Am J Physiol Gastrointest Liver Physiol 292: G215–G222, 2007.
First published August 17, 2006; doi:10.1152/ajpgi.00188.2006.
Rapid expansion of intestinal secretory lineages following
a massive small bowel resection in mice
Michael A. Helmrath,1,2 Jerry J. Fong,1 Christopher M. Dekaney,1 and Susan J. Henning2,3
1
Michael E. DeBakey Department of Surgery, Departments of 2Pediatrics and
Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas
3
Submitted 3 May 2006; accepted in final form 14 August 2006
small bowel resection (SBR) is a
complex process resulting in a marked increase in proliferation
to expand the mucosal surface area of the remaining intestine.
Animal models evaluating the adaptive response after intestinal
resection have demonstrated that sustained increases in crypt
depth and villus height are observed, indicating steady-state set
points for these parameters are increased after resection (24).
However, the cellular mechanisms by which both crypt depth
and villus height are reset and sustained after intestinal resection are not well understood. Clinical experience indicates that
the adaptive process usually leads to complete and long-lasting
functional compensation after modest intestinal loss. However,
after massive intestinal loss, the adaptive response is often
insufficient, leaving a patient with intestinal failure and the
prolonged requirement for administration of parenteral nutri-
tion (PN) to sustain adequate nourishment and fluid balance. In
contrast to animal models, studies performed on PN-dependent
patients with short-bowel syndrome have not demonstrated
sustained increases in mucosal crypt depth or villus height,
suggesting either a different adaptive mechanism occurs in
humans for expanding mucosal surface area or an insufficient
adaptative response has occurred resulting in intestinal failure
(37). Previous animal studies have demonstrated the ability of
various growth factors (7, 13, 18, 29, 31), luminal nutrients (7,
9, 20), pancreaticobiliary secretions (2, 33), and mesenchymal
factors (25) to augment the adaptive response, yet no treatments in animals or humans have demonstrated sustained
increases above the baseline parameters of adaptation without
continued administration of the given factor. Understanding
the mechanisms that allow the remaining intestine to sense the
need to reset and maintain a higher rate of epithelial proliferation, producing enhanced mucosal surface area, may give
insight essential for the management of patients with intestinal
failure.
Intestinal stem cells reside near the base of the crypt,
providing immature progeny, which continue to divide as they
migrate up the crypt until they differentiate into either intestinal absorptive cells (enterocytes) or secretory lineages (goblet,
Paneth, and enteroendocrine cells). Absorptive enterocytes
comprise ⬃90% of the cells in the entire epithelium and are
responsible for the terminal digestion and absorption of luminal nutrients. The goblet cells are distributed throughout the
crypts and villi and produce epithelial-protective mucins, as
well as trefoil factor-3 (Tff3), which is ultimately involved in
postinjury repair of the small bowel (3). The third cell type is
the Paneth cell, which resides at the base of the crypt and is
classically believed to have an antimicrobial function in the
small intestine (4, 11). The adjacent location of these cells to
the intestinal stem cell zone and recent research demonstrating
their secretion of cytokines, growth factors, and other products,
including soluble Wnt proteins known to regulate proliferation
(10, 12, 30), raises the possibility of a potential role for Paneth
cells initiating and maintaining the adaptive response. The
fourth lineage is the enteroendocrine cells that comprise only
1% of the intestinal epithelium, producing numerous factors
that act both locally and systemically, which may also influence epithelial proliferation and differentiation (28). The overall percentage of secretory lineages within the intestinal epithelium gradually increases from proximal to distal, with the
greatest percentage being found in the terminal ileum. Interestingly, the adaptive response, as measured by changes in
Address for reprint requests and other correspondence: M. A. Helmrath,
Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030 USA (e-mail:
[email protected]).
