoters, in particular those found within gene bodies, are more often methylated
compared to those found in promoters. Changes in intragenic CpC island methylation
may have roles in transcription elongation or splicing (Deaton and Bird, 2011), for
example, increased intragenic DNA methylation was shown to inhibit transcription
elongation (Lorincz et al., 2004).
23
1.5.2
Chromatin remodeling proteins
DNA is packaged into chromatin which allows organization and regulation of the nearly
two meters of DNA in each human cell. Chromatin remodeling complexes act on the
basic unit of chromatin, the nucleosome, to alter the interactions between DNA and
histones allowing these complexes to reposition, assemble, eject, or restructure the
composition of nucleosomes (reviewed in (Clapier and Cairns, 2009)). For example,
histones are repositioned or ejected to allow or inhibit access to the DNA by transcription
factors, assembled after new DNA is synthesized during DNA replication, or restructured
to replace canonical histones with histone variants. Chromatin remodeling complexes are
divided into four families: SWI/SNF; imitation switch (ISWI); chromodomain, helicase,
DNA binding (CHD); and inositol requiring 80 (INO80). Each complex contains a
catalytic subunit with a SWI2/SNF2 or SWI2/SNF2-like ATPase domain, but differing
complex composition allows for distinctive targeting and overall function. Targeting of
these complexes to particular regions of the genome relies on multiple nucleosome
recognition domains. Bromodomains found in SWI/SNF family members recognizes
acetylated lysines. Chromodomains of the CHD proteins recognize methylated lysine.
Plant homeodomains found in various proteins of the chromatin remodeling complexes
also recognize methylated lysine. SANT-SLIDE domains of ISWI proteins binds
unmodified histone tails through the SANT domain, and bind nucleosomal DNA through
the SLIDE domain. As a SWI2/SNF2, ATPase-containing protein, ATRX therefore
resembles the catalytic subunits seen in a wide variety of chromatin remodeling
complexes, while its PHD-like domain allows nucleosomal targeting.
1.5.3
The histone variant H3.3 and transcriptional elongation
Nucleosomes consist of about 147 bp of DNA wrapped around a histone octamer
complex consisting of an (H3-H4)2 histone tetramer with two H2A-H2B histone dimers
(Luger et al., 1997). Besides these canonical histones several variant histones exist. The
H3 family of histones contains several variants which perform different functions and
differ across species (Szenker et al., 2011). Firstly, all organisms have a centromerespecific CenH3 (CENP-A in mammals). Besides CenH3, yeast has a single H3 variant
most similar to human H3.3. Drosophila has H3.3 and H3.2, mice have H3.3, H3.2,
24
H3.1, and the testis-specific H3t, while humans have seven histone H3 variants: the five
found in mice, plus the recently identified primate-specific H3.X and H3.Y (Wiedemann
et al., 2010). Most chromatin is established during DNA replication with the assembly of
nucleosomes that contain replication-dependent histones–H3.1/2, H2A/B, and H4–which
are expressed most highly during S phase. On the contrary, replication-independent
variants such as H2A.Z and H3.3 are synthesized continuously throughout the cell cycle
and can be incorporated in a replication-independent manner (Henikoff and Ahmad,
2005). In yeast and organisms with only a single H3 variant, this “universal” H3 fulfills
both replication-dependent and -independent incorporation (Szenker et al., 2011). H3.3
differs from H3.1 by five amino acids and from H3.2 by only four. Three amino acids
specific to the H3.3 core (an “AIG” motif) determine its replication-independent
deposition (Ahmad and Henikoff, 2002) and genomic localization patterns (Goldberg et
al., 2010), and an alanine to serine change on the H3.3 histone tail adds an additional site
for potential phosphorylation (Hake et al., 2005).
Transcription is a multistep process involving different combinations of histone
modifications and transcription factors at different steps in the process (reviewed in
(Buratowski, 2009)). RNA PolII contains a C-terminal domain (CTD) which exhibits
different states of phosphorylation at different stages during transcription (Komarnitsky
et al., 2000). These phosphorylation states are involved in recruiting other factors
necessary at each stage. RNA PolII is unphosphorylated when initially bound to
promoters then is phosphorylated on CTD serine 5 (Ser5) for the first few hundred
nucleotides. Ser5 phosphorylation attracts methyltransferases which leads to enrichment
of H3K4Me3 at the promoters of active and recently active genes (Ng et al., 2003). Ser5
phosphorylation is gradually replaced with Ser2 phosphorylation on the elongating RNA
PolII and the regions of double Ser2/5 phosphorylation attract H3K36 methylation.
H3K36 methylation therefore marks actively elongating transcription.
Nucleosomes act as barriers to transcription (Bondarenko et al., 2006; Knezetic and Luse,
1986). In order for the transcriptional machinery to proceed down DNA, the interactions
between the DNA and histones must be disrupted. Therefore, the nature of these
interactions affects how easily transcription can occur. Different combinations of
25
histones exhibit different levels of stability, referring to how strong the histone-DNA
interactions are and how easily the histones can be evicted from DNA. Nucleosomes
containing H3.3 are inherently unstable. H2A.Z contributes to this instability but is
relatively stable itself if paired with H3.1/2 (Jin and Felsenfeld, 2007). Besides the core
nucleosome particles, histone tail modifications can also affect stability. Acetylation
inhibits the positive charge on the histone tail, reducing the strength of DNA-histone
interaction (Brower-Toland et al., 2005). Histone tail methylation attracts secondary
remodelers. For example, H3K9Me3 attracts the repressive protein HP1 (Fischle et al.,
2003; Lachner et al., 2001) which may bridge adjacent nucleosomes to stabilize them
(Canzio et al., 2011), and H3K27Me3 attracts repressive polycomb group proteins
(Fischle et al., 2003). H3.3 acts doubly to promote transcription due to its inherent
instability and high propensity to have activating modifications (McKittrick et al., 2004).
Elongating RNA PolII leads to eviction of one of the H2A-H2B histone dimers, while
elongation at higher rates can lead to eviction of the entire nucleosome (Petesch and Lis,
2012). Re-assembling chromatin after the passage of RNA PolII (or of DNA polymerase
during replication) is largely the work of various histone chaperones (reviewed in
(Avvakumov et al., 2011; Duina, 2011)). ‘Facilitates chromatin transcription’ (FACT) is
largely responsible for depositing H2A-H2B, though it can also bind H3-H4 (Orphanides
et al., 1998; Xin et al., 2009), while SPT6 acts on H3-H4 (Bortvin and Winston, 1996;
Ivanovska et al., 2011). As a replication-independent histone H3 variant, one of the main
functions of H3.3 is incorporation at sites of active transcription after passage of the
transcription machinery and eviction of the original histones (Ahmad and Henikoff, 2002;
Schwartz and Ahmad, 2005). Incorporation of H3.3 into transcribing gene bodies is
thought to be reliant on the histone chaperone HIRA (Goldberg et al., 2010; Schwartz and
Ahmad, 2005). H3.3 is therefore both a mark of active transcription and a facilitator of
future transcription.
26
1.6
Chromosome ends: the pseudoautosomal regions
and telomeres
Several lines of evidence have now associated ATRX with G-rich and repetitive genomic
targets. Two regions that exhibit these characteristics are the pseudoautosomal regions
(PARs) and telomeres.
1.6.1
The pseudoautosomal region: ancient regions of homology
between the X and Y chromosomes
The X and Y sex chromosomes in modern placental mammals are highly dimorphic but
initially evolved from a homologous pair of autosomes (origin and evolution of the PAR
reviewed in (Graves et al., 1998; Helena Mangs and Morris, 2007; Katsura et al., 2012)).
Over millions of years of mammalian evolution the sex chromosomes have lost most of
their homology due to chromosome Y attrition. However, the additions of genetic
material from other autosomes onto the ends of the diverging X and Y chromosomes at
several points in time have added new homology in regions known as pseudoautosomal
regions. The X and Y chromosomes have therefore gone through several rounds of
addition and attrition resulting in the modern X and Y chromosomes and PARs. Because
species diverged at different points in history as this process continued, the PARs show
various levels of similarity between species; therefore, the human and chimpanzee
PAR1’s are very similar, but are different from species such as cattle and sheep which
themselves have more closely related PAR1’s. Rodents exhibit an entirely different PAR
organization. It is believed that at some point after the evolutionary divergence between
mice and humans, nearly the entire ancestral PAR1 was lost from the rodent lineage
while a new, smaller PAR1 was gained (Graves et al., 1998; Helena Mangs and Morris,
2007; Katsura et al., 2012) (Figure 1-4).
It is not clear exactly what the purpose of the PAR is. While they are used for pairing
and crossing over in most mammals, marsupials and some rodents have no PARs
demonstrating that they are not a universal requirement for mammalian meiosis (Graves
et al., 1998; Helena Mangs and Morris, 2007; Katsura et al., 2012).
27
Figure 1-4: Evolution of the pseudoautosomal region.
(A) The pseudoautosomal region (PAR) originated when DNA from a pair of autosomes
translocated onto the ends of the ancient X and Y chromosomes. (B) Loss of homology
has gradually shrunk the PAR. Genes just outside the X chromosome PAR (light pink)
often contain pseudogenes on the Y chromosome. (C) The human PAR has continued to
shrink, but the modern human PAR is largely the same as the predicted ancestral PAR.
(D) Several rodents, including mice and rats, have completely lost the original PAR but
gained a new smaller, unique PAR.
Genes that were in the ancestral PAR have
translocated to autosomes, with some now located near telomeres and others not yet
definitively placed in the mouse genome. Black circles represent centromeres. mya,
millions of years ago.
28
By comparing sequences between the X and Y chromosomes, and between species, it has
been estimated that the boundary of the ancestral PAR1, before attrition, was at the
AMELX gene (Iwase et al., 2003) giving the original PAR1 a size of 11.3 Mb. The
modern cattle PAR1 is estimated at 5-9 Mb (Das et al., 2009), the human PAR1 is 2.5
Mb, while rodents, who have lost the original PAR1, have gained a small region of about
0.7 Mb (Perry et al., 2001). The differences in PAR size are reflected in their gene
content. Fewer than half of the 24 PAR1 genes identified so far in humans have also
been found in the mouse genome, and all have diverged considerably (Perry et al., 2001).
This divergence is largely due to the increased recombination rates in the PARs during
male meiosis (Lien et al., 2000). Many genes located on the human X chromosome
between 2.5 and 11.3 Mb (i.e. within the original PAR but outside the modern one) have
degenerative, non-functional copies (pseudogenes) on the Y chromosome.
The divergence between PAR orthologs makes the identification of human PAR1
orthologs difficult. Interestingly, in the mouse, all human PAR1 orthologs identified to
date are located on autosomes. For example, ‘colony stimulating factor 2 receptor, alpha’
(Csf2ra) is located on mouse chromosome 19 (Disteche et al., 1992) and ‘CD99 antigen’
(Cd99) and ‘dehydrogenase/reductase short-chain dehydrogenase/reductase family, X
chromosome’ (Dhrsx) are located on chromosome 4 (Bixel et al., 2004; Gianfrancesco et
al., 2001). Human orthologs of ‘acetylserotonin O-methyltransferase-like’ (ASMTL) and
several members of the arylsulfatase (ARS) family of genes (ARSD, ARSE, ARSF, and
ARSH) are located just outside the human PAR1, and have not yet been reported in the
mouse. The human X chromosome arylsulfatases are an example of genes that have
pseudogenes on the Y chromosome. Due to the location of these mouse genes in the
PAR region of evolutionary ancestors (before rodents lost the original PAR), and their
current autosomal location, I will refer to these genes in the mouse as “ancestral PAR
genes” (aPAR genes).
Equal gene dosage between XX females and XY males is usually achieved by the
silencing of one X chromosome in every female cell, a process known as X chromosome
inactivation (Lyon, 1989). Because both males and females have two copies of all PAR
genes, there is no requirement for dosage compensation and these genes therefore escape
29
this inactivation process in humans (Carrel and Willard, 2005) (and being on autosomes
are not subject to XCI in mice).
In addition to being subtelomeric, PARs comprise a unique chromosomal environment
that is rich in repetitive sequences (Bacolla et al., 2006; Gianfrancesco et al., 2001) and
GC-rich, making PARs and PAR genes potential targets for ATRX.
1.6.2
Telomeres
Telomeres are nucleoprotein structures that protect chromosome ends from degradation
upon DNA replication (the “end-replication problem”) and from unwanted double strand
break repair (the “end-protection problem”) (reviewed in (Stewart et al., 2012)). The free
ends of DNA are usually recognized by the cell as double stranded breaks which activate
DNA repair mechanisms. To avoid this process the six protein shelterin complex
specifically recognizes telomeres and acts as a protective cap on the ends of
chromosomes (de Lange, 2005). The end-replication problem exists because DNA
polymerase is unable to fully replicate the 5’ end of telomeres, meaning that after each
replication the telomere would get shorter. To alleviate this shortening the riboprotein
telomerase uses its RNA template to reverse transcribe new single-stranded DNA
consisting of “TTAGGG” repeats onto telomeres. DNA polymerase then fills in the
complementary strand. Telomeres therefore consist of many copies of short repeats, with
an overhanging G-rich strand (5’-TTAGGG-3’) and the complementary C-rich strand (5’CCCTAA-3’) (Gilson and Geli, 2007). The single-stranded G-rich strand is then able to
form G-quadruplexes.
Besides a role in chromosome end protection, it was discovered just a few years ago that
telomeres are not transcriptionally silent, as previously thought. Starting in the
subtelomere and proceeding through the telomeric repeats, the non-coding telomeric
repeat-containing RNA (TERRA) is transcribed, and these transcripts then associate with
the telomeres (Azzalin et al., 2007). The complete role of TERRA is uncertain, but
TERRA is able to alter telomere length by inhibiting telomerase (Schoeftner and Blasco,
2008). A role for ATRX at telomeres was identified when it was shown that deletion of
30
ATRX causes a moderate (~1.7 fold) increase in TERRA expression (Goldberg et al.,
2010).
Telomere-like repeats found outside telomeres are called interstitial telomere
repeats/sequences (ITS) (Azzalin et al., 1997; Meyne et al., 1990). ITS’s are often found
within subtelomeres, where they are likely the product of recombination events. They are
also found within pericentromeric heterochromatin, and at intrachromosomal locations
where they may be the product of chromosomal fusions or the remnants of ancient double
stranded break repair mechanisms that may have involved telomerase (Azzalin et al.,
2001; Flint et al., 1994; Ruiz-Herrera et al., 2008). While ITS’s are often associated with
fragile sites, it is unclear whether ITS’s themselves can lead to chromosome breaks, or
whether they have simply been inserted into already fragile sites during DNA repair
(Azzalin et al., 2001; Bolzan, 2012). Unlike traditional telomeres, intrachromosomal
ITS’s do not constitute constitutive heterochromatin, but similar to telomeres, there is
evidence that they may be at least moderately transcribed (Svetlova et al., 2007). In
addition, ITS’s share at least some of their bound protein partners with those normally
found at telomeres as part of the shelterin complex (Simonet et al., 2011; Yang et al.,
2011). Depletion of at least two of these proteins (RAP1 or TRF2) can lead to altered
transcription of genes proximal to RAP1- or TRF2-targeted ITS’s (Yang et al., 2011).
While the complete function of ITS’s is unclear, they may contribute to genome
instability, and appear to have the potential to affect the regulation of nearby genes.
1.6.3
G-quadruplexes
As described earlier, G-quadruplexes are short sequences containing four guanine
triplicates that form a four stranded secondary structure upon DNA denaturation such as
during replication or transcription ((Biffi et al., 2013; Duquette et al., 2004) and reviewed
in (Bochman et al., 2012)) (Figure 1-2). G-quadruplexes can therefore form a barrier to
processing ssDNA, requiring specific proteins to bypass them ((Belotserkovskii et al.,
2010) and reviewed in (Tornaletti, 2009)). If not properly bypassed, stalling of RNA
PolII during transcription, or of DNA polymerase during replication, triggers DNA repair
mechanisms which attempt to repair these lesions by nucleotide excision repair. This
superfluous DNA repair can introduce DNA damage and mutations (Vasquez and Wang,
31
2012). G-quadruplexes form throughout the genome in regions of high guanine
concentration but are particularly enriched at telomeres due to the telomeric “TTAGGG”
repeats. ATRX can bind directly to G-quadruplexes and is highly enriched at telomeres
(Law et al., 2010) and loss of ATRX causes telomere-specific DNA damage (Huh et al.,
2012; Watson et al., 2013; Wong et al., 2010). ATRX may therefore be involved in
processing or otherwise bypassing G-quadruplexes (Clynes and Gibbons, 2013).
1.7
Thesis overview
The overall aim of this work was to identify genes regulated by ATRX and determine a
mechanism by which this regulation could be achieved. At the beginning of this study,
genes that are directly regulated by the ATRX protein had not yet been identified, and
even in subsequent studies the focus has largely been on the regulation of individual
genes. To identify potential genes that are controlled by ATRX, we used microarrays to
perform wide-scale screens of expression changes in developing mouse brains with and
without ATRX. We found that a subset of ancestral PAR1 genes is consistently
downregulated in the absence of ATRX. Among them are two potentially novel mouse
orthologs of Arsd/e and Asmtl. Remarkably, murine PAR1 homologs have translocated
to various autosomes, reflecting the complex recombination history during the evolution
of the mammalian X chromosome. Despite the common ancestral location of these
genes, we found that ATRX does not influence their expression in cells from species in
which these genes remain in the PAR. Therefore, we proposed that the aPAR genes
misregulated in mice share conserved sequences and/or chromatin features targeted by
ATRX, which are nevertheless unique to their autosomal location in mice (Levy et al.,
2008).
Having identified a unique class of genes regulated by ATRX, we next sought to
determine a possible mechanism by which they could be co-regulated. A direct
mechanism for the regulation of gene transcription by ATRX had not yet been described
and could be relevant to the function of ATRX in the central nervous system and for its
tumor suppressive activities. Here we report that ATRX and the histone variant H3.3 are
enriched at G-rich regions within the gene bodies of Dhrsx and other aPAR genes in the
mouse brain. Loss of ATRX causes decreased H3.3 occupancy within the gene body,
32
without affecting TERRA levels, histone modifications or DNA methylation.
Importantly we provide evidence that in the absence of ATRX, RNA polymerase II
progression is impeded at the G-rich region of Dhrsx. We propose a model whereby
ATRX facilitates transcription elongation of particular target genes by assisting the
passage of the transcription machinery through G-rich templates (Levy et al., Nucleic
Acid Research, in revision). Taken together, the findings presented here identify a novel
function for ATRX in the regulation of aPAR genes, and provide insight into how defects
in ATRX could lead to problems in development and disease.
33
1.8
References
Aapola, U., Kawasaki, K., Scott, H.S., Ollila, J., Vihinen, M., Heino, M., Shintani, A.,
Kawasaki, K., Minoshima, S., Krohn, K., et al. (2000). Isolation and initial
characterization of a novel zinc finger gene, DNMT3L, on 21q22.3, related to the
cytosine-5-methyltransferase 3 gene family. Genomics 65, 293-298.
Aasland, R., Gibson, T.J., and Stewart, A.F. (1995). The PHD finger: implications for
chromatin-mediated transcriptional regulation. Trends in biochemical sciences 20, 56-59.
Abidi, F., Schwartz, C.E., Carpenter, N.J., Villard, L., Fontes, M., and Curtis, M. (1999).
Carpenter-Waziri syndrome results from a mutation in XNP. American journal of
medical genetics 85, 249-251.
Abidi, F.E., Cardoso, C., Lossi, A.M., Lowry, R.B., Depetris, D., Mattei, M.G., Lubs,
H.A., Stevenson, R.E., Fontes, M., Chudley, A.E., et al. (2005). Mutation in the 5'
alternatively spliced region of the XNP/ATR-X gene causes Chudley-Lowry syndrome.
Eur J Hum Genet 13, 176-183.
Ahmad, K., and Henikoff, S. (2002). The histone variant H3.3 marks active chromatin by
replication-independent nucleosome assembly. Mol Cell 9, 1191-1200.
Argentaro, A., Yang, J.C., Chapman, L., Kowalczyk, M.S., Gibbons, R.J., Higgs, D.R.,
Neuhaus, D., and Rhodes, D. (2007). Structural consequences of disease-causing
mutations in the ATRX-DNMT3-DNMT3L (ADD) domain of the chromatin-associated
protein ATRX. Proceedings of the National Academy of Sciences of the United States of
America 104, 11939-11944.
Avvakumov, N., Nourani, A., and Cote, J. (2011). Histone chaperones: modulators of
chromatin marks. Mol Cell 41, 502-514.
Azzalin, C.M., Mucciolo, E., Bertoni, L., and Giulotto, E. (1997). Fluorescence in situ
hybridization with a synthetic (T2AG3)n polynucleotide detects several
intrachromosomal telomere-like repeats on human chromosomes. Cytogenet Cell Genet
78, 112-115.
Azzalin, C.M., Nergadze, S.G., and Giulotto, E. (2001). Human intrachromosomal
telomeric-like repeats: sequence organization and mechanisms of origin. Chromosoma
110, 75-82.
Azzalin, C.M., Reichenbach, P., Khoriauli, L., Giulotto, E., and Lingner, J. (2007).
Telomeric Repeat Containing RNA and RNA Surveillance Factors at Mammalian
Chromosome Ends. Science 318, 798-801.
Bachman, K.E., Rountree, M.R., and Baylin, S.B. (2001). Dnmt3a and Dnmt3b are
transcriptional repressors that exhibit unique localization properties to heterochromatin.
The Journal of biological chemistry 276, 32282-32287.
34
Bacolla, A., Collins, J.R., Gold, B., Chuzhanova, N., Yi, M., Stephens, R.M., Stefanov,
S., Olsh, A., Jakupciak, J.P., Dean, M., et al. (2006). Long homopurine*homopyrimidine
sequences are characteristic of genes expressed in brain and the pseudoautosomal region.
Nucleic Acid Res 34, 2663-2675.
Badens, C., Lacoste, C., Philip, N., Martini, N., Courrier, S., Giuliano, F., Verloes, A.,
Munnich, A., Leheup, B., Burglen, L., et al. (2006a). Mutations in PHD-like domain of
the ATRX gene correlate with severe psychomotor impairment and severe urogenital
abnormalities in patients with ATRX syndrome. Clinical genetics 70, 57-62.
Badens, C., Martini, N., Courrier, S., Desportes, V., Touraine, R., Levy, N., and Edery, P.
(2006b). ATRX syndrome in a girl with a heterozygous mutation in the ATRX Zn finger
domain and a totally skewed X-inactivation pattern. American journal of medical
genetics Part A 140, 2212-2215.
Bagheri-Fam, S., Argentaro, A., Svingen, T., Combes, A.N., Sinclair, A.H., Koopman,
P., and Harley, V.R. (2011). Defective survival of proliferating Sertoli cells and androgen
receptor function in a mouse model of the ATR-X syndrome. Human molecular genetics
20, 2213-2224.
Bassett, A.R., Cooper, S.E., Ragab, A., and Travers, A.A. (2008). The chromatin
remodelling factor dATRX is involved in heterochromatin formation. PLoS ONE 3,
e2099.
Baumann, C., and De La Fuente, R. (2008). ATRX marks the inactive X chromosome
(Xi) in somatic cells and during imprinted X chromosome inactivation in trophoblast
stem cells. Chromosoma.
Baumann, C., Schmidtmann, A., Muegge, K., and De La Fuente, R. (2008). Association
of ATRX with pericentric heterochromatin and the Y chromosome of neonatal mouse
spermatogonia. BMC molecular biology 9, 29.
Baumann, C., Viveiros, M.M., and De La Fuente, R. (2010). Loss of maternal ATRX
results in centromere instability and aneuploidy in the mammalian oocyte and preimplantation embryo. PLoS genetics 6.
Belotserkovskii, B.P., Liu, R., Tornaletti, S., Krasilnikova, M.M., Mirkin, S.M., and
Hanawalt, P.C. (2010). Mechanisms and implications of transcription blockage by
guanine-rich DNA sequences. Proceedings of the National Academy of Sciences of the
United States of America 107, 12816-12821.
Berube, N.G., Healy, J., Medina, C.F., Wu, S., Hodgson, T., Jagla, M., and Picketts, D.J.
(2007). Patient mutations alter ATRX targeting to PML nuclear bodies. Eur J Hum
Genet.
Bérubé, N.G., Jagla, M., Smeenk, C., De Repentigny, Y., Kothary, R., and Picketts, D.J.
(2002). Neurodevelopmental defects resulting from ATRX overexpression in transgenic
mice. Human molecular genetics 11, 253-261.
35
Bérubé, N.G., Mangelsdorf, M., Jagla, M., Vanderluit, J., Garrick, D., Gibbons, R.J.,
Higgs, D.R., Slack, R.S., and Picketts, D.J. (2005). The chromatin-remodeling protein
ATRX is critical for neuronal survival during corticogenesis. The Journal of clinical
investigation 115, 258-267.
Bérubé, N.G., Smeenk, C.A., and Picketts, D.J. (2000). Cell cycle-dependent
phosphorylation of the ATRX protein correlates with changes in nuclear matrix and
chromatin association. Human molecular genetics 9, 539-547.
Biffi, G., Tannahill, D., McCafferty, J., and Balasubramanian, S. (2013). Quantitative
visualization of DNA G-quadruplex structures in human cells. Nature chemistry 5, 182186.
Bixel, G., Kloep, S., Butz, S., Petri, B., Engelhardt, B., and Vestweber, D. (2004). Mouse
CD99 participates in T-cell recruitment into inflamed skin. Blood 104, 3205-3213.
Bochman, M.L., Paeschke, K., and Zakian, V.A. (2012). DNA secondary structures:
stability and function of G-quadruplex structures. Nature reviews 13, 770-780.
Bolzan, A.D. (2012). Chromosomal aberrations involving telomeres and interstitial
telomeric sequences. Mutagenesis 27, 1-15.
Bondarenko, V.A., Steele, L.M., Ujvari, A., Gaykalova, D.A., Kulaeva, O.I., Polikanov,
Y.S., Luse, D.S., and Studitsky, V.M. (2006). Nucleosomes can form a polar barrier to
transcript elongation by RNA polymerase II. Mol Cell 24, 469-479.
Bortvin, A., and Winston, F. (1996). Evidence that Spt6p controls chromatin structure by
a direct interaction with histones. Science 272, 1473-1476.
Bower, K., Napier, C.E., Cole, S.L., Dagg, R.A., Lau, L.M., Duncan, E.L., Moy, E.L.,
and Reddel, R.R. (2012). Loss of wild-type ATRX expression in somatic cell hybrids
segregates with activation of Alternative Lengthening of Telomeres. PLoS ONE 7,
e50062.
Brower-Toland, B., Wacker, D.A., Fulbright, R.M., Lis, J.T., Kraus, W.L., and Wang,
M.D. (2005). Specific contributions of histone tails and their acetylation to the
mechanical stability of nucleosomes. J Mol Biol 346, 135-146.
Buratowski, S. (2009). Progression through the RNA polymerase II CTD cycle. Mol Cell
36, 541-546.
Canzio, D., Chang, E.Y., Shankar, S., Kuchenbecker, K.M., Simon, M.D., Madhani,
H.D., Narlikar, G.J., and Al-Sady, B. (2011). Chromodomain-mediated oligomerization
of HP1 suggests a nucleosome-bridging mechanism for heterochromatin assembly. Mol
Cell 41, 67-81.
Cardoso, C., Lutz, Y., Mignon, C., Compe, E., Depetris, D., Mattei, M.G., Fontes, M.,
and Colleaux, L. (2000). ATR-X mutations cause impaired nuclear location and altered
36
DNA binding properties of the XNP/ATR-X protein. Journal of medical genetics 37, 746751.
Cardoso, C., Timsit, S., Villard, L., Khrestchatisky, M., Fontes, M., and Colleaux, L.
(1998). Specific interaction between the XNP/ATR-X gene product and the SET domain
of the human EZH2 protein. Human molecular genetics 7, 679-684.
Carrel, L., and Willard, H.F. (2005). X-inactivation profile reveals extensive variability in
X-linked gene expression in females. Nature 434, 400-404.
Cesare, A.J., and Reddel, R.R. (2010). Alternative lengthening of telomeres: models,
mechanisms and implications. Nature reviews 11, 319-330.
Chang, F.T., McGhie, J.D., Chan, F.L., Tang, M.C., Anderson, M.A., Mann, J.R., Andy
Choo, K.H., and Wong, L.H. (2013). PML bodies provide an important platform for the
maintenance of telomeric chromatin integrity in embryonic stem cells. Nucleic acids
research.
Cheung Nv, Z.J.L.C., and et al. (2012). Association of age at diagnosis and genetic
mutations in patients with neuroblastoma. JAMA: The Journal of the American Medical
Association 307, 1062-1071.
Chui, D.H., Fucharoen, S., and Chan, V. (2003). Hemoglobin H disease: not necessarily a
benign disorder. Blood 101, 791-800.
Chung, I., Osterwald, S., Deeg, K.I., and Rippe, K. (2012). PML body meets telomere:
the beginning of an ALTernate ending? Nucleus 3, 263-275.
Clapier, C.R., and Cairns, B.R. (2009). The biology of chromatin remodeling complexes.
Annual review of biochemistry 78, 273-304.
Clynes, D., and Gibbons, R.J. (2013). ATRX and the replication of structured DNA. Curr
Opin Genet Dev.
Cole, T.R., May, A., and Hughes, H.E. (1991). Alpha thalassaemia/mental retardation
syndrome (non-deletional type): report of a family supporting X linked inheritance.
Journal of medical genetics 28, 734-737.
Cote, J., Peterson, C.L., and Workman, J.L. (1998). Perturbation of nucleosome core
structure by the SWI/SNF complex persists after its detachment, enhancing subsequent
transcription factor binding. Proceedings of the National Academy of Sciences of the
United States of America 95, 4947-4952.
Cote, J., Quinn, J., Workman, J.L., and Peterson, C.L. (1994). Stimulation of GAL4
derivative binding to nucleosomal DNA by the yeast SWI/SNF complex. Science 265,
53-60.
37
Crabbe, L., Verdun, R.E., Haggblom, C.I., and Karlseder, J. (2004). Defective telomere
lagging strand synthesis in cells lacking WRN helicase activity. Science 306, 1951-1953.
Das, P.J., Chowdhary, B.P., and Raudsepp, T. (2009). Characterization of the bovine
pseudoautosomal region and comparison with sheep, goat, and other mammalian
pseudoautosomal regions. Cytogenet Genome Res 126, 139-147.
De La Fuente, R., Viveiros, M.M., Wigglesworth, K., and Eppig, J.J. (2004). ATRX, a
member of the SNF2 family of helicase/ATPases, is required for chromosome alignment
and meiotic spindle organization in metaphase II stage mouse oocytes. Developmental
biology 272, 1-14.
de Lange, T. (2005). Shelterin: the protein complex that shapes and safeguards human
telomeres. Genes & development 19, 2100-2110.
de Wilde, R.F., Heaphy, C.M., Maitra, A., Meeker, A.K., Edil, B.H., Wolfgang, C.L.,
Ellison, T.A., Schulick, R.D., Molenaar, I.Q., Valk, G.D., et al. (2012). Loss of ATRX or
DAXX expression and concomitant acquisition of the alternative lengthening of
telomeres phenotype are late events in a small subset of MEN-1 syndrome pancreatic
neuroendocrine tumors. Mod Pathol 25, 1033-1039.
Deaton, A.M., and Bird, A. (2011). CpG islands and the regulation of transcription.
Genes & development 25, 1010-1022.
Delbarre, E., Ivanauskiene, K., Kuntziger, T., and Collas, P. (2012). DAXX-dependent
supply of soluble (H3.3-H4) dimers into PML bodies pending deposition into chromatin.
Genome research.
Dhayalan, A., Tamas, R., Bock, I., Tattermusch, A., Dimitrova, E., Kudithipudi, S.,
Ragozin, S., and Jeltsch, A. (2011). The ATRX-ADD domain binds to H3 tail peptides
and reads the combined methylation state of K4 and K9. Human molecular genetics 20,
2195-2203.
