Contribution of hMTH1 to the Maintenance of
8-Oxoguanine Levels in Lung DNA of
Non–Small-Cell Lung Cancer Patients
ARTICLE
Elżbieta Speina, Katarzyna D. Arczewska, Daniel Gackowski,
Maja Zielińska, Agnieszka Siomek, Janusz Kowalewski, Ryszard Oliński,
Barbara Tudek, Jarosław T. Kuśmierek
Background: The level of 8-oxoguanine (8-oxoG), a general
marker of oxidative DNA damage, in DNA is the result of
both an equilibrium between the rates of its formation and
removal from DNA by DNA repair enzymes and the removal
of 8-oxodGTP from the cellular nucleotide pool by hydrolysis to 8-oxodGMP, preventing its incorporation into DNA. To
determine the contribution of each component to the level
of 8-oxoG in DNA, we compared 8-oxoG–excising activity
(encoded by hOGG1), 8-oxodGTPase activity (encoded by
hMTH1), and 8-oxoG levels in DNA from tumors and surrounding normal lung tissues from non–small-cell lung cancer
patients. Methods: We measured the level of 8-oxoG in DNA
of 47 patients by high-performance liquid chromatography/
electrochemical detection (HPLC/ECD), hOGG1 activity in
tissue extracts of 56 patients by the nicking assay using an oligodeoxynucleotide containing a single 8-oxoG, and hMTH1
activity in tissue extracts of 33 patients by HPLC/UV detection. All statistical tests were two-sided. Results: The 8-oxoG
level was lower in tumor DNA than in DNA from normal
lung tissue (geometric mean: 5.81 versus 10.18 8-oxoG/106 G,
geometric mean of difference = 1.75; P<.001). The hOGG1
activity was also lower in tumor than in normal lung tissue (geometric mean: 8.76 versus 20.91 pmol/h/mg protein,
geometric mean of difference = 2.39; P<.001), whereas the
hMTH1 activity was higher in tumor than in normal lung
tissue (geometric mean: 28.79 versus 8.94 nmol/h/mg protein,
geometric mean of difference = 0.31; P<.001). The activity of
384 ARTICLES
hMTH1 was three orders of magnitude higher than that of
hOGG1 (nanomoles versus picomoles per hour per milligram
of protein, respectively). Conclusions: Several different components contribute to the maintenance of 8-oxoG levels in human DNA, with the greatest contributor being the removal
of 8-oxodGTP from the cellular nucleotide pool by hMTH1.
[J Natl Cancer Inst 2005;97:384–95]
Cellular DNA and its deoxynucleoside-5′-triphosphate (dNTP)
precursors are continuously exposed to reactive oxygen species
that are generated by mitochondrial respiration and inflammation
and by environmental exposures to ionizing radiation and certain
chemicals. Oxidative stress increases the level of oxidative damage to cellular components, including DNA. Because cells, in
Affiliations of authors: Department of Molecular Biology, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawińskiego 5a, 02-106
Warsaw, Poland (ES, KDA, MZ, BT, JTK); Department of Clinical Biochemistry
(DG, AS, RO) and Department and Clinic of Thoracic Surgery and Tumours (JK),
The Ludwik Rydygier Medical University in Bydgoszcz, Karłowicza 24, 85-092
Bydgoszcz, Poland.
Correspondence to: Jarosław T. Kuśmierek, Ph.D., Department of Molecular
Biology, Institute of Biochemistry and Biophysics, Polish Academy of Sciences,
Pawińskiego 5a, 02-106 Warsaw, Poland (e-mail: [email protected]).
See “Notes” following “References.”
DOI: 10.1093/jnci/dji058
Journal of the National Cancer Institute, Vol. 97, No. 5, © Oxford University
Press 2005, all rights reserved.
Journal of the National Cancer Institute, Vol. 97, No. 5, March 2, 2005
response to oxidative DNA damage, can repair the damage, replicate it, or activate cell death pathways, oxidative DNA damage
has been implicated to play a role in various diseases, including
cancer, atherosclerosis, neurodegenerative diseases, and acquired
immunodeficiency syndrome (1–3). Reactive oxygen species
modify DNA bases, and more than 20 different oxidatively
altered purines and pyrimidines have been detected and characterized (4). Among the modified bases, 8-oxo-7,8-dihydroguanine
(8-oxoguanine or 8-oxoG) is one of the most common and is often
considered a general marker of oxidative damage to DNA (1,5).
Cytosine and adenine bases can pair with 8-oxoG during
DNA synthesis when 8-oxoG is present in the DNA template
(6) or when 8-oxodGTP is incorporated into DNA from the
nucleotide pool during de novo DNA synthesis (7). The 8-oxoG:
A mispair formed by the incorporation of dATP opposite
8-oxoG results in a GC→TA transversion, whereas the A:8-oxoG
mispair formed by the incorporation of 8-oxodGTP opposite A
results in a AT→CG transversion. In Escherichia coli, at least
three repair enzymes are involved in correcting the mispairings.
Two of the enzymes involved are DNA glycosylases; the MutM
(Fpg) protein excises 8-oxoG from 8-oxoG:C mispairs, and the
MutY protein excises adenine from 8-oxoG:A mispairs. A third
enzyme, MutT, is a pyrophosphohydrolase (i.e., 8-oxodGTPase)
that hydrolyzes 8-oxodGTP to 8-oxodGMP and inorganic pyrophosphate, thus eliminating this damaged dGTP from the dNTP
pool and preventing it from being incorporated into DNA (8).
Recently, an additional 8-oxoG–excising activity, endonuclease
VIII (Nei), was isolated from E. coli. Nei was originally discovered as a DNA glycosylase that specifically excises damaged
pyrimidines (9). Whereas MutM preferentially excises 8-oxoG
paired in DNA with C, T, and G, Nei preferentially excises
8-oxoG from the 8-oxoG:A mispair.
Human cells contain enzymes that are analogous to the E. coli
MutM, Nei, MutY, and MutT proteins. The human enzymes
include two 8-oxoG glycosylases, OGG1 and OGG2. hOGG1
specifically excises 8-oxoG from the 8-oxoG:C mispair (10) and
is similar in function to MutM. hOGG2 specifically excises
8-oxoG from 8-oxoG:G or 8-oxoG:A mispairs (11) and is similar in function to Nei. Hazra et al. (12) postulated that OGG1
is a housekeeping enzyme that removes 8-oxoG from the DNA
of nondividing cells and that OGG2 is more specific, removing 8-oxoG from nascent or transcriptionally active DNA. Two
Nei-like human glycosylases, NEIL1 and NEIL2, have been
characterized, both of which have specific activity for oxidized
pyrimidines, but both can also excise 8-oxoG. These glycosylases
can excise oxidized bases from both double-stranded and singlestranded DNA (13,14). The human glycosylase MYH, which is
analogous to bacterial MutY, has been also identified and characterized (15–17). Similarly, the human enzyme MTH1, which is
analogous to MutT protein of E. coli, removes 8-oxodGTP from
the cellular dNTP pool (7,18,19). Human MTH1, in contrast to
bacterial MutT, acts also on some other oxidative stress-generated
dNTPs, e.g., 2-oxo- and 8-oxodATP (20) and 8-chlorodGTP, a
hypochlorous acid–modified nucleotide (21). In addition, oxidative DNA damage, including that associated with 8-oxoG, can be
repaired by general cellular repair systems: nucleotide excision
repair, both transcription-coupled and global genomic systems,
and mismatch repair [reviewed in (22)].
Increased DNA damage resulting from oxidative stress has
been suggested to play an important role in the induction and
progression of many types of human cancers (2,3). The etiology
Journal of the National Cancer Institute, Vol. 97, No. 5, March 2, 2005
of lung cancer has been linked to tobacco smoking. Cigarette
smoke contains many carcinogens, including polycyclic aromatic
hydrocarbons, which can form DNA adducts in lung tissue (23),
and reactive oxygen species, which can induce oxidative damage in human lung tissue (24). Cigarette smoke can also cause
chronic lung inflammation, which increases the oxidative stress
in lung tissues (25).
We (26) and Paz-Elizur et al. (27) have recently demonstrated
that a deficiency of 8-oxoG–excising activity, as measured in leukocytes of lung cancer patients and healthy volunteers, may be a
risk factor for developing lung cancer. In our work, we found that,
coincident with decreased 8-oxoG–excising activity, the level
of 8-oxoG in DNA isolated from leukocytes of cancer patients
was statistically significantly higher than that in DNA of healthy
control subjects (26). We have also shown that a deficiency of
the excision of lipid peroxidation-generated 1,N6-ethenoadenine
and 3,N4-ethenocytosine is associated with the risk of developing
lung adenocarcinoma (ADC) (28).
The level of 8-oxoG in DNA reflects the equilibrium of several processes: the rates of 8-oxoG formation in DNA and its
elimination from DNA and the rates of 8-oxodGTP formation in
and elimination from the cellular nucleotide pool and its incorporation into DNA. Although a number of enzymatic pathways
can be involved in removal of 8-oxoG from genomic DNA, it
appears that OGG1 plays an essential role in the repair of this lesion in mammalian cells. The evidence comes from experiments
with OGG1 gene knockout mice, which accumulate abnormal
levels of 8-oxoG in their DNA and have increased spontaneous
rate of mutations (29,30). It is interesting that, although extracts
of OGG1 null mouse tissues cannot excise 8-oxoG, as assayed
by nicking an 8-oxoG-containing oligodeoxynucleotide, there is
slow but substantial removal of 8-oxoG from DNA in proliferating cells in vivo. This “backup” repair of 8-oxoG lesions may
occur via the nucleotide excision repair pathway (29).