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
intestinal adaptation; intestinal failure; Paneth cells; goblet cells
INTESTINAL ADAPTATION AFTER
http://www.ajpgi.org
0193-1857/07 $8.00 Copyright © 2007 the American Physiological Society
G215
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.4 on June 18, 2017
Helmrath, Michael A., Jerry J. Fong, Christopher M. Dekaney,
and Susan J. Henning. Rapid expansion of intestinal secretory
lineages following a massive small bowel resection in mice. Am J
Physiol Gastrointest Liver Physiol 292: G215–G222, 2007. First
published August 17, 2006; doi:10.1152/ajpgi.00188.2006.—Following massive small bowel resection (SBR) in mice, there are sustained
increases in crypt depth and villus height, resulting in enhanced
mucosal surface area. The early mechanisms responsible for resetting
and sustaining this increase are presently not understood. We hypothesized that expansion of secretory lineages is an early and sustained
component of the adaptive response. This was assessed in the ileum
by quantitative morphometry at 12 h, 36 h, 7 days, and 28 days and
by quantitative RT-PCR of marker mRNAs for proliferation and
differentiated goblet, Paneth cell, and enterocyte genes at 12 h after
50% SBR or sham operation. As predicted, SBR elicited increases of
both crypt and villus epithelial cells, which were sustained though the
28 days of the experiment. Significant increases in the overall number
and percentage of both Paneth and goblet cells within intestinal
epithelium occurred by 12 h and were sustained up to 28 days after
SBR. The increases of goblet cells after SBR were initially observed
within villi at 12 h, with marked increases occurring in crypts at 36 h
and 7 days. Consistent with this finding, qRT-PCR demonstrated
significant increases in the expression of mRNAs associated with
proliferation (c-myc) and differentiated goblet cells (Tff3, Muc2) and
Paneth cells (lysozyme), whereas mRNA associated with differentiated enterocytes (sucrase-isomaltase) remained unchanged. From
these data, we speculate that early expansion of intestinal secretory
lineages within the epithelium of the ileum occurs following SBR,
possibly serving to amplify the signal responsible for initiating and
sustaining intestinal adaptation.
G216
INTESTINAL LINEAGE EXPANSION AFTER RESECTION IN MICE
METHODS
Animals and experimental design. The Baylor College of Medicine
Institutional Animal Care and Use Committee approved the protocol
for this study. Male C57BL/6J mice (weight range 25–31 g; Jackson
ImmunoResearch Laboratories, Bar Harbor, ME) were housed in
groups of 5 at 21°C on 12:12-h dark-light cycle with wood chip
bedding and were allowed to acclimate 5 days before being assigned
to undergo either a sham operation or 50% SBR. On the basis of
previous experience defining the murine model for SBR, the diet was
changed from regular chow to a liquid diet (Micro-Stablized Rodent
Liquid Diet LAD 101/101A, Purina Mills, St. Louis, MO) 2 days
before the operation and maintained for the duration of the experiment
to avoid intestinal obstruction of solid food at the anastomosis (14).
Animals used as nonoperated controls (n ⫽ 5) were similarly acclimated to liquid diet for 2 days before harvesting tissue. All operations
were performed under sterile conditions and with the aid of the
operating microscope (⫻7 magnification) using inhaled 2% isofluorane and oxygen (90%) for anesthesia. Through a midline incision,
the intestines were eviscerated in all animals, and the ileocecal
junction was identified. Sham operations (n ⫽ 5 per time point)
consisted of division and reanastomosis of the bowel ⬃7 cm proximal
to the ileocecal junction (transection only). In mice undergoing SBR
(n ⫽ 5 per time point), the small bowel was divided 7 cm proximal to
the ileocecal junction and 8 cm distal to the ligament of Trietz, and the
mesentery of the resected intestine was ligated, resulting in the
removal of 15 cm of the intervening small intestine (50% resection).
Intestinal continuity was restored using an end-to-end, single-layered
anastomosis with interrupted 9 – 0 monofilament sutures. Mice were
hydrated with 1–2 ml of warm intraperitoneal saline and the abdomen
closed with a running suture. Liquid diet was provided immediately
postoperatively, and the mice were maintained on the liquid diet
throughout the study.
Mice were euthanized by cervical dislocation, while under 2%
isoflurane anesthesia at 12 h, 36 h, 7 days, and 28 days postoperatively. A separate group of mice (n ⫽ 5) undergoing sham and SBR
also received an intraperitoneal injection of bromodeoxyuridine
(BrdU; 120 mg/kg) at the time of operation and were euthanized at
12 h. Intestinal contents were flushed with saline and gently expressed
with cotton swabs. The first centimeter proximal and distal to the
anastomosis was discarded, the subsequent centimeter proximal (jejunum) and distal (ileum) were fixed with 10% neutral buffered
formalin for histological evaluation. The following distal 2 cm (ileum)
was frozen in liquid nitrogen and stored at ⫺80°C until RNA was
isolated. Tissue from nonoperated mice was harvested in a similar
fashion.