Disteche, C.M., Brannan, C.I., Larsen, A., Adler, D.A., Schorderet, D.F., Gearing, D.,
Copeland, N.G., Jenkins, N.A., and Park, L.S. (1992). The human pseudoautosomal GMCSF receptor alpha subunit gene is autosomal in mouse. Nature genetics 1, 333-336.
Donnai, D., Clayton-Smith, J., Gibbons, R.J., and Higgs, D.R. (1991). The non-deletion
alpha thalassaemia/mental retardation syndrome: further support for X linkage. Journal of
medical genetics 28, 742-745.
Drane, P., Ouararhni, K., Depaux, A., Shuaib, M., and Hamiche, A. (2010). The deathassociated protein DAXX is a novel histone chaperone involved in the replicationindependent deposition of H3.3. Genes & development 24, 1253-1265.
Draskovic, I., Arnoult, N., Steiner, V., Bacchetti, S., Lomonte, P., and Londono-Vallejo,
A. (2009). Probing PML body function in ALT cells reveals spatiotemporal requirements
38
for telomere recombination. Proceedings of the National Academy of Sciences of the
United States of America 106, 15726-15731.
Duina, A.A. (2011). Histone Chaperones Spt6 and FACT: Similarities and Differences in
Modes of Action at Transcribed Genes. Genetics research international 2011, 625210.
Dundr, M. (2012). Nuclear bodies: multifunctional companions of the genome. Current
opinion in cell biology 24, 415-422.
Duquette, M.L., Handa, P., Vincent, J.A., Taylor, A.F., and Maizels, N. (2004).
Intracellular transcription of G-rich DNAs induces formation of G-loops, novel structures
containing G4 DNA. Genes & development 18, 1618-1629.
Elsaesser, S.J., Goldberg, A.D., and Allis, C.D. (2010). New functions for an old variant:
no substitute for histone H3.3. Curr Opin Genet Dev 20, 110-117.
Emelyanov, A.V., Konev, A.Y., Vershilova, E., and Fyodorov, D.V. (2010). Protein
complex of Drosophila ATRX/XNP and HP1a is required for the formation of pericentric
beta-heterochromatin in vivo. The Journal of biological chemistry 285, 15027-15037.
Euskirchen, G., Auerbach, R.K., and Snyder, M. (2012). SWI/SNF chromatin-remodeling
factors: multiscale analyses and diverse functions. The Journal of biological chemistry
287, 30897-30905.
Eustermann, S., Yang, J.C., Law, M.J., Amos, R., Chapman, L.M., Jelinska, C., Garrick,
D., Clynes, D., Gibbons, R.J., Rhodes, D., et al. (2011). Combinatorial readout of histone
H3 modifications specifies localization of ATRX to heterochromatin. Nat Struct Mol Biol
18, 777-782.
Everett, R.D., Earnshaw, W.C., Pluta, A.F., Sternsdorf, T., Ainsztein, A.M., Carmena,
M., Ruchaud, S., Hsu, W.L., and Orr, A. (1999). A dynamic connection between
centromeres and ND10 proteins. Journal of cell science 112 ( Pt 20), 3443-3454.
Fischle, W., Wang, Y., Jacobs, S.A., Kim, Y., Allis, C.D., and Khorasanizadeh, S.
(2003). Molecular basis for the discrimination of repressive methyl-lysine marks in
histone H3 by Polycomb and HP1 chromodomains. Genes & development 17, 18701881.
Flint, J., Craddock, C.F., Villegas, A., Bentley, D.P., Williams, H.J., Galanello, R., Cao,
A., Wood, W.G., Ayyub, H., and Higgs, D.R. (1994). Healing of broken human
chromosomes by the addition of telomeric repeats. American journal of human genetics
55, 505-512.
Garrick, D., Samara, V., McDowell, T.L., Smith, A.J., Dobbie, L., Higgs, D.R., and
Gibbons, R.J. (2004). A conserved truncated isoform of the ATR-X syndrome protein
lacking the SWI/SNF-homology domain. Gene 326, 23-34.
39
Garrick, D., Sharpe, J.A., Arkell, R., Dobbie, L., Smith, A.J., Wood, W.G., Higgs, D.R.,
and Gibbons, R.J. (2006). Loss of Atrx affects trophoblast development and the pattern of
X-inactivation in extraembryonic tissues. PLoS genetics 2, e58.
Gecz, J., Pollard, H., Consalez, G., Villard, L., Stayton, C., Millasseau, P.,
Khrestchatisky, M., and Fontes, M. (1994). Cloning and expression of the murine
homologue of a putative human X-linked nuclear protein gene closely linked to PGK1 in
Xq13.3. Human molecular genetics 3, 39-44.
Gianfrancesco, F., Sanges, R., Esposito, T., Tempesta, S., Rao, E., Rappold, G.,
Archidiacono, N., Graves, J.A.M., Forabosco, A., and D'Urso, M. (2001). Differential
Divergence of Three Human Pseudoautosomal Genes and Their Mouse Homologs:
Implications for Sex Chromosome Evolution. Genome Res 11, 2095-2100.
Gibbons, R. (2006). Alpha thalassaemia-mental retardation, X linked. Orphanet journal
of rare diseases 1, 15.
Gibbons, R.J., Bachoo, S., Picketts, D.J., Aftimos, S., Asenbauer, B., Bergoffen, J.,
Berry, S.A., Dahl, N., Fryer, A., Keppler, K., et al. (1997). Mutations in transcriptional
regulator ATRX establish the functional significance of a PHD-like domain. Nature
genetics 17, 146-148.
Gibbons, R.J., and Higgs, D.R. (2000). Molecular-clinical spectrum of the ATR-X
syndrome. American journal of medical genetics 97, 204-212.
Gibbons, R.J., McDowell, T.L., Raman, S., O'Rourke, D.M., Garrick, D., Ayyub, H., and
Higgs, D.R. (2000). Mutations in ATRX, encoding a SWI/SNF-like protein, cause
diverse changes in the pattern of DNA methylation. Nature genetics 24, 368-371.
Gibbons, R.J., Pellagatti, A., Garrick, D., Wood, W.G., Malik, N., Ayyub, H., Langford,
C., Boultwood, J., Wainscoat, J.S., and Higgs, D.R. (2003). Identification of acquired
somatic mutations in the gene encoding chromatin-remodeling factor ATRX in the alphathalassemia myelodysplasia syndrome (ATMDS). Nature genetics 34, 446-449.
Gibbons, R.J., Picketts, D.J., Villard, L., and Higgs, D.R. (1995). Mutations in a putative
global transcriptional regulator cause X-linked mental retardation with alpha-thalassemia
(ATR-X syndrome). Cell 80, 837-845.
Gibbons, R.J., Suthers, G.K., Wilkie, A.O., Buckle, V.J., and Higgs, D.R. (1992). Xlinked alpha-thalassemia/mental retardation (ATR-X) syndrome: localization to Xq12q21.31 by X inactivation and linkage analysis. American journal of human genetics 51,
1136-1149.
Gibbons, R.J., Wada, T., Fisher, C.A., Malik, N., Mitson, M.J., Steensma, D.P., Fryer, A.,
Goudie, D.R., Krantz, I.D., and Traeger-Synodinos, J. (2008). Mutations in the
chromatin-associated protein ATRX. Human mutation.
40
Gilson, E., and Geli, V. (2007). How telomeres are replicated. Nature reviews Molecular
cell biology 8, 825-838.
Goldberg, A.D., Banaszynski, L.A., Noh, K.M., Lewis, P.W., Elsaesser, S.J., Stadler, S.,
Dewell, S., Law, M., Guo, X., Li, X., et al. (2010). Distinct Factors Control Histone
Variant H3.3 Localization at Specific Genomic Regions. Cell 140, 678-691.
Graves, J.A.M., Wakefield, M.J., and Toder, R. (1998). The origin and evolution of the
pseudoautosomal regions of human sex chromosomes. Hum Mol Genet 7, 1991-1996.
Guerrini, R., Shanahan, J.L., Carrozzo, R., Bonanni, P., Higgs, D.R., and Gibbons, R.J.
(2000). A nonsense mutation of the ATRX gene causing mild mental retardation and
epilepsy. Annals of neurology 47, 117-121.
Hake, S.B., Garcia, B.A., Kauer, M., Baker, S.P., Shabanowitz, J., Hunt, D.F., and Allis,
C.D. (2005). Serine 31 phosphorylation of histone variant H3.3 is specific to regions
bordering centromeres in metaphase chromosomes. Proceedings of the National
Academy of Sciences of the United States of America 102, 6344-6349.
Hansen, J.C., Ghosh, R.P., and Woodcock, C.L. (2010). Binding of the Rett syndrome
protein, MeCP2, to methylated and unmethylated DNA and chromatin. IUBMB life 62,
732-738.
Harvey, M.P., Kearney, A., Smith, A., and Trent, R.J. (1990). Occurrence of the alpha
thalassaemia-mental retardation syndrome (non-deletional type) in an Australian male.
Journal of medical genetics 27, 577-581.
Heaphy, C.M., de Wilde, R.F., Jiao, Y., Klein, A.P., Edil, B.H., Shi, C., Bettegowda, C.,
Rodriguez, F.J., Eberhart, C.G., Hebbar, S., et al. (2011). Altered telomeres in tumors
with ATRX and DAXX mutations. Science 333, 425.
Helena Mangs, A., and Morris, B.J. (2007). The Human Pseudoautosomal Region (PAR):
Origin, Function and Future. Current genomics 8, 129-136.
Henikoff, S., and Ahmad, K. (2005). Assembly of variant histones into chromatin.
Annual review of cell and developmental biology 21, 133-153.
Howard, M.T., Malik, N., Anderson, C.B., Voskuil, J.L., Atkins, J.F., and Gibbons, R.J.
(2004). Attenuation of an amino-terminal premature stop codon mutation in the ATRX
gene by an alternative mode of translational initiation. Journal of medical genetics 41,
951-956.
Huh, M.S., Price O'Dea, T., Ouazia, D., McKay, B.C., Parise, G., Parks, R.J., Rudnicki,
M.A., and Picketts, D.J. (2012). Compromised genomic integrity impedes muscle growth
after Atrx inactivation. The Journal of clinical investigation 122, 4412-4423.
Huyhn, K., Renfree, M.B., Graves, J.A., and Pask, A.J. (2011). ATRX has a critical and
conserved role in mammalian sexual differentiation. BMC Dev Biol 11, 39.
41
Ishov, A.M., Sotnikov, A.G., Negorev, D., Vladimirova, O.V., Neff, N., Kamitani, T.,
Yeh, E.T., Strauss, J.F., 3rd, and Maul, G.G. (1999). PML is critical for ND10 formation
and recruits the PML-interacting protein daxx to this nuclear structure when modified by
SUMO-1. The Journal of cell biology 147, 221-234.
Ishov, A.M., Vladimirova, O.V., and Maul, G.G. (2004). Heterochromatin and ND10 are
cell-cycle regulated and phosphorylation-dependent alternate nuclear sites of the
transcription repressor Daxx and SWI/SNF protein ATRX. Journal of cell science 117,
3807-3820.
Ivanovska, I., Jacques, P.E., Rando, O.J., Robert, F., and Winston, F. (2011). Control of
chromatin structure by spt6: different consequences in coding and regulatory regions.
Mol Cell Biol 31, 531-541.
Iwase, M., Satta, Y., Hirai, Y., Hirai, H., Imai, H., and Takahata, N. (2003). The
amelogenin loci span an ancient pseudoautosomal boundary in diverse mammalian
species. Proceedings of the National Academy of Sciences of the United States of
America 100, 5258-5263.
Iwase, S., Xiang, B., Ghosh, S., Ren, T., Lewis, P.W., Cochrane, J.C., Allis, C.D.,
Picketts, D.J., Patel, D.J., Li, H., et al. (2011). ATRX ADD domain links an atypical
histone methylation recognition mechanism to human mental-retardation syndrome. Nat
Struct Mol Biol 18, 769-776.
Je, E.M., An, C.H., Yoo, N.J., and Lee, S.H. (2012). Expressional and mutational
analysis of ATRX gene in gastric, colorectal and prostate cancers. APMIS : acta
pathologica, microbiologica, et immunologica Scandinavica 120, 519-520.
Jiang, W.Q., Zhong, Z.H., Henson, J.D., Neumann, A.A., Chang, A.C., and Reddel, R.R.
(2005). Suppression of alternative lengthening of telomeres by Sp100-mediated
sequestration of the MRE11/RAD50/NBS1 complex. Mol Cell Biol 25, 2708-2721.
Jiao, Y., Killela, P.J., Reitman, Z.J., Rasheed, A.B., Heaphy, C.M., de Wilde, R.F.,
Rodriguez, F.J., Rosemberg, S., Oba-Shinjo, S.M., Marie, S.K., et al. (2012). Frequent
ATRX, CIC, and FUBP1 mutations refine the classification of malignant gliomas.
Oncotarget.
Jiao, Y., Shi, C., Edil, B.H., de Wilde, R.F., Klimstra, D.S., Maitra, A., Schulick, R.D.,
Tang, L.H., Wolfgang, C.L., Choti, M.A., et al. (2011). DAXX/ATRX, MEN1, and
mTOR pathway genes are frequently altered in pancreatic neuroendocrine tumors.
Science 331, 1199-1203.
Jin, C., and Felsenfeld, G. (2007). Nucleosome stability mediated by histone variants
H3.3 and H2A.Z. Genes & development 21, 1519-1529.
Jones, P.L., Veenstra, G.J., Wade, P.A., Vermaak, D., Kass, S.U., Landsberger, N.,
Strouboulis, J., and Wolffe, A.P. (1998). Methylated DNA and MeCP2 recruit histone
deacetylase to repress transcription. Nature genetics 19, 187-191.
42
Kannan, K., Inagaki, A., Silber, J., Gorovets, D., Zhang, J., Kastenhuber, E.R., Heguy,
A., Petrini, J.H., Chan, T.A., and Huse, J.T. (2012). Whole-exome sequencing identifies
ATRX mutation as a key molecular determinant in lower-grade glioma. Oncotarget 3,
1194-1203.
Katsura, Y., Iwase, M., and Satta, Y. (2012). Evolution of genomic structures on
Mammalian sex chromosomes. Current genomics 13, 115-123.
Kernohan, K.D., Jiang, Y., Tremblay, D.C., Bonvissuto, A.C., Eubanks, J.H., Mann,
M.R., and Berube, N.G. (2010). ATRX partners with cohesin and MeCP2 and contributes
to developmental silencing of imprinted genes in the brain. Dev Cell 18, 191-202.
Khuong-Quang, D.A., Buczkowicz, P., Rakopoulos, P., Liu, X.Y., Fontebasso, A.M.,
Bouffet, E., Bartels, U., Albrecht, S., Schwartzentruber, J., Letourneau, L., et al. (2012).
K27M mutation in histone H3.3 defines clinically and biologically distinct subgroups of
pediatric diffuse intrinsic pontine gliomas. Acta neuropathologica 124, 439-447.
Klose, R.J., and Bird, A.P. (2006). Genomic DNA methylation: the mark and its
mediators. Trends in biochemical sciences 31, 89-97.
Knezetic, J.A., and Luse, D.S. (1986). The presence of nucleosomes on a DNA template
prevents initiation by RNA polymerase II in vitro. Cell 45, 95-104.
Komarnitsky, P., Cho, E.J., and Buratowski, S. (2000). Different phosphorylated forms of
RNA polymerase II and associated mRNA processing factors during transcription. Genes
& development 14, 2452-2460.
Kourmouli, N., Sun, Y.M., van der Sar, S., Singh, P.B., and Brown, J.P. (2005).
Epigenetic regulation of mammalian pericentric heterochromatin in vivo by HP1.
Biochemical and biophysical research communications 337, 901-907.
Kwon, S.H., and Workman, J.L. (2011). The changing faces of HP1: From
heterochromatin formation and gene silencing to euchromatic gene expression: HP1 acts
as a positive regulator of transcription. Bioessays 33, 280-289.
Lachner, M., O'Carroll, D., Rea, S., Mechtler, K., and Jenuwein, T. (2001). Methylation
of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature 410, 116-120.
Lallemand-Breitenbach, V., and de The, H. (2010). PML nuclear bodies. Cold Spring
Harbor perspectives in biology 2, a000661.
Lang, M., Jegou, T., Chung, I., Richter, K., Munch, S., Udvarhelyi, A., Cremer, C.,
Hemmerich, P., Engelhardt, J., Hell, S.W., et al. (2010). Three-dimensional organization
of promyelocytic leukemia nuclear bodies. Journal of cell science 123, 392-400.
Laud, P.R., Multani, A.S., Bailey, S.M., Wu, L., Ma, J., Kingsley, C., Lebel, M., Pathak,
S., DePinho, R.A., and Chang, S. (2005). Elevated telomere-telomere recombination in
43
WRN-deficient, telomere dysfunctional cells promotes escape from senescence and
engagement of the ALT pathway. Genes & development 19, 2560-2570.
Law, M.J., Lower, K.M., Voon, H.P., Hughes, J.R., Garrick, D., Viprakasit, V., Mitson,
M., De Gobbi, M., Marra, M., Morris, A., et al. (2010). ATR-X syndrome protein targets
tandem repeats and influences allele-specific expression in a size-dependent manner. Cell
143, 367-378.
Le Douarin, B., Nielsen, A.L., Garnier, J.M., Ichinose, H., Jeanmougin, F., Losson, R.,
and Chambon, P. (1996). A possible involvement of TIF1 alpha and TIF1 beta in the
epigenetic control of transcription by nuclear receptors. The EMBO journal 15, 67016715.
Lee, J., Hong, Y.K., Jeon, G.S., Hwang, Y.J., Kim, K.Y., Seong, K.H., Jung, M.K.,
Picketts, D.J., Kowall, N.W., Cho, K.S., et al. (2012). ATRX induction by mutant
huntingtin via Cdx2 modulates heterochromatin condensation and pathology in
Huntington's disease. Cell death and differentiation 19, 1109-1116.
Levy, M.A., Fernandes, A.D., Tremblay, D.C., Seah, C., and Berube, N.G. (2008). The
SWI/SNF protein ATRX co-regulates pseudoautosomal genes that have translocated to
autosomes in the mouse genome. BMC genomics 9, 468.
Lewis, P.W., Elsaesser, S.J., Noh, K.M., Stadler, S.C., and Allis, C.D. (2010). Daxx is an
H3.3-specific histone chaperone and cooperates with ATRX in replication-independent
chromatin assembly at telomeres. Proceedings of the National Academy of Sciences of
the United States of America 107, 14075-14080.
Lien, S., Szyda, J., Schechinger, B., Rappold, G., and Arnheim, N. (2000). Evidence for
heterogeneity in recombination in the human pseudoautosomal region: high resolution
analysis by sperm typing and radiation-hybrid mapping. American journal of human
genetics 66, 557-566.
Lipps, H.J., and Rhodes, D. (2009). G-quadruplex structures: in vivo evidence and
function. Trends in cell biology 19, 414-422.
Liu, N., Balliano, A., and Hayes, J.J. (2011). Mechanism(s) of SWI/SNF-induced
nucleosome mobilization. Chembiochem : a European journal of chemical biology 12,
196-204.
Liu, X.Y., Gerges, N., Korshunov, A., Sabha, N., Khuong-Quang, D.A., Fontebasso,
A.M., Fleming, A., Hadjadj, D., Schwartzentruber, J., Majewski, J., et al. (2012).
Frequent ATRX mutations and loss of expression in adult diffuse astrocytic tumors
carrying IDH1/IDH2 and TP53 mutations. Acta neuropathologica.
Lopes, J., Piazza, A., Bermejo, R., Kriegsman, B., Colosio, A., Teulade-Fichou, M.P.,
Foiani, M., and Nicolas, A. (2011). G-quadruplex-induced instability during leadingstrand replication. The EMBO journal 30, 4033-4046.
44
Lorincz, M.C., Dickerson, D.R., Schmitt, M., and Groudine, M. (2004). Intragenic DNA
methylation alters chromatin structure and elongation efficiency in mammalian cells. Nat
Struct Mol Biol 11, 1068-1075.
Lovejoy, C.A., Li, W., Reisenweber, S., Thongthip, S., Bruno, J., de Lange, T., De, S.,
Petrini, J.H., Sung, P.A., Jasin, M., et al. (2012). Loss of ATRX, Genome Instability, and
an Altered DNA Damage Response Are Hallmarks of the Alternative Lengthening of
Telomeres Pathway. PLoS genetics 8, e1002772.
Luciani, J.J., Depetris, D., Usson, Y., Metzler-Guillemain, C., Mignon-Ravix, C.,
Mitchell, M.J., Megarbane, A., Sarda, P., Sirma, H., Moncla, A., et al. (2006). PML
nuclear bodies are highly organised DNA-protein structures with a function in
heterochromatin remodelling at the G2 phase. Journal of cell science 119, 2518-2531.
Luger, K., Mader, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. (1997).
Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251260.
Lukashchuk, V., and Everett, R.D. (2010). Regulation of ICP0 null mutant HSV-1
infection by ND10 components ATRX and hDaxx. Journal of virology.
Lyon, M.F. (1989). X-chromosome inactivation as a system of gene dosage
compensation to regulate gene expression. Progress in nucleic acid research and
molecular biology 36, 119-130.
McDowell, T.L., Gibbons, R.J., Sutherland, H., O'Rourke, D.M., Bickmore, W.A.,
Pombo, A., Turley, H., Gatter, K., Picketts, D.J., Buckle, V.J., et al. (1999). Localization
of a putative transcriptional regulator (ATRX) at pericentromeric heterochromatin and
the short arms of acrocentric chromosomes. Proceedings of the National Academy of
Sciences of the United States of America 96, 13983-13988.
McKittrick, E., Gafken, P.R., Ahmad, K., and Henikoff, S. (2004). Histone H3.3 is
enriched in covalent modifications associated with active chromatin. Proceedings of the
National Academy of Sciences of the United States of America 101, 1525-1530.
Medina, C.F., Mazerolle, C., Wang, Y., Berube, N.G., Coupland, S., Gibbons, R.J.,
Wallace, V.A., and Picketts, D.J. (2008). Altered visual function and interneuron survival
in Atrx knockout mice: Inference for the human syndrome. Human molecular genetics.
Meyne, J., Baker, R.J., Hobart, H.H., Hsu, T.C., Ryder, O.A., Ward, O.G., Wiley, J.E.,
Wurster-Hill, D.H., Yates, T.L., and Moyzis, R.K. (1990). Distribution of non-telomeric
sites of the (TTAGGG)n telomeric sequence in vertebrate chromosomes. Chromosoma
99, 3-10.
Mitson, M., Kelley, L.A., Sternberg, M.J., Higgs, D.R., and Gibbons, R.J. (2011).
Functional significance of mutations in the Snf2 domain of ATRX. Human molecular
genetics 20, 2603-2610.
45
Molenaar, J.J., Koster, J., Zwijnenburg, D.A., van Sluis, P., Valentijn, L.J., van der Ploeg,
I., Hamdi, M., van Nes, J., Westerman, B.A., van Arkel, J., et al. (2012). Sequencing of
neuroblastoma identifies chromothripsis and defects in neuritogenesis genes. Nature 483,
589-593.
Muers, M.R., Sharpe, J.A., Garrick, D., Sloane-Stanley, J., Nolan, P.M., Hacker, T.,
Wood, W.G., Higgs, D.R., and Gibbons, R.J. (2007). Defining the cause of skewed xchromosome inactivation in x-linked mental retardation by use of a mouse model.
American journal of human genetics 80, 1138-1149.
Nan, X., Ng, H.H., Johnson, C.A., Laherty, C.D., Turner, B.M., Eisenman, R.N., and
Bird, A. (1998). Transcriptional repression by the methyl-CpG-binding protein MeCP2
involves a histone deacetylase complex. Nature 393, 386-389.
Newhart, A., Rafalska-Metcalf, I.U., Yang, T., Negorev, D.G., and Janicki, S.M. (2012).
Single-cell analysis of Daxx and ATRX-dependent transcriptional repression. Journal of
cell science 125, 5489-5501.
Ng, H.H., Robert, F., Young, R.A., and Struhl, K. (2003). Targeted recruitment of Set1
histone methylase by elongating Pol II provides a localized mark and memory of recent
transcriptional activity. Mol Cell 11, 709-719.
Nogami, T., Beppu, H., Tokoro, T., Moriguchi, S., Shioda, N., Fukunaga, K., Ohtsuka,
T., Ishii, Y., Sasahara, M., Shimada, Y., et al. (2011). Reduced expression of the ATRX
gene, a chromatin-remodeling factor, causes hippocampal dysfunction in mice.
Hippocampus 21, 678-687.
Noll, M. (1974). Internal structure of the chromatin subunit. Nucleic acids research 1,
1573-1578.
O'Meara, M.M., and Simon, J.A. (2012). Inner workings and regulatory inputs that
control Polycomb repressive complex 2. Chromosoma 121, 221-234.
Orphanides, G., LeRoy, G., Chang, C.H., Luse, D.S., and Reinberg, D. (1998). FACT, a
factor that facilitates transcript elongation through nucleosomes. Cell 92, 105-116.
Paeschke, K., Capra, J.A., and Zakian, V.A. (2011). DNA replication through Gquadruplex motifs is promoted by the Saccharomyces cerevisiae Pif1 DNA helicase. Cell
145, 678-691.
Perry, J., Palmer, S., Gabriel, A., and Ashworth, A. (2001). A Short Pseudoautosomal
Region in Laboratory Mice. Genome Res 11, 1826-1832.
Petesch, S.J., and Lis, J.T. (2012). Overcoming the nucleosome barrier during transcript
elongation. Trends Genet 28, 285-294.
Picketts, D.J., Higgs, D.R., Bachoo, S., Blake, D.J., Quarrell, O.W., and Gibbons, R.J.
(1996). ATRX encodes a novel member of the SNF2 family of proteins: mutations point
46
to a common mechanism underlying the ATR-X syndrome. Human molecular genetics 5,
1899-1907.
Picketts, D.J., Tastan, A.O., Higgs, D.R., and Gibbons, R.J. (1998). Comparison of the
human and murine ATRX gene identifies highly conserved, functionally important
domains. Mamm Genome 9, 400-403.
Razak, Z.R., Varkonyi, R.J., Kulp-McEliece, M., Caslini, C., Testa, J.R., Murphy, M.E.,
and Broccoli, D. (2004). p53 differentially inhibits cell growth depending on the
mechanism of telomere maintenance. Mol Cell Biol 24, 5967-5977.
Riggs, A.D. (1975). X inactivation, differentiation, and DNA methylation. Cytogenet
Cell Genet 14, 9-25.
Ritchie, K., Seah, C., Moulin, J., Isaac, C., Dick, F., and Berube, N.G. (2008). Loss of
ATRX leads to chromosome cohesion and congression defects. The Journal of cell
biology 180, 315-324.
Ruiz-Herrera, A., Nergadze, S.G., Santagostino, M., and Giulotto, E. (2008). Telomeric
repeats far from the ends: mechanisms of origin and role in evolution. Cytogenet Genome
Res 122, 219-228.
Salomoni, P., and Khelifi, A.F. (2006). Daxx: death or survival protein? Trends in cell
biology 16, 97-104.
Schneiderman, J.I., Sakai, A., Goldstein, S., and Ahmad, K. (2009). The XNP remodeler
targets dynamic chromatin in Drosophila. Proceedings of the National Academy of
Sciences of the United States of America 106, 14472-14477.
Schoeftner, S., and Blasco, M.A. (2008). Developmentally regulated transcription of
mammalian telomeres by DNA-dependent RNA polymerase II. Nat Cell Biol 10, 228236.
Schreiner, S., Burck, C., Glass, M., Groitl, P., Wimmer, P., Kinkley, S., Mund, A.,
Everett, R.D., and Dobner, T. (2013). Control of human adenovirus type 5 gene
expression by cellular Daxx/ATRX chromatin-associated complexes. Nucleic acids
research.
Schwab, R.A., Nieminuszczy, J., Shin-Ya, K., and Niedzwiedz, W. (2013). FANCJ
couples replication past natural fork barriers with maintenance of chromatin structure.
The Journal of cell biology 201, 33-48.
Schwartz, B.E., and Ahmad, K. (2005). Transcriptional activation triggers deposition and
removal of the histone variant H3.3. Genes & development 19, 804-814.
Schwartzentruber, J., Korshunov, A., Liu, X.Y., Jones, D.T., Pfaff, E., Jacob, K., Sturm,
D., Fontebasso, A.M., Quang, D.A., Tonjes, M., et al. (2012). Driver mutations in histone
H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature 482, 226-231.
47
Seah, C., Levy, M.A., Jiang, Y., Mokhtarzada, S., Higgs, D.R., Gibbons, R.J., and
Berube, N.G. (2008). Neuronal death resulting from targeted disruption of the Snf2
protein ATRX is mediated by p53. J Neurosci 28, 12570-12580.
Simonet, T., Zaragosi, L.E., Philippe, C., Lebrigand, K., Schouteden, C., Augereau, A.,
Bauwens, S., Ye, J., Santagostino, M., Giulotto, E., et al. (2011). The human TTAGGG
repeat factors 1 and 2 bind to a subset of interstitial telomeric sequences and satellite
repeats. Cell Res 21, 1028-1038.
Stayton, C.L., Dabovic, B., Gulisano, M., Gecz, J., Broccoli, V., Giovanazzi, S.,
Bossolasco, M., Monaco, L., Rastan, S., Boncinelli, E., et al. (1994). Cloning and
characterization of a new human Xq13 gene, encoding a putative helicase. Human
molecular genetics 3, 1957-1964.
Steensma, D.P., Gibbons, R.J., and Higgs, D.R. (2005). Acquired alpha-thalassemia in
association with myelodysplastic syndrome and other hematologic malignancies. Blood
105, 443-452.
Stewart, J.A., Chaiken, M.F., Wang, F., and Price, C.M. (2012). Maintaining the end:
roles of telomere proteins in end-protection, telomere replication and length regulation.
Mutation research 730, 12-19.
Svetlova, M.P., Solovjeva, L.V., Smirnova, A.N., and Tomilin, N.V. (2007). Long
interstitial (TTAGGG)n arrays do not colocalize with repressive chromatin modifications
in Chinese hamster cells. Cell Biol Int 31, 308-315.
Szenker, E., Ray-Gallet, D., and Almouzni, G. (2011). The double face of the histone
variant H3.3. Cell Res 21, 421-434.
Takagi, N., and Sasaki, M. (1975). Preferential inactivation of the paternally derived X
chromosome in the extraembryonic membranes of the mouse. Nature 256, 640-642.
Tang, J., Wu, S., Liu, H., Stratt, R., Barak, O.G., Shiekhattar, R., Picketts, D.J., and
Yang, X. (2004). A novel transcription regulatory complex containing death domainassociated protein and the ATR-X syndrome protein. The Journal of biological chemistry
279, 20369-20377.
Tang, L., Nogales, E., and Ciferri, C. (2010). Structure and function of SWI/SNF
chromatin remodeling complexes and mechanistic implications for transcription. Progress
in biophysics and molecular biology 102, 122-128.
Tornaletti, S. (2009). Transcriptional processing of G4 DNA. Molecular carcinogenesis
48, 326-335.
Tsai, K., Thikmyanova, N., Wojcechowskyj, J.A., Delecluse, H.J., and Lieberman, P.M.
(2011). EBV tegument protein BNRF1 disrupts DAXX-ATRX to activate viral early
gene transcription. PLoS pathogens 7, e1002376.
48
Valadez-Graham, V., Yoshioka, Y., Velazquez, O., Kawamori, A., Vazquez, M.,
Neumann, A., Yamaguchi, M., and Zurita, M. (2012). XNP/dATRX interacts with DREF
in the chromatin to regulate gene expression. Nucleic acids research 40, 1460-1474.
Vasquez, K.M., and Wang, G. (2012). The yin and yang of repair mechanisms in DNA
structure-induced genetic instability. Mutation research.
Villard, L., Fontes, M., Ades, L.C., and Gecz, J. (2000). Identification of a mutation in
the XNP/ATR-X gene in a family reported as Smith-Fineman-Myers syndrome.
American journal of medical genetics 91, 83-85.
Villard, L., Gecz, J., Mattei, J.F., Fontes, M., Saugier-Veber, P., Munnich, A., and
Lyonnet, S. (1996). XNP mutation in a large family with Juberg-Marsidi syndrome.