The role of elimination of the mutagen-damaged dNTPs
from the cellular pool in the maintenance of genomic integrity
has received less attention than the role of genomic DNA repair
pathways. However, numerous lines of evidence indicate that
eliminating mutagen-damaged dNTPs from the cellular pool is
important for maintaining genomic integrity. For example, in
E. coli, the lack of a functional MutT protein results in a mutator
phenotype that is a much stronger mutator than if 8-oxoG DNA
glycosylase is missing (31). Mice defective in the MTH1 gene
have more tumors in the lungs, livers, and stomachs 18 months
after birth than wild-type animals. MTH1−/− murine cell lines exhibit increased mutation rates compared with wild-type cells (32).
To better understand a role of oxidative DNA damage in lung
cancer development, we compared three oxidative DNA damage/repair measures in patients with non–small-cell lung cancer
(NSCLC): 8-oxoG level in DNA, 8-oxoG–excising (hOGG1),
and 8-oxodGTP–hydrolyzing (hMTH1) activities in tumor and
surrounding normal lung tissue. Our goal was also to determine
the relative contributions of these activities to regulating the
level of 8-oxoG in DNA.
MATERIALS
AND
METHODS
Materials
All chemical reagents were of high purity. Monoclonal antiβ-actin antibody was purchased from Santa Cruz Biotech., Inc.
ARTICLES
385
(Santa Cruz, CA). T4 polynucleotide kinase, [γ-32P]ATP, Hybond-C
membrane, horseradish peroxidase–conjugated goat anti–rabbit
immunoglobulin G (IgG), and the enhanced chemiluminescence
(ECL) Western blotting detection reagents were obtained from
Amersham-Pharmacia Biotech (Uppsala, Sweden). Micro BioSpin P-30 columns were obtained from Bio-Rad Laboratories
(Hercules, CA). The 40-base oligodeoxynucleotide containing
a single 8-oxoG at position 20 in the sequence 5′-d(GCTACC
TACCTAGCGACCTXCGACTGTCCCACTGCTCGAA)-3′, in
which X indicates 8-oxoG, and the complementary oligodeoxynucleotide, containing C opposite 8-oxoG, were obtained from
Eurogentec Herstal (Herstal, Belgium). Yeast 8-oxoG DNA glycosylase (yOGG1) was a kind gift from Dr. Serge Boiteux (CEA,
Fontenay-aux-Roses, France).
We prepared 8-oxodGMP according to a published procedure
(33), with minor modifications. Tributylammonium phosphate
and pyrophosphate were used as phosphorylating agents to generate 8-oxodGDP and 8-oxodGTP, respectively, from an imidazolidate derivative of 8-oxodGMP (34). All reaction mixtures
were separated and purified of individual nucleotides by using
DEAE-Sephadex A-25 (carbonate form) columns, with appropriate concentration gradients of triethylammonium bicarbonate as
eluents. High-performance liquid chromatography (HPLC) was
used to assess the purity of the prepared 8-oxo-2′-deoxyguanosine
5′-mono-, di-, and triphosphate before (i.e., in the nucleotide
form) and after (i.e., in nucleoside form) complete dephosphorylation by bacterial alkaline phosphatase.
Study Group and Tissue Sampling
The study was performed on a group of 56 patients with primary
NSCLC, who underwent pulmonary surgery during the period
from February 2001 through January 2003 at the Department and
Clinic of Thoracic Surgery and Tumours, Medical University
Hospital, in Bydgoszcz, Poland. Patients who had undergone
prior chemotherapy or radiation therapy (within 3 weeks before
surgery) were excluded from the study. Of the 56 patients, 51 had
not received any treatment before surgery. Although it is unclear
whether the other five patients had received chemotherapy, they
had not received treatment for at least 3 weeks before surgery.
Each patient was assigned an individual code number. All patients
answered a questionnaire concerning demographic data, smoking, diet, vitamin uptake, and medical history. The questionnaire
was administered by the team physician (J. Kowalewski). The
patient cohort comprised 41 men and 15 women and 32 smokers and 24 ex-smokers, i.e., individuals who had refrained from
smoking for at least 2 years. The mean age was 60 years (range,
41–82 years). Information on the type of tumor and treatment of
patients was collected by the team physician (J. Kowalewski).
The histologic type of cancer was determined according to the
World Health Organization classification (35). Thirty-six patients
had squamous cell carcinomas (SCCs), and 14 patients had
ADCs. For six patients, no information about the type of cancer
was obtained. The information about tumor histology and patient
questionnaire responses were blinded to all investigators (with
the exception of the team physician) until after the statistical
analysis was complete.
Samples were obtained from tissues removed during therapeutic surgery. Pairs of samples from the tumor and the
surrounding normal tissue were collected from each patient.
Each sample was divided into two parts: one part was used to
386 ARTICLES
isolate DNA and determine 8-oxoG levels at the Department
of Clinical Biochemistry, Medical University, in Bydgoszcz;
the other part was used to prepare tissue extracts and determine
hOGG1 and hMTH1 protein activities at the Department of
Molecular Biology, Institute of Biochemistry and Biophysics,
PAS, Warsaw. The samples were immediately frozen under liquid
nitrogen and kept at −80 °C during transportation and storage.
The study was conducted in accordance with the Helsinki
Declaration, and the protocol was approved by the medical ethics committee of L. Rydygier Medical University, Bydgoszcz,
Poland (in accordance with Good Clinical Practice, Warsaw,
Poland, 1998). All study participants provided written informed
consent.
DNA Isolation and 8-OxoG Determination
DNA from lung tissue was isolated as previously described
(36), with some modifications (37). The research team participated in the European Standards Committee on Oxidative DNA
Damage (ESCODD), a European Community project that ended
in 2003, which was set up to critically examine the different
approaches to measure base oxidation in DNA. In several interlaboratory trials determining the levels of 8-oxoG in HeLa cell
DNA, isolated from untreated cells or from cells treated with light
in the presence of a photosensitizer to induce different amounts of
8-oxoG in DNA, our laboratory demonstrated a low background
level of 8-oxoG in DNA from untreated cells and an ability to
detect a dose–response between the concentration of photosensitizer and the level of 8-oxoG in DNA of treated cells (37).
Levels of 8-oxoG were determined by the HPLC/electrochemical
detection technique, as described previously (38). For technical
reasons (enzymatic digestion of DNA to deoxynucleosides and
better solubility of the oxidized deoxynucleoside than of the
base), 8-oxoG was analyzed as its 2′-deoxynucleoside equivalent,
7,8-dihydro-8-oxo-2′-deoxyguanosine (8-oxo-2′-deoxyguanosine,
8-oxodG). The amount of both molecules in the DNA is exactly
the same. The level of 8-oxoG in DNA is reported in number of
8-oxoG per 106 unmodified G.
Preparation of Tissue Extracts
Lung tissue samples were homogenized with four volumes
of buffer containing 50 mM Tris-HCl, pH 7.5, 1 mM EDTA,
10 mM dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride.
Cells were disrupted by sonication (three times with 15-second
pulses and 30-second intervals). Cell debris was removed by
centrifugation (7000g, 4 °C, 15 minutes), and the supernatant
was collected. Protein concentration in the supernatant was
determined by the Bradford method (39) using the Sigma (St.
Louis, MO) protein assay reagent. Supernatants were stored in
aliquots at −80 °C until tested.
hOGG1 (8-OxoG–excising Activity) Assay
The 5′-end of the 40-base oligodeoxynucleotide containing 8oxoG at position 20 was labeled with 32P by polynucleotide kinase
and an excess of [γ-32P]ATP (3000 Ci/mmol). The radiolabeled
oligodeoxynucleotide was purified using a Micro Bio-Spin P-30
column, according to the manufacturer’s recommended protocol.
This oligonucleotide was annealed to its complementary oligonucleotide (present in twofold-molar excess), such that C was
Journal of the National Cancer Institute, Vol. 97, No. 5, March 2, 2005
opposite 8-oxoG, by incubating the oligonucleotides together
at 95 °C for 3 minutes and subsequently cooling the mixture to
room temperature for at least 2 hours. Formation of the oligonucleotide duplexes was verified by subjecting the duplexes to
nondenaturing polyacrylamide gel electrophoresis (PAGE).