Histology. Formalin-fixed and paraffin-embedded specimens were
oriented to provide cut sections perpendicular with the longitudinal
axis of the bowel and 5-␮m-thick sections mounted on poly-L-lysine
AJP-Gastrointest Liver Physiol • VOL
slides. Goblet cells were identified using Alcian blue staining with a
light eosin counter stain. Paneth cells were identified by lysozyme
immunohistochemistry, and enteroendocrine cells were stained using
chromogranin A immunohistochemistry, both with light hematoxylin
counterstaining. Routine immunohistochemistry was used to determine BrdU incorporation. All histological analyses were performed in
a blinded manner. As our goal was to focus on the hyperplastic
response of secretory lineages as a percentage of the entire epithelium
following SBR, the total number of epithelial cells within entire crypts
and along one side of the villi was counted as a measure of adaptation.
For each animal, the total number of epithelial cells and lysozymepositive Paneth cells within 10 intact crypts, in which a single layer of
epithelium was identified, were counted to determine the percentage
of Paneth cells. Similarly, the total number of epithelial cells and
number of Alcian blue-stained goblet cells from the crypt-villus
junction up to the tip of 10 villi, in which the central lymphatic vessel
and a single layer of epithelium were identified and scored to determine the percentage of goblet cells. Percentage of goblet cells within
crypts could not be determined as the absolute number of nuclei
associated with enterocytes and goblet cells was obscured by the
marked numbers of Alcian blue-stained cells throughout the crypts
after SBR at 36 h and 7 days. To overcome this difficulty, only the
total number of Alcian blue cells was determined within crypts. The
low frequency of enteroendocrine cells detected within intact crypts
and villi, as determined by chromograinin A staining precluded
quantitative analysis.
RNA isolation and quantitative RT-PCR. Total RNA was isolated
using a guanidine isothiocyanate/cesium chloride method (19, 23). All
RNA samples were DNase treated using the Turbo DNA-free kit
(Ambion, Austin, TX) following instructions of the manufacturer.
Quantitative real-time PCR was performed using Applied Biosystems
7500 Real-Time PCR System and Taqman One-step RT-PCR Master
Mix Reagents Kit (Applied Biosystems, Foster City, CA), according
to manufacturer’s instructions. Primer and probe sets for c-myc
(Assay ID Mm00487803_m1), lysozyme (Mm00727183_s1),
Muc2 (Mm00458299_m1), Tff3 (Mm00495590_m1), Math1
(Mm00476035_s1), Hes1 (Mm00468601_m1), and ␤-actin
(Mm00607939_s1) were purchased from Applied Biosystems Taqman Gene Expression/Assay on Demand sets (Applied Biosystems).
Primer and probe sequences for sucrase-isomaltase (accession no.
XM_143332) were forward primer TTCAAGAAATCACAACATTCAATTTACTAG; reverse primer CTAAAACTTTCTTTGACATTTGAGCAA; and probe AGGCAAGATCCTGTTTCCTGGAATGAAACT. Samples from each tissue were analyzed in triplicate. Data were analyzed using the ⌬⌬Ct method with ␤-actin mRNA
as the constitutive marker (1, 27). Pooled RNA from nonoperated
intact terminal ileum harvested 5–7 cm proximal to the cecum from 5
adult C57BL/6J mice was used as the reference.
Statistical analyses. All quantitative results are presented as
means ⫾ SE. For the morphometry data, the analyses were based on
the assumption that the 10 crypts used for counting the Paneth cells,
and the 10 villi used for counting the goblet cells were selected at
random. For each animal the 10 observed crypt and villus counts were
collapsed into an average value. The average values were used to
generate means ⫾ SE (n ⫽ 5) and were compared among the three
groups (nonoperated, sham, SBR) at each time point using ANOVA
with correction for multiple comparisons using the Tukey’s procedure. Two-way ANOVAs were conducted with repeated measures to
investigate the effect of treatment, time, and the interaction of treatment and time on cell means. These analyses did not include the
control group as control data were available for only one time point.