Nature genetics 12, 359-360.
Villard, L., Lossi, A.M., Cardoso, C., Proud, V., Chiaroni, P., Colleaux, L., Schwartz, C.,
and Fontes, M. (1997). Determination of the genomic structure of the XNP/ATRX gene
encoding a potential zinc finger helicase. Genomics 43, 149-155.
Wada, T., Sugie, H., Fukushima, Y., and Saitoh, S. (2005). Non-skewed X-inactivation
may cause mental retardation in a female carrier of X-linked alpha-thalassemia/mental
retardation syndrome (ATR-X): X-inactivation study of nine female carriers of ATR-X.
American journal of medical genetics Part A 138, 18-20.
Wang, W., Cote, J., Xue, Y., Zhou, S., Khavari, P.A., Biggar, S.R., Muchardt, C.,
Kalpana, G.V., Goff, S.P., Yaniv, M., et al. (1996). Purification and biochemical
heterogeneity of the mammalian SWI-SNF complex. The EMBO journal 15, 5370-5382.
Watson, L.A., Solomon, L.A., Li, J.R., Jiang, Y., Edwards, M., Shin-Ya, K., Beier, F.,
and Berube, N.G. (2013). Atrx deficiency induces telomere dysfunction, endocrine
defects, and reduced life span. The Journal of clinical investigation.
Weatherall, D.J., Higgs, D.R., Bunch, C., Old, J.M., Hunt, D.M., Pressley, L., Clegg,
J.B., Bethlenfalvay, N.C., Sjolin, S., Koler, R.D., et al. (1981). Hemoglobin H disease
and mental retardation: a new syndrome or a remarkable coincidence? The New England
journal of medicine 305, 607-612.
Wiedemann, S.M., Mildner, S.N., Bonisch, C., Israel, L., Maiser, A., Matheisl, S., Straub,
T., Merkl, R., Leonhardt, H., Kremmer, E., et al. (2010). Identification and
characterization of two novel primate-specific histone H3 variants, H3.X and H3.Y. The
Journal of cell biology 190, 777-791.
Wilkie, A.O., Buckle, V.J., Harris, P.C., Lamb, J., Barton, N.J., Reeders, S.T.,
Lindenbaum, R.H., Nicholls, R.D., Barrow, M., Bethlenfalvay, N.C., et al. (1990a).
Clinical features and molecular analysis of the alpha thalassemia/mental retardation
syndromes. I. Cases due to deletions involving chromosome band 16p13.3. American
journal of human genetics 46, 1112-1126.
49
Wilkie, A.O., Zeitlin, H.C., Lindenbaum, R.H., Buckle, V.J., Fischel-Ghodsian, N., Chui,
D.H., Gardner-Medwin, D., MacGillivray, M.H., Weatherall, D.J., and Higgs, D.R.
(1990b). Clinical features and molecular analysis of the alpha thalassemia/mental
retardation syndromes. II. Cases without detectable abnormality of the alpha globin
complex. American journal of human genetics 46, 1127-1140.
Winston, F., and Carlson, M. (1992). Yeast SNF/SWI transcriptional activators and the
SPT/SIN chromatin connection. Trends Genet 8, 387-391.
Wong, L.H., McGhie, J.D., Sim, M., Anderson, M.A., Ahn, S., Hannan, R.D., George,
A.J., Morgan, K.A., Mann, J.R., and Choo, K.H. (2010). ATRX interacts with H3.3 in
maintaining telomere structural integrity in pluripotent embryonic stem cells. Genome
research 20, 351-360.
Xin, H., Takahata, S., Blanksma, M., McCullough, L., Stillman, D.J., and Formosa, T.
(2009). yFACT induces global accessibility of nucleosomal DNA without H2A-H2B
displacement. Mol Cell 35, 365-376.
Xue, Y., Gibbons, R., Yan, Z., Yang, D., McDowell, T.L., Sechi, S., Qin, J., Zhou, S.,
Higgs, D., and Wang, W. (2003). The ATRX syndrome protein forms a chromatinremodeling complex with Daxx and localizes in promyelocytic leukemia nuclear bodies.
Proceedings of the National Academy of Sciences of the United States of America 100,
10635-10640.
Yang, D., Xiong, Y., Kim, H., He, Q., Li, Y., Chen, R., and Songyang, Z. (2011). Human
telomeric proteins occupy selective interstitial sites. Cell Res 21, 1013-1027.
Yntema, H.G., Poppelaars, F.A., Derksen, E., Oudakker, A.R., van Roosmalen, T.,
Jacobs, A., Obbema, H., Brunner, H.G., Hamel, B.C., and van Bokhoven, H. (2002).
Expanding phenotype of XNP mutations: mild to moderate mental retardation. American
journal of medical genetics 110, 243-247.
Zhong, S., Muller, S., Ronchetti, S., Freemont, P.S., Dejean, A., and Pandolfi, P.P.
(2000). Role of SUMO-1-modified PML in nuclear body formation. Blood 95, 27482752.
50
Chapter 2
2
The SWI/SNF protein ATRX co-regulates
pseudoautosomal genes that have translocated to
autosomes in the mouse genome
The work described in this chapter represents the first genome-wide analysis of gene
expression changes that result from loss of ATRX and identifies the aPAR genes as a
unique class of genes regulated by ATRX. This chapter, except for data and commentary
related to section 3.6, has been published in BMC Genomics (Levy et al., 2008). The
conclusions have been modified to accommodate the new data from section 3.6.
2.1 Introduction
The sex chromosomes in modern placental mammals (eutharians) are highly dimorphic
but initially evolved from a homologous pair of autosomes (Ohno, 1967). Over millions
of years of mammalian evolution, the sex chromosomes have lost most of their homology
due to chromosome Y attrition (Charlesworth and Charlesworth, 2000). The remaining
homology between the sex chromosomes exists in the pseudoautosomal regions (PARs),
located at the ends of the X and Y chromosomes (Graves, 2006), and was generated when
genetic material from the tips of autosomes translocated onto the ancient sex
chromosomes (Graves et al., 1998). Gene dosage between XX females and XY males is
usually achieved by the silencing of one X chromosome in every female cell, a process
known as X chromosome inactivation (XCI) (Lyon, 1989). Because both males and
females have two copies of all PAR genes, there is no requirement for dosage
compensation and these genes therefore escape this inactivation process (Carrel and
Willard, 2005).
Comparison of human PARs with those of other primates and carnivores (dogs and cats)
and artiodactyls (cattle, sheep, pigs; representing the common evolutionary ancestor
between humans and mice) has revealed that gene content is mostly conserved in
eutherians, including the existence of PARs at both ends of the X and Y chromosomes
(Graves et al., 1998). However, rodents are strikingly different in that they have a single,
51
dissimilar and considerably shorter PAR region (Perry et al., 2001). Fewer than half of
the 24 PAR1 genes identified so far in humans have also been found in the mouse
genome, and all have diverged considerably (Perry et al., 2001). This divergence is
largely due to the increased recombination rates in the PARs during male meiosis (Lien et
al., 2000). In addition, the PARs comprise a unique chromosomal environment that is
rich in repetitive sequences (Bacolla et al., 2006; Gianfrancesco et al., 2001). For these
reasons, the identification of human PAR genes and orthologs has been difficult.
Interestingly, in the mouse, all human PAR1 orthologs identified to date are located on
autosomes. For example, Csf2ra is located on mouse chromosome 19 (Disteche et al.,
1992) and Cd99 and Dhrsx are located on chromosome 4 (Bixel et al., 2004;
Gianfrancesco et al., 2001). Human orthologs of ASMTL and the arylsulfatase (ARS)
family of genes (ARSE, ARSD, ARSF, and ARSH) located just outside the PAR1, have not
yet been reported in the mouse (Figure 2-1). Due to their location in the PAR region of
evolutionary ancestors, and their current autosomal location, we will refer to these genes
in the mouse as “ancestral PAR genes”.
52
Figure 2-1: Evolution of PAR genes in humans and mice.
PAR genes that are downregulated in the ATRX-null mouse forebrain are clustered
together within the PAR1 region of common evolutionary ancestors of humans and mice
but have translocated to autosomes in the mouse. Vertical lines and arrows represent
individual genes. The position of the first nucleotide for each gene is as follows: SHOX
(505,079), CSF2RA (1,347,701), ASMTL (1,482,032), DHRSXY (2,147,553), CD99
(2,619,553), ARSD (2,848,421), ARSE (2,832,011) (Human reference sequence NCBI
Build 36.1). PAR1, pseudoautosomal region 1; PAR2, pseudoautosomal region 2. PAR
regions are highlighted in orange.
53
The α-thalassemia mental retardation, X linked (ATRX) protein, transcribed from Xq13.3
belongs to the sucrose non-fermenting 2 (Snf2) family of enzymes that use the energy of
adenosine tri-phosphate (ATP) hydrolysis to disrupt nucleosome stability (Eisen et al.,
1995; Picketts et al., 1996). Mutations in ATRX result in moderate to profound cognitive
deficits, facial dysmorphisms, as well as skeletal and urogenital abnormalities, among
other symptoms (Gibbons and Higgs, 2000). The chromatin remodeling properties of
ATRX have been demonstrated in vitro (Xue et al., 2003). In addition to a conserved
ATPase/helicase domain, ATRX has an N-terminal zinc finger ATRX-DNMT3A/BDNMT3L (ADD) domain that is shared with de novo methyltransferases. Several lines
of evidence have also linked ATRX to highly repetitive genomic regions including
pericentromeric heterochromatin in mouse and human cells (McDowell et al., 1999).
Moreover, ATRX mutations in humans result in aberrant DNA methylation patterns at
several repetitive elements, including ribosomal DNA (rDNA) repeats, subtelomeric
repeats and Y-specific satellite repeats (Gibbons et al., 2000). These repetitive sequences
usually form heterochromatic structures and seem to be specifically targeted by the
ATRX protein.
To assess the role of ATRX in brain development, we previously used Cre-loxP
recombination to remove Atrx specifically in the mouse forebrain beginning at E8.5.
Loss of ATRX in the embryonic forebrain caused hypocellularity, a reduction in
forebrain size, and loss of the dentate gyrus (Bérubé et al., 2005).
Genes that are directly regulated by ATRX have not yet been identified in either humans
or mice. To identify potential ATRX target genes we performed a screen of gene
expression in control and ATRX-null mouse forebrain tissue. We found that a subset of
ancestral PAR1 genes is consistently downregulated in the absence of ATRX in the
developing mouse brain, where they are located on autosomes, but not in non-murine
species, where they are located in the X/Y PAR1. Among these genes are two potentially
novel mouse orthologs of Arsd/e and Asmtl. The only common link between aPAR genes
is their adjacent location and shared chromatin environment in the ancestral PAR region.
We propose that conserved sequences and/or chromatin features were maintained upon
translocation from the PAR1 on the ancestral X chromosome to their current location on
54
mouse autosomes, and that theses sequences and/or features allow ATRX to modulate
their expression.
2.2 Materials and Methods
2.2.1
Mouse husbandry
Mice conditionally deficient for ATRX in the forebrain were generated by crossing
AtrxloxP females with heterozygous Foxg1Cre male mice, as previously described (Bérubé
et al., 2005). Pregnant females were sacrificed at E13.5, embryos were recovered and
yolk sac DNA was genotyped by PCR using the primers 17F, 18R and neor as described
previously (Bérubé et al., 2005). For newborns (P0.5) and juveniles (P17), pups were
sacrificed and tail DNA was used for genotyping as previously described (Bérubé et al.,
2005).
2.2.2
Microarray analysis
Total forebrain RNA (10 µg) was isolated from three pairs of littermate-matched ATRXnull and control embryos using the RNeasy Mini kit (Qiagen). Complementary RNA was
generated and hybridized to an Affymetrix Mouse Genome 430 2.0 Array at the London
Regional genomics Center (London, Canada). For the analysis at E13.5, RNA from two
forebrains was pooled for each array. Probe signal intensities were generated using
GCOS1.4 (Affymetrix Inc., Santa Clara, CA) using default values for the Statistical
Expression algorithm parameters and a Target Signal of 150 for all probe sets and a
Normalization Value of 1. Gene level data were generated using the RMA preprocessor
in GeneSpring GX 7.3.1 (Agilent Technologies Inc., Palo Alto, CA). Data were then
transformed (measurements less than 0.01 set to 0.01), normalized per chip to the 50th
percentile, and per gene to control samples. Probe sets representing Atrx transcripts were
removed (10 sets). Remaining probe sets were filtered by fold change of either ≥1.5 or 2
between control and ATRX-null samples, and by confidence level of P<0.05. Heatmaps
were generated using the GeneSpring hierarchical clustering gene tree function.
Significantly overrepresented GO categories were determined using GeneSpring: at
E13.5 and P0.5, probesets were filtered by 1.5 fold change, P<0.05 and categorized as
55
either up or downregulated. Where there were multiple probesets for a gene, duplicates
were removed. P<0.001 was used as the significance cutoff.
2.2.3
Quantitative reverse transcriptase PCR
Total RNA was isolated using the RNeasy Mini kit (Qiagen). First-strand cDNA was
synthesized from 3 µg of total RNA using the SuperScriptTM II Reverse Transcriptase kit
(Invitrogen) with 25 mM dNTPs (GE Healthcare), porcine RNAguard (GE Healthcare)
and random primers (GE Healthcare). PCR reactions were performed in triplicate on a
Chromo4 Continuous Fluorescence Detector in the presence of iQTM SYBR Green
Supermix and recorded using the Opticon Monitor 3 software (all Bio-Rad Laboratories,
o
o
Inc.). Samples were amplified as follows: 95 C for 10 sec, annealed for 20 sec, 72 C for
30 sec (See Supplementary table 2-2 for primer sequences and annealing temperatures).
After amplification, a melting curve was generated, and samples were run on a 1.5%
agarose gel (75V for 1h) to visualize amplicon purity. Standard curves were generated
for each primer pair using five-fold serial dilutions of control cDNA. Primer efficiency
was calculated as E = [10(-1/slope) – 1]*100, where a desirable slope is –3.32 and
r2>0.99. Samples were normalized to β-actin expression and relative gene expression
levels were calculated using GeneX software (Bio-Rad Laboratories, Inc.).
For Arsd/e and Asmtl, the PCR products were gel extracted using the QIAquick Gel
Extraction Kit (Qiagen) according to the manufacturer’s instructions and sequenced at the
DNA Sequencing Facility at Robarts Research Institute (London, Canada).
2.2.4
Bioinformatics analysis of novel ancestral PAR genes
Probeset sequences were obtained from the Netaffx website (Liu et al., 2003) and used
for BLASTn searches (www.ncbi.nlm.nih.gov/BLAST). For calculation of interspecies
similarity, sequences were obtained from NCBI RefSeq (www.ncbi.nlm.nih.gov/RefSeq)
or Ensemble (www.ensembl.org) where RefSeq sequences were not available, and
pairwise comparisons made using Jalview (Clamp et al., 2004).
For generation of trees and sequence alignments, human arylsulfatase E precursor
(ARSE, SwissProt P51690, RefSeq NP_000038) and human N-acetylserotonin O-
56
methyltransferase-like protein (ASMTL, SwissProt O95671, RefSeq NP_004183) were
used as seeds and the GenBank NR database was searched for high-similarity, full-length
orthologs and paralogs. Fifty-nine ARSE and twenty-two ASMTL sequences met or
exceeded the similarity cutoff, with resultant species spanning the metazoa from anemone
and urchin to a diverse set of vertebrates. Sequences were aligned using T-Coffee 5.56
(Notredame et al., 2000) using default parameters. Alignments were manually adjusted
via inspection prior to further analysis. Approximate maximum-likelihood trees were
built using PHYML 2.4.5 (Guindon and Gascuel, 2003) using the WAG model of protein
evolution (Whelan and Goldman, 2001) and a seven-category Gamma-plus-invariant
model of rate heterogeneity. All rate parameters were estimated from the data. One
hundred bootstrap replicates were performed to assess support for the inferred tree
topology. All trees are presented as midpoint-rooted phylograms. Since the given mouse
sequences were quite short compared to the full protein length, two sets of trees were
built for each family to assess if the mouse sequences were long enough to definitively
support their taxonomic clustering. One set utilized a “trimmed” alignment where all
alignment columns outside the mouse sequence domain were removed. The trees
produced with this trimmed alignment were compared with the set of trees produced from
the alignment of the mouse sequences to their respective full-length proteins. For both
ARSD/E and ASMTL, very little difference was observed between full-length and
trimmed-alignment trees. The trimmed alignments tended to exaggerate sequence
divergence and modestly lower bootstrap support levels. Overall topology did not appear
significantly different, however, and the text references the full-length sequence
phylogeny exclusively.
2.2.5
Cell culture and RNA interference
Neuro-2a, IMR-90 and bovine fetal fibroblast cells were grown at 37°C with 5% CO2 in
DMEM supplemented with 10% fetal bovine serum (Sigma-Aldrich). For siRNA
treatment, 1.5x104 cells were plated in a plastic six well dish (Corning Incorporated) on
glass coverslips and allowed to grow to 25% confluency (approximately 24 hours).
Cultures were transfected using Lipofectamine 2000 (Invitrogen) with 8 nM siATRX
(Dharmacon), a non-specific control siRNA (Sigma-Aldrich), or with no siRNA
57
(“Mock”) according to the manufacturers’ instructions (for siRNA sequences refer to
(Ritchie et al., 2008)). Total RNA was extracted from cells after 72 hours, cDNA was
generated and qPCR analysis performed as described above. Alternatively, cells were
processed for immunofluorescence staining as described below.
2.2.6
Immunofluorescence
Cells were fixed using 4% formaldehyde, incubated for 1 h with the primary antibody
(H300 anti-ATRX, 1:100 dilution; Santa Cruz) followed by the secondary antibody (goatanti rabbit Alexa 594, 1:1500 dilution; Molecular Probes), then counterstained with 4’,6diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) for 5 min. Coverslips were mounted
with Vectashield (Vector Laboratories), Z-stack images were captured using a Leica
DMI6000b inverted microscope and Openlab software (v5.0, Improvision) and processed
using Volocity software (v4.0, Improvision); deconvolution was performed using
iterative restoration set with a confidence limit of 95%.
2.3 Results
2.3.1
Effects of ATRX deletion on forebrain gene expression
The ability of ATRX to remodel chromatin (Xue et al., 2003) suggests that ATRX can
regulate gene expression. To identify possible gene targets of the ATRX protein in the
developing mouse brain, we used the previously described AtrxFoxg1Cre mice that lack
ATRX in the forebrain (Bérubé et al., 2005). In this model system, Atrx deletion is
achieved by crossing AtrxloxP “floxed” mice to mice that express cyclization recombinase
(Cre) under the control of the forebrain-specific forkhead box G1 (Foxg1) promoter
(Hebert and McConnell, 2000). We performed microarray analysis to compare the
expression profiles of the AtrxFoxg1Cre and control telencephalon at embryonic day 13.5
(E13.5) (n = 3 pairs) using an Affymetrix mouse genome expression array representing
approximately 39,000 transcripts (Affymetrix, 2008). Only probe sets showing a
significant difference (p<0.05) were included in all subsequent studies. By setting a
threshold of 1.5 fold change we identified 202 misregulated probesets, and at a threshold
of 2 fold change we identified only 22 altered probe sets. Approximately two-thirds of
58
the probe sets demonstrating altered expression were upregulated (Supplementary Figure
2-7).
We next compared gene expression patterns in control and ATRX-null forebrain tissue at
postnatal day 0.5 (P0.5) (n = 4 pairs). At a threshold of 1.5 fold change we identified 304
probe sets, and at a threshold of 2 fold change we identified 57 probe sets showing
altered transcript levels. When we compared results between the two timepoints, we
identified 14 probesets commonly upregulated and 13 commonly downregulated more
than 1.5 fold, and one increased and three decreased more than 2 fold (Supplementary
Figure 2-7). We used GeneSpring software to identify significantly overrepresented
Gene Ontology (GO) categories in the ATRX-null mouse forebrain. Several statistically
and biologically significant categories of upregulated genes were related to immune
response. This could be an indirect response to the increased apoptosis that characterizes
the ATRX-null forebrain at E13.5 in the developing cortex and to a lesser extent at P0.5
in the hippocampus (Bérubé et al., 2005). In particular, categories and genes involved in
phagocytotic clearing of apoptotic cells, such as complement activation (Trouw et al.,
2008), were enriched at both E13.5 and P0.5. Several genes involved in cell adhesion
processes were upregulated at P0.5 and, consistent with the abnormal forebrain
development described in the ATRX-null forebrain (Bérubé et al., 2005), genes involved
in neurogenesis and nervous system development were downregulated at both timepoints
(Supplementary table 2-3).
2.3.2
Ancestral pseudoautosomal genes are downregulated in the
ATRX-null mouse forebrain
Five of the most downregulated transcripts identified in the microarray analysis were
unidentified cDNA clones (Affymetrix IDs 1436320_at, 1448057_at, 1443755_at,
1429730_at and 1453066_at; GenBank Accessions W45978, BI202412, BE457721,
AK007409 and BI320076, respectively). To further investigate these probe sets, their
NCBI nucleotide sequences were used for a Basic Local Alignment Search Tool
nucleotide (BLASTn) search of the nr database. The expressed sequence tag (EST)
W45978 has similarity to Mus musculus Dhrsx (NM_001033326, score = 120, E value
5e-24). The EST BI202412 displayed similarity to several unidentified mouse cDNA
59
clones. Interestingly, a BLAST-like Alignment Tool (BLAT) search of this clone
showed similarity to intron 1 of mouse Dhrsx and it could represent an unknown splice
variant of Dhrsx. The EST BE457721 is annotated as similar to human ARSE and a
BLASTn search revealed high similarity to Rattus norvegicus Arse (NM_001047885,
score 197, E value 6e-28). BLASTn of AK007409 showed high similarity to Asmtl in
cow (BT02626, score = 248, E value = 6e-62) as well as dog, human, the putative rat
Asmtl, and numerous other species. The EST BI320076 displayed no significant hits to
any sequences by either BLASTn or BLAT.
Interestingly, while Dhrsx, Arse, and Asmtl do not display an obvious functional
connection, they do share a common link in that they are all pseudoautosomal genes in
nearly all eutherians (placental mammals). In addition, the microarray data showed
decreased expression of Cd99, Shox2 and Csf2ra, genes that also lie within the eutherian
pseudoautosomal region. Therefore, while GO analysis identified a subset of
downregulated genes involved in brain development at both timepoints, a more in depth
analysis of downregulated targets revealed that many are orthologs of PAR1 genes
residing on the tip of the X and Y chromosomes in most placental mammals. Overall,
our differential gene expression analysis identified six of these genes, constituting
approximately half of all PAR1 orthologs discovered in the mouse genome so far. The
more intriguing aspect of this finding is that in the mouse, these genes no longer reside
within the PAR1 region but have translocated to autosomes (Figure 2-1). It also
identified two potential novel PAR1 orthologs—Arse and Asmtl—not previously
identified in the mouse genome. At E13.5, these genes represent 6 of the 15 most
downregulated transcripts identified by microarray analysis. Strikingly, they constitute 4
of the top 5 most downregulated genes in the microarray performed on P0.5 forebrain
tissue (Arse and Shox2 were not significantly decreased in the microarray at P0.5) (Table
2-1, Supplementary figure 2-7). These results suggest that ATRX normally participates
in the transcription of these genes during the proliferative (E13.5) and more differentiated
(P0.5) stages of forebrain development.
60
Table 2-1: Downregulated genes in the ATRX-null forebrain at E13.5 and P0.5.
Chromosome
Gene
E13.5 Downregulated Genes
Description
Mouse Human
Fold
Change
Genbank
IMAGE:354942
Similar to dehydrogenase/reductase (SDR family) X chromosome
(Dhrsxy)1
4
X/Y PAR
-4.81
W45978
Csf2ra
Colony stimulating factor 2 receptor, alpha, low-affinity (granulocytemacrophage)
19
X/Y PAR
-3.05
BM941868
Vit
Vitrin
17
2
-2.74
AF454755
Shox2
Short stature homeobox 2
3
X/Y PAR
-2.73
AV332957
Tcf7l2
Transcription factor 7-like 2, T-cell specific, HMG-box
19
10
-2.72
BB175494
Gbx2
Gastrulation brain homeobox 2
1
2
-2.55
L39770
IMAGE:3326212
Similar to Arylsulfatase E (Arse)1
-2
X/Y
-2.21
BE457721
Syt13
Synaptotagmin 13
2
11
-2.19
BB244585
Cd99
CD99 antigen
4
X/Y PAR
-2.09
AK004342
Nxph1
Neurexophilin 1
6
7
-1.92
BB274960
Neurod4
Neurogenic differentiation 4
10
12
-1.86
NM_007501
Nxph2
Neurexophilin 2
2
2
-1.86
BB169128
Peg10
Paternally expressed 10
6
7
-1.86
BG076799
-
X/Y PAR
-1.81
AK007409
10
12
-1.81
BC004048
1
RIKEN:1810009N02 Similar to Asmtl (acetylserotonin O-methyltransferase-like)
Wif1
Wnt inhibitory factor 1
P0.5 Downregulated Genes
Csf2ra
Colony stimulating factor 2 receptor, alpha, low-affinity (granulocytemacrophage)
19
X/Y PAR
-7.14
BM941868
Nr4a2
Nuclear receptor subfamily 4, group A, member 2
2
2
-3.33
NM_013613
IMAGE:354942
Similar to Dhrsxy (dehydrogenase/reductase (SDR family) X
chromosome1
4
X/Y PAR
-3.33
W45978
IMAGE:5656844
Unknown EST
-
-
-2.86
BI320076
Met
Met proto-oncogene
6
7
-2.78
BG060788
Cd99
CD99 antigen
4
X/Y PAR
-2.22
AK004342
Dsc3
Desmocollin 3
18
18
-2.22
NM_007882
Mbp
Myelin basic protein
18
18
-2.17
AI323506
Cbln4
Cerebellin 4 precursor protein
2
20
-2.08
AV343573
EST
Unknown EST
-
-
-2.08
BI202412
Trpc4
Tansient receptor potential cation channel, subfamily C, member 4
3
13
-2.04
BB271442
-
X/Y PAR
-2.00
AK007409
RIKEN:1810009N02 Similar to Asmtl (acetylserotonin O-methyltransferase-like)1
1
2
By BLASTn
“-“ indicates unknown chromosome
61
2.3.3
Verification of gene expression changes
To validate the microarray results, we performed real-time quantitative reverse
transcriptase polymerase chain reaction (qRT-PCR) analysis of Dhrsx, Cd99, Csf2ra,
Shox2 and also of the putative new orthologs of Asmtl and Arse in ATRX-null and
control E13.5 and P0.5 forebrain (n=3 at each time point). Since Arse and Asmtl have not
yet been identified in the mouse, we sequenced the PCR products to ensure they
corresponded to the transcripts identified on the microarray, and not to other
contaminating sequences. The qRT-PCR results confirmed that five of the six genes
exhibit decreased expression in the ATRX-null forebrain at E13.5, and that these genes
remain downregulated at P0.5 (Figure 2-2A). In addition, analysis at P17 demonstrated
decreased expression of ancestral PAR genes at this later time point as well (Figure 22A). One exception was Shox2 which exhibited highly variable expression differences
between the ATRX-null and control tissue at E13.5, P0.5 and P17, ranging from a 170
fold decrease to a 90 fold increase (Figure 2-2B). Therefore, while the expression of
Shox2 is clearly affected by the loss of ATRX protein, the outcome on expression levels
appears to be highly variable and does not validate the consistent downregulation
observed by microarray analysis.
Our discovery that the expression of several ancestral PAR1 genes is controlled by
ATRX throughout the early developmental period of the mouse brain reveals an
unexpected association between the levels of ATRX protein and the expression of these
ancestral PAR1 genes.
62
Figure 2-2: Relative expression of ancestral PAR genes in ATRX-null mouse
forebrains.
(A) Real-time quantitative RT-PCR of the indicated genes was performed on RNA
isolated from the forebrains of littermate-matched Atrx-null and control embryos/mice at
E13.5, P0.5 and P17. Results were normalized to β-actin expression levels. Error bars
represent standard error of the mean between biological replicates for n=3. (** p<0.05, *
p<0.1) (B) Expression of Shox2 in seven (E13.5) or three (P0.5 and P17) littermatematched pairs.
Error bars represent standard error of the mean for three technical
replicates. In (A) and (B) expression levels for the control forebrains were set to one for
each reaction.
63
2.3.4
Identification of a novel arylsulfatase family mouse homolog
In humans, a cluster of arylsulfatase genes is located approximately 115 kb centromeric
to the PAR1 region on the X chromosome, but still possesses the ability to escape XCI in
females (Franco et al., 1995). Located outside the PAR1, these genes do not have an
identical homolog on the Y chromosome but have pseudogenes, and in the evolutionary
past it is believed that they were true pseudoautosomal genes with identical copies on
both the X and Y chromosome (Meroni et al., 1996).
An alignment of the amino acid sequence coded for by BE45772 suggested that it is a
fragment of the full length ARSE protein, aligning in the middle of the approximately
600 amino acid ARSE proteins of multiple other species (Supplementary figure 2-8).
The putative mouse ARSE is 65% identical to rat and 47% identical to human.
Phylogenetic analysis demonstrated that the mouse ARSE sequence clusters with near
certainty with the rat ARSE, however, this putative ARSE clustered within the ARSD
proteins, not ARSE as expected (Figure 2-3). Therefore, we propose that we have
identified a member of the PAR1 ARS family but at this time cannot determine the exact
identity and will refer to this sequence as Arsd/e. We note that the long branch-length
between the rodent ARS sequences and the remaining ARSD clade may be an artifact due
to the short mouse sequence and its high similarity to the rat sequence, which has
undergone seemingly accelerated evolutionary change.
64
Figure 2-3: Phylogenetic tree of arylsulfatase proteins.
Human ARSE (NP_000038) was used as a seed to search the GenBank NR database for
orthologs and an approximate maximum-likelihood tree was generated. The putative
ARS family gene downregulated in the ATRX-null mouse forebrain clusters closely with
rat ARSE, but within the ARSD rather than ARSE protein family (boxed). Entries are
annotated with species, chromosome (where known) and GenBank Accession number.
65
Comparisons to available mouse Ars gene family members shows that BE457721 is more
similar to Arse genes in rat than to other mouse arylsulfatase family members
(Supplementary table 2-4), suggesting that we have identified an Arse gene. These data,
combined with our ability to specifically amplify this transcript from mouse brain cDNA
and also from a commercially available E15 cDNA library (data not shown), indicates
that we have likely identified the mouse homologue of a previously unidentified mouse
Ars gene rather than a gene fragment from a known mouse family member.
To further confirm the identity of BE457721, we assessed the outcome of ATRX
depletion on Arsd/e expression by RNA interference in the Neuro-2a cultured
neuroblastoma cell line. Small interfering RNAs (siRNAs) were used to transiently
deplete ATRX, as was done previously (Ritchie et al., 2008). Cells transfected with a
non-specific siRNA or no siRNA (“Mock”) were used as controls. At 72 hours following
siRNA transfection, we monitored the effectiveness of ATRX depletion by indirect
immunofluorescence using an ATRX-specific antibody (H300) and qRT-PCR analysis of
Atrx expression levels using primers that simultaneously amplify both the full length
isoform and the reported truncated isoform (Garrick et al., 2004). In the siATRX-treated
samples, approximately 95% of cells were negative for ATRX (Figure 2-4A) and Atrx
transcript levels were depleted by approximately 5 fold (Figure 2-4B). We then used
qRT-PCR to determine the outcome of ATRX silencing on the expression level of the
Arsd/e. Similar to the results obtained in the ATRX-null forebrain, the expression of
Arsd/e was decreased two fold (Figure 2-4B). These findings support the conclusion that
we have identified the mouse Arsd/e gene, confirm the regulation of this ancestral PAR
gene by ATRX, and show that this outcome on gene expression can be recapitulated in
two different systems: in vivo in the ATRX-null developing forebrain and in vitro in
ATRX-depleted cultured neuronal cells.
66
Figure 2-4: Arsd/e transcriptional downregulation is recapitulated in ATRXdepleted cells.