We measured the ability of enzymes in the lung tissue extracts
to excise 8-oxoG by determining the extent of nicking of the oligodeoxynucleotide at the site of lesion. The reaction mixture of
20 μL contained 25 mM Tris-HCl, pH 7.8, 50 mM NaCl, 5 mM
β-mercaptoethanol, 1 mM EDTA, 1 pmol of 32P-labeled duplex,
and increasing amounts of tissue extract (1–100 μg of protein/
sample). The mixtures were incubated at 37 °C for 1 hour, and the
reactions were stopped by digestion with proteinase K (1 μg/μL
of reaction mixture, 1 hour, 37 °C). Because the lyase activity of
recombinant full-length human OGG1 protein is approximately
5- to 10-fold lower than that of glycosylase (40), we incubated
the reaction mixtures in 0.2 M NaOH at 70 °C for an additional
30 minutes. This incubation permitted complete cleavage of
the oligonucleotide at the apurinic site formed in the oligodeoxynucleotide molecule after excision of 8-oxoG. The cleavage
products were mixed with denaturing gel loading buffer (95%
formamide, 20 mM EDTA, 0.05% bromophenol blue, and 0.05%
xylene cyanol) and were subjected to 20% PAGE in the presence
of 7 M urea. A scheme of the nicking assay and a representative
autoradiogram of the excision activities in lung tissues from one
patient are shown in Fig. 1, A and B. A digital image of the separated radioactive oligonucleotides was captured on a Molecular
Dynamics Storm 820 PhosphorImager, and the radioactivity of
the bands was quantified with ImageQuant software (Molecular
Dynamics, version 5.2). From each data set, a Michaelis–Menten
curve was plotted, and the activities of the enzymes were calculated from the initial velocity, i.e., from the part of the curve
characterized by the linear increase of the reaction rate. All measurements were performed at least in triplicate, and calculated
means are presented as picomoles of cleaved 32P-oligonucleotide
(20-bases) per hour per milligram of protein. Each experiment
included positive and negative control samples. The positive
control consisted of the 32P-labeled oligonucleotide being digested with an excess of the damage-specific repair glycosylase/
AP-lyase yOGG1, and the negative control consisted of omitting the lung tissue supernatant from the reaction mixture with
32P-labeled oligonucleotide.
Protein extraction efficiency and protein integrity were assessed
by Western blot analysis of β-actin levels in extracts of normal
and tumor lung tissues. Equal amounts of protein extracts (50 μg/
lane) were resolved on sodium dodecyl sulfate–10% polyacrylamide gels and were electrotransferred to Hybond-C membranes.
The membranes were blocked for 2 hours at room temperature
in a blocking solution containing 5% nonfat dry milk, 1% bovine serum albumin, and 0.05% Tween 20 in phosphate-buffered
saline, and incubated sequentially with a monoclonal anti–β-actin
antibody (1 μg/mL, diluted in blocking solution) for 2 hours
at room temperature and horseradish peroxidase–conjugated
secondary antibody. The protein–antibody bands were visualized after the membranes were incubated with the ECL reagent,
according to the manufacturer’s recommendations.
hMTH1 (8-OxodGTPase) Assay
Lung tissue extracts were treated according to a previously
published protocol (33), with minor modifications. Extracts (0.5
Journal of the National Cancer Institute, Vol. 97, No. 5, March 2, 2005
Fig. 1. The nicking assay for the measurement of 8-oxoG excision activity (i.e.,
hOGG1) in lung tissue extracts. A) The oligodeoxynucleotide sequence and
scheme of the method. B) Typical autoradiograms of denaturing PAGE showing
the nicking of the 8-oxoG–containing oligodeoxynucleotide after incubation
with human tissue extracts. 5′-Labeled 8-oxoG–oligomer annealed to its complementary strand was incubated with protein extracts from normal and tumor lung
tissues from a patient with non–small-cell lung cancer. The annealing and the
identity of the damaged base in the 8-oxoG duplex were verified by digestion with
pure OGG1 glycosylase derived from S. cerevisiae. The oligomer is cleaved at
the position of the modified base, generating a 20-base nucleotide fragment. The
fraction of the cleaved oligomer was measured by using a PhosphorImager. The
percentage of spontaneous breaks, measured in each control lane, was subtracted
from the percentage of breaks obtained from incubation with the tissue extracts.
The number above each lane indicates the amount of tissue extract or pure protein
added per assay (in micrograms of protein). M = 20-base oligomer marker.
C) Western blot analysis showing the β-actin levels in extracts from normal lung
(lane 1) and lung tumor (lane 2) tissues isolated from the same patient who provided samples for panel B. β-Actin levels are shown as a control for protein
integrity and overall protein yield following the extraction protocol.
mL) were subjected to ultracentrifugation (1 hour at 100 000g,
4 °C), and the supernatants were collected. The supernatant protein concentrations were estimated (39), and Triton X-100 was
added to each sample to a final concentration of 0.1%. Next,
the supernatants were filtered through a low protein-binding
ultrafiltration membrane, which had a 30-kD protein cutoff
(Ultrafree-MC Filtration Unit; Millipore). The ultrafiltration
procedure removes nonspecific phosphatases (i.e., those with
a molecular mass greater than 30 kD), the presence of which
interferes with determining 8-oxodGTPase (molecular mass, 18
kD) activity (33). We found (unpublished data) that the addition
of Triton X-100 improves the ultrafiltration and recovery of 8-oxodGTPase. 8-OxodGTPase activity was measured
immediately in the resulting flow-through fraction, i.e., ultrafiltrate, or after being temporarily stored at −80 °C.
8-OxodGTPase activity in the ultrafiltrates was determined by
measuring the degradation of 8-oxodGTP to 8-oxodGMP according to a previously published protocol (19). The reaction mixture
(total volume of 100 μL) contained 40 μM 8-oxodGTP, 5 mM
ARTICLES
387
Fig. 2. HPLC analysis of 8-oxodGTPase activity in lung tissue extracts. Typical
HPLC separations of the substrate, 8-oxodGTP, and the reaction product 8-oxodGMP,
formed after incubation with ultrafiltrates of tissue protein extracts from a lung cancer patient, are shown. The right-hand panels show separation of the products of
the reaction of 8-oxodGTP with ultrafiltrates isolated from tumor (upper panels)
and normal (lower panels) tissues. The amount of protein added (5, 15, or 30 μg) is
shown on the panels. The control (left-upper panel) included the standard reaction
with tumor tissue ultrafiltrate, with the exception of EDTA, which was added to the
reaction mixture before the ultrafiltrate. Lower-left panel shows separation of the
standards. Chromatographic conditions are given in Methods. DTT = dithiothreitol.
MgCl2, 40 mM NaCl, and 50 mM Tris-HCl, pH 8. The mixture
was incubated for 2 minutes, after which the reaction was started
by the addition of the ultrafiltrate (0.5 to 1000 μg of protein).
Samples were incubated for 1 hour at 37 °C, and the reaction was
stopped by the addition of 10 μL of 100 mM EDTA.
Because the 8-oxodGTPase activity in tissue extracts varied
up to 50-fold among patients, the preliminary experiments determined the amount of extract needed to yield the product of
hydrolysis of 8-oxodGTP within the range of 3%–60%. Each
ultrafiltrate was then finally tested at four concentrations, with
the concentrations of protein chosen on the basis of initial experiments. Subsequently, samples (100 μL) were subjected to HPLC
analysis. Chromatographic conditions were as follows: Waters
High Performance Carbohydrate Column, 60 Å, 4 μm, 4.6 × 250
mm; isocratic elution with 0.2 M phosphate buffer, pH 4, 1 mM
EDTA; flow rate, 1 mL/min; UV detection at 295 nm (see Fig. 2
for examples of HPLC profiles). Products were quantified by using
Millennium software (version 2.15). The amount of 8-oxodGMP
formed during the reaction was estimated as a percentage of the
sum of 8-oxodGMP and 8-oxodGTP (determined from the HPLC
peaks) and calculated in nanomoles of 8-oxodGMP formed per
hour per milligram of protein. From each data set, a Michaelis–
Menten curve was plotted, and enzymatic activities were calculated from initial velocities. All measurements were performed
using at least two independent ultrafiltrates of the same tissue
extract, and calculated means are presented. To measure possible
spontaneous degradation of 8-oxodGTP, each series of experiments included a sample in which the reaction mixture did not
include the ultrafiltrate and a sample where EDTA was added
before addition of the ultrafiltrate.
388 ARTICLES
Statistical Analysis
All variables were examined for normality and homogeneity
of variance. To use parametric statistical tests in the analysis of
variance, variables that were not normally distributed (i.e., for
the whole patient population) were normalized via transformation to natural logarithms. Data are presented as means and standard deviations or as the antilog of the means (geometric means)
and the 95% confidence interval (CI) of the antilog of the means.
The levels of 8-oxoG were measured once. The cohort of patients
fell into two subpopulations: one with similar 8-oxoG levels both
in normal lung and lung tumor (subgroup I, n = 37), and the other
with approximately twofold-higher 8-oxoG levels in normal lung
than in lung tumor (subgroup II, n = 10) (Table 1, Fig. 3, A).
For hOGG1 and hMTH1 activities, the results present the mean
values of three and two measurements, respectively. In the graph
showing the relation between hMTH1 activities in normal lung
Journal of the National Cancer Institute, Vol. 97, No. 5, March 2, 2005
Table 1. Analytical parameters in normal lung and lung tumor tissues from
patients with non–small-cell lung cancer
Mean value*
Variable
Normal lung
Difference between
normal lung and
Lung tumor
lung tumor
P
8-OxoG per 106 G in DNA
Whole patient
population†
n = 47
Subgroup I‡
n = 37
Subgroup II‡
n = 10
2.32 (0.60)
10.18
(8.5 to 12.1)
8.85 (3.30)
1.76 (0.49)
5.81
(5.1 to 6.7)
6.08 (2.88)
0.56 (0.48)
1.75
(1.5 to 2.0)
2.77 (2.70)
<.001§
<.001§
23.86 (6.05)
7.87 (2.12)
15.98 (5.40)
<.001§
8-OxoG excision activity in tissue extracts║
Whole patient
population†
n = 56
3.04 (0.67)
20.91
(17.5 to 25.0)
2.17 (0.62)
8.76
(7.4 to 10.4)
0.87 (0.66)
2.39
(2.0 to 2.9)
<.001¶
Whole patient
population†
n = 33
Subgroup III‡
n = 16
Subgroup IV‡
n = 13
2.19 (0.50)
8.94
(7.5 to 10.7)
7.35 (2.51)
3.36 (0.87)
−1.17 (0.94)
28.79
0.31
(21.1 to 39.3)
(0.2 to 0.4)
59.52 (40.90) −52.17 (38.80)
<.001¶
9.54 (2.77)
23.42 (14.58) −13.88 (12.37)
.0025¶
hMTH1 activity in tissue extracts║
<.001¶
*Data for the hOGG1 and the hMTH1 activities come from the mean values
of three and two measurements, respectively. 8-OxoG = 8-oxoguanine, hOGG1 =
human 8-oxoG DNA glycosylase, and hMTH1 = human 8-oxodGTPase.
†For the whole population, data are shown as the means and standard deviations of natural logarithm transformed data (first line) and the antilog of the
means and the 95% CI for the antilogged means (second line).
‡For the subgroups, data are the means and standard deviations.
§Differences between variables (natural logarithm transformed data for the
whole patient population) were compared with two-sided Student’s t test for
dependent samples.
║hOGG1 activity is expressed in picomoles per hour per milligram of protein.
hMTH1 activity is expressed in nanomoles per hour per milligram of protein.
¶Variables (natural logarithm transformed data for the whole patient population) were analyzed with a one-way repeated ANOVA with repeated measures of
hOGG1 and hMTH1 activities as within-subject factors.
and lung tumor tissues, three apparent clusters of points can be
distinguished (Fig. 3, C). Therefore, three subpopulations were
discriminated analytically on the basis of means from normal
lung to tumor ratios. By visual inspection of the means, the first
population (mean ratio = 1.44) consisted of four patients who had
apparently higher hMTH1 activity (>20 nmol h-1 mg-1 protein) in
normal lung than did the remaining patients; we considered the
four patients outliers and excluded them from further analyses. The
other subpopulations were subgroup III (n = 16, mean ratio = 0.16)
and subgroup IV (n = 13, mean ratio = 0.61) (Table 1, Fig. 3, C).
Differences in the level of 8-oxoG between normal lung and lung
tumor tissues were tested for statistical significance using Student’s t test for dependent samples. Differences in hOGG1 and in
hMTH1 activities were analyzed with one-way repeated analyses
of variance (ANOVAs), with the repeated measures of hOGG1
and hMTH1 activities as within-subject factors. To determine
whether smoking, histologic type of tumor, and/or sex was associated with the level of 8-oxoG and enzyme activities in normal
lung and in tumor, data were analyzed with one-way ANOVAs
(for the 8-oxoG level) or with one-way repeated ANOVAs (with
repeated measures of hOGG1 and hMTH1 activities as withinsubject factors). Additionally, to investigate the cooperative
Journal of the National Cancer Institute, Vol. 97, No. 5, March 2, 2005
Fig. 3. Correlations between normal lung and tumor tissues of patients with
NSCLC of 8-oxoG level in DNA (A), hOGG1 (B), and hMTH1 (C) activity. Correlation coefficients and levels of significance are shown above the plots. Each
data point of hOGG1 or hMTH1 activities represents the mean of three or two independent measurements, respectively. C) Lines on the plot have the same slopes
as the mean ratio of normal lung to tumor calculated for each patient’s subgroup
(see “Materials and Methods” for details).
association of smoking, histologic type of tumor, and sex (as the
main, nested, or between-subject factors), three-way main effect
ANOVAs for 8-oxoG level and means of replicates of hOGG1
and hMTH1 activity measurements, which had not revealed
any significant effect of within-subject factors on differences
between these variables in the ANOVA, were conducted. Interactions were further examined by Tukey’s honestly significant
ARTICLES
389
difference (HSD) test. Associations between different variables
within the whole patient population were calculated by Spearman’s correlation analysis. Pearson’s correlation was calculated
within each subgroup of patients. All statistical analyses were
performed using STATISTICA 6.0 (StatSoft, Inc., Tulsa, OK).
All statistical tests were two-sided, and P values less than 0.05
were considered statistically significant.
samples, suggesting that differential protein enrichment did not
account for the differences in hOGG1 activities.
The activities of hOGG1 in normal and tumor lung tissue
were positively correlated (ρ = 0.4, P = .002, n = 56; Fig. 3, B).
However, there was no correlation between the 8-oxoG level and
8-oxoG–excising activity in normal lung or tumor tissues.
hMTH1 (8-OxodGTPase) Activity
RESULTS
8-OxoG Level in DNA
The levels of 8-oxoG were measured in normal lung and
tumor DNA samples from 47 of the 56 patients (the amount
of DNA isolated from nine other samples was insufficient to
perform the analyses). The levels of 8-oxoG were highly variable in both tissue types, ranging from 2.44 to 34.23 8-oxoG
per 106 G in normal lung tissue DNA and from 1.44 to 13.13
8-oxoG per 106 G in lung tumor DNA. Overall, the 8-oxoG levels were higher in normal lung DNA than in lung tumor DNA
(Table 1).
We assumed that the level of 8-oxoG in DNA was intrinsic to
the individual, probably reflecting the level of oxidative stress to
which a person had been exposed and individual repair capacity. Accordingly, we observed a positive correlation between 8oxoG levels in DNA from paired normal and tumor lung tissues
(ρ = 0.61, P <. 001, n = 47). The cohort of patients fell into two
distinct subpopulations: subgroup I (n = 37), with similar mean
8-oxoG levels in both the normal lung and tumor tissue, and
subgroup II (n = 10), with approximately twofold-higher levels
in normal lung than in tumor tissue. Subgroup I had mean levels of
8.85 (standard deviation = 3.30) and 6.08 (standard deviation =
2.88) 8-oxoG per 106 G in normal lung and tumor tissues, respectively; and subgroup II (n = 10) had mean levels of 23.86
(standard deviation = 6.05) and 7.87 (standard deviation = 2.12)
8-oxoG per 106 G for normal lung and tumor tissues, respectively (Table 1). We found a positive correlation between normal
lung tissue and tumor tissue in 8-oxoG levels for patients in both
subgroups (for subgroup I, r = 0.63, P<.001; for subgroup II,
r = 0.46, P = .177 [Fig. 3, A]), although, given the small number
of patients in subgroup II, the correlation was not statistically
significant.
hOGG1 (8-OxoG–Excising) Activity
We next measured the hOGG1 activities by the nicking assay in tissues from all 56 patients. The level of hOGG1 activity was highly variable among patient tissues, ranging from
3.54 to 62.91 pmol h-1 mg-1 protein in normal lung tissue and
from 2.35 to 34.85 pmol h-1 mg-1 protein in lung tumor tissue.
hOGG1 activity was higher in normal lung than in tumor tissue
(Table 1).
To determine whether the differences in hOGG1 activities
among normal lung and tumor tissues were the result of a differential of enzyme protein enrichment, we performed two control
experiments: Western blot analysis for β-actin using aliquots of
tissue extracts (Fig. 1, C) and determination of hOGG1 activity
in at least three independent protein extractions from each tissue
sample. We observed comparable levels of β-actin in 50 μg of
protein extract from tumor and normal tissues and comparable
hOGG1 activities in distinct protein extracts from the same tissue
390 ARTICLES
hMTH1 activities were measured in tissue extract ultrafiltrates
from 33 of the 56 patients using HPLC. Because the hMTH1
assay requires a large amount of tissue extract and the hMTH1
activity measurements were done after hOGG1 activity assays,
the amounts of tissue extracts of the remaining 23 patients were
insufficient to perform analyses. Typical HPLC separations of
the 8-oxodGTP substrate and the 8-oxodGMP reaction product
formed during incubation with a tissue extract ultrafiltrate from
a patient are shown in Fig. 2. The hMTH1 activities were highly
variable among patients, ranging from 3.2 to 27.2 nmol h-1 mg-1
protein in normal lung tissue and from 2.7 to 144.9 nmol h-1
mg-1 protein in lung tumor tissue. Overall, hMTH1 activities
were higher in tumor tissues than in normal lung tissues (Table 1);
however, no correlation of hMTH1 activity in the paired normal
lung and tumor tissues in the whole patient population (n = 33)
was found. Although higher hMTH1 activity coincided with the
lower level of 8-oxoG, levels of hMTH1 activity did not correlate
with 8-oxoG levels or with hOGG1 activity in either normal lung
or tumor tissues.
In the patient cohort, two subpopulations (subgroups III and
IV) and a group of four outliers could be distinguished by visual
inspection (see Materials and Methods). Although a correlation
was found for hMTH1 activity in the paired normal lung and tumor tissues among the outlier group (r = 0.8, P = .203, n = 4), this
group was excluded from further analysis because of the high
P value and the small number of patients. For the remaining 29
patients, hMTH1 activity in normal and tumor lung tissues was
positively correlated (ρ = 0.55, P = .003, n = 29). Moreover, after
excluding the outliers, we found strong correlations in the two
apparent subpopulations within the cohort: for subgroup III
(n = 16), r = 0.84, P<.001; and for subgroup IV (n = 13), r = 0.83,
P<.001 (Fig. 3, C, Table 1). For the entire cohort (n = 33), the
cohort after excluding the four outliers (n = 29), and subgroups
III and IV, there was no inverse correlation between the hMTH1
activities and 8-oxoG levels, either in normal lung or in tumor
DNA, as would have been expected if hMTH1 was the only enzyme responsible for maintenance of 8-oxoG level in DNA.