(A) RNA interference was used to deplete ATRX in Neuro-2a neuroblastoma cells. Cells
were transfected with 8 nM siRNA, fixed after 72 h and processed for
immunofluorescence staining using an anti-ATRX primary antibody (H300) and antirabbit Alexa 488 secondary antibody, then counterstained with DAPI to detect nuclei. In
the siATRX treated samples, approximately 95% of cells were negative for ATRX. Scale
bar = 20 μM. (B) Total RNA was isolated for quantitative real-time PCR of Atrx and
Arsd/e gene expression at 72 hours post-transfection. Mock (transfection reagent only)
expression levels were set to one and a non-specific siRNA was used as a control.
Results were normalized to β-actin expression levels. Error bars represent standard error
of the mean for n = 3. Numbers on siATRX bars indicate p values.
67
2.3.5
Identification of an ASMTL-like gene
AK007409 is the “RIKEN cDNA 1810009N02” gene and contains a musculoaponeurotic
fibrosarcoma (MAF) domain. A multiple sequence alignment of amino acid sequences
was used to further determine the identity of AK007409 (Supplementary figure 2-9).
AK007409 aligns to the N terminus of ASMTL from multiple other species. The N
terminal portion of ASMTL also contains a MAF domain. Human ASMTL was generated
by a fusion of a duplicated acetylserotonin O-methyltransferase (ASMT) with the
bacterial maf gene (Ried et al., 1998). While AK007409 contains a MAF domain, it
lacks the ASMT domain. However, this is similar to the putative rat ASMTL (Accession
NP_001099385) which also lacks the ASMT domain. The putative mouse ASMTL is
54% identical to rat, and 51% identical to the human protein.
In contrast to ARSD/E, ASMTL has fewer discernible high-similarity full-length
orthologs, and its evolution appears tied to the pseudoautosomal region (Ried et al.,
1998). Therefore fewer sequences were available for analysis. Figure 2-5 shows the
inferred phylogeny of the ASMTL family, with the primate branches collapsed for
clarity. With fairly high bootstrap support, the tree mirrors the known branching of the
placental mammals, marsupials, monotremes, birds, amphibians, and fish. The mouse
sequence displays the only anomalous placement in the tree, clustering well outside the
mammalian clade. Both the placement and the branch-length of the mouse sequence
indicate that it is of considerable evolutionarily derived character compared to the
putative ancestor, and it appears to have followed an evolutionary path quite distinct from
its paralogs. The lack of the ASMT domain in the mouse sequence may also be
responsible for the placement of the mouse sequence in the tree. As with ARSD/E, some
of this divergence may be due to the availability of a partial mouse sequence, but the
sequence remains quite unique, nonetheless.
68
Figure 2-5: Phylogenetic tree of ASMTL proteins.
Human ASMTL (NP_004183) was used as a seed to search the GenBank NR database
for orthologs and an approximate maximum-likelihood tree was generated. The putative
mouse ASMTL lacks the ASMT domain and clusters well outside the mammalian clade
(at bottom), indicating that it has considerably diverged compared to the putative
ancestor. Entries are annotated with species, chromosome (where known) and GenBank
Accession number.
69
2.3.6
Expression of PAR genes regulated by ATRX in the mouse
is unchanged upon depletion of ATRX in non-murine cell
lines
Our finding of common regulation of a group of genes now dispersed throughout the
mouse genome, but connected by their common ancestral location, suggested that ATRX
may be able to regulate the expression of these genes regardless of their chromosomal
location. To study this, we examined expression of these genes in two species where the
PAR genes are located together on the X chromosome. In humans, ASMTL, CD99,
CSF2RA and DHRSX are located in the PAR1 region. ARSD and ARSE are located just
outside the human PAR1 but expression of these genes was not detected in the IMR-90
lung fibroblast cells used in this study (data not shown). In cattle (Bos taurus), Arse,
Asmtl, Cd99, and Csf2ra are all within the PAR1 region, as the PAR1 is larger than in
humans, but no Dhrsx gene has been identified. Bovine fetal fibroblasts were provided
by Dr. Jim Petrik (University of Guelph). Atrx was depleted in the two fibroblast cell
lines using siRNA that targeted both the full length and truncated forms of Atrx at a
region conserved in mouse, humans, and cattle. Depletion was assessed using qRT-PCR
and immunofluorescence. qRT-PCR showed that 72 hours after siRNA transfection
overall transcript levels were depleted to 30% of that seen in mock treated (transfection
reagent only) (Figure 2-6B). Immunofluorescence with an antibody that recognizes full
length ATRX protein showed that while some cells continued to express ATRX, the
majority (>85%) had no or very little detectable ATRX protein (Figure 2-6A).
Expression of the PAR genes was then measured using qRT-PCR, but no change was
seen in either human or bovine Atrx-depleted fibroblasts (Figure 2-6B). Additionally, in
shRNA-mediated ATRX-depleted HeLa cells (Ritchie et al., 2008), PAR gene expression
was also unchanged (data not shown). These data suggest that the regulation of PAR
genes by ATRX depends on their genomic location, contrary to our initial hypothesis.
Therefore, both the current autosomal locations as well as common ancestry of these
genes appear essential for their regulation by ATRX.
70
Figure 2-6: PAR gene expression is unchanged in human and bovine cells.
(A) RNA interference was used to deplete ATRX in human (IMR90) and bovine (fetal
fibroblast) cells.
Cells were transfected with 10 nM siRNA, fixed after 72 h, and
processed for immunofluorescence using an anti-ATRX antibody (H300) and anti-rabbit
Alexa 488 secondary antibody, then counterstained with DAPI to detect nuclei.
In
siATRX samples, approximately 85% of cells were negative for ATRX. Scale bar = 20
uM. (B) Total RNA was isolated for quantitative real-time PCR of Atrx and the aPAR
genes 72 hours post-transfection. Mock (transfection reagent only) expression levels
were set to one. Results were normalized to β-actin expression levels. Error bars
represent standard error of the mean for n=3 (* p<0.05).
71
2.4 Discussion
Mutations in the ATRX gene result in profound cognitive deficits, facial dysmorphisms,
as well as skeletal and urogenital abnormalities (Gibbons and Higgs, 2000). Global
deletion of Atrx in mouse embryonic stem cells resulted in a growth disadvantage
(Garrick et al., 2006), and conditional loss of Atrx beginning at the 8-16 cell stage leads
to embryonic lethality by E9.5 (Garrick et al., 2006). To bypass early embryonic
lethality, we have previously used a conditional approach to delete Atrx in the mouse
forebrain beginning at E8.5. These mice had significantly increased cortical progenitor
cell apoptosis causing a reduction in forebrain size and hypocellularity in the neocortex
and hippocampus (Bérubé et al., 2005). ATRX is a chromatin remodeling protein (Xue
et al., 2003) and has been proposed to regulate gene expression by modulating chromatin
structure, but gene targets of ATRX have not yet been reported. We used a microarray
approach to perform large-scale analysis of gene expression changes in the ATRX-null
versus wild type mouse forebrain at E13.5 and P0.5. The fact that relatively few genes
display altered expression indicates that ATRX is not a global regulator of gene
expression but likely controls specific gene loci. It is not clear at this point if ATRX acts
by binding directly to DNA or through other unidentified factors to upregulate the aPAR
genes identified in our study. The only target of ATRX identified to date is α-globin
which is downregulated in patients with germline or somatic ATRX mutations (Gibbons et
al., 1995), including α-thalassemia myelodysplastic syndrome (Steensma et al., 2005),
although at the time of this study, evidence that ATRX directly binds to the α-globin
locus is was still lacking.
Through global transcriptional profiling we have now identified a distinct group of genes,
the ancestral PAR genes, which are controlled by ATRX in the mouse brain. The human
PAR1 contains 24 genes, but only 10 of these have been reported in the mouse genome.
Arsd/e, Asmtl, Cd99, Csf2ra, Dhrsx and Shox2 were among the most downregulated
genes identified in the ATRX-null embryonic forebrain. Although these genes are
unrelated in function, they share a common ancestral location in the PAR1 of the X
chromosome millions of years ago. Our findings demonstrate that they have maintained
a mechanism of co-regulation that was conserved in evolution and that requires ATRX,
72
even after their dispersal to autosomes in the mouse genome. However, the absence of an
effect on expression in human and bovine cells suggests that common ancestry may be
necessary but is not sufficient for these genes to be regulated by ATRX.
The PAR1 region exhibits recombination rates approximately 10 times higher than the
rest of the human genome (Lien et al., 2000). Consequently, genes in this region undergo
rapid evolution leading to high interspecies divergence (Ellison et al., 1996;
Gianfrancesco et al., 2001) making positive identification of homologs difficult. Using
multiple sequence alignments and phylogenetic analysis we have identified Arsd/e and
Asmtl as putative novel mouse ancestral PAR transcripts. Identity between mouse and
human sequences are 47%, 40% and 51% for ARSE (NM_000047), ARSD (NM_001669)
and ASMTL (NM_004192), respectively, which is similar to what was reported for other
PAR1 genes. For example, DHRSX exhibits 59% protein identity between humans and
mice (Gianfrancesco et al., 2001), CD99 46% identity (Park et al., 2005), and 35% for
CSF2RA (Park et al., 1992).
ARSD and ARSE are members of the arylsulfatase gene family and are located just
outside the human PAR1 in a cluster of four arylsulfatase gene family members (Meroni
et al., 1996). ARSE gene mutations cause X-linked chondrodysplasia punctata, a disorder
characterized by abnormalities in cartilage and bone development (Daniele et al., 1998).
ARSE may therefore play a role in the skeletal defects seen in patients with the ATR-X
syndrome if it is also regulated by ATRX in humans. The role of ARSD is unknown and
it has no demonstrated sulfatase activity despite its high conservation of the N-terminal
domain important for catalytic sulfatase activity (Urbitsch et al., 2000). ARSE exhibits a
restricted pattern of expression (Franco et al., 1995) while ARSD is ubiquitously
expressed (Dooley et al., 2000).
The function of human ASMTL is unknown. The gene was generated by the duplication
of the PAR1 gene Asmt which then fused with the bacterial orfE/maf gene (Ried et al.,
1998). While other ASMT genes involved in the serotonin/N-acetylserotonin/melatonin
pathway are expressed specifically in the human brain, pineal gland and retina (Gauer
and Craft, 1996), ASMTL has a wider expression pattern and may not be involved in this
73
pathway but could still have methyltransferase activity since it retains the necessary
domain (Ried et al., 1998).
We have also identified the mouse Shox2 gene as a potential target of ATRX, and we
observed that Shox2 expression levels are highly sensitive to ATRX deficiency in the
developing mouse brain. Two SHOX genes, SHOX and SHOX2 have been identified in
the human genome, on chromosomes X and 3, respectively. Only one mouse homolog
has been identified and is mapped to chromosome 3. Like ARSE, SHOX genes are
involved in skeletal development: mutations and deletions in SHOX lead to Leri-Weill
dyschondrosteosis (Belin et al., 1998; Shears et al., 1998) and mutations cause the short
stature phenotype seen in Turner syndrome (Clement-Jones et al., 2000). SHOX2 is
involved in craniofacial and limb development (Blaschke et al., 1998) and SHOX2
mutations lead to cleft palate (Yu et al., 2005). Along with ARSE, the SHOX genes
provide an intriguing correlation with the skeletal phenotype of ATR-X patients, and
future work should address whether these genes are regulated by ATRX in humans.
Collectively, our findings suggest that even though they are now located on different
chromosomes, a large subset of ancestral PAR genes might share a common sequence or
factor that was conserved upon translocation from the pseudoautosomal region on the X
chromosome to their current autosomal locations in the mouse genome. Uniform
regulation of gene expression may be due to similar regulatory features such as common
sequences or epigenetic modifications (e.g. CpG islands). Despite the sequencing of the
human X chromosome, gaps remain, most notably in the PAR1 region (Ross et al., 2005).
The repetitive nature of the PARs likely explains the paucity of sequence data for these
regions, and the lack of genomic sequence data for the PAR1 genes that have translocated
to autosomes in the mouse. However, we speculate that ATRX could be targeted to
repetitive sequences surrounding these genes. One indication that ATRX would
preferentially target repetitive sequences comes from studies done in human ATR-X
syndrome patients. The analysis of blood samples revealed altered DNA methylation of
several highly repeated sequences including ribosomal DNA arrays, the Y-specific repeat
DYZ2 and subtelomeric repeats (Gibbons et al., 2000). Conservation of repetitive
elements in the PAR1 region of eutherians may have been maintained with the PAR1
74
genes as they moved to autosomes, and perhaps allow ATRX to target these genes in
their modern chromosomal locations.
Future work should focus on identifying the molecular mechanisms by which ATRX can
co-regulate this diverse set of genes linked by their ancestral localization in the PAR1
region. This will lead to a better understanding of ATRX function in the regulation of
chromatin structure and its effects on gene expression in general.
75
2.5 Supplementary Figures
76
77
Figure 2-7 (supplementary): Summary of microarray results.
Complementary RNA was generated from total forebrain RNA from three pairs of
littermate-matched ATRX-null and wild type forebrain tissue and hybridized to an
Affymetrix Mouse Genome 430 2.0 Array.
Data was analyzed using GeneSpring.
Probesets were filtered by fold change (1.5 and 2 fold at both E13.5 and P0.5) and
confidence (P<0.05) and duplicate genes were removed.
(A) Venn diagrams to
categorize probesets according to developmental timepoint and fold change in expression
levels. (B) Hierarchical clustering of differentially expressed probesets. Approximately
two-thirds of the misregulated genes are upregulated.
Ancestral PAR genes are
consistently downregulated at both timepoints and are indicated by blue text. Probesets
were filtered by 1.5 fold or 2 fold change, P<0.05, at either E13.5 or P0.5. Normalized
expression levels are displayed.
78
Figure 2-8 (supplementary): Amino acid alignment of a small portion of ARSD/E
between multiple species.
Sequences were aligned using T-Coffee 5.56 (Notredame et al., 2000) using default
parameters, edited using JalView (Clamp et al., 2004) and shaded using Boxshade
(Hofmann and Baron, 2007). Mouse ARSD/E has highest identity to rat ARSE (65%).
GenBank accession numbers are ARSE: chicken (XP_416856), cow (ABS45001), dog
(NP_001041587), horse (XP_001495573), macaque (Q60HH5), human (CAA58556),
platypus (XP_001514429), opossum (XP_001362844), pufferfish (CAG09268), rat
(CAI84983). ARSD: dog (XP_548838), horse (XP_001495553), human (CAA58555),
macaque (XP_001092405), opossum, (XP_001362931), platypus (XP_001507106),
chicken (XP_416855), zebrafish (XP_700386). Putative mouse ARSD/E translated from
BE457721.
79
Figure 2-9 (supplementary): Amino acid alignment of the N terminal of ASMTL
between multiple species.
Sequences were aligned using T-Coffee 5.56 (Notredame et al., 2000) using default
parameters, edited using JalView (Clamp et al., 2004) and shaded using Boxshade
(Hofmann and Baron, 2007). The putative mouse ASMTL aligns within the N terminal
MAF domain and is most similar to rat ASMTL (54% identity) which also contains only
the MAF domain. GenBank accession numbers are: human (XP_001133965), orangutan
(CAH90398), chimpanzee (XP_001137696), cow (AAI03000), dog (XP_851655), frog
(NP_001085814),
chicken
(XP_001231914),
(XP_001506357), mouse (NP_081215).
zebrafish
(NP_998676),
platypus
80
2.6 Supplementary tables
Table 2-2 (supplementary): Conditions for quantitative real-time PCR.
Primer
Sequence
Annealing Temp.
Arse Forward
GTCGAAGGTCGGCGTCACGAAGT
68
Arse Reverse
GCCCACGAGGTCCTGCTCCACTA
68
Asmtl Forward
CCTTCCACGAGGAGACGAG
60
Asmtl Reverse
CCACAGCGTTGAGGACATC
60
Cd99 Forward
AGCTTCGTGGCCTATCAGC
60
Cd99 Reverse
ATGAGCAGCGTCAGTGATGT
60
Csf2ra Forward
ATCAGTACTCGTGGCCATCC
60
Csf2ra Reverse
TTGATCATGAAGGCACGTTG
60
Dhrsx Forward
GACCCTGTGACCTCCAACAT
63
Dhrsx Reverse
CCTCCGACACCTTCTAGCTC
63
Shox2 Forward
TTGGTTTCAAAATCGAAGAGC
60
Shox2 Reverse
TGGCATCCTTAAAGCACCTAC
60
81
Table 2-3 (supplementary): Significantly misregulated GO categories.
E13.5 Upregulated Biological Process GO:0008150
Category
GO:6955: immune response
GO:6952: defense response
GO:16064: humoral defense mechanism (sensu Vertebrata)
GO:9607: response to biotic stimulus
GO:9613: response to pest, pathogen or parasite
GO:43207: response to external biotic stimulus
GO:30888: regulation of B cell proliferation
GO:6959: humoral immune response
GO:42100: B cell proliferation
GO:50864: regulation of B cell activation
GO:42113: B cell activation
GO:50670: regulation of lymphocyte proliferation
GO:6958: complement activation, classical pathway
GO:51249: regulation of lymphocyte activation
GO:50865: regulation of cell activation
GO:50874: organismal physiological process
GO:46651: lymphocyte proliferation
GO:30889: negative regulation of B cell proliferation
GO:50869: negative regulation of B cell activation
GO:9605: response to external stimulus
GO:6909: phagocytosis
GO:6956: complement activation
GO:45576: mast cell activation
GO:46649: lymphocyte activation
GO:50672: negative regulation of lymphocyte proliferation
GO:6897: endocytosis
GO:51250: negative regulation of lymphocyte activation
GO:50866: negative regulation of cell activation
GO:45321: immune cell activation
GO:1775: cell activation
Genes
p-Value
12
13
5
13
8
8
3
5
3
3
4
3
3
3
3
14
3
2
2
8
3
3
2
4
2
5
2
2
4
4
8.80E-07
1.19E-06
1.61E-06
1.66E-06
1.48E-05
2.07E-05
2.34E-05
3.17E-05
3.54E-05
5.08E-05
5.13E-05
5.68E-05
0.000144
0.000168
0.000168
0.000168
0.000254
0.000312
0.000312
0.000344
0.000432
0.000506
0.000539
0.000616
0.000627
0.000723
0.000825
0.000825
0.00087
0.000911
E13.5 Upregulated Molecular Function GO:0003674
Category
GO:19864: IgG binding
Genes
p-Value
2
5.48E-04
E13.5 Upregulated Cellular Component GO:0005575
Category
GO:5576: extracellular region
GO:9986: cell surface
GO:17177: alpha-glucosidase II complex
GO:5615: extracellular space
GO:9897: external side of plasma membrane
GO:5901: caveola
GO:16599: caveolar membrane
GO:5923: tight junction
GO:16327: apicolateral plasma membrane
GO:43296: apical junction complex
GO:307: cyclin-dependent protein kinase holoenzyme complex
GO:5641: nuclear membrane lumen
Genes
p-Value
21
3
1
17
2
1
1
2
2
2
1
1
1.55E-03
5.98E-03
0.0077
0.0161
0.0194
0.0204
0.0204
0.0221
0.0349
0.0349
0.0355
0.0478
82
E13.5 Downregulated Biological Process GO:0008150
Category
GO:6355: regulation of transcription, DNA-dependent
GO:6351: transcription, DNA-dependent
GO:45449: regulation of transcription
GO:6139: nucleobase, nucleoside, nucleotide and nucleic acid metabolism
GO:19219: regulation of nucleobase, nucleoside, nucleotide and nucleic acid
metabolism
GO:6350: transcription
GO:31323: regulation of cellular metabolism
GO:19222: regulation of metabolism
GO:48731: system development
GO:50794: regulation of cellular process
GO:7399: nervous system development
GO:30182: neuron differentiation
GO:48699: neurogenesis
GO:51244: regulation of cellular physiological process
GO:7275: development
Genes
p-Value
16
16
16
20
7.82E-06
9.98E-06
1.32E-05
1.34E-05
16
16
16
16
7
17
6
4
3
16
12
1.43E-05
2.25E-05
2.94E-05
4.17E-05
7.39E-05
0.000397
0.000413
0.000648
0.000753
0.00083
0.000933
E13.5 Downregulated Molecular Function GO:0003674
Category
GO:3700: transcription factor activity
GO:30528: transcription regulator activity
GO:3677: DNA binding
GO:3676: nucleic acid binding
Genes
p-Value
15
15
17
20
2.79E-09
9.01E-08
3.64E-06
1.70E-05
E13.5 Downregulated Cellular Component GO:0005575
Category
GO:5654: nucleoplasm
GO:5667: transcription factor complex
GO:43234: protein complex
GO:5634: nucleus
Genes
p-Value
12
11
14
21
1.01E-08
1.11E-08
0.000428
0.000469
P0.5 Upregulated Biological Process GO:0008150
Category
GO:7155: cell adhesion
GO:6956: complement activation
GO:7178: transmembrane receptor protein serine/threonine kinase signaling pathway
GO:30509: BMP signaling pathway
GO:7167: enzyme linked receptor protein signaling pathway
GO:30199: collagen fibril organization
GO:6958: complement activation, classical pathway
Genes
p-Value
18
4
5
3
8
2
3
1.05E-06
0.000181
0.00043
0.000495
0.000605
0.000639
0.000824
P0.5 Upregulated Molecular Function GO:0003674
Category
GO:30020: extracellular matrix structural constituent conferring tensile strength
GO:5201: extracellular matrix structural constituent
GO:8289: lipid binding
GO:4528: phosphodiesterase I activity
GO:30332: cyclin binding
GO:5198: structural molecule activity
GO:8083: growth factor activity
Genes
p-Value
5
6
8
2
2
14
6
3.64E-06
7.99E-06
0.000353
0.000571
0.000571
0.000596
0.000689
83
GO:16722: oxidoreductase activity, oxidizing metal ions
GO:16724: oxidoreductase activity, oxidizing metal ions, oxygen as acceptor
GO:4322: ferroxidase activity
GO:4551: nucleotide diphosphatase activity
2
2
2
2
0.000911
0.000911
0.000911
0.000911
P0.5 Upregulated Cellular Component GO:0005575
Category
GO:5615: extracellular space
GO:5576: extracellular region
GO:5578: extracellular matrix (sensu Metazoa)
GO:31012: extracellular matrix
GO:5581: collagen
GO:5911: intercellular junction
GO:30054: cell junction
GO:5604: basement membrane
Genes
p-Value
58
60
15
15
5
7
8
4
1.71E-16
6.76E-16
1.17E-07
1.38E-07
8.60E-06
6.96E-05
7.97E-05
0.000663
P0.5 Downregulated Biological Process GO:0008150
Category
GO:48666: neuron development
GO:30182: neuron differentiation
GO:48468: cell development
GO:7399: nervous system development
Genes
p-Value
4
4
4
5
0.000148
0.000262
0.000702
0.001
P0.5 Downregulated Molecular Function GO:0003674
Category
GO:5509: calcium ion binding
GO:5102: receptor binding
GO:4871: signal transducer activity
GO:4970: ionotropic glutamate receptor activity
GO:5179: hormone activity
GO:4972: N-methyl-D-aspartate selective glutamate receptor activity
GO:8066: glutamate receptor activity
GO:1664: G-protein-coupled receptor binding
GO:16623: oxidoreductase activity, acting on the aldehyde or oxo group of donors, oxygen as
acceptor
GO:4031: aldehyde oxidase activity
GO:4723: calcium-dependent protein serine/threonine phosphatase activity
GO:5262: calcium channel activity
Genes
p-Value
8
6
12
2
3
1
2
2
2.13E-05
0.000193
0.000287
0.000539
0.000651
0.00118
0.0023
0.00253
1
1
1
2
0.00473
0.00473
0.00473
0.00498
Genes
p-Value
P0.5 Downregulated Cellular Component GO:0005575
Category
None
84
Table 2-4 (supplementary): Pairwise comparisons of arylsulfatase family members.
Rat
Arse
Arsa
Arsb
Arsc/Sts
Arsg
Arsi
Arsj
Arsk
Arse
Arsc/Sts
Arse
-
50
54
60
50
51
51
49
66
54
Arsa
50
-
49
50
51
53
49
48
51
51
Arsb
54
49
-
48
48
59
53
49
49
48
Arsc/Sts
60
50
48
-
47
49
51
46
63
67
Arsg
50
51
48
47
-
49
48
47
49
50
Arsi
51
53
59
49
49
-
63
49
50
51
Arsj
51
49
53
51
48
63
-
49
49
48
Arsk
49
48
49
46
47
49
49
-
51
51
Rat Arse
66
51
49
63
49
50
49
51
-
62
Rat Arsc/Sts
54
51
48
67
50
51
48
51
62
-
Arse [GenBank:BE457721], Arsa [GenBank:NM_009713], Arsb [GenBank:NM_009712.3], Arsc/Sts [GenBank:NM_009293.1], Arsg [GenBank:NM_028710.2],
Arsi [GenBank:NM_001038499.1], Arsj [GenBank:NM_173451.2], Arsk [GenBank:NM_029847.4], rat Arse [GenBank:NM_001047885.1], rat Arsc/Sts
[GenBank:NM_012661.1]
85
2.7 References
Affymetrix (2008). GeneChip® Mouse Genome 430 2.0 Array (Santa Clara:
Affymetrix).
Bacolla, A., Collins, J.R., Gold, B., Chuzhanova, N., Yi, M., Stephens, R.M., Stefanov,
S., Olsh, A., Jakupciak, J.P., Dean, M., et al. (2006). Long homopurine*homopyrimidine
sequences are characteristic of genes expressed in brain and the pseudoautosomal region.
Nucleic Acid Res 34, 2663-2675.
Belin, V., Cusin, V., Viot, G., Girlich, D., Toutain, A., Moncla, A., Vekemans, M., Le
Merrer, M., Munnich, A., and Cormier-Daire, V. (1998). SHOX mutations in
dyschondrosteosis (Leri-Weill syndrome). Nature genetics 19, 67-69.
Bérubé, N.G., Mangelsdorf, M., Jagla, M., Vanderluit, J., Garrick, D., Gibbons, R.J.,
Higgs, D.R., Slack, R.S., and Picketts, D.J. (2005). The chromatin-remodeling protein
ATRX is critical for neuronal survival during corticogenesis. The Journal of clinical
investigation 115, 258-267.
Bixel, G., Kloep, S., Butz, S., Petri, B., Engelhardt, B., and Vestweber, D. (2004). Mouse
CD99 participates in T-cell recruitment into inflamed skin. Blood 104, 3205-3213.
Blaschke, R.J., Monaghan, A.P., Schiller, S., Schechinger, B., Rao, E., Padilla-Nash, H.,
Ried, T., and Rappold, G.A. (1998). SHOT, a SHOX-related homeobox gene, is
implicated in craniofacial, brain, heart, and limb development. Proceedings of the
National Academy of Sciences of the United States of America 95, 2406-2411.
Carrel, L., and Willard, H.F. (2005). X-inactivation profile reveals extensive variability in
X-linked gene expression in females. Nature 434, 400-404.
Charlesworth, B., and Charlesworth, D. (2000). The degeneration of Y chromosomes.
Philosophical transactions of the Royal Society of London 355, 1563-1572.
Clamp, M., Cuff, J., Searle, S.M., and Barton, G.J. (2004). The Jalview Java alignment
editor. Bioinformatics (Oxford, England) 20, 426-427.
Clement-Jones, M., Schiller, S., Rao, E., Blaschke, R.J., Zuniga, A., Zeller, R., Robson,
S.C., Binder, G., Glass, I., Strachan, T., et al. (2000). The short stature homeobox gene
SHOX is involved in skeletal abnormalities in Turner syndrome. Hum Mol Genet 9, 695702.
Daniele, A., Parenti, G., d'Addio, M., Andria, G., Ballabio, A., and Meroni, G. (1998).
Biochemical characterization of arylsulfatase E and functional analysis of mutations
found in patients with X-linked chondrodysplasia punctata. American journal of human
genetics 62, 562-572.
86
Disteche, C.M., Brannan, C.I., Larsen, A., Adler, D.A., Schorderet, D.F., Gearing, D.,
Copeland, N.G., Jenkins, N.A., and Park, L.S. (1992). The human pseudoautosomal GMCSF receptor alpha subunit gene is autosomal in mouse. Nature genetics 1, 333-336.
Dooley, T.P., Haldeman-Cahill, R., Joiner, J., and Wilborn, T.W. (2000). Expression
profiling of human sulfotransferase and sulfatase gene superfamilies in epithelial tissues
and cultured cells. Biochemical and biophysical research communications 277, 236-245.
Eisen, J.A., Sweder, K.S., and Hanawalt, P.C. (1995). Evolution of the SNF2 family of
proteins: subfamilies with distinct sequences and functions. Nucleic acids research 23,
2715-2723.
Ellison, J., Franckle, L.U., and LJ, S. (1996). Rapid evolution of human pseudoautosomal
genes and their mouse homologs. Mammalian Genome 7, 25-30.
Franco, B., Meroni, G., Parenti, G., Levilliers, J., Bernard, L., Gebbia, M., Cox, L.,
Maroteaux, P., Sheffield, L., Rappold, G.A., et al. (1995). A cluster of sulfatase genes on
Xp22.3: mutations in chondrodysplasia punctata (CDPX) and implications for warfarin
embryopathy. Cell 81, 15-25.
Garrick, D., Samara, V., McDowell, T.L., Smith, A.J., Dobbie, L., Higgs, D.R., and
Gibbons, R.J. (2004). A conserved truncated isoform of the ATR-X syndrome protein
lacking the SWI/SNF-homology domain. Gene 326, 23-34.
Garrick, D., Sharpe, J.A., Arkell, R., Dobbie, L., Smith, A.J., Wood, W.G., Higgs, D.R.,
and Gibbons, R.J. (2006). Loss of Atrx affects trophoblast development and the pattern of
X-inactivation in extraembryonic tissues. PLoS genetics 2, e58.
Gauer, F., and Craft, C.M. (1996). Circadian regulation of hydroxyindole-Omethyltransferase mRNA levels in rat pineal and retina. Brain research 737, 99-109.
Gianfrancesco, F., Sanges, R., Esposito, T., Tempesta, S., Rao, E., Rappold, G.,
Archidiacono, N., Graves, J.A.M., Forabosco, A., and D'Urso, M. (2001). Differential
Divergence of Three Human Pseudoautosomal Genes and Their Mouse Homologs:
Implications for Sex Chromosome Evolution. Genome Res 11, 2095-2100.
Gibbons, R.J., and Higgs, D.R. (2000). Molecular-clinical spectrum of the ATR-X
syndrome. American journal of medical genetics 97, 204-212.
Gibbons, R.J., McDowell, T.L., Raman, S., O'Rourke, D.M., Garrick, D., Ayyub, H., and
Higgs, D.R. (2000). Mutations in ATRX, encoding a SWI/SNF-like protein, cause
diverse changes in the pattern of DNA methylation. Nature genetics 24, 368-371.
Gibbons, R.J., Picketts, D.J., Villard, L., and Higgs, D.R. (1995). Mutations in a putative
global transcriptional regulator cause X-linked mental retardation with alpha-thalassemia
(ATR-X syndrome). Cell 80, 837-845.
87
Graves, J.A. (2006). Sex chromosome specialization and degeneration in mammals. Cell
124, 901-914.
Graves, J.A.M., Wakefield, M.J., and Toder, R. (1998). The origin and evolution of the
pseudoautosomal regions of human sex chromosomes. Hum Mol Genet 7, 1991-1996.
Guindon, S., and Gascuel, O. (2003). A simple, fast, and accurate algorithm to estimate
large phylogenies by maximum likelihood. Syst Biol 52, 696-704.
Hebert, J.M., and McConnell, S.K. (2000). Targeting of cre to the Foxg1 (BF-1) locus
mediates loxP recombination in the telencephalon and other developing head structures.
Developmental biology 222, 296-306.
Hofmann, K., and Baron, M. (2007). BoxShade Server 3.21.
Levy, M.A., Fernandes, A.D., Tremblay, D.C., Seah, C., and Berube, N.G. (2008). The
SWI/SNF protein ATRX co-regulates pseudoautosomal genes that have translocated to
autosomes in the mouse genome. BMC genomics 9, 468.
Lien, S., Szyda, J., Schechinger, B., Rappold, G., and Arnheim, N. (2000). Evidence for
heterogeneity in recombination in the human pseudoautosomal region: high resolution
analysis by sperm typing and radiation-hybrid mapping. American journal of human
genetics 66, 557-566.
Liu, G., Loraine, A.E., Shigeta, R., Cline, M., Cheng, J., Valmeekam, V., Sun, S., Kulp,
D., and Siani-Rose, M.A. (2003). NetAffx: Affymetrix probesets and annotations.
Nucleic acids research 31, 82-86.
Lyon, M.F. (1989). X-chromosome inactivation as a system of gene dosage
compensation to regulate gene expression. Progress in nucleic acid research and
molecular biology 36, 119-130.
McDowell, T.L., Gibbons, R.J., Sutherland, H., O'Rourke, D.M., Bickmore, W.A.,
Pombo, A., Turley, H., Gatter, K., Picketts, D.J., Buckle, V.J., et al. (1999). Localization
of a putative transcriptional regulator (ATRX) at pericentromeric heterochromatin and
the short arms of acrocentric chromosomes. Proceedings of the National Academy of
Sciences of the United States of America 96, 13983-13988.
Meroni, G., Franco, B., Archidiacono, N., Messali, S., Andolfi, G., Rocchi, M., and
Ballabio, A. (1996). Characterization of a cluster of sulfatase genes on Xp22.3 suggests
gene duplications in an ancestral pseudoautosomal region. Hum Mol Genet 5, 423-431.
Notredame, C., Higgins, D.G., and Heringa, J. (2000). T-Coffee: A novel method for fast
and accurate multiple sequence alignment. J Mol Biol 302, 205-217.
Ohno, S. (1967). Sex chromosomes and sex-linked genes (Berlin: Springer-Verlag).
88
Park, L.S., Martin, U., Sorensen, R., Luhr, S., Morrissey, P.J., Cosman, D., and Larsen,
A. (1992). Cloning of the low-affinity murine granulocyte-macrophage colonystimulating factor receptor and reconstitution of a high-affinity receptor complex.
Proceedings of the National Academy of Sciences of the United States of America 89,
4295-4299.
Park, S.H., Shin, Y.K., Suh, Y.H., Park, W.S., Ban, Y.L., Choi, H.S., Park, H.J., and
Jung, K.C. (2005). Rapid divergency of rodent CD99 orthologs: implications for the
evolution of the pseudoautosomal region. Gene 353, 177-188.
Perry, J., Palmer, S., Gabriel, A., and Ashworth, A. (2001). A Short Pseudoautosomal
Region in Laboratory Mice. Genome Res 11, 1826-1832.
Picketts, D.J., Higgs, D.R., Bachoo, S., Blake, D.J., Quarrell, O.W., and Gibbons, R.J.
(1996). ATRX encodes a novel member of the SNF2 family of proteins: mutations point
to a common mechanism underlying the ATR-X syndrome. Human molecular genetics 5,
1899-1907.
Ried, K., Rao, E., Schiebel, K., and Rappold, G.A. (1998). Gene duplications as a
recurrent theme in the evolution of the human pseudoautosomal region 1: isolation of the
gene ASMTL. Hum Mol Genet 7, 1771-1778.
Ritchie, K., Seah, C., Moulin, J., Isaac, C., Dick, F., and Berube, N.G. (2008). Loss of
ATRX leads to chromosome cohesion and congression defects. The Journal of cell
biology 180, 315-324.
Ross, M.T., Grafham, D.V., Coffey, A.J., Scherer, S., McLay, K., Muzny, D., Platzer,
M., Howell, G.R., Burrows, C., Bird, C.P., et al. (2005). The DNA sequence of the
human X chromosome. Nature 434, 325-337.
Shears, D.J., Vassal, H.J., Goodman, F.R., Palmer, R.W., Reardon, W., Superti-Furga,
A., Scambler, P.J., and Winter, R.M. (1998). Mutation and deletion of the
pseudoautosomal gene SHOX cause Leri-Weill dyschondrosteosis. Nature genetics 19,
70-73.
Steensma, D.P., Gibbons, R.J., and Higgs, D.R. (2005). Acquired alpha-thalassemia in
association with myelodysplastic syndrome and other hematologic malignancies. Blood
105, 443-452.
Trouw, L.A., Blom, A.M., and Gasque, P. (2008). Role of complement and complement
regulators in the removal of apoptotic cells. Molecular immunology 45, 1199-1207.
Urbitsch, P., Salzer, M.J., Hirschmann, P., and Vogt, P.H. (2000). Arylsulfatase D gene
in Xp22.3 encodes two protein isoforms. DNA and cell biology 19, 765-773.
Whelan, S., and Goldman, N. (2001). A general empirical model of protein evolution
derived from multiple protein families using a maximum-likelihood approach. Mol Biol
Evol 18, 691-699.
89
Xue, Y., Gibbons, R., Yan, Z., Yang, D., McDowell, T.L., Sechi, S., Qin, J., Zhou, S.,
Higgs, D., and Wang, W. (2003). The ATRX syndrome protein forms a chromatinremodeling complex with Daxx and localizes in promyelocytic leukemia nuclear bodies.
Proceedings of the National Academy of Sciences of the United States of America 100,
10635-10640.
Yu, L., Gu, S., Alappat, S., Song, Y., Yan, M., Zhang, X., Zhang, G., Jiang, Y., Zhang,
Z., Zhang, Y., et al. (2005). Shox2-deficient mice exhibit a rare type of incomplete
clefting of the secondary palate. Development 132, 4397-4406.
90
Chapter 3
3
ATRX aids transcription elongation through G-rich gene
segments in a process involving histone H3.3
incorporation
The aim of the work outlined in this chapter was to identify mechanisms by which ATRX
modulates gene expression. The aPAR gene Dhrsx was used as a model gene for this
purpose. My findings suggest that ATRX can regulate the expression of genes by
influencing transcriptional elongation. This represents the first evidence of such a
function for ATRX and may have important implications in understanding how ATRX
mutations lead to cognitive deficits and brain tumors in humans.
3.1 Introduction
Decreased activity of the SWI2/SNF2 chromatin remodeling protein ATRX, as a result of
mutations in the corresponding gene, causes a rare syndrome called alpha thalassemia
mental retardation, X linked (the ATR-X syndrome) (Gibbons et al., 1995). Affected
individuals exhibit intellectual disabilities, facial dysmorphisms, genital abnormalities
and alpha thalassemia, among other less common phenotypes (Gibbons, 2006). At a
molecular level, ATR-X patients show aberrant DNA methylation of repetitive DNA
regions, including ribosomal DNA, subtelomeric regions, and DYZ2 repeats (Gibbons et
al., 2000). More recently, ATRX mutations have been identified in pancreatic
neuroendocrine tumors (de Wilde et al., 2012; Heaphy et al., 2011; Jiao et al., 2011) and
brain cancer (Cheung Nv and et al., 2012; Heaphy et al., 2011; Jiao et al., 2012; KhuongQuang et al., 2012; Molenaar et al., 2012; Schwartzentruber et al., 2012). Tumorigenic
cells lacking ATRX expression typically exhibit alternative lengthening of telomeres
(ALT), a recombination process that maintains telomere length and proliferative capacity
in the absence of the telomerase enzyme (Cheung Nv and et al., 2012; de Wilde et al.,
2012; Heaphy et al., 2011; Jiao et al., 2012; Schwartzentruber et al., 2012). ALT-positive
cell lines frequently lack ATRX, although artificial depletion of ATRX does not itself lead
to ALT (Lovejoy et al., 2012).
91
ATRX contains a conserved ATPase/helicase domain and a zinc finger ATRXDNMT3A/B-DNMT3L (ADD) domain that is shared with de novo methyltransferases
(Aapola et al., 2000). It is enriched at heterochromatic regions including the inactive X
chromosome (Baumann and De La Fuente, 2008), pericentromeric heterochromatin
(McDowell et al., 1999), and telomeres (Law et al., 2010). At pericentromeric
heterochromatin and telomeres, ATRX forms a complex with the death-associated
protein (DAXX) and deposits the replication-independent histone variant H3.3 (Goldberg
et al., 2010; Lewis et al., 2010; Wong et al., 2010). However, the deposition of H3.3 at
transcribed genes and regulatory elements is believed to occur independently of ATRX
(Goldberg et al., 2010). Targeting of ATRX to heterochromatin is mediated by binding
of the ADD domain to the heterochromatic histone mark H3K9me3 in the absence of
H3K4 methylation (Dhayalan et al., 2011; Eustermann et al., 2011; Iwase et al., 2011).
Enrichment of ATRX at telomeric ‘TTAGGG’ tandem repeats may be mediated by the
ability of ATRX to bind G-quadruplexes (Law et al., 2010). G-quadruplexes are short
sequences containing four G triplicates that form a four stranded secondary structure
upon DNA denaturation during replication or transcription (Duquette et al., 2004).
Expression of the non-coding telomeric repeat-containing RNA (TERRA) (Azzalin et al.,
2007; Schoeftner and Blasco, 2008) from telomeric tandem repeats is increased in the
absence of ATRX in mouse ES cells (Goldberg et al., 2010).
We previously reported that loss of ATRX in the mouse forebrain causes reduced
expression of ancestral pseudoautosomal (aPAR) genes (Levy et al., 2008). These genes
are located on autosomes in the mouse, but are pseudoautosomal (located on the X and Y
chromosomes and expressed biallelically in males and females) in humans and in the
common evolutionary ancestors between humans and mice. These aPAR genes are
amongst the most downregulated genes in the ATRX-null mouse forebrain regardless of
the developmental time point (Levy et al., 2008). The most affected genes are
dehydrogenase/reductase (SDR family) X-linked (Dhrsx) and colony stimulating factor 2
receptor, alpha (Csf2ra). These genes are located at the subtelomeric region of mouse
chromosomes 4 and 19, respectively. Other downregulated aPAR genes Asmtl and Cd99
have not yet been mapped to the mouse genome, indicating that they are likely positioned
92
within highly repetitive regions that are notoriously difficult to sequence and place within
existing genomic assemblies.
A direct mechanism for the regulation of gene transcription by ATRX has not yet been
identified and could be relevant to the function of ATRX in the central nervous system
and for its tumor suppressive activities. Here we report that ATRX and H3.3 are
enriched at G-rich regions within the gene bodies of Dhrsx and other aPAR genes in the
mouse brain. Loss of ATRX causes decreased H3.3 occupancy within the gene body,
without affecting TERRA levels, histone modifications or DNA methylation.
Importantly we provide evidence that in the absence of ATRX, RNA polymerase II
progression is impeded at the G-rich region of Dhrsx. We propose a model whereby
ATRX facilitates transcription elongation of particular target genes by assisting the
passage of the transcription machinery through G-rich templates.
3.2 Materials and Methods
3.2.1
Mouse husbandry and genotyping
The Atrx gene was conditionally deleted in the mouse forebrain and mice were genotyped
as previously described (Bérubé et al., 2005; Seah et al., 2008). To obtain E13.5
embryos, midday of vaginal plug discovery was considered E0.5. All animal studies
were conducted in compliance with the regulations of The Animals for Research Act of
the province of Ontario, the guidelines of the Canadian Council on Animal Care, and the
policies and procedures approved by the University of Western Ontario Council on
Animal Care.
3.2.2
Mouse embryonic fibroblast isolation, culture and viral
infection
Primary mouse embryonic fibroblasts (MEFs) were isolated from male E13.5 AtrxloxP
embryos. Internal organs and heads were removed, embryos were minced, digested in
trypsin at 37°C for 45 minutes, then cultured in DMEM (Sigma-Aldrich) with 10% FBS
(Sigma-Aldrich), Pen Strep (Gibco), and GlutaMAX (Invitrogen). Experiments were
performed at passages 3 to 6. To delete Atrx, MEFs at 30-40% confluence were
93
incubated with 50 MOI Ad-Cre-GFP, or Ad-CMV-GFP (Vector Biolabs) and assayed 72
hours post-infection.
3.2.3
RNA isolation and transcriptional assays
Forebrains were dissected, flash frozen, and stored at -80°C and MEFs were grown in
culture and scraped off the plates. Total RNA was isolated using the RNeasey Mini Kit
(Qiagen) and cytoplasmic and nuclear RNA was extracted using the RNeasy Plus Mini
Kit (Qiagen) in conjunction with the supplementary protocol, “Purification of
cytoplasmic RNA from animal cells using the RNeasy Mini Kit” (Qiagen). For
expression analysis of Atrx, Csf2ra, and Dhrsx, cDNA was synthesized from 1 µg of
RNA using the SuperScript II Reverse Transcriptase kit (Invitrogen) according to the
manufacturer’s instructions. For non-coding RNA expression analysis, cDNA was
synthesized from 0.5 µg of cytoplasmic or nuclear RNA using the SuperScript III
Reverse Transcriptase kit (Invitrogen). PCR of cDNA was performed as follows: 95°C
for 10 seconds, anneal for 20 seconds, 72°C for 30 seconds, for 30-40 cycles to ensure
amplification in the linear range. Real-time PCR was performed in duplicate on a
Chromo4 Continuous Fluorescence Detector (Bio-Rad) in the presence of iQ SYBR
Green Supermix and recorded using the Opticon Monitor 3 software (Bio-Rad). Samples
were amplified for 35-40 cycles as follows: 95°C for 10 seconds, annealed for 20
seconds, 72°C for 30 seconds. To ensure amplicon purity, a melting curve was generated
and samples were resolved on an agarose gel. Gene expression was normalized to
expression of β-actin and/or Gapdh. Normalization and relative gene expression levels
were calculated using the ΔΔCt method with the Excel Gene Expression macro (BioRad). Primer sequences are listed in Supplementary Table 3-1.
3.2.4
RNA dot blots
RNA was manually spotted onto Amersham Hybond-XL nylon membrane (GE
Healthcare Life Sciences) according to the manufacturer’s instructions.
32
P end-labelled
probes were generated using T4 polynucleotide kinase (NEB) along with ATP[ɤ-32P]
3000Ci/mmol (PerkinElmer) and oligos complementary to TERRA or Gapdh (Zhang et
al., 2009), then purified using illustra MicroSpin G-25 columns (GE Healthcare Life
94
Sciences). Membranes were pre-hybridized in Amersham Rapid-Hyb Buffer (GE
Healthcare Life Sciences) for 20 minutes at 42°C, hybridized with 25 µL labelled
TERRA probe at 42°C for 1 hour, washed according to the Hybond-XL instructions, then
exposed to Amersham Hyperfilm MP (GE Healthcare Life Sciences) at -80°C for 6 hours
to 14 days to generate multiple exposures. Blots were stripped with boiling 0.1% SDS
then washed in 2X SSC, exposed to film to ensure removal of probes, hybridized with the
Gapdh probe, and re-exposed. Dots on non-saturated exposures were quantified using
the integrated density method with ImageJ (Rasband, 2012), and normalized to Gapdh
levels.
3.2.5
Bisulfite mutagenesis and sequencing
Genomic DNA was isolated from neonatal mouse cortices using the DNeasy Blood &
Tissue Kit (Qiagen). Bisulfite treatment was performed essentially as described (MarketVelker et al., 2010), except the starting material used was purified gDNA, and the final
DNA was purified using the QIAquick Gel Extraction Kit (Qiagen). Nested PCR (see
Supplementary Table 3-1 for primer sequence) was performed, including a 72°C, 10 min
step at the end of the second round of PCR to add adenine overhangs. Purified amplicons
were ligated into a pGEM-T Easy vector using T4 DNA Ligase (both Promega) and clone
inserts were sequenced at the London Regional Genomics Centre, London, Canada, or
Bio Basic Inc., Markham, Canada.
3.2.6
Chromatin immunoprecipitation
All reagents are from Sigma-Aldrich unless otherwise noted. ChIP was performed as
previously described (Kernohan et al., 2010) except that the cells were fixed at 37°C, the
LiCl wash was omitted following the IP step and all tissues were fixed fresh. For ChIPsequencing, samples were pre-cleared for 1 hour with 20 µL of ChIP-Grade Protein G
Magnetic Beads (Cell Signaling). 1/25th the amount of chromatin used for IP was kept
for input. 3 µg of antibody (15 µg for H300 and D5, or 3 µL where concentration was
not specified) was added and immunoprecipitation reactions were incubated 16-20 hours
at 4°C. Antibodies (from Millipore unless noted) used were: rabbit IgG (PP64B), H4Ac
(06-866), H3K4Me3 (04-745), H3K9Me3 (07-442), H3K27Me3 (07-449), Histone H3.3
95
(17-10245), RNA PolII (05-623), mouse IgG (Santa Cruz sc-2025), ATRX D5 (Santa
Cruz, sc-55584), ATRX H300 (Santa Cruz, sc-15408). Immunoprecipitated samples
were incubated with 20 µL Magnetic Beads for 2 hours to collect the chromatin/antibody
complexes, beads were washed, chromatin/antibody complexes eluted, and DNA purified
as previously described (Kernohan et al., 2010). Real-time PCR reactions were
performed as described above, and percent input was calculated as previously described
(Kernohan et al., 2010).
3.2.7
Next generation sequencing and analysis
For ChIP-seq, DNA was sent to The Centre for Applied Genomics at the Hospital for
Sick Children, Toronto, Canada, and 30-40 million 100 base pair, paired-end reads were
generated for each sample using an Illumina HiSeq 2000. Sequences (cDNA, since
genomic DNA sequences are unavailable) for Asmtl (4713 bp; AK084779 and
AK010990), and Cd99 (1976 bp; NW_016967) were added to the mouse genome version
mm9 (including ‘random’ chromosomes) and a Bowtie index (Langmead et al., 2009)
was created. Raw sequencing data for ATRX and H3.3 ESC ChIP-seq was downloaded
from the NCBI Sequence Read Archive (Accession numbers GSE22162 and GSE16893).
H3.3 ChIP-seq data for control and ATRX-null forebrain tissue was generated as
described above. Quality control was done using FastQC (Andrews, 2012) and reads
were aligned to the mouse genome using Bowtie version 0.12.8 in the -n alignment mode.
During alignment up to 3 mismatches were allowed and reads that aligned to more than
one location were discarded. Duplicate sequences were removed. Genome-wide
coverage tracks (.wig files) were generated using custom Perl scripts to extend reads to
their fragment lengths (for single end reads, average fragment length was determined
using SISSRS (Jothi et al., 2008)) and to normalize coverage to 20 million reads. Data
was then viewed using the UCSC Genome Browser (Kent et al., 2002). G-quadruplexes
were identified using Quadfinder (Scaria et al., 2006) with default settings.
Custom Perl scripts were used to perform the following analysis. Genes enriched for
ATRX and H3.3 were identified by dividing each gene in the control sample into 100 bp
bins, then looking for bins that had a minimum average coverage of 10 reads and a
minimum enrichment of five-fold over input for both ATRX and H3.3. Sites found
96
enriched in the control were then compared with the corresponding location in the
ATRX-null sample to look for sites with a 1.5 fold or greater decrease in H3.3
enrichment. Genes were considered positive hits if they had at least two bins within 500
bp fulfilling the above criteria. Genomic DNA sequences within the identified regions
were then screened for high GC content (70% G or C) overlapping the ATRX/H3.3
binding site. Telomere enrichment was determined by looking for sequence reads that
consisted of at least 80% telomere repeats (TTAGGG or CCCTAA). Genome-wide
distribution of H3.3 was determined by dividing each chromosome into 500 segments,
summing the number of reads within each segment, then calculating average enrichment
within each segment across mouse chromosomes 1-19 and X.
3.3 Results
3.3.1
ATRX is required for the normal expression of Dhrsx and
flanking non-coding RNAs in mouse cells
We have previously shown that ATRX regulates the expression of Dhrsx, Csf2ra and
other aPAR genes in the mouse brain (Levy et al., 2008). To determine the genomic
location of Dhrsx, we examined the mouse genome (Waterston et al., 2002) using the
UCSC Genome Browser (Kent et al., 2002). Dhrsx is most likely subtelomeric on
chromosome 4 (Gianfrancesco et al., 2001), and while mouse genomes up to and
including version mm10 place it on an unassembled fragment of chromosome 4, the
alternate assembly Mm_Celera (Mural et al., 2002) places Dhrsx approximately 110 kb
from the end of an incomplete chromosome 4 (accession AC_000026.1). While the
precise distance from the telomere is unknown, there are high concentrations of telomere
sequence repeats (TTAGGG) flanking the gene (Figure 3-1A). These likely represent
interstitial telomeric sequences (ITSs) (Lin and Yan, 2008) as opposed to actual
telomeres, since the repeats are generally not in tandem and do not continue to the end of
the fragments. Along with the ITSs, the UCSC Genome Browser shows non-coding
ESTs and mRNAs flanking Dhrsx, in particular in the 5’ region overlapping the larger
concentration of ITSs (Figure 3-1A). We therefore wondered if non-coding RNAs are
transcribed from the regions flanking Dhrsx in the mouse brain, and if so, whether this
expression correlates with expression of the Dhrsx gene itself in the absence of ATRX.
97
Figure 3-1: Expression of non-coding RNAs flanking Dhrsx is decreased in the Atrxnull mouse forebrain.
(A) Analysis of 50 kb of genomic DNA around Dhrsx reveals several mRNAs, expressed
sequence tags (ESTs), and interstitial telomere sequences (ITS) both upstream and
downstream of the Dhrsx gene. (B) RT-qPCR of RNA isolated from the P17 mouse
forebrain showed the presence of transcripts from approximately 7 kb upstream of Dhrsx
to 5 kb downstream, with higher levels 5’. Highest expression was seen with primers that
also detect exon 1 of Dhrsx. (C) Semi-quantitative RT-PCR showed nuclear enrichment
of transcripts flanking Dhrsx. Cyto, cytoplasmic fraction. Nuc, nuclear fraction. (D)
RT-qPCR of RNA isolated from control and ATRX-null P17 forebrains showed
decreased expression of all sites analyzed at Dhrsx in the absence of ATRX. In (B) and
(D), error bars represent standard error of the mean for n=3. *p-value < 0.05.
98
To look for expression from regions surrounding Dhrsx, we designed primers to sites
upstream and downstream of the gene (locations indicated in Figure 3-1A), and used
quantitative reverse transcription polymerase chain reaction (qRT-PCR) to measure
transcript levels. Expression was normalized to amplification from gDNA to account for
primer efficiency. We observed moderate expression from up to 7 kb upstream of the
Dhrsx start site and low expression up to 5 kb downstream of the gene (Figure 3-1B). As
a control, primers were designed to the first exon of Dhrsx. This site exhibited highest
expression, but it is not clear whether these primers are detecting just the Dhrsx
transcript, or the Dhrsx transcript along with transcripts initiating upstream of Dhrsx
which overlap with the gene. Non-quantitative RT-PCR showed that transcripts from
sites flanking Dhrsx are generally enriched in the nucleus (Figure 3-1C), suggesting that
these transcripts may be non-coding RNAs (Forrest et al., 2009). When Atrx was deleted,
we found a decrease in expression at most sites, although not all decreases were
statistically significant (Figure 3-1D). These results demonstrate that transcripts are
generated from within some of the ITSs, and that loss of ATRX affects a region larger
than just the Dhrsx gene itself.
3.3.2
ATRX deficiency in the mouse forebrain or in MEFs does not
affect TERRA levels
Loss of ATRX in mouse embryonic stem cells (mESCs) was reported to induce a ~1.7
fold increase in levels of non-coding telomeric repeat-containing RNA (TERRA)
(Goldberg et al., 2010). TERRA transcription starts in the subtelomere (Azzalin et al.,
2007) and in human cells is driven by repetitive CpG-island promoters within 1 kb of the
start of the telomeric hexamers (Nergadze et al., 2009). Increased TERRA expression
can promote heterochromatin formation at telomeres by binding to HP1α and H3K9Me3
(Deng et al., 2009), proteins that interact with ATRX (Dhayalan et al., 2011; McDowell
et al., 1999). The downregulation of subtelomeric genes in the ATRX-null brain may
therefore be due to their proximity to telomeres, perhaps as part of the telomere position
effect (TPE) (Baur et al., 2001; Gottschling et al., 1990; Pedram et al., 2006).
A series of radioactive RNA dot blots were performed to assess TERRA transcript levels
(Figure 3-2A). The results did not show changes in the levels of TERRA transcripts in
99
the P17 ATRX-null forebrain (Figure 3-2B). To confirm these findings, we examined
this phenomenon in mouse embryonic fibroblasts (MEFs). We used adenoviral vectors
expressing Cre recombinase to delete Atrx in MEFs isolated from Atrx-floxed mice
(Bérubé et al., 2005). qRT-PCR and immunofluorescence assays revealed nearly
undetectable levels of Atrx RNA and protein upon Cre recombinase expression
(Supplementary Figure 3-10 A,B). In addition, both Csf2ra and Dhrsx showed a 2.7 fold
decrease in transcript levels in ATRX-null MEFs (Supplementary Figure 3-10B), a result
analogous to that seen in the mouse forebrain (Levy et al., 2008). Thus loss of ATRX in
MEFs recapitulates the gene expression effects observed in vivo in brain tissue. The
expression of TERRA in wildtype MEFs was considerably lower than in forebrain tissue
and MEF blots had to be exposed for approximately four times longer than the forebrain
RNA blots to generate comparable signal intensity. Again, we observed that the levels of
TERRA transcripts were comparable between control and Ad-Cre treated cells (Figure 32C,D). To completely rule out an effect of ATRX loss on TERRA levels, we analyzed
RNA sequencing data of control (109,539,088 sequence reads) and Atrx-null (84,639,248
sequence reads) E14 forebrains (A. Watson, unpublished data). TERRA RNA
(sequences made up of (TTAGGG)10 or (CCCTAA)10) constituted 2.54x10-4% of all
sequence reads in control and 2.95x10-4% of all sequence reads in the Atrx-null forebrain.
Therefore, we detect only a 1.16 fold increase in TERRA levels in the Atrx-null
embryonic forebrain, strongly suggesting that TERRA levels are not affected by ATRX,
and that TERRA is regulated differently in the mouse brain and fibroblasts compared to
ESCs. Moreover, Dhrsx gene silencing upon loss of ATRX cannot be explained by a
change in TERRA transcript levels.
100
Figure 3-2: TERRA expression is not altered in forebrain tissue or mouse
embryonic fibroblasts lacking ATRX.
(A)
32
P-labelled probes for TERRA and Gapdh were hybridized to membranes spotted
with cytoplasmic and nuclear RNA from control or ATRX-null P17 mouse forebrains. A
representative experiment is shown from n=4. The non-coding TERRA was enriched in
the nuclear fraction while Gapdh was equal between fractions. (B) Quantification of spot
intensity showed no change in TERRA expression between control and ATRX-null
forebrains. Error bars represent standard error of the mean for n=4. (C)
32
P-probes for
TERRA and Gapdh were hybridized to membranes spotted with cytoplasmic and nuclear
RNA from uninfected MEFs, MEFs infected with a control adenovirus expressing GFP,
or MEFs infected with an adenovirus expressing Cre recombinase to delete Atrx. A
representative experiment is shown from n=2. The non-coding TERRA was enriched in
the nuclear fraction while Gapdh was equal between fractions.
(D) Quantification
showed no change in TERRA expression between control and ATRX-null forebrains.
Error bars represent the range for n=2.
101
3.3.3
ATRX and H3.3 are enriched within the gene body of Dhrsx
We next investigated the possibility that ATRX localizes near or within the aPAR genes
in the mouse brain. To study this, we first analyzed data from previously published
ATRX ChIP sequencing (ChIP-seq) done in ESCs (Law et al., 2010). Our analysis
demonstrated that ATRX is highly enriched across a 5 kb region of the Dhrsx gene body
(Figure 3-3A). Importantly, this segment of the gene is G-rich and has a high potential of
forming G-quadruplex structures as predicted by Quadfinder (Scaife, 2005) (Figure 33A). To determine whether ATRX also binds within the Dhrsx gene in the mouse brain
we performed ChIP-qPCR for ATRX in the neonatal forebrain. ChIP with two different
antibodies showed that ATRX is bound to Dhrsx, similar to the results in ESCs (Figure 33B).
It was previously established that ATRX is required for the deposition of H3.3 at
telomeres (Goldberg et al., 2010). We therefore examined H3.3 distribution at Dhrsx.
To achieve this, we analyzed the available ChIP-seq data from mouse ESCs which used
EYFP-tagged H3.3 (Goldberg et al., 2010) as well as our own H3.3 ChIP-seq data in the
neonatal mouse forebrain done with an H3.3-specific antibody. We were surprised to
find that H3.3 enrichment mirrored that of ATRX at Dhrsx (Figure 3-3A). We confirmed
enrichment of H3.3 across the 5 kb G-rich region of Dhrsx by ChIP-qPCR
(Supplementary Figure 3-11A). These findings show that H3.3 incorporation within gene
body nucleosomes corresponds to the presence of ATRX at the same chromatin region.
3.3.4
Reduced levels of H3.3 at Dhrsx and other aPAR genes in
the absence of ATRX correlates with decreased gene
expression
Since ATRX and H3.3 co-localize within a gene that exhibits decreased expression in the
absence of ATRX, we examined whether loss of ATRX affects H3.3 deposition at that
site. Indeed, we observed a substantial loss of H3.3 at Dhrsx in ATRX-null mouse ESCs
and forebrain (Figure 3-3A). ChIP-qPCR for H3.3 at Dhrsx showed loss of H3.3 at both
P0.5 and P17 (Figures 3-3C and Supplementary Figure 11-3B). Results obtained in
ATRX-null neonatal brain showed an approximately 50% decrease in H3.3, but this
effect was more modest at P17 (Supplementary Figure 11-3B). These results suggest that
102
H3.3 is not maintained or incorporated as efficiently in the ATRX/H3.3/G-rich region of
Dhrsx when ATRX is absent, potentially implicating H3.3 deposition in the control of
transcription at specific ATRX target genes. To determine whether the binding of ATRX
and H3.3 is specific to Dhrsx or is a common feature of all the aPAR genes regulated by
ATRX, we examined the ChIP-seq data at three other genes: Asmtl, Cd99 and Csf2ra.
We found that ATRX and H3.3 are also highly enriched in the gene body of these
additional aPAR genes and that H3.3 enrichment is decreased in the absence of ATRX
(Figure 3-4A). Moreover, these three aPAR genes are enriched for putative Gquadruplexes (Figure 3-4A). Thus, the correlation between ATRX-dependent enrichment
of H3.3 within the gene body and gene transcript levels is not specific to Dhrsx, as it is
also observed at several other ATRX-regulated genes.
103
Figure 3-3: ATRX and H3.3 enrichment at Dhrsx.
(A) ChIP-seq raw sequence data from previously published studies of ATRX (GEO
accession GSE22162) and H3.3 (GEO accession GSE16893) in mouse embryonic stem
cells (ESCs) and novel ChIP-seq for H3.3 in the P0.5 mouse forebrain were aligned to the
mouse genome and visualized at Dhrsx. ATRX and H3.3 are highly enriched across 5 kb
at the 3’ end of Dhrsx, and H3.3 was lost in the absence of ATRX. Enrichment overlaps
with high GC content and putative G quadruplexes (as predicted by Quadfinder (Scaif,
2005)). Input tracks showed only background levels of enrichment (see Supplementary
figure 3.12).
(B) ChIP-PCR for ATRX in the P0.5 mouse forebrain showed high
enrichment for ATRX within the binding region identified by ChIP-sequencing. ChIP
was performed with anti-ATRX antibodies H300 and D5. Error bars represent standard
error of the mean. (C) ChIP-qPCR for H3.3 at in the P0.5 mouse forebrain showed a
significant loss of H3.3 throughout its binding domain. Error bars represent standard
error of the mean for n=5. * p<0.05.
104
To identify additional genes potentially regulated by ATRX in a manner similar to the
previously identified aPAR genes, we analyzed genome-wide expression and ChIP data.
Downregulated genes were first identified from the previously published wild-type versus
ATRX-null P0.5 microarray dataset (Levy et al., 2008). Not including probesets for Atrx,
there were 463 probesets with an average downregulation of 1.3 fold or greater, p<0.05,
across 3 pairs. These probesets were then curated to filter the probesets to a list of 366
unique genes that could be reliably mapped to specific locations in the mouse genome.