Associations Among Tobacco Smoking, Histologic Type
of Tumor, and Sex and 8-OxoG levels, and hOGG1 or
hMTH1 Activities
We next examined the associations among smoking status (current versus former smoker), tumor histology (SCC versus ADC),
and patient sex and 8-oxoG levels, and hOGG1 or hMTH1 activities. There was no association of smoking status with the 8-oxoG
level, hOGG1 activity, or hMTH1 activity in normal lung and
tumor tissues, regardless of whether we considered all patients
together or in the apparent subgroups (Table 2).
No statistically significant differences in 8-oxoG levels or
in hMTH1 activities were observed between patients grouped
according to histologic type of tumor (Table 2). By contrast,
Journal of the National Cancer Institute, Vol. 97, No. 5, March 2, 2005
Table 2. Analytical parameters in normal lung and lung tumor tissues of three groups of patients with non–small-cell lung cancer distinguished on the basis of
smoking (S), histologic type of tumor (H), or sex (G)*
Smoking
Variable
Smokers
Histologic type of tumor
Ex-smokers
SCC
ADC
Sex
Male
Female
8-OxoG per 106 G in DNA§
Normal lung
2.38 (0.60)
2.26 (0.60)
Whole patient population† 10.80 (8.4 to 14.0)
9.58 (7.39 to 12.3)
n = 24
n = 23
P = .481
Subgroup I‡
8.75 (3.16)
8.95 (3.50)
n = 18
n = 19
P = .859
Subgroup II‡
25.54 (6.52)
21.33 (4.96)
n=6
n=4
P = .307
Lung tumor
1.80 (0.54)
1.72 (0.43)
Whole patient population† 6.05 (4.8 to 7.6)
5.58 (4.6 to 6.7)
n = 24
n = 23
P = .555
Subgroup I‡
6.32 (3.13)
5.86 (2.69)
n = 18
n = 19
P = .633
Subgroup II‡
8.32 (1.37)
7.2 (3.06)
n=6
n=4
P = .447
2.27 (0.60)
2.54 (0.47)
9.68 (7.9 to 11.9)
12.68 (7.1 to 22.6)
n = 36
n=5
P = .349
8.88 (3.39)
9.64 (2.60)
n = 30
n=3
P = .709
24.59 (5.72)
20.09 (4.26)
n=6
n=2
P = .355
1.75 (0.53)
1.77 (0.32)
5.75 (4.8 to 6.9)
5.87 (3.9 to 8.7)
n = 36
n=5
P = .953
6.18 (3.08)
5.42 (1.77)
n = 30
n=3
P = .678
8.31 (2.58)
7.09 (2.08)
n=6
n=2
P = .573
2.37 (0.56)
2.05 (0.74)
10.70 (8.9 to 12.9)
7.77 (4.2 to 14.4)
n = 39
n=8
P = .164
9.37 (3.18)
6.17 (2.70)
n = 31
n=6
P = .027
24.61 (6.51)
20.84 (3.20)
n=8
n=2
P = .463
1.80 (0.49)
1.59 (0.50)
6.05 (5.2 to 7.1)
4.90 (3.4 to 7.2)
n = 39
n=8
P = .288
6.36 (2.98)
4.65 (1.91)
n = 31
n=6
P = .186
7.99 (2.30)
7.39 (1.66)
n=8
n=2
P = .74
hOGG1 activity in extracts║¶
Normal lung
3.07 (0.74)
3.01 (0.58)
Whole patient population† 21.54 (16.4 to 27.9) 20.29 (15.8 to 25.8)
n = 32
n = 24
P = .735
Lung tumor
Whole patient population†
2.15 (0.66)
2.19 (0.59)
8.58 (6.8 to 10.9)
8.94 (7.0 to 11.5)
n = 32
n = 24
P = .803
2.85 (0.64)
3.26 (0.65)
17.29 (13.9 to 21.5) 26.05 (17.8 to 38.1)
n = 36
n = 14
P = .047
H(S) + S + G: P = .151#
H(G) + S + G: P = .033#
H(SxG) + S + G: P = .228#
2.10 (0.64)
2.27 (0.54)
8.17 (6.6 to 10.2)
9.68 (7.1 to 13.2)
n = 36
n = 14
P = .375
2.95 (0.67)
3.29 (0.62)
19.11 (15.5 to 23.6) 26.84 (19.1 to 37.7)
n = 41
n = 15
P = .093
2.10 (0.58)†
2.36 (0.73)
8.17 (6.8 to 9.9)
10.59 (7.0 to 15.8)
n = 41
n = 15
P = .188
hMTH1 activity in extracts║¶
Normal lung
Whole patient population†
2.10 (0.42)
2.27 (0.56)
8.17 (6.6 to 10.3)
9.68 (7.2 to 12.9)
n = 16
n = 17
P = .328
Subgroup III‡
7.69 (2.56)
6.92 (2.58)
n=9
n=7
P = .551
Subgroup IV‡
8.83 (3.07)
10.15 (2.56)
n=6
n=7
P = .414
Lung tumor
3.39 (1.06)
3.33 (0.69)
Whole patient population† 29.67 (16.9 to 52.5) 27.94 (19.5 to 39.6)
n = 16
n = 17
P = .829
Subgroup III‡
68.07 (46.60)
48.52 (32.18)
n=9
n=7
P = .361
Subgroup IV‡
18.84 (14.26)
27.34 (14.73)
n=6
n=7
P = .315
2.23 (0.52)
1.93 (0.19)
9.30 (7.6 to 11.2)
6.89 (5.1 to 9.4)
n = 29
n=4
P = .274
7.57 (2.62)
5.85 (0.38)
n = 14
n=2
P = .381
9.80 (2.95)
8.1 (0.42)
n = 11
n=2
P = .454
3.38 (0.93)
3.19 (0.34)
29.37 (20.7 to 42.1) 24.29 (14.2 to 41.7)
n = 29
n=4
P = .682
63.71 (42.17)
30.18 (2.46)
n = 14
n=2
P = .293
24.02 (15.72)
20.10 (7.47)
n = 11
n=2
P = .743
2.19 (0.46)
2.21 (0.68)
8.94 (7.4 to 10.7)
9.12 (4.5 to 18.5)
n = 27
n=6
P = .895
7.79 (2.58)
5.46 (0.94)
n = 13
n=3
P = .155
9.64 (2.87)
8.40 (0.00)
n = 12
n=1
P: nd
3.42 (0.95)
3.07 (0.29)
30.57 (21.1 to 44.7) 21.54 (16.0 to 29.4)
n = 27
n=6
P = .391
67.26 (41.72)
26.00 (5.40)
n = 13
n=3
P = .118
23.26 (15.22)
25.38 (0.00)
n = 12
n=1
P: nd
*Data for hOGG1 and hMTH1 activities come from the mean values of three and two measurements, respectively. 8-OxoG = 8-oxoguanine; hOGG1 = human 8-oxoG DNA glycosylase; hMTH1 = human 8-oxodGTPase; S = smoking; H = histologic type of tumor; G = sex; nd = not determined; SCC = squamous cell carcinoma; ADC = adenocarcinoma.
†For the whole population, data are shown as the means and standard deviations of the natural logarithm transformed data (first line) and the antilog of the means
and the 95% CIs for the antilogged means (second line).
‡For the subgroups, data are shown as the means and standard deviations.
§Variables (natural logarithm transformed data for the whole patient population) were analyzed with a one-way ANOVA with smoking, histologic type of tumor,
or sex as between-groups factors.
║Variables (natural logarithm transformed data for the whole patient population) were analyzed with a one-way repeated ANOVA with repeated measures of
hOGG1 and hMTH1 activities as within-subject factors and with smoking, histologic type of tumor, or sex as between-group factors.
¶hOGG1 activity is expressed in picomoles per hour per milligram of protein. hMTH1 activity is expressed in nanomoles per hour per milligram of protein.
#Variables (natural logarithm transformed data, means from replicates) were analyzed with a three-way ANOVA with histology as the main factor and smoking,
histology or sex as nested, or between-groups factors. A factor(s) in the bracket indicates that it was (they were) nested under the factor prior to the bracket.
Journal of the National Cancer Institute, Vol. 97, No. 5, March 2, 2005
ARTICLES
391
hOGG1 activity was higher in normal lung tissue of patients with
ADCs than in patients with SCCs (P = .047; Table 2).
Men and women did not differ statistically significantly in
normal lung and tumor tissue in 8-oxoG levels and hOGG1 or
hMTH1 activities (Table 2). The only sex-related difference was
found in subgroup I, in which men had higher 8-oxoG levels in
normal lung tissue than did women (P = .027; Table 2).
To identify interactions among sex, smoking, and histologic
type of tumor, the data were examined using three-way ANOVAs, with nested between-group factors. Potential interactions
found were further analyzed with Tukey’s HSD test. The only
statistically significant interaction was between tumor histology
and sex (P = .033; Table 2). hOGG1 activity in normal lung was
higher in women with ADCs, although the relationship was not
statistically significant (P = .056, Tukey’s HSD test).
DISCUSSION
The link between smoking tobacco and lung cancer is generally acknowledged. Because tobacco smoke induces oxidative
DNA damage, we sought to learn whether the level of 8-oxoG,
a general marker of oxidative damage to DNA, is associated
with lung cancer. In addition, we studied the role of two repair
enzymes, hOGG1 (8-oxoG DNA glycosylase) and hMTH1
(8-oxodGTPase), in the maintenance of 8-oxoG levels in DNA
of lung cancer patients.