Each gene was then analyzed in the ATRX ESC (Law et al., 2010) and H3.3 P0.5 ChIPSeq data sets to identify sites that were enriched for both ATRX and H3.3, that showed a
1.5 fold or greater loss of H3.3 in the ATRX-null sample, and that had high (70%) GC
content overlapping the ATRX/H3.3 binding region. Ultimately, this analysis identified
Csf2ra, Dhrsx and two additional genes, Ppp2r3d and 4930526I15Rik. The latter two
genes overlap each other but are expressed in opposite directions and are located on an
unassembled fragment of chromosome 9 in mouse genome version mm9 (Figure 3-4B).
Gene expression changes as shown by microarray analysis (Levy et al., 2008) is not as
drastic as with previous aPAR genes; expression at E13.5, P0.5, and P17 for Ppp2r3d is
-1.2, -1.4, and -1.3 fold, respectively, and for 4930526I15Rik is -1.1, -1.5, and -1.3 fold,
respectively. Analysis of the Ppp2r3d/4930526I15Rik region using Quadfinder (Scaria et
al., 2006) identified potential G-quadruplexes, and an examination of the more recent
mouse genome version mm10 showed that this region is located approximately 140 kb
from the telomere of chromosome 9 and is the most telomeric gene on the chromosome.
105
Figure 3-4: ATRX and H3.3 enrichment at additional aPAR genes.
(A) ChIP-seq raw sequence data from previously published studies of ATRX (GEO
accession GSE22162) and H3.3 (GEO accession GSE16893) in mouse embryonic stem
cells (ESCs) and novel ChIP-seq for H3.3 in the P0.5 mouse forebrain were aligned to the
mouse genome. Enrichment patterns of ATRX and H3.3 at Asmtl, Cd99, and Csf2ra are
similar to that seen at Dhrsx, with high ATRX and H3.3, and loss of H3.3 in ATRX-null
samples.
Enrichment corresponds to putative G quadruplexes (as predicted by
Quadfinder (37)). * Peak artifacts not seen in the paired-end samples due to their higher
alignment specificity.
(B) Analysis of expression microarray and ChIP-seq data
identified Ppp2r3d (and an overlapping non-coding RNA 4930526l15Rik) as an
additional aPAR gene enriched for ATRX and H3.3 and that exhibits decreased H3.3
enrichment in the absence of ATRX. See Supplementary Figure 3-12 for ChIP-seq input
tracks.
106
There is no direct human ortholog of the mouse gene Ppp2r3d, but it is very similar to,
and may have evolved from a common ancestor of the closely related family member
PPP2R3B (Zwaenepoel et al., 2008). PPP2R3B codes for a subunit of protein
phosphatase 2A and is responsible for determining localization, activity, and substrate
specificity (Stevens et al., 2003; Yan et al., 2000; Zhou et al., 2003). Perhaps
unsurprisingly, the gene is location within the human pseudoautosomal region 1 (PAR1).
Therefore, based on the criteria of ATRX binding, H3.3 binding and loss, GC
richness/presence of G-quadruplexes, proximity to the mouse telomere and presence in
the human PAR, Ppp2r3d/4930526I15Rik is an additional region where gene expression
is likely regulated by ATRX through deposition of H3.3.
3.3.5
H3.3 is enriched at telomeres and towards the ends of
chromosomes, and depleted from telomeres in the absence
of ATRX
Previous studies have reported H3.3 enrichment at telomeres in mouse ESCs and
neuroprogenitors and that this enrichment in ESCs is dependent on ATRX (Goldberg et
al., 2010; Wong et al., 2010). Analysis of the P0.5 ChIP-seq dataset revealed that
telomeric sequences were 5.8 fold enriched over input in the control sample and 2.5 fold
enriched in the ATRX-null tissue. This compares to 7.7 and 1.6 fold enriched over input
in wild-type and ATRX-null mouse ESCs, respectively (Figure 3-5A) (Goldberg et al.,
2010). Therefore, in the absence of ATRX, there was a 2.3 fold decrease in telomeric
enrichment of H3.3 in the P0.5 mouse forebrain and a 3.9 fold decrease in mouse ESCs,
demonstrating that ATRX assists H3.3 deposition at telomeres in the differentiating
forebrain, as well as undifferentiated ESCs as previously described (Goldberg et al.,
2010).
107
Figure 3-5: H3.3 distribution along chromosomes and at telomeres.
(A) The percent of total reads representing telomeres was calculated from ESC (Goldberg
et al., 2010) and P0.5 forebrain from H3.3 ChIP-seq, with or without ATRX. ESCs
showed a 2.5 fold decrease and P0.5 showed a 1.6 fold decrease in telomeric sequences
upon loss of ATRX. (B) H3.3 ChIP-seq sequence-read chromosomal enrichment profile.
Each chromosome was divided into 500 “bins” and the number of reads in each bin was
calculated then averaged across all mouse chromosomes.
108
ATRX is also enriched in mouse subtelomeres and towards the ends of chromosomes,
with a high concentration of ATRX binding sites in the most telomeric 15-20% of
chromosomes (Law et al., 2010). H3.3 enrichment profiles along whole chromosomes
were generated using the P0.5 H3.3 ChIP-seq data. In the P0.5 forebrain, H3.3
enrichment was highest towards the telomeres, in the most telomeric 15-20% of the
chromosomes (Figure 3-5B). This corresponded to the same pattern of ATRX binding
sites across chromosomes seen in mouse ESCs (Law et al., 2010). There was no obvious
change in H3.3 enrichment when ATRX was deleted (Figure 3-5B), demonstrating that
while ATRX and H3.3 co-localize at multiple sites throughout the mouse genome, a
regulatory role for ATRX in H3.3 enrichment is only seen at telomeres and a small
number of specific genes.
109
3.3.6
DNA methylation and histone modifications are not altered at
Dhrsx in the absence of ATRX
To determine whether the regulation of Dhrsx by the chromatin remodeling factor ATRX
was solely correlated with a reduction of H3.3 within the gene, we studied additional
chromatin features. The PAR region in humans is GC-rich, and Dhrsx, despite having
translocated to mouse autosomes, maintains this feature. Given the altered patterns of
DNA methylation in ATR-X patients (Gibbons et al., 2000), and presence of CpG islands
at the subtelomeric target genes in the mouse, we first investigated whether loss of ATRX
causes changes in DNA methylation. Dhrsx has a 5’ CpG island in the promoter region
and a second at the 3’ end encompassing the last three exons. Bisulfite mutagenesis and
sequencing of neonatal control forebrain tissue revealed that the Dhrsx 5’ CpG island was
largely unmethylated (12%) and the 3’ island was almost fully methylated (98%).
However, DNA methylation at these sites was similar in the ATRX-null forebrain tissue
(Figure 3-6). We then extended this analysis to Csf2ra, which has a small CpG island at
the promoter (Supplementary Figure 3-13). We found that the Csf2ra 5’ island was
approximately 65% methylated in two littermate-matched ATRX-null and control mice
(Supplementary Figure 3-13). Thus, ATRX does not appear to influence gene expression
at these sites by altering DNA methylation states.
110
Figure 3-6: DNA methylation at Dhrsx CpG islands is not changed in the P0.5
ATRX-null mouse forebrain.
Bisulfite mutagenesis and sequencing at Dhrsx showed low DNA methylation (12%)
within the CpG island overlapping a putative promoter region (CpG1), and high DNA
methylation (98%) within the 3’ CpG island (CpG2). No change was seen between P0.5
control and Atrx-null forebrains (n=2). Empty circles represent unmethylated cytosines,
while filled circles represent methylated cytosines.
111
Next, we analyzed various histone post-translational modifications within and outside the
Dhrsx gene (Figure 3-7A). Promoter regions including the transcription start site of
active genes show high levels of acetylation of histone H4 (H4Ac) and of trimethylation
on lysine 4 of histone H3 (H3K4me3). These active sites are also marked by low levels
of histone H3 tri-methylation one lysine 9 (H3K9me3) and lysine 27 (H3K27me3)
(Barski et al., 2007; Li et al., 2007; Wang et al., 2008). Enrichment of these four histone
modifications was examined across the 20 kb Dhrsx gene, revealing the expected profile
for an active gene. High peaks of H4Ac and H3K4Me3 occur in the promoter region that
overlaps with the 5’ CpG island of Dhrsx. The repressive marks H3K9me3 and
H3K27me3 both showed low levels of enrichment specifically at this site (Figure 3-7BE). In the absence of ATRX no significant changes were observed in the enrichment of
these histone modifications (Figures 3-7B-E). Thus, the effects of ATRX deficiency on
gene expression cannot be explained by changes in CpG island DNA methylation or in
key histone post-translational modifications.
112
Figure 3-7: Histone modifications are unchanged in the P17 ATRX-null mouse
forebrain.
(A) Location of PCR amplicons (numbered) used for ChIP analysis at Dhrsx. Primers 1
and 18 are located 15 kb upstream and downstream, respectively, from the indicated
locations.
ChIP for the active histone modifications H4Ac (B) and H3K4me3 (C)
showed enrichment at the Dhrsx putative promoter region and transcription start site
(TSS) (primer sites 2 and 3) but no change between control and ATRX-null mice. The
repressive modification H3K9me3 (D) and H3K27me3 (E) showed an opposite pattern of
enrichment with low levels at the promoter/TSS region, but also had no significant
changes between in the absence of ATRX.
To control for variability between
experiments, in all cases raw percent input was normalized to enrichment at control sites
for the Myod1 promoter and Gapdh promoter. Error bars represent standard error of the
mean for n=3 (n=2 for H3K9Me3).
113
3.3.7
Increased RNA polymerase II occupancy at the
ATRX/H3.3/G-rich region of Dhrsx in the absence of ATRX
So far, we have determined that in the absence of ATRX, H3.3 deposition is decreased in
the G-rich segment of the Dhrsx gene body, whereas several other epigenetic marks
within the gene body and at the promoter remain unchanged. We therefore hypothesized
that the decrease in Dhrsx transcripts consistently observed when ATRX is absent could
be due to a problem in transcriptional elongation rather than initiation. To study this
possibility, we performed ChIP-qPCR for RNA polymerase II (PolII) across Dhrsx in the
presence and absence of ATRX in the mouse forebrain. We found moderate levels of
PolII at the Dhrsx promoter/transcriptional start site region and lower levels across the
gene (Figure 3-8). In the absence of ATRX, PolII occupancy was significantly increased
within the ATRX/H3.3-binding/G-rich region of Dhrsx (Figure 3-8), suggesting that the
enzyme is more prone to stalling. This is predicted to either decrease the rate of
elongation or to stop elongation altogether, which could provide an explanation for
decreased levels of gene transcripts. Taken together, these data suggest that ATRX may
be required for proper transcription through certain G-rich gene regions.
114
Figure 3-8: RNA Pol-II stalling in the absence of ATRX.
(A) ChIP-qPCR for RNA polymerase II (PolII) at Dhrsx in control and ATRX-null P0.5
mouse forebrain. PolII is enriched at the promoter and TSS region followed by lower
levels throughout the gene body. In the absence of ATRX, PolII enrichment is increased
at sites 9 to 13, corresponding to the ATRX/H3.3 binding region, with three sites
showing statistically significant change. Error bars represent standard error of the mean
for n=5. * p<0.05.
115
3.4 Discussion
This work explored possible epigenetic mechanisms that could explain how ATRX
regulates gene expression. We focused on a gene, Dhrsx, which we previously identified
as one of the most downregulated genes in the ATRX-deficient brain (Levy et al., 2008).
Our findings demonstrate that transcriptional regulation of Dhrsx does not occur through
interactions of ATRX with the gene promoter, but rather with the gene body in a G-rich
region containing many predicted G-quadruplexes. We show that loss of ATRX results
in decreased levels of histone H3.3 within this region of the gene and at four other aPAR
genes, showing that ATRX is able to regulate H3.3 deposition at a subset of genes in the
genome. In fact we see decreased H3.3 deposition at all of the aPAR genes previously
identified as downregulated in the ATRX-null brain (Levy et al., 2008). In addition, we
show increased occupancy of RNA PolII within this G-rich region of Dhrsx in the
absence of ATRX, suggesting that loss of ATRX and H3.3 at this G-rich transcribed
region results in the stalling of RNA polymerase.
While a small fraction of the mammalian genome codes for proteins, transcription of noncoding RNAs is likely a widespread phenomenon (Clark et al., 2011; Kapranov and St
Laurent, 2012). We detected transcription from regions flanking Dhrsx, including from
within an ITS. This transcription was decreased in the absence of ATRX, similar to the
decrease seen in the Dhrsx gene itself. Transcription of DNA flanking the Dhrsx gene
may indicate that the annotated start and end sites are incorrect. However, the levels of
transcription and degree of repression are inconsistent across the region, making it
unlikely that a single long transcript spans the entire domain. Rather, non-coding
transcripts are likely expressed in addition to, and overlapping with, the protein-coding
Dhrsx transcript. The direction of transcription for these transcripts in comparison to
Dhrsx transcription is unknown. Given the location of ATRX and H3.3 binding at the 3’
end of Dhrsx, we speculate that the non-coding transcripts, regardless of start sites and
direction of transcription, pass through the ATRX/H3.3/G-rich region, and are thus coregulated with Dhrsx. A more detailed analysis will be required to determine the number,
length and direction of transcripts and to examine the effects of ATRX at these sites and
provide a complete picture of the transcriptional architecture within this domain.
116
Loss of ATRX in mouse ESCs has been associated with increased TERRA expression
(Goldberg et al., 2010) while a series of human ALT cell lines showed no correlation
between loss of ATRX and levels of TERRA (Lovejoy et al., 2012). We found no
change in TERRA expression in either ATRX-null MEFs or mouse forebrain tissue. We
do note however, that expression of Dhrsx and Csf2ra was decreased in ATRX-null
MEFs, similar to the effect observed in the mouse forebrain. We also see strong
downregulation of these genes in the ATRX-null embryonic limb bud (our unpublished
data). Together, our data demonstrates that ATRX regulates the expression of these
genes in many cell types, and that this regulation is independent of TERRA transcripts.
ATRX is a chromatin remodeling protein that exhibits DNA translocase and nucleosome
remodeling activity (Xue et al., 2003). Loss of ATRX also correlates with altered
patterns of DNA methylation at several repetitive regions in ATR-X syndrome patients
(Gibbons et al., 2000) and in mice (Garrick et al., 2006; Kernohan et al., 2010).
Conversely, loss of ATRX did not affect DNA methylation at imprinted domains
(Kernohan et al., 2010). In this present study we find no differences in DNA methylation
at Dhrsx and Csf2ra CpG islands, and no change in active or repressive histone
modifications at Dhrsx. The epigenetic profile of the Dhrsx promoter region indicates an
active gene, and this profile remains unchanged in the absence of ATRX. These data
suggest that the mechanism of regulation might not involve transcriptional initiation, a
supposition reinforced by the position of ATRX and H3.3 further along the gene.
One third of ATRX binding sites in ESCs are within genes bodies, yet intragenic H3.3
binding was shown to be largely unchanged upon loss of ATRX (Goldberg et al., 2010;
Law et al., 2010). Instead, histone regulator A (HIRA) is thought to be the histone
chaperone responsible for depositing H3.3 within gene bodies (Goldberg et al., 2010). In
contrast, our findings clearly show that ATRX and H3.3 are co-localized within the gene
bodies of all four aPAR genes and that the level of H3.3 at these sites depends on ATRX.
H3.3 is traditionally associated with active transcription (Ahmad and Henikoff, 2002), in
part because its rapid turnover rate maintains more easily accessible DNA which allows
binding of transcription factors and passage of transcription machinery (Henikoff, 2008;
Schwartz and Ahmad, 2005). Without ATRX to deposit H3.3, the more stable H3.1 or
117
H3.2 may be deposited instead, as is seen in Drosophila where in the absence of H3.3,
replication independent incorporation of H3 is observed (Sakai et al., 2009).
Incorporation of H3.3 by ATRX may assist passage of the transcription machinery by
helping to resolve inhibitory DNA structures such as G-quadruplexes, as previously
hypothesized (Law et al., 2010), since putative G-quadruplex-forming sequences were
identified within the ATRX/H3.3/G-rich binding domains of the aPAR genes.
Supporting the idea that ATRX assists transcriptional elongation via H3.3 deposition,
RNA polymerase II showed increased enrichment at the ATRX/H3.3/G-rich region of
Dhrsx in the absence of ATRX indicating pausing of the transcription machinery. The
P17 ATRX-null forebrain exhibited a more subtle decrease in H3.3 enrichment compared
to neonatal brain tissue. Post-mitotic neurons are enriched for H3.3 and have reduced
H3.1 and H3.2 (Bosch and Suau, 1995; Pina and Suau, 1987) therefore the ATRX-null
cells may have little choice but to incorporate H3.3, perhaps at a slower rate using an
ATRX-independent mechanism.
From a genome-wide perspective, the binding pattern of H3.3 in the mouse brain
reflected that previously reported for H3.3 and ATRX in mouse ESCs (Goldberg et al.,
2010; Law et al., 2010), including high enrichment at telomeres and loss of H3.3 in
ATRX-null cells. The higher enrichment of ATRX and H3.3 towards telomeres suggests
that they may be more involved in gene regulation in this region. The fact that all aPAR
genes regulated by ATRX and that can be definitively positioned in the mouse genome
are located within this region supports this assessment.
Based on the known functions of the four studied aPAR genes, it is not immediately clear
how decreased expression of the aPAR genes may contribute to the ATRX-null
phenotypes in mice and humans. However, the regulation of Csf2ra might shed some
light into the placental defects seen in the ATRX-null concepti (Garrick et al., 2006;
Sferruzzi-Perri et al., 2009). Csf2ra codes for a receptor subunit of the cytokine
granulocyte-macrophage colony-stimulating factor. Mutations in this factor can lead to
adverse fetal and placental health and viability (Robertson, 2007). In addition, Csf2ra
118
was identified as a schizophrenia susceptibility gene, which suggests a potential role in
the functioning of the central nervous system (Lencz et al., 2007; Loe-Mie et al., 2010).
In conclusion, our study provides mechanistic insight of ATRX-mediated transcriptional
regulation. We propose a model whereby incorporation of H3.3, as directed by ATRX,
promotes transcriptional elongation of a G-rich region by organizing chromatin into a
more accessible state (Figure 3-9). Future studies should seek to identify other
components of the regulatory system by which loss of H3.3 affects expression of Dhrsx
and the other target genes. It will be interesting to see whether DAXX is present with
ATRX, as DAXX has been shown to be required for the ATRX-mediated deposition of
H3.3 at telomeres (Lewis et al., 2010) and pericentromeric heterochromatin (Drane et al.,
2010). Further analyses of genome wide protein binding and expression data may
identify additional genes besides the four aPAR genes which are regulated in the manner
described here.
119
Figure 3-9: A model for the regulation of transcription by ATRX.
Transcription proceeds from the transcription start site (TSS). In the presence of ATRX
(top, purple), ATRX resolves G-quadruplex structures in G-rich regions allowing passage
of RNA polymerase (PolII, green triangles). After passage of the transcription machinery
ATRX directs the incorporation of H3.3-containing histones (blue), which facilitates
subsequent transcription. In the absence of ATRX (bottom), G-quadruplexes that form in
the single-stranded region of the transcription bubble impede the passage of the
transcription machinery leading to RNA polymerase stalling and decreased transcription.
In the absence of ATRX, H3.3 deposition is decreased, further inhibiting transcription.
120
3.5 Supplementary figures
Figure 3-10 (supplementary): Adenoviral treatment of Atrx-floxed MEFs.
(A) MEFs were infected with adenovirus expressing Cre recombinase with GFP, or just
GFP, and ATRX expression was assessed by immunofluorescence 72 hours post
infection. Scale bar = 500 µm. (B) Atrx, Csf2ra, and Dhrsx expression was measured by
qRT-PCR 72 hours after Adeno-Cre-mediated Atrx deletion.
standard error of the mean for n=3. * p<0.05.
Error bars represent
121
Figure 3-11 (supplementary): Comparison of H3.3 enrichment at Dhrsx in the
mouse brain at P0.5 and P17.
(A) ChIP-qPCR of histone H3.3 at Dhrsx in the P0.5 and P17 forebrain confirmed the
P0.5 ChIP-seq data and showed a similar pattern of enrichment at P17, with highest
levels at the ATRX/H3.3/G region. Enrichment was normalized to H3.3 binding at Bactin.
(B) ChIP-qPCR of histone H3.3 at P17 showed decrease H3.3 binding at
amplicons 8 and 11 of the ATRX/H3.3/G region of Dhrsx. Error bars represent standard
error of the mean for n=4. * p<0.05.
122
Figure 3-12 (supplementary): ATRX and H3.3 ChIP-Seq input tracks .
No antibody control (input) tracks for Dhrsx (A) and the additional aPAR genes Asmtl,
Cd99, and Csf2ra (B) and Ppp2r3d (C). For ChIP-seq in the P0.5 forebrain, control and
ATRX-null ChIP DNA was pooled prior to sequencing.
123
Figure 3-13 (supplementary): DNA methylation at the Csf2ra promoter is not
altered in the neonatal ATRX-null mouse forebrain.
Bisulfite mutagenesis and sequencing showed 65% DNA methylation within the Csf2ra
putative promoter region.
forebrains.
No change was seen between control and ATRX-null
Open circles represent unmethylated cytosines, closed circles represent
methylated cytosines.
124
3.6 Supplementary tables
Table 3-1 (supplementary): Primer sequences and annealing temperatures.
Primer
Forward
Reverse
Anneal.
temp.
Genotyping
Atrx
NeoR
Cre
Sry
AGAAATTGAGGATGCTTCACC
Atrx forward used as forward primer
TGACCAGAGTCATCCTTAGCG
GCAGGTGGAAAAGCCTTACA
TGAACCTGGGGACTTCTTTG
CCACCATGATATTCGGCAAG
AATGCTTCTGTCCGTTTGCC
AAGCTTTGCTGGTTTTTGGA
58
58
58
58
CAACGACCCCTTCATTGACCT
CTGTCGAGTCGCGTCCACCC
AGAAATTGAGGATGCTTCACC
ATCAGTACTCGTGGCCATCC
GCAGCTGTCAATTCTCTTCTCC
ATCCACGACCGACACATTGG
ACATGCCGGAGCCGTTGTCG
TGAACCTGGGGACTTCTTTG
TTGATCATGAAGGCACGTTG
CGAAGACATGGACTGAGACAAG
55
60
58
60
60
AAATCTTCTAGAACCCTAACAATCCA
GCTCTGTCGCGTTTGTTTAAG
TGAAGGGGTTTTCTTATGTAGGG
GTCTTTCCAGTGTTTTTAGCGATT
TATTTTGTTTTTCGGGCTTCTAAA
GCAGCTGTCAATTCTCTTCTCC
ACATACACATAGATATAGGTTTCAGTTGG
TATGAAGAGTTTATCAGGGGCTTAGGG
GTATTAGGTTCTTTTCGGGTTGG
TTCAATAAGTGAGTCAGGATCCAA
GGAGAGTAGGAGAGTGAGAGACTGAT
GGCTTCAGGTTTTTGTTGTATCTAT
TCTACAAGAAACCAAAAACCTTCA
AATTTGAAACCCCCAAAGAATC
GGTGGCGTCTTAGTTACTTTCCTA
AGGCTTCTGGTGTATTTTTCATGT
CGAAGACATGGACTGAGACAAG
GTGACAGACAACCCAATTTGCATAC
TATGCATGTCTGTAGTTGTGTCTCAGG
CTGCAAAGTCCCTAAAACTCTCA
ATACAAAAACCTGTTTGGGAAAAA
ACAAAGTATACATGGGCATTACTCAG
60
55
55
58
58
60
60
58
60
55
60
AGTCTCTCTGCCCTCCTTCCTA
GCGCGCGTCATCAGCTC
GTTCCGAAAGTTGCCTTTTATG
ACAAAACTCCTGAGGCCATAGT
AAATCTTCTAGAACCCTAACAATCCA
AGTCACTCGTCCTTGTCTCAGTC
ACCGGAAGTCAACCTCAAAAC
TCCACGTCATGTATAACAACAAGA
TGGACTCCTCTGTTCTCTTAGCTT
GTTAAAGAAACGATCCTGTGGATT
TGGTGTGATAAAAGCAAATTGAGT
ACAGCCTTAGGAGACCTTGATG
GAATATTCATGACCCGAAGAACAC
CTCCCCGCTATGTAAATATGGA
CACCTGGGTGTGAACTTCCT
CTCCTATCCCCACATCCTGACT
ATTGACCCCTACTTACCCCTTG
AAAAACAGAAGAGTTTTAGGGTCATTT
ATGCTTATGTCACTTATGGATTTTTACT
ACATACACATAGATATAGGTTTCAGTTGG
CACATTATACACACACGCATA
GGAGAGTAGGAGAGTGAGAGACTGAT
GAACCCCAACAGTACAATGACA
CATCCCTAGACCCGTACAGTGC
AGGACCCTGCAGTGAGGTACTA
GTTGCTCTGACAACCACAGG
GGCTTCAGGTTTTTGTTGTATCTAT
ACACTGCGCTGGTGTTTGT
GACCCTGTGGTCTCGGTCTG
GAGAGTGACGTACACCAAGATGAC
GGCAGGAAAAGTAATTGTAGTTCG
TTTTGGTAGGGTTCTAGAGGTTTG
CCCCACTTTCTGTCTTCAGATT
AAATTTCCCCCAAACTAAGGAA
AAATTATTCACAGCAAGTCCCAAT
ACATAGAGTGGGGTCTGAGAGACA
GTCACTTCCTGTAATGCCACAC
GAGGTCACACAGGGTAGAAAGG
AGTAGACGTCAGGTGGGATCAG
CTAAAGAATAACCGTAAGCAAAACAAAA
AGTGTTTGCCTTCGTTTTTATATACATT
GTGACAGACAACCCAATTTGCATAC
TTTTAGGGATTTTGAGCTTTTG
ACAAAGTATACATGGGCATTACTCAG
60
60
60
60
60
60
60
60
60
58
60
60
60
60
60
60
60
60
60
60
60
60
GAAAATGTATAATAAATTAAAAATGTTTTT
TTTTAGTGTTGAGATTAAAGGTTTG
TGATTTTGTTTTTTGATTTTTGATTT
TGGTATTATAGGAAGTGATTATGGG
ATTGTGTGTATTAGGGTAAGATTGT
ATAAGGGGTTAGATGTAGTGATTGA
GTAAAACGACGGCCAG
TATTCATAACCAAACCTAAAAAAAA
AAAACTCCCAAAAACCTCAAC
CTCCCACACACACACAATTATAAAC
CTAAAATCACACAAAATAAAAAAAA
CTCTTCCTCATCTACAAATTAAAAA
AAAAAAAACAAAACAAACAAAAATAAATAA
CAGGAAACAGCTATGAC
50
55
50
55
55
55
55
Gene expression
Gapdh
Bactin
Atrx
Csf2ra
Dhrsx
Dhrsx non-coding
A
B
C
D
E
F
G
H
I
J
K
ChIP
Myod1 Promoter
Gapdh Promoter
Actb Promoter
Actb gene body
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
Bisulfite sequencing
Dhrsx CpG1 outside
Dhrsx CpG1 inside
Dhrsx CpG2 outside
Dhrsx CpG2 inside
Csf2ra outside
Csf2ra inside
M13
125
3.7 References
Aapola, U., Kawasaki, K., Scott, H.S., Ollila, J., Vihinen, M., Heino, M., Shintani, A.,
Kawasaki, K., Minoshima, S., Krohn, K., et al. (2000). Isolation and initial
characterization of a novel zinc finger gene, DNMT3L, on 21q22.3, related to the
cytosine-5-methyltransferase 3 gene family. Genomics 65, 293-298.
Ahmad, K., and Henikoff, S. (2002). The histone variant H3.3 marks active chromatin by
replication-independent nucleosome assembly. Mol Cell 9, 1191-1200.
Andrews, S. (2012). FastQC (Cambridge, United Kingdon: Babraham Bioinformatics).
Azzalin, C.M., Reichenbach, P., Khoriauli, L., Giulotto, E., and Lingner, J. (2007).
Telomeric Repeat Containing RNA and RNA Surveillance Factors at Mammalian
Chromosome Ends. Science 318, 798-801.
Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Schones, D.E., Wang, Z., Wei, G.,
Chepelev, I., and Zhao, K. (2007). High-resolution profiling of histone methylations in
the human genome. Cell 129, 823-837.
Baumann, C., and De La Fuente, R. (2008). ATRX marks the inactive X chromosome
(Xi) in somatic cells and during imprinted X chromosome inactivation in trophoblast
stem cells. Chromosoma.
Baur, J.A., Zou, Y., Shay, J.W., and Wright, W.E. (2001). Telomere position effect in
human cells. Science 292, 2075-2077.
Bérubé, N.G., Mangelsdorf, M., Jagla, M., Vanderluit, J., Garrick, D., Gibbons, R.J.,
Higgs, D.R., Slack, R.S., and Picketts, D.J. (2005). The chromatin-remodeling protein
ATRX is critical for neuronal survival during corticogenesis. The Journal of clinical
investigation 115, 258-267.
Bosch, A., and Suau, P. (1995). Changes in core histone variant composition in
differentiating neurons: the roles of differential turnover and synthesis rates. European
journal of cell biology 68, 220-225.
Cheung Nv, Z.J.L.C., and et al. (2012). Association of age at diagnosis and genetic
mutations in patients with neuroblastoma. JAMA: The Journal of the American Medical
Association 307, 1062-1071.
Clark, M.B., Amaral, P.P., Schlesinger, F.J., Dinger, M.E., Taft, R.J., Rinn, J.L., Ponting,
C.P., Stadler, P.F., Morris, K.V., Morillon, A., et al. (2011). The reality of pervasive
transcription. PLoS biology 9, e1000625; discussion e1001102.
de Wilde, R.F., Heaphy, C.M., Maitra, A., Meeker, A.K., Edil, B.H., Wolfgang, C.L.,
Ellison, T.A., Schulick, R.D., Molenaar, I.Q., Valk, G.D., et al. (2012). Loss of ATRX or
DAXX expression and concomitant acquisition of the alternative lengthening of
126
telomeres phenotype are late events in a small subset of MEN-1 syndrome pancreatic
neuroendocrine tumors. Mod Pathol 25, 1033-1039.
Deng, Z., Norseen, J., Wiedmer, A., Riethman, H., and Lieberman, P.M. (2009). TERRA
RNA Binding to TRF2 Facilitates Heterochromatin Formation and ORC Recruitment at
Telomeres. Molecular Cell 35, 403-413.
Dhayalan, A., Tamas, R., Bock, I., Tattermusch, A., Dimitrova, E., Kudithipudi, S.,
Ragozin, S., and Jeltsch, A. (2011). The ATRX-ADD domain binds to H3 tail peptides
and reads the combined methylation state of K4 and K9. Human molecular genetics 20,
2195-2203.
Drane, P., Ouararhni, K., Depaux, A., Shuaib, M., and Hamiche, A. (2010). The deathassociated protein DAXX is a novel histone chaperone involved in the replicationindependent deposition of H3.3. Genes & development 24, 1253-1265.
Duquette, M.L., Handa, P., Vincent, J.A., Taylor, A.F., and Maizels, N. (2004).
Intracellular transcription of G-rich DNAs induces formation of G-loops, novel structures
containing G4 DNA. Genes & development 18, 1618-1629.
Eustermann, S., Yang, J.C., Law, M.J., Amos, R., Chapman, L.M., Jelinska, C., Garrick,
D., Clynes, D., Gibbons, R.J., Rhodes, D., et al. (2011). Combinatorial readout of histone
H3 modifications specifies localization of ATRX to heterochromatin. Nat Struct Mol Biol
18, 777-782.
Forrest, A.R., Abdelhamid, R.F., and Carninci, P. (2009). Annotating non-coding
transcription using functional genomics strategies. Briefings in functional genomics &
proteomics 8, 437-443.
Garrick, D., Sharpe, J.A., Arkell, R., Dobbie, L., Smith, A.J., Wood, W.G., Higgs, D.R.,
and Gibbons, R.J. (2006). Loss of Atrx affects trophoblast development and the pattern of
X-inactivation in extraembryonic tissues. PLoS genetics 2, e58.
Gianfrancesco, F., Sanges, R., Esposito, T., Tempesta, S., Rao, E., Rappold, G.,
Archidiacono, N., Graves, J.A.M., Forabosco, A., and D'Urso, M. (2001). Differential
Divergence of Three Human Pseudoautosomal Genes and Their Mouse Homologs:
Implications for Sex Chromosome Evolution. Genome Res 11, 2095-2100.
Gibbons, R. (2006). Alpha thalassaemia-mental retardation, X linked. Orphanet journal
of rare diseases 1, 15.
Gibbons, R.J., McDowell, T.L., Raman, S., O'Rourke, D.M., Garrick, D., Ayyub, H., and
Higgs, D.R. (2000). Mutations in ATRX, encoding a SWI/SNF-like protein, cause
diverse changes in the pattern of DNA methylation. Nature genetics 24, 368-371.
Gibbons, R.J., Picketts, D.J., Villard, L., and Higgs, D.R. (1995). Mutations in a putative
global transcriptional regulator cause X-linked mental retardation with alpha-thalassemia
(ATR-X syndrome). Cell 80, 837-845.
127
Goldberg, A.D., Banaszynski, L.A., Noh, K.M., Lewis, P.W., Elsaesser, S.J., Stadler, S.,
Dewell, S., Law, M., Guo, X., Li, X., et al. (2010). Distinct Factors Control Histone
Variant H3.3 Localization at Specific Genomic Regions. Cell 140, 678-691.
Gottschling, D.E., Aparicio, O.M., Billington, B.L., and Zakian, V.A. (1990). Position
effect at S. cerevisiae telomeres: reversible repression of Pol II transcription. Cell 63,
751-762.
Heaphy, C.M., de Wilde, R.F., Jiao, Y., Klein, A.P., Edil, B.H., Shi, C., Bettegowda, C.,
Rodriguez, F.J., Eberhart, C.G., Hebbar, S., et al. (2011). Altered telomeres in tumors
with ATRX and DAXX mutations. Science 333, 425.
Henikoff, S. (2008). Nucleosome destabilization in the epigenetic regulation of gene
expression. Nature reviews 9, 15-26.
Iwase, S., Xiang, B., Ghosh, S., Ren, T., Lewis, P.W., Cochrane, J.C., Allis, C.D.,
Picketts, D.J., Patel, D.J., Li, H., et al. (2011). ATRX ADD domain links an atypical
histone methylation recognition mechanism to human mental-retardation syndrome. Nat
Struct Mol Biol 18, 769-776.
Jiao, Y., Killela, P.J., Reitman, Z.J., Rasheed, A.B., Heaphy, C.M., de Wilde, R.F.,
Rodriguez, F.J., Rosemberg, S., Oba-Shinjo, S.M., Marie, S.K., et al. (2012). Frequent
ATRX, CIC, and FUBP1 mutations refine the classification of malignant gliomas.
Oncotarget.
Jiao, Y., Shi, C., Edil, B.H., de Wilde, R.F., Klimstra, D.S., Maitra, A., Schulick, R.D.,
Tang, L.H., Wolfgang, C.L., Choti, M.A., et al. (2011). DAXX/ATRX, MEN1, and
mTOR pathway genes are frequently altered in pancreatic neuroendocrine tumors.
Science 331, 1199-1203.
Jothi, R., Cuddapah, S., Barski, A., Cui, K., and Zhao, K. (2008). Genome-wide
identification of in vivo protein-DNA binding sites from ChIP-Seq data. Nucleic acids
research 36, 5221-5231.
Kapranov, P., and St Laurent, G. (2012). Dark Matter RNA: Existence, Function, and
Controversy. Frontiers in genetics 3, 60.
Kent, W.J., Sugnet, C.W., Furey, T.S., Roskin, K.M., Pringle, T.H., Zahler, A.M., and
Haussler, D. (2002). The human genome browser at UCSC. Genome research 12, 9961006.
Kernohan, K.D., Jiang, Y., Tremblay, D.C., Bonvissuto, A.C., Eubanks, J.H., Mann,
M.R., and Berube, N.G. (2010). ATRX partners with cohesin and MeCP2 and contributes
to developmental silencing of imprinted genes in the brain. Dev Cell 18, 191-202.
Khuong-Quang, D.A., Buczkowicz, P., Rakopoulos, P., Liu, X.Y., Fontebasso, A.M.,
Bouffet, E., Bartels, U., Albrecht, S., Schwartzentruber, J., Letourneau, L., et al. (2012).
128
K27M mutation in histone H3.3 defines clinically and biologically distinct subgroups of
pediatric diffuse intrinsic pontine gliomas. Acta neuropathologica 124, 439-447.
Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009). Ultrafast and memoryefficient alignment of short DNA sequences to the human genome. Genome biology 10,
R25.
Law, M.J., Lower, K.M., Voon, H.P., Hughes, J.R., Garrick, D., Viprakasit, V., Mitson,
M., De Gobbi, M., Marra, M., Morris, A., et al. (2010). ATR-X syndrome protein targets
tandem repeats and influences allele-specific expression in a size-dependent manner. Cell
143, 367-378.
Lencz, T., Morgan, T.V., Athanasiou, M., Dain, B., Reed, C.R., Kane, J.M.,
Kucherlapati, R., and Malhotra, A.K. (2007). Converging evidence for a
pseudoautosomal cytokine receptor gene locus in schizophrenia. Molecular psychiatry
12, 572-580.
Levy, M.A., Fernandes, A.D., Tremblay, D.C., Seah, C., and Berube, N.G. (2008). The
SWI/SNF protein ATRX co-regulates pseudoautosomal genes that have translocated to
autosomes in the mouse genome. BMC genomics 9, 468.
Lewis, P.W., Elsaesser, S.J., Noh, K.M., Stadler, S.C., and Allis, C.D. (2010). Daxx is an
H3.3-specific histone chaperone and cooperates with ATRX in replication-independent
chromatin assembly at telomeres. Proceedings of the National Academy of Sciences of
the United States of America 107, 14075-14080.
Li, B., Carey, M., and Workman, J.L. (2007). The role of chromatin during transcription.
Cell 128, 707-719.
Lin, K.W., and Yan, J. (2008). Endings in the middle: current knowledge of interstitial
telomeric sequences. Mutation research 658, 95-110.
Loe-Mie, Y., Lepagnol-Bestel, A.M., Maussion, G., Doron-Faigenboim, A., Imbeaud, S.,
Delacroix, H., Aggerbeck, L., Pupko, T., Gorwood, P., Simonneau, M., et al. (2010).
SMARCA2 and other genome-wide supported schizophrenia-associated genes: regulation
by REST/NRSF, network organization and primate-specific evolution. Hum Mol Genet
19, 2841-2857.
Lovejoy, C.A., Li, W., Reisenweber, S., Thongthip, S., Bruno, J., de Lange, T., De, S.,
Petrini, J.H., Sung, P.A., Jasin, M., et al. (2012). Loss of ATRX, Genome Instability, and
an Altered DNA Damage Response Are Hallmarks of the Alternative Lengthening of
Telomeres Pathway. PLoS genetics 8, e1002772.
Market-Velker, B.A., Zhang, L., Magri, L.S., Bonvissuto, A.C., and Mann, M.R. (2010).
Dual effects of superovulation: loss of maternal and paternal imprinted methylation in a
dose-dependent manner. Human molecular genetics 19, 36-51.
129
McDowell, T.L., Gibbons, R.J., Sutherland, H., O'Rourke, D.M., Bickmore, W.A.,
Pombo, A., Turley, H., Gatter, K., Picketts, D.J., Buckle, V.J., et al. (1999). Localization
of a putative transcriptional regulator (ATRX) at pericentromeric heterochromatin and
the short arms of acrocentric chromosomes. Proceedings of the National Academy of
Sciences of the United States of America 96, 13983-13988.
Molenaar, J.J., Koster, J., Zwijnenburg, D.A., van Sluis, P., Valentijn, L.J., van der Ploeg,
I., Hamdi, M., van Nes, J., Westerman, B.A., van Arkel, J., et al. (2012). Sequencing of
neuroblastoma identifies chromothripsis and defects in neuritogenesis genes. Nature 483,
589-593.
Mural, R.J., Adams, M.D., Myers, E.W., Smith, H.O., Miklos, G.L., Wides, R., Halpern,
A., Li, P.W., Sutton, G.G., Nadeau, J., et al. (2002). A comparison of whole-genome
shotgun-derived mouse chromosome 16 and the human genome. Science 296, 16611671.
Nergadze, S.G., Farnung, B.O., Wischnewski, H., Khoriauli, L., Vitelli, V., Chawla, R.,
Giulotto, E., and Azzalin, C.M. (2009). CpG-island promoters drive transcription of
human telomeres. RNA 15, 2186-2194.
Pedram, M., Sprung, C.N., Gao, Q., Lo, A.W., Reynolds, G.E., and Murnane, J.P. (2006).
Telomere position effect and silencing of transgenes near telomeres in the mouse. Mol
Cell Biol 26, 1865-1878.
Pina, B., and Suau, P. (1987). Changes in histones H2A and H3 variant composition in
differentiating and mature rat brain cortical neurons. Developmental biology 123, 51-58.
Rasband, W.S. (2012). ImageJ (Bethesda, Maryland, USA: U.S. National Institutes of
Health).
Robertson, S.A. (2007). GM-CSF regulation of embryo development and pregnancy.
Cytokine & growth factor reviews 18, 287-298.
Sakai, A., Schwartz, B.E., Goldstein, S., and Ahmad, K. (2009). Transcriptional and
developmental functions of the H3.3 histone variant in Drosophila. Current biology : CB
19, 1816-1820.
Scaife, R.M. (2005). Selective and irreversible cell cycle inhibition by
diphenyleneiodonium. Molecular cancer therapeutics 4, 876-884.
Scaria, V., Hariharan, M., Arora, A., and Maiti, S. (2006). Quadfinder: server for
identification and analysis of quadruplex-forming motifs in nucleotide sequences.
Nucleic acids research 34, W683-685.
Schoeftner, S., and Blasco, M.A. (2008). Developmentally regulated transcription of
mammalian telomeres by DNA-dependent RNA polymerase II. Nat Cell Biol 10, 228236.
130
Schwartz, B.E., and Ahmad, K. (2005). Transcriptional activation triggers deposition and
removal of the histone variant H3.3. Genes & development 19, 804-814.
Schwartzentruber, J., Korshunov, A., Liu, X.Y., Jones, D.T., Pfaff, E., Jacob, K., Sturm,
D., Fontebasso, A.M., Quang, D.A., Tonjes, M., et al. (2012). Driver mutations in histone
H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature 482, 226-231.
Seah, C., Levy, M.A., Jiang, Y., Mokhtarzada, S., Higgs, D.R., Gibbons, R.J., and
Berube, N.G. (2008). Neuronal death resulting from targeted disruption of the Snf2
protein ATRX is mediated by p53. J Neurosci 28, 12570-12580.
Sferruzzi-Perri, A.N., Macpherson, A.M., Roberts, C.T., and Robertson, S.A. (2009).
Csf2 null mutation alters placental gene expression and trophoblast glycogen cell and
giant cell abundance in mice. Biology of reproduction 81, 207-221.
Stevens, I., Janssens, V., Martens, E., Dilworth, S., Goris, J., and Van Hoof, C. (2003).
Identification and characterization of B"-subunits of protein phosphatase 2 A in Xenopus
laevis oocytes and adult tissues. European journal of biochemistry / FEBS 270, 376-387.
Wang, Z., Zang, C., Rosenfeld, J.A., Schones, D.E., Barski, A., Cuddapah, S., Cui, K.,
Roh, T.Y., Peng, W., Zhang, M.Q., et al. (2008). Combinatorial patterns of histone
acetylations and methylations in the human genome. Nature genetics 40, 897-903.
Waterston, R.H., Lindblad-Toh, K., Birney, E., Rogers, J., Abril, J.F., Agarwal, P.,
Agarwala, R., Ainscough, R., Alexandersson, M., An, P., et al. (2002). Initial sequencing
and comparative analysis of the mouse genome. Nature 420, 520-562.
Wong, L.H., McGhie, J.D., Sim, M., Anderson, M.A., Ahn, S., Hannan, R.D., George,
A.J., Morgan, K.A., Mann, J.R., and Choo, K.H. (2010). ATRX interacts with H3.3 in
maintaining telomere structural integrity in pluripotent embryonic stem cells. Genome
research 20, 351-360.
Xue, Y., Gibbons, R., Yan, Z., Yang, D., McDowell, T.L., Sechi, S., Qin, J., Zhou, S.,
Higgs, D., and Wang, W. (2003). The ATRX syndrome protein forms a chromatinremodeling complex with Daxx and localizes in promyelocytic leukemia nuclear bodies.
Proceedings of the National Academy of Sciences of the United States of America 100,
10635-10640.
Yan, Z., Fedorov, S.A., Mumby, M.C., and Williams, R.S. (2000). PR48, a novel
regulatory subunit of protein phosphatase 2A, interacts with Cdc6 and modulates DNA
replication in human cells. Mol Cell Biol 20, 1021-1029.
Zhang, L.F., Ogawa, Y., Ahn, J.Y., Namekawa, S.H., Silva, S.S., and Lee, J.T. (2009).
Telomeric RNAs mark sex chromosomes in stem cells. Genetics 182, 685-698.
Zhou, J., Pham, H.T., Ruediger, R., and Walter, G. (2003). Characterization of the
Aalpha and Abeta subunit isoforms of protein phosphatase 2A: differences in expression,
subunit interaction, and evolution. The Biochemical journal 369, 387-398.
131
Zwaenepoel, K., Louis, J.V., Goris, J., and Janssens, V. (2008). Diversity in genomic
organisation, developmental regulation and distribution of the murine PR72/B" subunits
of protein phosphatase 2A. BMC genomics 9, 393.
132
Chapter 4
4
General Discussion and Future Directions
4.1
Thesis summary
The overall goal of my thesis was to identify gene targets of ATRX and determine how
they are regulated by ATRX. To this end, I mainly used a mouse model of ATRX loss to
identify these genes and study how ATRX interacts with them. I focused on epigenetic
changes associated with ATRX loss given that ATRX is a chromatin remodeling protein.
The first part of my thesis, presented in chapter two, describes the identification of a
unique group of genes regulated by ATRX, the aPAR genes. A connection between these
genes was not immediately recognized, and indeed we initially took note of genes
involved in brain development and neurogenesis before changing direction to address a
novel question: how could a group of genes, seemingly only connected by their genomic
location in the evolutionary past, be regulated by the same protein? These genes, which
are GC rich and originate from a highly repetitive region (the PAR) were identified
before it was known that ATRX is in fact highly enriched at these types of regions
throughout the genome (Law et al., 2010). In the process of identifying aPAR genes
regulated by ATRX we found two new mouse aPAR genes, Arsd/e and Asmtl. We
hypothesized that the target genes could be regulated by ATRX due to an intrinsic
sequence within, or epigenetic environment surrounding these genes, regardless of their
genomic location. However, we found that when these genes are in the PAR region itself
they are not regulated by ATRX, suggesting that their genomic location is also important
for their targeting and regulation by ATRX.
The second part of my thesis, presented in chapter three, attempted to find a mechanism
by which ATRX regulates gene expression. To study this, I focused on a role for ATRX
at the previously identified aPAR genes. We first found that ATRX binds directly at
these genes and that the binding pattern corresponds to high GC regions and the presence
of potential secondary DNA structures known as G-quadruplexes. This suggested a
direct mechanism of gene regulation by ATRX. Several epigenetic factors were
133
examined and found to be unchanged: DNA methylation, histone modifications, and
TERRA expression. We then investigated the histone variant H3.3 after several reports
described a link between ATRX and H3.3 at telomeres (Goldberg et al., 2010; Wong et
al., 2010). I made the novel discovery that H3.3 binds in a pattern mirroring ATRX
within the bodies of the aPAR genes, and that H3.3 is consistently depleted at all aPAR
genes misregulated in the absence of ATRX. I further demonstrated that there is an
increase in binding of RNA PolII within the ATRX/H3.3/G-rich binding region,
suggesting stalled transcription machinery. Therefore, I believe that we have
demonstrated one potential mechanism by which ATRX can regulate gene expression:
facilitating transcription though regions prone to forming inhibitory secondary DNA
structures.
4.2
A role for ATRX in gene regulation
When I started this work, ATRX had a suspected but not confirmed role in regulating
gene expression. This was largely based on two observations. First, conserved domains
in ATRX had been implicated in gene regulation in other proteins, such as the PHD DNA
binding domain (Aasland et al., 1995) and SWI2/SNF2 chromatin remodeling domain
(Pazin and Kadonaga, 1997). Second, ATRX binding partners HP1, EZH2 and DAXX
were themselves known to be involved in gene regulation (Cao et al., 2002; Cao and
Zhang, 2004; Kourmouli et al., 2005; Salomoni and Khelifi, 2006; Stewart et al., 2005).
The repressive nature of HP1 (Grewal and Jia, 2007; Stewart et al., 2005) and EZH2 (Cao
and Zhang, 2004), the frequent association of ATRX with condensed PCH (McDowell et
al., 1999), the ability of ATRX to assemble heterochromatin and suppress nearby gene
expression in Drosophila (Bassett et al., 2008; Emelyanov et al., 2010), and the finding
that ATRX tethered to a promoter can suppress transcription (Tang et al., 2004),
suggested a predominantly repressive role for ATRX. However, the decreased
expression of α-globin in ATR-X syndrome patients (Gibbons et al., 1995) hinted at an
additional activating role, although whether it was direct or indirect regulation was
unknown. As my work progressed, additional small-scale studies found roles for ATRX
regulation at specific genes (Bagheri-Fam et al., 2011; Kernohan et al., 2010; Newhart et
al., 2012; Schreiner et al., 2013; Tang et al., 2011; Tsai et al., 2011), but my work was the
134
first to look at genome-wide changes in gene expression upon loss of ATRX (Levy et al.,
2008). When ATRX is lost in the developing mouse forebrain, two-thirds of
misregulated genes had increased transcript levels. This observation confirmed a mostly
suppressive role for ATRX in gene expression. However, with approximately 100 genes
downregulated in the absence of ATRX there is a clear activating role as well. Given that
the presumed mechanism for gene activation seen at aPAR genes accounts for a small
number of these targets, there is at least one and possibly several other mechanisms by
which ATRX can regulate gene expression. While many of the genes identified in our
microarray screen may be secondary effects of ATRX loss, I believe it is reasonable to
assume that there are at least some additional genes besides the aPAR genes that are
directly regulated by ATRX. Indeed, a mechanism of gene regulation similar to the one
proposed here has been identified for the α-globin gene cluster in humans (Law et al.,
2010). The α-globin gene cluster is near the telomere of chromosome 16 and contains
several globin genes, regulatory elements, and other genes unrelated to globin production
(Higgs et al., 2005). It was found that ATRX binds directly to intergenic G-rich tandem
repeats predicted to form G-quadruplexes, and that alleles with more repeats had a
stronger downregulation of α-globin (Law et al., 2010). In light of the known roles for
ATRX in replication (Huh et al., 2012; Wong et al., 2010), it was proposed that the
presence of G-quadruplexes hinders DNA replication through the α-globin region (Figure
1-3A). This hindrance could lead to DNA damage, replication fork collapse, and loss of
activating epigenetic marks which could all contribute to the decreased expression of a
number of genes surrounding the α-globin locus (Clynes and Gibbons, 2013; Gibbons
and Higgs, 2010; Law et al., 2010). It is important to note that the α-globin Gquadruplexes are intergenic, necessitating an indirect method of regulation (i.e. secondary
to a replication defect), while the aPAR G-quadruplexes are within gene bodies,
potentiating a direct inhibition of transcription.
The impact of ATRX loss on the α-globin locus has been examined in a second, more
recent study (Ratnakumar et al., 2012). It was found that a unique ATRX complex
regulates the repressive histone variant macroH2A (mH2A), and that this is distinct from
the previously identified ATRX-DAXX-H3.3 complex. In the absence of ATRX,
increased enrichment of mH2A was found at telomeres and across the α-globin gene
135
cluster (Ratnakumar et al., 2012). This is in contrast to H3.3 enrichment which is
decreased at telomeres in the absence of ATRX (Goldberg et al., 2010). It would
therefore be interesting to measure mH2A levels at the aPAR genes to see if they show an
inverse relation with H3.3 enrichment.
We found that the aPAR genes misregulated in the mouse are not affected in human cells
upon loss of ATRX. Why could this be? Like the individual mouse aPAR genes, the
overall human PAR is rich in potential G-quadruplex forming sequences. The aPAR
genes in mice have diverged considerably from their counterparts in the human PAR, and
along with the coding sequences, the overall genomic structure between the human PAR
and mouse aPAR genes are quite different. For example, the mouse Dhrsx gene spans
approximately 20 kb of genomic DNA, while the human DHRSX is over 200 kb long.
Nevertheless, some of the human PAR genes also contain potential G-quadruplex
forming regions, suggesting that these genes in the human PAR require the ability to
transcribe through G-quadruplexes similar to the autosomal aPAR genes in mice.
However, preliminary analysis of a previously published ChIP-seq dataset from human
erythroid cells (Law et al., 2010) showed that while ATRX binding sites are present
within the overall human PAR, none of the sites overlap the G-quadruplex regions within
the studied PAR genes themselves, and indeed there are no ATRX binding sites that
directly overlap the studied PAR genes. It is therefore possible that these human PAR
genes utilize a different mechanism to bypass their G-quadruplexes, or that Gquadruplexes fail to form at the predicted sites. It is interesting to note that while the
genes in the human PAR are near the end of the X and Y chromosomes, they are between
10 and 30 times farther from their respective telomeres than the aPAR genes on mouse
autosomes (one to three megabases for human PAR genes, compared to 100 to 150 kb for
mouse aPAR genes). A role for ATRX in H3.3 deposition and G-quadruplex bypass may
therefore be restricted to the telomeres and to regions within a certain distance of the
telomeres. This restriction may be mediated by PML-NBs. It has been shown that the
ATRX-DAXX complex co-localizes with telomeres within PML-NBs, and that this is
where the H3.3 deposition occurs (Chang et al., 2013; Delbarre et al., 2012). It is
possible that this co-localization may bring the mouse aPAR genes within the PML-NBs
136
along with the telomeres themselves, allowing ATRX-DAXX to deposit H3.3, and that
the human orthologs may be too far from the telomeres for this to occur.
Despite the lack of changes in human PAR gene expression, we can still speculate on a
role for ATRX in gene regulation in humans based on our findings and those of others.
Only 5% of ATRX binding sites in mice overlap CpG islands (Law et al., 2010). The
aPAR genes are therefore members of the small category of mouse ATRX targets that
contain CpG islands, further suggesting that they represent a unique subset of genes
regulated by ATRX. In humans, nearly half overlap CpG islands compared to the 5% in
mice (Law et al., 2010). In addition, gene density and CpG content near telomeres is
higher in humans than mice (Law et al., 2010; Murmann et al., 2005). It is therefore
possible that ATRX regulates more genes in humans than in mice through the mechanism
proposed in the present study. When ATRX binds a promoter, it represses transcription
(Newhart et al., 2012; Valadez-Graham et al., 2012). While approximately one-third of
ATRX binding sites are in gene bodies in both humans and mice, ATRX bound 78
promoters (6% of all sites) in mouse ESCs and 326 promoters (36% of all sites) in human
erythrocytes (Law et al., 2010), possibly due to the generally higher CpG density of
human CpG islands (Illingworth et al., 2010) at promoters. Therefore, loss of ATRX
may cause more genes to be upregulated in humans than in mice.
4.3
ATRX and structured DNA
Clearly, ATRX plays a role in managing secondary DNA structures like G-quadruplexes,
but what exactly could it be doing at these sites? G-quadruplexes form on single stranded
DNA, such as during replication and transcription. It has been shown that DNA damage
increases in the absence of ATRX, and that this damage may be the result of the inability
to replicate telomeric G-quadruplexes (Huh et al., 2012; Watson et al., 2013; Wong et al.,
2010). Transcription through G-quadruplexes can also signal additional DNA damage.
Just as the replication fork can stall at these structures, so too can RNA PolII and the
transcription machinery. Without ATRX to assist in the transcriptional bypass of these
structures, paused or stopped RNA PolII may be detected by transcription-coupled DNA
repair factors, even though no actual damage has occurred (Tornaletti, 2009).
Superfluous DNA repair through the nucleotide excision repair pathway can increase the
137
chances of mutations leading to DNA instability and possibly cancer (Bochman et al.,
2012; Tornaletti, 2009). Mutations in the Fanconia anemia gene known as BRCA1
interacting protein (BRIP1) is associated with breast cancer and the bone marrow disease
Fanconi anemia. BRIP1 is a helicase that can unwind G-quadruplexes, and when
depleted, sensitizes cells to DNA damage caused by stabilization of G-quadruplexes (Wu
et al., 2008). In addition, mutations in ATRX have recently been found in pancreatic and
several types of brain cancers (Heaphy et al., 2011; Jiao et al., 2011; Molenaar et al.,
2012; Schwartzentruber et al., 2012). Looking for markers of transcription-coupled DNA
repair, such as the excision repair protein ERCC6 and ubiquitination of RNA PolII
(Fousteri and Mullenders, 2008), associated with the increased RNA PolII at Dhrsx
would clarify this question.
It is unclear exactly how ATRX assists in the transcriptional bypass of G-quadruplexes,
but several other proteins that act at these structures have previously been identified. For
example, the G4 resolvase DEAH box polypeptide 36 (DHX36), and the RecQ helicases
involved in Werner syndrome (WRN) (Fry and Loeb, 1999) and Bloom’s syndrome
(BLM) (Sun et al., 1998) can unwind G-quadruplexes; protection of telomeres 1 (POT1)
(Zaug et al., 2005) and replication protein A (RPA) (Salas et al., 2006) can unfold
telomere G-quadruplexes; and G quartet nuclease 1 (GQN1) can cut within them (Sun et
al., 2001). While ATRX has a helicase domain, it has no helicase activity (Xue et al.,
2003). ATRX may therefore act through an as yet undiscovered mechanism, or through
an additional protein partner, to resolve G-quadruplexes to assist transcriptional
elongation. In addition, the mere act of depositing H3.3 may help to suppress Gquadruplex formation as G-quadruplexes are enriched in nucleosome-free regions
(Halder et al., 2009; Hershman et al., 2008; Wong and Huppert, 2009).
Transcribing RNA PolII generates positive supercoiling in front of, and negative
supercoiling behind the passing transcription machinery (Liu and Wang, 1987). Negative
supercoiling facilitates G-quadruplex formation (Sun and Hurley, 2009) and transcription
blockage in potential G-quadruplex forming regions is enhanced by negative supercoiling
(Belotserkovskii et al., 2010). Nucleosome assembly on negatively supercoiled DNA can
relieve superhelical stress (Clark and Felsenfeld, 1991; Worcel et al., 1981). Therefore,
138
ATRX may suppress G-quadruplexes in DNA undergoing transcription by assisting in
nucleosome deposition after passage of the transcription machinery, creating a helical
state less conducive to G-quadruplex formation.
G-rich regions have the ability to form additional non-B structures besides Gquadruplexes. While DNA G-quadruplexes can form when the G-rich strand is either the
coding or template strand, RNA G-quadruplexes and R-loops can form only when the Grich strand is the coding strand (and is therefore also reflected in the RNA itself). Rloops can form during transcription when the single stranded coding strand binds with an
unusually stable RNA:DNA hybrid, due to the G:C-rich nature of the sequences
(Aguilera and Garcia-Muse, 2012). R-loops have been shown to inhibit transcription
within genes and at telomeres (Belotserkovskii et al., 2010). Since Dhrsx and the other
aPAR genes have G-rich stretches on both their coding and template strands, it is unclear
exactly which secondary structure may be forming. Given that ATRX is known to target
DNA G-quadruplexes (Law et al., 2010), it is most likely that it is these structures that
form and interfere with transcription. However, possible interactions between ATRX and
other non-B DNA have not yet been studied.
4.4
Histone chaperones and the genomic localization
of histone H3.3
Involvement of H3.3 in regulation of transcription is mediated by different chaperones in
different regions of the genome. H3.3 is recruited to PCH by ATRX and DAXX where it
is required to maintain expression from the repetitive PCH DNA (Drane et al., 2010). It
is also recruited to telomeres by ATRX and DAXX but here loss of ATRX (and therefore
H3.3) causes an increase instead of decrease in transcription from the repetitive telomeric
DNA (Goldberg et al., 2010; Lewis et al., 2010; Wong et al., 2010). DAXX and HIRA
are responsible for localizing H3.3 to at least a small number of regulatory elements
(Goldberg et al., 2010; Michod et al., 2012). Lastly, HIRA targets H3.3 to intergenic
regions and the majority of gene bodies, but loss of ATRX was found to cause minimal
change at these sites (Goldberg et al., 2010; Law et al., 2010). Nevertheless, we have
now identified a small class of genes that require ATRX for H3.3 localization within
gene bodies. Given that the aPAR genes do not fit neatly into one of the previously
139
described categories of H3.3 deposition regions, it would be interesting to study other
chaperones involved in H3.3 regulation at these genes. Their location near telomeres
may mean that H3.3 at these genes is solely deposited by the ATRX-DAXX complex.
However, since the deposition is occurring in gene bodies, HIRA may be able to partly
compensate for loss of ATRX-mediated deposition. Examining DAXX and HIRA at the
aPAR genes would rule in or out these two options.
PML-NBs may be involved in deciding which chaperones will associate with H3.3 and
therefore where in the genome it will be deposited. In ESCs, the ATRX-DAXX complex
localizes to PML-NBs and directs the deposition of H3.3 to telomeres (Chang et al.,
2013; Delbarre et al., 2012), while a separate complex containing HIRA also localizes to
PML-NBs where it presumably performs its role in depositing H3.3 at intergenic regions
and gene bodies (Delbarre et al., 2012). In somatic and fully differentiated cells, ATRXDAXX still localizes to PML-NBs (Drane et al., 2010; Ishov et al., 2004; Xue et al.,
2003) but telomeres do not (Chang et al., 2013), and ATRX is no longer found at
telomeres (Wong et al., 2010). The proximity of the specific aPAR genes studied in this
work to telomeres may mean they are within PML-NBs and therefore within the vicinity
of ATRX. The subtelomeric location would also explain why they are the only aPAR
genes affected by loss of ATRX. At least four other aPAR genes have been identified in
mice (Crlf2, Plcxd1, Gtpbp6, Il3ra) that are not located near telomeres. Analysis of our
microarray data revealed that expression of these genes is not altered upon loss of Atrx.
The newborn mouse forebrain contains a mix of differentiated and undifferentiated cells.
We showed that in the P0.5 mouse forebrain, H3.3 is decreased at telomeres and aPAR
genes in the absence of ATRX, but this decrease is not as severe as seen in ESCs
(Goldberg et al., 2010). In addition, the loss of H3.3 in the ATRX-null P17 forebrain was
less than that seen at P0.5. Therefore, ATRX may play a continually less important role
in H3.3 deposition as cells differentiate. Nevertheless, the small loss of H3.3 at P17
appears to be enough to inhibit Dhrsx transcription. Given that H3.3 is incorporated in a
replication independent manner, it is the predominant H3 variant in the post-mitotic adult
brain (Bosch and Suau, 1995; Pina and Suau, 1987). While there is an overall increase in
H3.3 levels in this tissue, the specific genomic distribution of H3.3 has not been studied
140
beyond the neuroprogenitor stage (Goldberg et al., 2010). By ChIP-seq, we found that
H3.3 was enriched at telomeres in the newborn forebrain, but that this enrichment was
not as high as seen in ESCs (Goldberg et al., 2010). Given the requirement for ATRX in
telomeric deposition of H3.3, and the loss of ATRX from telomeres in differentiated cells
(Xue et al., 2003), it is possible that while H3.3 may be enriched throughout most of the
genome (through HIRA-mediated deposition), it may be depleted from post-mitotic
telomeres. This supports the idea that ATRX is required at telomeres specifically in
replicating cells. Indeed, H3.3 is incorporated into telomeres during S phase (Wong et
al., 2010; Wong et al., 2009), and loss of ATRX results in telomere dysfunction in ESCs
(Wong et al., 2010), replicating muscle cells (Huh et al., 2012), and neuroprogenitors
(Watson et al., 2013).