Our most striking finding was that the level of 8-oxoG in DNA
from lung tumor tissue was lower than that in DNA from normal lung tissue, even though hOGG1 activity was also lower in
lung tumor tissue than in normal lung tissue (Table 1). These
observations are paradoxical because one would expect to find
low levels of 8-oxoG in tissues with high hOGG1 activity. These
observations were also surprising because, in our previous study
on repair of lipid peroxidation-generated DNA etheno adducts
in the lungs of NSCLC patients (28), the levels of these adducts
were similar in tumor and normal tissues, whereas the excising
activities were higher in tumor tissues than in normal lung tissues, possibly to counter the increased DNA damage associated
with oxidative stress and lipid peroxidation in tumor tissues.
However, etheno adducts are excised by glycosylases entirely
different from those involved in the excision of 8-oxoG, and
the activity of different repair enzymes can be modified differently by oxidative stress–triggered factors. Indeed, we found
that hMTH1 protein activity, which catalyzes the hydrolysis of
8-oxodGTP to 8-oxodGMP, a step that limits the incorporation of
8-oxoG into DNA (18,19), was statistically significantly higher
in tumor than in normal tissue (Table 1). The results of determinations of the 8-oxoG levels and both enzymatic activities, i.e.,
hOGG1 and hMTH1, suggest that incorporation of 8-oxodGTP
into DNA from the nucleotide pool may be an important source
of 8-oxoG in DNA. Thus, the high hMTH1 activity might have
compensated for the low hOGG1 activity, resulting in a lower
8-oxoG level in tumor DNA.
The potential biologic relevance of the removal of 8-oxodGTP
from the cellular pool for the level of 8-oxoG in DNA is further
highlighted because the hMTH1 activity observed in human lung
tissues was three orders of magnitude higher than the hOGG1
activity excising 8-oxoG from DNA. In other words, the hydrolysis of 8-oxodGTP was expressed in nanomoles per hour per
milligram of protein, whereas the excision of 8-oxoG from DNA
was expressed in picomoles per hour per milligram of protein
392 ARTICLES
(Table 1). This difference in activities can be attributed mostly to
the differences in the turnover of these enzymes. The kcat values
are 211 min−1 for hMTH1 (K. D. Arczewska, unpublished) and
0.1 min−1 for hOGG1 (41).
Given our results, if hMTH1 activity is more critical than is
hOGG1 activity for the level of 8-oxoG in DNA, then the incorporation of damaged precursors from the nucleotide pool may
be more harmful for genomic DNA integrity than the damaging
of the DNA itself. However, experimental data with living cells
to support such a hypothesis are sparse. Unincorporated bases in
the dNTP pool are much more susceptible to methylation than
are incorporated bases in DNA from C3H mouse embryo fibroblasts treated with the methylating agent N-methyl-N-nitrosourea
(42). The susceptibility to methylation depended on the modified
position; e.g., N7 of G was methylated 190-fold and N1 of A
13 000-fold more efficiently as free nucleotides than as incorporated bases in DNA. These data corroborate the notion that free
nucleotide bases should be much more reactive than are incorporated bases in cellular DNA, where they are protected by the
double helix and chromosomal structures.
Although the mechanism for increased hMTH1 activity in
tumor tissue versus normal tissue is unknown, one possibility is
an increase in hMTH1 mRNA levels. In several types of cancers
(43–47), including brain (46) and lung (47), hMTH1 mRNA levels are increased relative to levels in normal cells. Whether the
increased hMTH1 mRNA levels in tumors reflect a response to
increased oxidative stress is unclear. However, hydrogen peroxide, a chemical inducer of oxidative damage, increased hMTH1
mRNA expression and enzyme activity two- to threefold in human lymphoid cells and normal fibroblasts (48), and exposure of
human alveolar epithelial cells to crocidolite asbestos increased
hOGG1 and hMTH1 mRNA expression and 8-oxoG–excising
activity (49).
The observed increase in hMTH1 activity in lung tumor tissue
may suggest that a substantial fraction of 8-oxoG in human DNA
is derived from the oxidized nucleotide pool. A similar conclusion has been drawn from several in vitro studies. First, Russo et
al. (50) observed that overexpression of the hMTH1 protein in
mismatch repair–deficient cell lines decreased the mutation rates
to normal, reduced microsatellite instability, and led to reduced
8-oxoG levels in DNA. Second, expression levels of hMTH1
mRNA were inversely proportional to the levels of 8-oxoG in
DNA in 11 human lung cancer cell lines and simian virus 40–
transformed nontumorigenic human bronchial epithelial cells
(45). Third, hydrogen peroxide–induced accumulation of 8-oxoG
in nuclear and mitochondrial DNA in MTH1-null mouse fibroblasts was suppressed by expression of human MTH1 in these
cells (51). Fourth, MTH1 activity was higher and background
levels of 8-oxoG were lower in fetal DNA than the levels found
in maternal mouse organs (52). In our study, although we noted
concomitantly increased hMTH1 activity and decreased 8-oxoG
levels in DNA from tumor tissues (Table 1), the correlation between these parameters was not statistically significant. This lack
of correlation may suggest that, although hMTH1 is an important
component in regulating the 8-oxoG level in human lung DNA,
other DNA repair pathways and antioxidant defense mechanisms
may also be involved.
Although the exact mechanism for decrease in hOGG1 activity in tumor lung tissue relative to normal lung tissue is unknown,
several potential mechanisms may explain it. The first is loss of
heterozygosity (LOH) at the hOGG1 locus. LOH at the OGG1
Journal of the National Cancer Institute, Vol. 97, No. 5, March 2, 2005
results in decreased expression of the OGG1 gene and was observed in 62.2% of patients with SCLCs and NSCLCs (53) and in
up to 38% of head-and-neck squamous cancer patients, as measured by single nucleotide polymorphism characterizing hOGG1
allelic loss and by immunohistochemical staining (54). However,
not all studies find a high level of OGG1 allelic loss (55). Although in our study, LOH at OGG1 locus was not examined, it is
unlikely to be the only reason for the decrease in enzymatic activity. The rate of 8-oxoG excision was decreased in 52 (92.9%)
of 56 examined tumors relative to unaffected surrounding lung
tissue, and the extent of this decrease (2- to 10-fold in 37 of 56
tumors) was much higher than would be expected for decreases
associated with LOH at OGG1 locus. The second is tumorassociated (i.e., somatic) mutations in the hOGG1 gene resulting
in lost functional activity. Although tumor-associated mutations
in the hOGG1 gene have been reported (55), the frequency of
them was low in human kidney cancers (only 4%) and even lower
in lung cancers, suggesting that such mutations in the hOGG1
gene are an unlikely explanation for our observation. The third
is deregulation of OGG1 cooperation with partners of the BER
pathway. One partner is the human apurinic site endonuclease
1 (HAP1), which cleaves DNA at apurinic sites and stimulates
OGG1 activity in vitro up to 400-fold by increasing OGG1 turnover on damaged DNA (41). However, in our assay, in which we
used 0.2 M NaOH for complete cleavage of oligodeoxynucleotide, it was not possible to assess the influence of HAP1 levels on
OGG1 activity. Expression of HAP1 is increased in many tumors
(56), and because HAP1 is induced in the S phase of the cell
cycle (57), it is likely that its level is increased in highly proliferating tissues. HAP1 is induced by hydrogen peroxide (58), which
could mimic endogenous oxidative stress in tumors. Therefore,
it is unlikely that the observed decreased OGG1 activity in lung
tumor tissues in our experiments is caused by decreased expression of HAP1 protein. However, we cannot exclude deregulation
of the interaction between hOGG1 and its other partner, XRCC1
protein (X-ray cross-complementation group protein 1), which
coordinates and stimulates hOGG1 activity (59). A fourth possible mechanism is inhibition of OGG1 activity by modification
of OGG1 protein. Exogenous nitric oxide and peroxynitrite have
been shown to inhibit the activity of hOGG1 (60), as well as
that of other enzymes involved in DNA repair (61–63), by direct nitrosylation. Despite the contradictory data regarding the
activity of nitric oxide synthase in various types of lung cancer
versus normal lung tissues (64,65), the inactivation of hOGG1
protein by reactive nitrogen species in tumors is a plausible explanation of the decreased hOGG1 activity in lung cancer tissues.
Although hOGG1 can also undergo phosphorylation, phosphorylation seems to alter the enzyme localization rather than activity
(66), suggesting that this fifth possible mechanism is an unlikely
explanation for our observation.
Different etiologies are believed to be responsible for the
different histologic types of NSCLC. ADC has been linked to
defective repair of 8-oxoG because of a hOGG1 gene polymorphism (67) and to decreased hMTH1 expression relative to
hMTH1 expression in SCC types of NSCLC (47). In our study,
although we also observed lower hMTH1 activity in normal
lung tissue from the four patients with ADCs than from the 29
patients with SCCs, the relationship was not statistically significant (Table 2). We did not observe statistically significant
differences in 8-oxoG levels in normal lung tissue DNA from
patients grouped according to tumor histology (Table 2). We
Journal of the National Cancer Institute, Vol. 97, No. 5, March 2, 2005
did, however, observe that hOGG1 activity was higher in normal
lung tissue from patients with ADCs than in patients with SCCs
(P = .047; Table 2). One possible explanation for this difference
is related to the detection of several different polymorphisms
in the OGG1 gene (68): the most common polymorphism is a
Ser326Cys polymorphism (69), and at least one polymorphism,
the Cys/Cys variant at amino acid 326, is associated with lower
OGG1 activity (53) and the risk of development of lung SCC
(70,71). Whether the frequency of the Cys/Cys polymorphism
was higher in our patients with SCC than in those with ADC is
unknown.