The dentate gyrus is one of only two regions where adult neurogenesis occurs (Altman
and Das, 1965; Ming and Song, 2011). When Atrx is deleted from the mouse forebrain,
the most severe effects are seen in this region (Bérubé et al., 2005), and this is in part
caused by defective migration of dentate gyrus precursor cells (Seah et al., 2008). It is
possible that an additional reason the dentate gyrus is so severely affected upon deletion
of ATRX is because the ongoing neurogenesis and cell division in this structure makes it
particularly sensitive to ATRX loss. Future studies to investigate the association of
ATRX and H3.3 with telomeres in the dentate gyrus versus other regions of the forebrain,
in the adult brain and throughout hippocampal development, would help clarify the role
for ATRX in neurogenesis and brain development.
4.5
H3.3 the and regulation of aPAR genes
H3.3 is a multi-faceted histone variant. Firstly, it was originally associated with active
chromatin, but more recently found to also play a role at repressive regions (Ahmad and
Henikoff, 2002; Elsaesser et al., 2010; Szenker et al., 2011). Secondly, it may play dual
roles in enhancing gene expression: H3.3 is deposited in transcribed regions to replace
nucleosomes that are evicted upon passage of the transcriptional machinery (Schwartz
and Ahmad, 2005, 2006), but it can also facilitate future gene expression by maintaining
a chromatin state more permissive to transcription (compared to canonical H3) that
persists through cell division (Henikoff, 2008; Ng and Gurdon, 2008). Therefore, it is
141
possible that the change in H3.3 enrichment at aPAR genes upon loss of ATRX is both a
cause and effect of the decreased transcription.
The question of what happens when transcribing RNA PolII and the transcription
machinery encounters a nucleosome is the matter of much study (reviewed recently in
(Kulaeva et al., 2013; Subtil-Rodriguez and Reyes, 2011)). A picture is emerging where
RNA PolII loops around nucleosomes causing transient disruptions between the DNA
and the various histones. Upon passage of an initial RNA PolII, a single H2A/H2B dimer
is displaced from the nucleosome octamer leaving behind a histone hexamer (the
hexasome). For genes expressed at low levels the H2A/H2B dimer is replaced before the
next RNA PolII encounters the nucleosome, meaning that the original hexasome and its
modifications are maintained. If the next RNA PolII encounters the hexasome before
H2A/H2B is replaced, such as in a high expressing gene, the entire nucleosome is
displaced from the DNA and will need to be replaced, likely with an H3.3-containing
nucleosome through replication independent assembly. Based on our informal
observations of gene expression levels and given that H3.3 is not enriched across the
entirety of the Dhrsx gene body, it appears that Dhrsx is not a very highly expressing
gene. However, several studies have found that extremes of either AT or GC are
enriched at generally nucleosome free regions (Fenouil et al., 2012; Schwarzbauer et al.,
2012), and that CpG promoters can be enriched for H3.3 (Delbarre et al., 2010). The
GC-rich nature this region could therefore increase histone instability, enhancing
nucleosome octamer removal, and allowing for the incorporation of histone H3.3 after
passage of the transcription machinery.
It is unclear exactly what the nucleosome state is when H3.3 is not deposited due to
ATRX loss. Either the remaining nucleosomes could be redistributed across the depleted
region, or some of the canonical histones could be reinserted. In Drosophila, cells are
able to upregulate and insert H3 when H3.3 is deleted, and except for infertility are
otherwise unaffected (Hodl and Basler, 2009; Sakai et al., 2009). Mice with deleted H3.3
exhibit neonatal lethality, stunted growth, neuromuscular deficits, and male sub-fertility,
suggesting that mammals may not be able to overcome the loss of H3.3 as easily
(Couldrey et al., 1999). In either case (redistribution or reinsertion), it is likely to lead to
142
at least a partial decrease in overall nucleosome density. A decrease in nucleosome
density due to the inability to deposit H3.3 could itself lead to G-quadruplex formation,
as G-quadruplexes are enriched in nucleosome-free regions (Halder et al., 2009; Wong
and Huppert, 2009). Studying the overall composition of nucleosomes at Dhrsx in the
absence of ATRX would help shed light on to this question.
4.6
A model for gene regulation by ATRX
By integrating the results of this work with the body of previously known knowledge
related to ATRX, I suggest a model for gene regulation by ATRX, and speculate on what
may happen when ATRX is absent (Figure 4-1). On newly synthesized DNA, canonical
H3 is deposited, while the presence of G-quadruplexes that may form at the aPAR genes
and at telomeres may attract ATRX to deposit H3.3. At this point, it is possible that
nucleosome density is lower at the high GC regions (Figure 4-1A). Upon initial passage
of RNA PolII, and possibly facilitated by a lower initial nucleosome density, single
stranded DNA is generated and the presence of guanine triplicates leads to G-quadruplex
formation. ATRX is targeted to the G-quadruplexes, perhaps facilitated by the common
localization between telomeres, aPAR genes, and ATRX within PML-NBs. ATRX
mitigates G-quadruplex formation using one or both of the following mechanisms:
ATRX directly suppresses or resolves G-quadruplexes, and/or ATRX, in a complex with
DAXX, deposits H3.3. Subsequent RNA PolII movement through the G-rich region is
facilitated due to lack of G-quadruplexes and labile nature H3.3-containing nucleosomes
(Figure 4-1B). In the absence of ATRX, loss of H3.3 deposition may lead to decreased
nucleosome density which could be somewhat mitigated by deposition of H3.
Transcription elongation by RNA PolII would be hindered by decreased nucleosome
density which would promote the formation of G-quadruplexes and/or by more stable
H3-containing nucleosomes (Figure 4-1C). H3.3 is the only remaining H3 variant in post
mitotic brain cells, causing H3.3 levels to partially recover over time, even in the absence
of ATRX, perhaps through a less efficient ATRX-independent salvage pathway.
However, H3.3 levels remain below that necessary to fully facilitate aPAR gene
expression.
143
Figure 4-1: A model for regulation of transcription by ATRX.
(A) H3.3 is deposited at newly synthesized DNA by ATRX targeting G-quadruplexes at
telomeres and aPAR genes. (B) ATRX facilitates transcription at aPAR genes by directly
binding and suppressing G-quadruplexes, and/or by acting with DAXX to deposit H3.3
after passage of the transcription machinery. (C) In the absence of ATRX, H3.3 is not
deposited and G-quadruplexes inhibit transcriptional elongation at aPAR genes. Despite
decreased telomeric H3.3, TERRA expression is unaffected. TSS, transcription start site.
144
4.7
Concluding remarks
The identification of ancestral pseudoautosomal region genes as ATRX targets was an
unexpected finding, but pursuing this avenue of investigation has proven a valuable basis
to study a model of gene regulation by ATRX. The characteristics of these genes – GCrich, presence of G-quadruplexes, proximity to the mouse telomere and presence in the
human pseudoautosomal region – enables their unique regulation by ATRX, and we have
shown that this mechanism of regulation involves H3.3 deposition and facilitation of
transcription. This role for ATRX in transcription at intragenic G-quadruplexes
complements its role in replication at intergenic G-quadruplexes, and these two
mechanisms likely work in concert to maintain proper cellular function. Certainly, a
number of details remain to be addressed before we fully understand how ATRX
regulates gene expression, such as what other proteins ATRX may be working with at
these sites, and how a role for ATRX in transcription and replication may change
throughout brain development. ATRX loss of function was originally linked to
developmental defects, but has since also been linked to cancer. Other biological roles
may be discovered in the future, and by understanding the molecular mechanisms by
which ATRX functions, we will develop a better understanding of how genetic changes
in ATRX lead to problems in development and disease.
145
4.8 References
Aasland, R., Gibson, T.J., and Stewart, A.F. (1995). The PHD finger: implications for
chromatin-mediated transcriptional regulation. Trends in biochemical sciences 20, 56-59.
Aguilera, A., and Garcia-Muse, T. (2012). R loops: from transcription byproducts to
threats to genome stability. Mol Cell 46, 115-124.
Ahmad, K., and Henikoff, S. (2002). The histone variant H3.3 marks active chromatin by
replication-independent nucleosome assembly. Mol Cell 9, 1191-1200.
Altman, J., and Das, G.D. (1965). Autoradiographic and histological evidence of
postnatal hippocampal neurogenesis in rats. The Journal of comparative neurology 124,
319-335.
Bagheri-Fam, S., Argentaro, A., Svingen, T., Combes, A.N., Sinclair, A.H., Koopman,
P., and Harley, V.R. (2011). Defective survival of proliferating Sertoli cells and androgen
receptor function in a mouse model of the ATR-X syndrome. Human molecular genetics
20, 2213-2224.
Bassett, A.R., Cooper, S.E., Ragab, A., and Travers, A.A. (2008). The chromatin
remodelling factor dATRX is involved in heterochromatin formation. PLoS ONE 3,
e2099.
Belotserkovskii, B.P., Liu, R., Tornaletti, S., Krasilnikova, M.M., Mirkin, S.M., and
Hanawalt, P.C. (2010). Mechanisms and implications of transcription blockage by
guanine-rich DNA sequences. Proceedings of the National Academy of Sciences of the
United States of America 107, 12816-12821.
Bérubé, N.G., Mangelsdorf, M., Jagla, M., Vanderluit, J., Garrick, D., Gibbons, R.J.,
Higgs, D.R., Slack, R.S., and Picketts, D.J. (2005). The chromatin-remodeling protein
ATRX is critical for neuronal survival during corticogenesis. The Journal of clinical
investigation 115, 258-267.
Bochman, M.L., Paeschke, K., and Zakian, V.A. (2012). DNA secondary structures:
stability and function of G-quadruplex structures. Nature reviews 13, 770-780.
Bosch, A., and Suau, P. (1995). Changes in core histone variant composition in
differentiating neurons: the roles of differential turnover and synthesis rates. European
journal of cell biology 68, 220-225.
Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H., Tempst, P., Jones, R.S.,
and Zhang, Y. (2002). Role of histone H3 lysine 27 methylation in Polycomb-group
silencing. Science 298, 1039-1043.
Cao, R., and Zhang, Y. (2004). The functions of E(Z)/EZH2-mediated methylation of
lysine 27 in histone H3. Curr Opin Genet Dev 14, 155-164.
146
Chang, F.T., McGhie, J.D., Chan, F.L., Tang, M.C., Anderson, M.A., Mann, J.R., Andy
Choo, K.H., and Wong, L.H. (2013). PML bodies provide an important platform for the
maintenance of telomeric chromatin integrity in embryonic stem cells. Nucleic acids
research.
Clark, D.J., and Felsenfeld, G. (1991). Formation of nucleosomes on positively
supercoiled DNA. The EMBO journal 10, 387-395.
Clynes, D., and Gibbons, R.J. (2013). ATRX and the replication of structured DNA. Curr
Opin Genet Dev.
Couldrey, C., Carlton, M.B., Nolan, P.M., Colledge, W.H., and Evans, M.J. (1999). A
retroviral gene trap insertion into the histone 3.3A gene causes partial neonatal lethality,
stunted growth, neuromuscular deficits and male sub-fertility in transgenic mice. Human
molecular genetics 8, 2489-2495.
Delbarre, E., Ivanauskiene, K., Kuntziger, T., and Collas, P. (2012). DAXX-dependent
supply of soluble (H3.3-H4) dimers into PML bodies pending deposition into chromatin.
Genome research.
Delbarre, E., Jacobsen, B.M., Reiner, A.H., Sorensen, A.L., Kuntziger, T., and Collas, P.
(2010). Chromatin environment of histone variant H3.3 revealed by quantitative imaging
and genome-scale chromatin and DNA immunoprecipitation. Mol Biol Cell 21, 18721884.
Drane, P., Ouararhni, K., Depaux, A., Shuaib, M., and Hamiche, A. (2010). The deathassociated protein DAXX is a novel histone chaperone involved in the replicationindependent deposition of H3.3. Genes & development 24, 1253-1265.
Elsaesser, S.J., Goldberg, A.D., and Allis, C.D. (2010). New functions for an old variant:
no substitute for histone H3.3. Curr Opin Genet Dev 20, 110-117.
Emelyanov, A.V., Konev, A.Y., Vershilova, E., and Fyodorov, D.V. (2010). Protein
complex of Drosophila ATRX/XNP and HP1a is required for the formation of pericentric
beta-heterochromatin in vivo. The Journal of biological chemistry 285, 15027-15037.
Fenouil, R., Cauchy, P., Koch, F., Descostes, N., Cabeza, J.Z., Innocenti, C., Ferrier, P.,
Spicuglia, S., Gut, M., Gut, I., et al. (2012). CpG islands and GC content dictate
nucleosome depletion in a transcription-independent manner at mammalian promoters.
Genome research 22, 2399-2408.
Fousteri, M., and Mullenders, L.H. (2008). Transcription-coupled nucleotide excision
repair in mammalian cells: molecular mechanisms and biological effects. Cell Res 18, 7384.
Fry, M., and Loeb, L.A. (1999). Human werner syndrome DNA helicase unwinds
tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n. The Journal
of biological chemistry 274, 12797-12802.
147
Gibbons, R.J., and Higgs, D.R. (2010). ATRX: taming tandem repeats. Cell Cycle 9,
4605-4606.
Gibbons, R.J., Picketts, D.J., Villard, L., and Higgs, D.R. (1995). Mutations in a putative
global transcriptional regulator cause X-linked mental retardation with alpha-thalassemia
(ATR-X syndrome). Cell 80, 837-845.
Goldberg, A.D., Banaszynski, L.A., Noh, K.M., Lewis, P.W., Elsaesser, S.J., Stadler, S.,
Dewell, S., Law, M., Guo, X., Li, X., et al. (2010). Distinct Factors Control Histone
Variant H3.3 Localization at Specific Genomic Regions. Cell 140, 678-691.
Grewal, S.I., and Jia, S. (2007). Heterochromatin revisited. Nature reviews 8, 35-46.
Halder, K., Halder, R., and Chowdhury, S. (2009). Genome-wide analysis predicts DNA
structural motifs as nucleosome exclusion signals. Molecular bioSystems 5, 1703-1712.
Heaphy, C.M., de Wilde, R.F., Jiao, Y., Klein, A.P., Edil, B.H., Shi, C., Bettegowda, C.,
Rodriguez, F.J., Eberhart, C.G., Hebbar, S., et al. (2011). Altered telomeres in tumors
with ATRX and DAXX mutations. Science 333, 425.
Henikoff, S. (2008). Nucleosome destabilization in the epigenetic regulation of gene
expression. Nature reviews 9, 15-26.
Hershman, S.G., Chen, Q., Lee, J.Y., Kozak, M.L., Yue, P., Wang, L.S., and Johnson,
F.B. (2008). Genomic distribution and functional analyses of potential G-quadruplexforming sequences in Saccharomyces cerevisiae. Nucleic acids research 36, 144-156.
Higgs, D.R., Garrick, D., Anguita, E., De Gobbi, M., Hughes, J., Muers, M., Vernimmen,
D., Lower, K., Law, M., Argentaro, A., et al. (2005). Understanding alpha-globin gene
regulation: Aiming to improve the management of thalassemia. Ann N Y Acad Sci 1054,
92-102.
Hodl, M., and Basler, K. (2009). Transcription in the absence of histone H3.3. Current
biology : CB 19, 1221-1226.
Huh, M.S., Price O'Dea, T., Ouazia, D., McKay, B.C., Parise, G., Parks, R.J., Rudnicki,
M.A., and Picketts, D.J. (2012). Compromised genomic integrity impedes muscle growth
after Atrx inactivation. The Journal of clinical investigation 122, 4412-4423.
Illingworth, R.S., Gruenewald-Schneider, U., Webb, S., Kerr, A.R., James, K.D., Turner,
D.J., Smith, C., Harrison, D.J., Andrews, R., and Bird, A.P. (2010). Orphan CpG islands
identify numerous conserved promoters in the mammalian genome. PLoS genetics 6,
e1001134.
Ishov, A.M., Vladimirova, O.V., and Maul, G.G. (2004). Heterochromatin and ND10 are
cell-cycle regulated and phosphorylation-dependent alternate nuclear sites of the
transcription repressor Daxx and SWI/SNF protein ATRX. Journal of cell science 117,
3807-3820.
148
Jiao, Y., Shi, C., Edil, B.H., de Wilde, R.F., Klimstra, D.S., Maitra, A., Schulick, R.D.,
Tang, L.H., Wolfgang, C.L., Choti, M.A., et al. (2011). DAXX/ATRX, MEN1, and
mTOR pathway genes are frequently altered in pancreatic neuroendocrine tumors.
Science 331, 1199-1203.
Kernohan, K.D., Jiang, Y., Tremblay, D.C., Bonvissuto, A.C., Eubanks, J.H., Mann,
M.R., and Berube, N.G. (2010). ATRX partners with cohesin and MeCP2 and contributes
to developmental silencing of imprinted genes in the brain. Dev Cell 18, 191-202.
Kourmouli, N., Sun, Y.M., van der Sar, S., Singh, P.B., and Brown, J.P. (2005).
Epigenetic regulation of mammalian pericentric heterochromatin in vivo by HP1.
Biochemical and biophysical research communications 337, 901-907.
Kulaeva, O.I., Hsieh, F.K., Chang, H.W., Luse, D.S., and Studitsky, V.M. (2013).
Mechanism of transcription through a nucleosome by RNA polymerase II. Biochimica et
biophysica acta 1829, 76-83.
Law, M.J., Lower, K.M., Voon, H.P., Hughes, J.R., Garrick, D., Viprakasit, V., Mitson,
M., De Gobbi, M., Marra, M., Morris, A., et al. (2010). ATR-X syndrome protein targets
tandem repeats and influences allele-specific expression in a size-dependent manner. Cell
143, 367-378.
Levy, M.A., Fernandes, A.D., Tremblay, D.C., Seah, C., and Berube, N.G. (2008). The
SWI/SNF protein ATRX co-regulates pseudoautosomal genes that have translocated to
autosomes in the mouse genome. BMC genomics 9, 468.
Lewis, P.W., Elsaesser, S.J., Noh, K.M., Stadler, S.C., and Allis, C.D. (2010). Daxx is an
H3.3-specific histone chaperone and cooperates with ATRX in replication-independent
chromatin assembly at telomeres. Proceedings of the National Academy of Sciences of
the United States of America 107, 14075-14080.
Liu, L.F., and Wang, J.C. (1987). Supercoiling of the DNA template during transcription.
Proceedings of the National Academy of Sciences of the United States of America 84,
7024-7027.
McDowell, T.L., Gibbons, R.J., Sutherland, H., O'Rourke, D.M., Bickmore, W.A.,
Pombo, A., Turley, H., Gatter, K., Picketts, D.J., Buckle, V.J., et al. (1999). Localization
of a putative transcriptional regulator (ATRX) at pericentromeric heterochromatin and
the short arms of acrocentric chromosomes. Proceedings of the National Academy of
Sciences of the United States of America 96, 13983-13988.
Michod, D., Bartesaghi, S., Khelifi, A., Bellodi, C., Berliocchi, L., Nicotera, P., and
Salomoni, P. (2012). Calcium-dependent dephosphorylation of the histone chaperone
DAXX regulates H3.3 loading and transcription upon neuronal activation. Neuron 74,
122-135.
Ming, G.L., and Song, H. (2011). Adult neurogenesis in the mammalian brain: significant
answers and significant questions. Neuron 70, 687-702.
149
Molenaar, J.J., Koster, J., Zwijnenburg, D.A., van Sluis, P., Valentijn, L.J., van der Ploeg,
I., Hamdi, M., van Nes, J., Westerman, B.A., van Arkel, J., et al. (2012). Sequencing of
neuroblastoma identifies chromothripsis and defects in neuritogenesis genes. Nature 483,
589-593.
Murmann, A.E., Gao, J., Encinosa, M., Gautier, M., Peter, M.E., Eils, R., Lichter, P., and
Rowley, J.D. (2005). Local gene density predicts the spatial position of genetic loci in the
interphase nucleus. Exp Cell Res 311, 14-26.
Newhart, A., Rafalska-Metcalf, I.U., Yang, T., Negorev, D.G., and Janicki, S.M. (2012).
Single-cell analysis of Daxx and ATRX-dependent transcriptional repression. Journal of
cell science 125, 5489-5501.
Ng, R.K., and Gurdon, J.B. (2008). Epigenetic memory of an active gene state depends
on histone H3.3 incorporation into chromatin in the absence of transcription. Nat Cell
Biol 10, 102-109.
Pazin, M.J., and Kadonaga, J.T. (1997). SWI2/SNF2 and related proteins: ATP-driven
motors that disrupt protein-DNA interactions? Cell 88, 737-740.
Pina, B., and Suau, P. (1987). Changes in histones H2A and H3 variant composition in
differentiating and mature rat brain cortical neurons. Developmental biology 123, 51-58.
Ratnakumar, K., Duarte, L.F., LeRoy, G., Hasson, D., Smeets, D., Vardabasso, C.,
Bonisch, C., Zeng, T., Xiang, B., Zhang, D.Y., et al. (2012). ATRX-mediated chromatin
association of histone variant macroH2A1 regulates alpha-globin expression. Genes &
development 26, 433-438.
Sakai, A., Schwartz, B.E., Goldstein, S., and Ahmad, K. (2009). Transcriptional and
developmental functions of the H3.3 histone variant in Drosophila. Current biology : CB
19, 1816-1820.
Salas, T.R., Petruseva, I., Lavrik, O., Bourdoncle, A., Mergny, J.L., Favre, A., and
Saintome, C. (2006). Human replication protein A unfolds telomeric G-quadruplexes.
Nucleic acids research 34, 4857-4865.
Salomoni, P., and Khelifi, A.F. (2006). Daxx: death or survival protein? Trends in cell
biology 16, 97-104.
Schreiner, S., Burck, C., Glass, M., Groitl, P., Wimmer, P., Kinkley, S., Mund, A.,
Everett, R.D., and Dobner, T. (2013). Control of human adenovirus type 5 gene
expression by cellular Daxx/ATRX chromatin-associated complexes. Nucleic acids
research.
Schwartz, B.E., and Ahmad, K. (2005). Transcriptional activation triggers deposition and
removal of the histone variant H3.3. Genes & development 19, 804-814.
150
Schwartz, B.E., and Ahmad, K. (2006). 2. Chromatin assembly with H3 histones: full
throttle down multiple pathways. Current topics in developmental biology 74, 31-55.
Schwartzentruber, J., Korshunov, A., Liu, X.Y., Jones, D.T., Pfaff, E., Jacob, K., Sturm,
D., Fontebasso, A.M., Quang, D.A., Tonjes, M., et al. (2012). Driver mutations in histone
H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature 482, 226-231.
Schwarzbauer, K., Bodenhofer, U., and Hochreiter, S. (2012). Genome-wide chromatin
remodeling identified at GC-rich long nucleosome-free regions. PLoS ONE 7, e47924.
Seah, C., Levy, M.A., Jiang, Y., Mokhtarzada, S., Higgs, D.R., Gibbons, R.J., and
Berube, N.G. (2008). Neuronal death resulting from targeted disruption of the Snf2
protein ATRX is mediated by p53. J Neurosci 28, 12570-12580.
Stewart, M.D., Li, J., and Wong, J. (2005). Relationship between histone H3 lysine 9
methylation, transcription repression, and heterochromatin protein 1 recruitment. Mol
Cell Biol 25, 2525-2538.
Subtil-Rodriguez, A., and Reyes, J.C. (2011). To cross or not to cross the nucleosome,
that is the elongation question. RNA biology 8, 389-393.
Sun, D., and Hurley, L.H. (2009). The importance of negative superhelicity in inducing
the formation of G-quadruplex and i-motif structures in the c-Myc promoter: implications
for drug targeting and control of gene expression. J Med Chem 52, 2863-2874.
Sun, H., Karow, J.K., Hickson, I.D., and Maizels, N. (1998). The Bloom's syndrome
helicase unwinds G4 DNA. The Journal of biological chemistry 273, 27587-27592.
Sun, H., Yabuki, A., and Maizels, N. (2001). A human nuclease specific for G4 DNA.
Proceedings of the National Academy of Sciences of the United States of America 98,
12444-12449.
Szenker, E., Ray-Gallet, D., and Almouzni, G. (2011). The double face of the histone
variant H3.3. Cell Res 21, 421-434.
Tang, J., Wu, S., Liu, H., Stratt, R., Barak, O.G., Shiekhattar, R., Picketts, D.J., and
Yang, X. (2004). A novel transcription regulatory complex containing death domainassociated protein and the ATR-X syndrome protein. The Journal of biological chemistry
279, 20369-20377.
Tang, P., Frankenberg, S., Argentaro, A., Graves, J.M., and Familari, M. (2011).
Comparative analysis of the ATRX promoter and 5' regulatory region reveals conserved
regulatory elements which are linked to roles in neurodevelopment, alpha-globin
regulation and testicular function. BMC Res Notes 4, 200.
Tornaletti, S. (2009). Transcriptional processing of G4 DNA. Molecular carcinogenesis
48, 326-335.
151
Tsai, K., Thikmyanova, N., Wojcechowskyj, J.A., Delecluse, H.J., and Lieberman, P.M.
(2011). EBV tegument protein BNRF1 disrupts DAXX-ATRX to activate viral early
gene transcription. PLoS pathogens 7, e1002376.
Valadez-Graham, V., Yoshioka, Y., Velazquez, O., Kawamori, A., Vazquez, M.,
Neumann, A., Yamaguchi, M., and Zurita, M. (2012). XNP/dATRX interacts with DREF
in the chromatin to regulate gene expression. Nucleic acids research 40, 1460-1474.
Watson, L.A., Solomon, L.A., Li, J.R., Jiang, Y., Edwards, M., Shin-Ya, K., Beier, F.,
and Berube, N.G. (2013). Atrx deficiency induces telomere dysfunction, endocrine
defects, and reduced life span. The Journal of clinical investigation.
Wong, H.M., and Huppert, J.L. (2009). Stable G-quadruplexes are found outside
nucleosome-bound regions. Molecular bioSystems 5, 1713-1719.
Wong, L.H., McGhie, J.D., Sim, M., Anderson, M.A., Ahn, S., Hannan, R.D., George,
A.J., Morgan, K.A., Mann, J.R., and Choo, K.H. (2010). ATRX interacts with H3.3 in
maintaining telomere structural integrity in pluripotent embryonic stem cells. Genome
research 20, 351-360.
Wong, L.H., Ren, H., Williams, E., McGhie, J., Ahn, S., Sim, M., Tam, A., Earle, E.,
Anderson, M.A., Mann, J., et al. (2009). Histone H3.3 incorporation provides a unique
and functionally essential telomeric chromatin in embryonic stem cells. Genome research
19, 404-414.
Worcel, A., Strogatz, S., and Riley, D. (1981). Structure of chromatin and the linking
number of DNA. Proceedings of the National Academy of Sciences of the United States
of America 78, 1461-1465.
Wu, Y., Shin-ya, K., and Brosh, R.M., Jr. (2008). FANCJ helicase defective in Fanconia
anemia and breast cancer unwinds G-quadruplex DNA to defend genomic stability. Mol
Cell Biol 28, 4116-4128.
Xue, Y., Gibbons, R., Yan, Z., Yang, D., McDowell, T.L., Sechi, S., Qin, J., Zhou, S.,
Higgs, D., and Wang, W. (2003). The ATRX syndrome protein forms a chromatinremodeling complex with Daxx and localizes in promyelocytic leukemia nuclear bodies.
Proceedings of the National Academy of Sciences of the United States of America 100,
10635-10640.
Zaug, A.J., Podell, E.R., and Cech, T.R. (2005). Human POT1 disrupts telomeric Gquadruplexes allowing telomerase extension in vitro. Proceedings of the National
Academy of Sciences of the United States of America 102, 10864-10869.
152
Appendices
Appendix A: Permission to reproduce previously published work
The data and associated text in Chapter2, sections 2.3.1 - 2.3.5 represents a previously
published manuscript:
Levy, M.A., Fernandes, A.D., Tremblay, D.C., Seah, C., and Berube, N.G. (2008). The
SWI/SNF protein ATRX co-regulates pseudoautosomal genes that have translocated to
autosomes in the mouse genome. BMC genomics 9, 468.
This material is re-used here in accordance with the policy of BMC Genomics that
authors retain copyright to their work, and illustrations, figures, or tables may be
reproduced provided that BioMed Central is duly identified as the original publisher, and
that proper attribution of authorship and correct citation details are given.
Appendix B: Statement of permission for the use of animals for experimental
research.
All animal studies were conducted in compliance with the regulations of The Animals for
Research Act of the province of Ontario, the guidelines of the Canadian Council on
Animal care, and the policies and procedures approved by the University of Western
Ontario Council on Animal Care. This work was conducted in compliance with the
animal use protocol 2008-041-02 held by Dr. Nathalie Bérubé, principal investigator at
the Schulich School of Medicine and Dentistry and the department of Paediatrics at the
University of Western Ontario in London, Ontario, Canada.
153
Curriculum Vitae
Name:
Michael Levy
Post-secondary Education and Degrees:
2001-2005
B.Sc. (Honors) genetics, University of Western Ontario, London, Canada.
Honours and Awards:
2012
2009-2011
2009-2010
2010
20007
2005-2006
2002-2005
2001
CIHR Inst. of Human Development, Child and Youth Health travel award.
NSERC CGS Ph.D. scholarship.
OGS Ph.D. scholarship (declined).
UWO/LHRI Dept. of Paediatrics Research Day, best poster.
VRL Research Day, 2nd place, platform competition.
CHRI Curtis Cadman Graduate Studentship.
Deans Honor List, Faculty of Science, UWO.
Western Scholarship of Excellence admission scholarship.
Relevant Work Experience
2005 (summer)
2004 (summer)
Student researcher, CHRI, London, Canada.
Let’s Talk Science camp co-ordinator, London, Canada.
Relevant Volunteer Experience
2006-2009
2002-2007
Lawson Association of Fellows and Students, executive committee
Let’s Talk Science, London, Canada.
Publications:
Seah C, Levy MA (co-first authors), Jiang Y, Mokhtarzada S, Higgs DR, Gibbons RJ,
Bérubé NG. Neuronal death resulting from targeted disruption of the Snf2 protein ATRX
is mediated by p53. Journal of Neuroscience 28, 12570-12580. 2008 Nov 19.
Levy MA, Fernandes AD, Tremblay DC, Seah C, Bérubé NG. The SWI/SNF protein
ATRX co-regulates pseudoautosomal genes that have translocated to autosomes in the
mouse genome. BMC Genomics 9, 486. 2008 Oct 8.
Selected Posters & Presentations
Levy MA, Jiang Y, Bérubé NG. Epigenetic regulation of specific subtelomeric genes by
ATRX. Keystone Symposia - Chromatin Dynamics, Keystone, Colorado, USA, 2012
(poster).
154
Levy MA, Jiang Y, Bérubé NG. Epigenetic regulation of ancestral pseudoautosomal
genes in the developing mouse brain. Great Lakes Mammalian Development Meeting,
Toronto, Ontario, Canada, 2010 (poster).
Levy MA, Fernandes A, Tremblay D, Seah C, Bérubé NG. ATRX co-regulates ancestral
pseudoautosomal genes in the mouse. The American Society of Human Genetics annual
meeting, Philadephia, Pennsylvania, USA, 2008 (poster).
Levy MA. ATRX regulates the expression of ancestral pseudoautosomal genes in the
murine forebrain. Victoria Research Laboratories Research Day, Lawson Health
Research Institute, London, Canada, 2007 (presentation).
Cavanagh PC, Pampillo M, Levy M, Bérubé NG, Han V, Bhattacharya M, and Babwah
AV. A DNA Microarray and Real-Time expression Analysis of GnRH-Regulated Gene
Expression during Human Placentation. Lawson Health Research Institute Research Day,
London, Canada, 2007 (poster).
Levy, M., Seah, C., and Bérubé, NG. The role of ATRX in the cortical hem and
hippocampus. Paediatrics Research Day, Lawson Health Research Institute, London,
Canada, 2006 (poster).