In summary, we found that the 8-oxoG level and the excising
activity were statistically significantly lower in tumor lung tissue
than in the surrounding normal lung tissue. By contrast, hMTH1
activity was statistically significantly higher in tumor tissue than
in normal lung tissue. These data suggest that incorporation of
8-oxoG from the nucleotide pool is an important mechanism in
the formation of DNA oxidative damage in humans. The results
also raise an important question concerning the mechanisms that
regulate hOGG1 activity in association with oxidative stress and
neoplastic transformation.
REFERENCES
(1) Floyd RA. The role of 8-hydroxyguanine in carcinogenesis. Carcinogenesis
1990;11:1447–50.
(2) Olinski R, Gackowski D, Foksinski M, Rozalski R, Roszkowski K, Jaruga P.
Oxidative DNA damage: assessment of the role in carcinogenesis, atherosclerosis, and acquired immunodeficiency syndrome. Free Radic Biol Med
2002;33:192–200.
(3) Olinski R, Gackowski D, Rozalski R, Foksinski M, Bialkowski K. Oxidative DNA damage in cancer patients: a cause or a consequence of the disease
development? Mutat Res 2003;531:177–90.
(4) Dizdaroglu M. Oxidative damage to DNA in mammalian chromatin. Mutat
Res 1992;275:331–42.
(5) Helbock HJ, Beckman KB, Ames BN. 8-Hydroxydeoxyguanosine and
8-hydroxyguanine as biomarkers of oxidative DNA damage. Methods
Enzymol 1999;300:156–66.
(6) Shibutani S, Takeshita M, Grollman AP. Insertion of specific bases during DNA synthesis past the oxidation-damaged base 8-oxodG. Nature
1991;349:431–4.
(7) Maki H, Sekiguchi M. MutT protein specifically hydrolyses a potent mutagenic substrate for DNA synthesis. Nature 1992;355:273–5.
(8) Michaels ML, Miller JH. The GO system protects organisms from the mutagenic effect of the spontaneous lesion 8-hydroxyguanine (7,8-dihydro-8oxoguanine). J Bacteriol 1992;174:6321–5.
(9) Hazra TK, Izumi T, Venkatarman R, Kow YW, Dizdaroglu M, Mitra S.
Characterization of a novel 8-oxoguanine-DNA glycosylase activity in
Escherichia coli and identification of the enzyme as endonuclease VIII. J
Biol Chem 2000;275:27762–7.
(10) Radicella JP, Dherin C, Desmaze C, Fox MS, Boiteux S. Cloning and characterization of hOGG1, a human homolog of the OGG1 gene of Sacharomyces cerevisiae. Proc Natl Acad Sci U S A 1997;94:8010–5.
(11) Hazra TK, Izumi T, Maidt L, Floyd RA, Mitra S. The presence of two distinct
8-oxoguanine repair enzymes in human cells: their potential complementary
roles in preventing mutation. Nucleic Acids Res 1998;26:5116–22.
(12) Hazra TK, Hill JW, Izumi T, Mitra S. Multiple DNA glycosylases for repair
of 8-oxoguanine and their potential in vivo functions. Prog Nucleic Acid Res
Mol Biol 2001;68:193–205.
(13) Hazra TK, Izumi T, Boldogh I, Imhoff B, Kow YW, Jaruga P, et al. Identification and characterization of a human DNA glycosylase for repair of
modified bases in oxidatively damaged DNA. Proc Natl Acad Sci U S A
2002;99:3523–8.
(14) Dou H, Mitra S, Hazra TK. Repair of oxidized bases in DNA bubble
structures by human DNA glycosylases NEIL1 and NEIL2. J Biol Chem
2003;278:49678–84.
ARTICLES
393
(15) Yeh YC, Chang DY, Masin J, Lu AL. Two nicking enzyme systems specific
for mismatch-containing DNA in nuclear extracts from human cells. J Biol
Chem 1991;266:6480–4.
(16) McGoldrick JP, Yeh YC, Solomon M, Essigman JM, Lu AL. Characterization of a mammalian homolog of the Escherichia coli MutY mismatch repair protein. Mol Cell Biol 1995;15:989–96.
(17) Slupska MM, Baikalov C, Luther WM, Chiang JH, Wei YF, Miller JH.
Cloning and sequencing a human homolog (hMYH) of the Escherichia coli
mutY gene whose function is required for the repair of oxidative DNA damage. J Bacteriol 1996;178:3885–92.
(18) Mo JY, Maki H, Sekiguchi M. Hydrolytic elimination of a mutagenic nucleotide, 8-oxodGTP, by human 18-kilodalton protein: sanitization of nucleotide pool. Proc Natl Acad Sci U S A 1992;89:11021–5.
(19) Sakumi K, Furuichi M, Tsuzuki T, Kakuma T, Kawabata S, Maki H, et al.
Cloning and expression of cDNA for a human enzyme that hydrolyzes
8-oxo-dGTP, a mutagenic substrate for DNA synthesis. J Biol Chem
1993;268:23524–30.
(20) Fujikawa K, Kamiya H, Yakushiji H, Fuji Y, Nakabeppu Y, Kasai H. The
oxidized forms of dATP are substrates for the human MutT homolgue, the
hMTH1 protein. J Biol Chem 1999;274:18201–5.
(21) Fujikawa K, Yakushiji H, Nakabeppu Y, Suzuki T, Masuda M, Ohshima
H, et al. 8-Chloro-dGTP, a hypochlorous acid-modified nucleotide, is
hydrolyzed by hMTH1, the human MutT homolog. FEBS Lett 2002;
512:149–51.
(22) Slupphaug G, Kavli B, Krokan HE. The interacting pathways for prevention
and repair of oxidative DNA damage. Mutat Res 2003;531:231–51.
(23) Wiencke JK. DNA adduct burden and tobacco carcinogenesis. Oncogene
1998;21:7376–91.
(24) Asami S, Manabe H, Miyake J, Tsurudome Y, Hirano T, Yamaguchi R,
et al. Cigarette smoking induces an increase in oxidative DNA damage,
8-hydroxydeoxyguanosine, in a central site of the human lung. Carcinogenesis
1997;18:1763–6.
(25) Saetta M. Airway inflammation in chronic obstructive pulmonary disease.
Am J Respir Crit Care Med 1999;160:17–20.
(26) Gackowski D, Speina E, Zielinska M, Kowalewski J, Rozalski R, Siomek A,
et al. Products of oxidative DNA damage and repair as possible biomarkers
of susceptibility to lung cancer. Cancer Res 2003;63:4899–902.
(27) Paz-Elizur T, Krupsky M, Blumenstein S, Elinger D, Schechtman E,
Livneh Z. DNA repair activity for oxidative damage and risk of lung cancer.
J Natl Cancer Inst 2003;95:1312–9.
(28) Speina E, Zielinska M, Barbin A, Gackowski D, Kowalewski J, Graziewicz
MA, et al. Decreased repair activities of 1,N6-ethenoadenine and 3,N4ethenocytosine in lung adenocarcinoma patients. Cancer Res 2003;63:4351–7.
Erratum in: Cancer Res 2003;63:6103.
(29) Klungland A, Rosewell I, Hollenbach S, Larsen E, Daly G, Epe B, et al. Accumulation of premutagenic DNA lesions in mice defective in removal of
oxidative base damage. Proc Natl Acad Sci U S A 1999;96:13300–5.
(30) Minowa O, Arai T, Hirano M, Monden Y, Nakai S, Fukuda M, et al. Mmh/
Ogg1 gene inactivation results in accumulation of 8-hydroxyguanine in
mice. Proc Natl Acad Sci U S A 2000;97:4156–61.
(31) Fowler RG, White SJ, Koyama C, Moore SC, Dunn RL, Schaaper RM.
Interactions among Escherichia coli mutT, mutM, and mutY damage prevention pathways. DNA Repair 2003;2:159–73.
(32) Tsuzuki T, Egashira A, Igarashi H, Iwakuma T, NakatsuruY, Tominaga Y,
et al. Spontaneous tumorigenesis in mice defective in the MTH1 gene encoding 8-oxo-dGTPase. Proc Natl Acad Sci U S A 2001;98:11456–61.
(33) Bialkowski K, Kasprzak, KS. A novel assay of 8-oxo-2′-deoxyguanosine
5′-triphosphate pyrophosphohydrolase (8-oxo-dGTPase) activity in cultured
cells and its use for evaluation of cadmium(II) inhibition of this activity.
Nucleic Acids Res 1998;26:3193–201.
(34) Hoard DE, Ott DG. Conversion of mono- and oligodeoxyribonucleotides to
5′-triphosphates. J Am Chem Soc 1965;87:1785–8.
(35) World Health Organization. Histological typing of lung tumors. Am J Clin
Pathol 1982;77:123–36.
(36) Gackowski D, Kruszewski M, Bartlomiejczyk T, Jawien A, Ciecierski M,
Olinski R. The level of 8-oxo-7,8-dihydro-2′-deoxyguanosine is positively
correlated with the size of the labile iron pool in human lymphocytes. J Biol
Inorg Chem 2002;7:548–50.
(37) ESCODD. Measurement of DNA oxidation in human cells by chromatographic and enzymic methods. Free Radic Biol Med 2003;34:1089–99.
394 ARTICLES
(38) Foksinski M, Bialkowski K, Skiba M, Ponikowska I, Szmurlo W, Olinski R.
Evaluation of 8-oxodeoxyguanosine, typical oxidative DNA damage, in lymphocytes of ozone-treated arteriosclerotic patients. Mutat Res 1999;438:23–7.
(39) Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem 1976;72:248–55.
(40) Roldan-Arjona T, Wei YF, Carter KC, Klungland A, Anselmino C, Wang RP,
et al. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase. Proc Natl
Acad Sci U S A 1997;94:8016–20.
(41) Hill JW, Hazra TK, Izumi T, Mitra S. Stimulation of human 8-oxoguanineDNA glycosylase by AP-endonuclease: potential coordination of the initial
steps in base excision repair. Nucleic Acids Res 2001;29:430–8.
(42) Topal MD, Baker MS. DNA precursor pool: a significant target for N-methylN-nitrosourea in C3H/10T1/2 clone 8 cells. Proc Natl Acad Sci U S A
1982;79:2211–5.
(43) Okamoto K, Toyokuni S, Kim WJ, Ogawa O, Kakehi Y, Arao S, et al. Overexpression of human mutT homologue gene messenger RNA in renal-cell
carcinoma: evidence of persistent oxidative stress in cancer. Int J Cancer
1996;65:437–41.
(44) Wani G, Milo GE, D’Ambrosio SM. Enhanced expression of the 8-oxo-7,
8-dihydrodeoxyguanosine triphosphatase gene in human breast tumor cells.
Cancer Lett 1998;125:123–30.
(45) Kennedy CH, Cueto R, Belinsky SA, Lechner JF, Pryor WA. Overexpression of hMTH1 mRNA: a molecular marker of oxidative stress in lung cancer cells. FEBS Lett 1998;429:17–20.
(46) Iida T, Furuta A, Kawashima M, Nishida J, Nakabeppu Y, Iwaki T. Accumulation of 8-oxo-2′-deoxyguanosine and increased expression of hMTH1
protein in brain tumors. Neuro-Oncology 2001;3:73–81.
(47) Kennedy CH, Pass HI, Mitchell JB. Expression of human MutT
homologue (hMTH1) protein in primary non–small-cell lung carcinomas and histologically normal surrounding tissue. Free Radic Biol Med
2003;34:1447–57.
(48) Meyer F, Fiala E, Westendorf J. Induction of 8-oxo-dGTPase activity in human lymphoid cells and normal fibroblasts by oxidative stress. Toxicology
2000;146:83–92.
(49) Kim HN, Morimoto Y, Tsuda T, Ootsuyama Y, Hirohashi M, Hirano T,
et al. Changes in DNA 8-hydroxyguanine levels, 8-hydroxyguanine repair
activity, and hOGG1 and hMTH1 mRNA expression in human lung
alveolar epithelial cells induced by crocidolite asbestos. Carcinogenesis
2001;22:265–9.
(50) Russo MT, Blasi MF, Chiera F, Fortini P, Degan P, Macpherson P, et al.
The oxidized deoxynucleoside triphosphate pool is a significant contributor to genetic instability in mismatch repair-deficient cells. Mol Cell Biol
2004;24:465–74.
(51) Yoshimura D, Sakumi K, Ohno M, Saki Y, Furuichi M, Iwai S, et al. An
oxidized purine nucleoside triphosphatase, MTH1, suppresses cell death
caused by oxidative stress. J Biol Chem 2003;278:37965–73.
(52) Bialkowski K, Bialkowska A, Anderson LM, Kasprzak KS. Higher activity
of 8-oxo-2′-deoxyguanosine 5′-triphosphate pyrophosphohydrolase
(8-oxo-dGTPase) coincides with lower background levels of 8-oxo-2′deoxyguanosine in DNA of fetal compared with maternal mouse organs.
Free Radic Biol Med 1999;27:90–4.
(53) Kohno T, Shinmura K, Tosaka M, Tani M, Kim SR, Sugimura H, et al.
Genetic polymorphism and alternative splicing of hOGG1 gene, that is
involved in the repair of 8-hydroxyguanine in damaged DNA. Oncogene
1998;16:3219–25.
(54) Fan CY, Liu KL, Huang HY, Barnes EL, Swalsky PA, Bakker A, et al.
Frequent allelic imbalance and loss of protein expression of the DNA repair gene hOGG1 in head and neck squamous cell carcinoma. Lab Invest
2001;81:1429–38.
(55) Chevillard S, Radicella JP, Levalois C, Lebeau J, Poupon MF, Oudard
S, et al. Mutations in OGG1, a gene involved in the repair of oxidative
DNA damage, are found in human lung and kidney tumours. Oncogene
1998;16:3083–6.
(56) Fritz G, Grosch S, Tomicic M, Kaina B. APE/Ref-1 and the mammalian
response to genotoxic stress. Toxicology 2003;193:67–78.
(57) Bouziane M, Miao F, Bates SE, Somsouk L, Sang BC, Denissenko M, et al.
Promoter structure and cell cycle dependent expression of the human methylpurine-DNA glycosylase gene. Mutat Res 2000;461:15–29.
Journal of the National Cancer Institute, Vol. 97, No. 5, March 2, 2005
(58) Ramana CV, Boldogh I, Izumi T, Mitra S. Activation of apurinic/apyrimidinic endonuclease in human cells by reactive oxygen species and its
correlation with their adaptive response to genotoxicity of free radicals. Proc
Natl Acad Sci U S A 1998;95:5061–6.
(59) Marsin S, Vidal AE, Sossou M, Menissier-de Murcia J, Le Page F, Boiteux
S, et al. Role of XRCC1 in the coordination and stimulation of oxidative
DNA damage repair initiated by the DNA glycosylase hOGG1. J Biol Chem.
2003;278:44068–74.
(60) Jaiswal M, LaRusso NF, Nishioka N, Nakabeppu Y, Gores GJ. Human
Ogg1, a protein involved in the repair of 8-oxoguanine, is inhibited by nitric
oxide. Cancer Res 2001;61:6388–93.
(61) Graziewicz M, Wink DA, Laval F. Nitric oxide inhibits DNA ligase activity: potential mechanisms for NO-mediated DNA damage. Carcinogenesis
1996;17:2501–5.
(62) Wink DA, Laval J. The Fpg protein, a DNA repair enzyme, is inhibited
by the biomediator nitric oxide in vitro and in vivo. Carcinogenesis
1994;15:2125–9.
(63) Laval F, Wink DA. Inhibition by nitric oxide of the repair protein, O6methylguanine-DNA-methyltransferase. Carcinogenesis 1994;15:443–7.
(64) Fujimoto H, Ando Y, Yamashita T, Terazaki H, Tanaka Y, Sasaki J, et al.
Nitric oxide synthase activity in human lung cancer. Jpn J Cancer Res
1997;88:1190–8.
(65) Ambs S, Bennett WP, Merriam WG, Ogunfusika MO, Oser SM, Kham
MA, et al. Vascular endothelial growth factor and nitrite oxide synthase
expression in human lung cancer and the relation to p53. Br J Cancer
1998;78:233–9.
(66) Dantzer F, Luna L, Bjoras M, Seeberg E. Human OGG1 undergoes
serine phosphorylation and associates with the nuclear matrix and mitotic
chromatin in vivo. Nucleic Acids Res 2002;30:2349–57.
Journal of the National Cancer Institute, Vol. 97, No. 5, March 2, 2005
(67) Ishida T, Takashima R, Fukayama M, Hamada C, Hippo Y, Fujii T, et al.
New DNA polymorphisms of human MMH/OGG1 gene: prevalence of one
polymorphism among lung-adenocarcinoma patients in Japanese. Int J Cancer 1999;80:18–21.
(68) Goode EL, Ulrich CM, Potter JD. Polymorphisms in DNA repair genes
and associations with cancer risk. Cancer Epidemiol Biomarkers Prev
2002;11:1513–30.
(69) Wikman H, Risch A, Klimek F, Schmezer P, Spiegelhalder B, Dienemann
H, et al. hOGG1 polymorphism and loss of heterozygosity (LOH): significance for lung cancer susceptibility in a caucasian population. Int J Cancer
2000;88:932–7.
(70) Le Marchand L, Donlon T, Lum-Jones A, Seifried A, Wilkens LR. Association of the hOGG1 Ser326Cys polymorphism with lung cancer risk. Cancer
Epidemiol Biomarkers Prev 2002;11:409–12.
(71) Sugimura H, Kohno T, Wakai K, Nagura K, Genka K, Igarashi H, et al.
hOGG1 Ser326Cys polymorphism and lung cancer susceptibility. Cancer
Epidemiol Biomarkers Prev 1999;8:669–74.
NOTES
E. Speina, K. D. Arczewska, and D. Gackowski contributed equally to the
work. This work was supported by a grant from the State Committee for Scientific
Research (PBZ-KBN-091/P05/2003/55) and was conducted within the activity of
the Center of Excellence in Molecular Biotechnology, Institute of Biochemistry
and Biophysics PAS (WP10). D. Gackowski and R. Oliński also acknowledge the
Foundation for Polish Science for support.
Manuscript received April 21, 2004; revised September 30, 2004; accepted
January 5, 2005.
ARTICLES
395