The t-test was used to compare the gene expression between groups
for each gene. For all parameters, P ⬍ 0.05 was considered the level
of significance.
292 • JANUARY 2007 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.4 on June 18, 2017
morphological parameters, follows the same pattern, as the
distal ileum adapts to a far greater extent following resection
than that seen within the proximal jejunum (8, 33, 34).
To date, the effect of SBR on enterocytes has been extensively studied (14); however, the response of intestinal secretory lineages after resection is not well documented. The
purpose of this study, therefore, was to determine the effect of
resection-induced adaptation on lineage allocation of intestinal
secretory cells within the terminal ileum. We hypothesized that
expansion of secretory lineages is an early and sustained
component of the adaptive response. In addition, further evaluation of mRNAs associated with proliferation (c-myc) and
differentiated goblet cells (Tff3, Muc2), Paneth cells (lysozyme) and enterocytes (sucrase-isomaltase) were assessed at
the earliest time point (12 h) to confirm expansion of secretory
lineages.
INTESTINAL LINEAGE EXPANSION AFTER RESECTION IN MICE
RESULTS
paring sham and SBR 7 days after resection clearly demonstrate the increased staining pattern of goblet cells throughout
crypts (Fig. 2).
Similar to the findings of early increased staining of goblet
cells within villi, intestinal resection resulted in markedly
increased lysozyme staining confined to the base of crypts in
mice 12 h after SBR compared with sham-operated animals
(Fig. 1B). By 36 h, lysozyme-positive cells were observed
throughout the mid and upper portion of crypts, a pattern that
remains evident 7 days postoperation (Fig. 2, black arrows).
We postulate that these newly stained cells are recently differentiated Paneth cells migrating to the base of the crypt. Increased lysozyme staining is evident 28 days postoperative in
SBR vs. sham, yet the staining at this point is confined to the
base of the crypt.
Immunohistochemical chromogranin A staining of enteroendocrine cells was also performed on these sections. The overall
staining of these cells generally appeared to be increased
within crypts and villi in sections from SBR mice compared
with sham at 7 days. However, determining the relative change
in the percentage of these cells within the entire epithelium
Fig. 1. Photomicrographs of histological sections taken from the distal ileum of unoperated mice and animals at 12 h, 36 h, 7 days,
and 28 days following either sham operation
or 50% small bowel resection (SBR). A: representative sections of Alcian blue-stained
goblet cells with light eosin counter staining
(magnification ⫻160). B: representative sections of Paneth cells labeled by lysozyme
immunohistochemisty with light hematoxylin
counterstaining (magnification ⫻320).
AJP-Gastrointest Liver Physiol • VOL
292 • JANUARY 2007 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.4 on June 18, 2017
Qualitative overview. Postoperative survival after SBR was
90% based on data from all time points studied. All surviving
mice used for the study were healthy and vigorous throughout
the experiment. Representative histological sections from ileums of SBR mice demonstrate the well-described robust
adaptive changes in both crypts and villi compared with shamoperated animals (Fig. 1). In addition, histological sections
from unoperated controls maintained on liquid diet for 48 h
were used to evaluate the overall operative effect (both sham
and SBR) on secretory lineages. Early increases in the overall
number of goblet cells within villi, as assessed by Alcian blue
staining, are appreciated in SBR compared with sham animals
12 h postoperation (Fig. 1A). Whereas early increased staining
occurred following resection within the upper villus at 12 h, a
different staining pattern involving significant increases in the
overall number of Alcian blue-positive cells throughout the
crypt is seen at 36 h and 7 days yet returns to the original
distribution pattern, although with increased staining of goblet
cells at 28 days in SBR vs. sham-operated animals. Representative high-power images of Alcian blue-stained sections com-
G217
G218
INTESTINAL LINEAGE EXPANSION AFTER RESECTION IN MICE
Fig. 2. High-power photomicrographs (magnification ⫻640) of sections taken from the
ileum at 7 days following either sham operation or SBR. Numerous Alcian blue-stained
goblet cells are seen throughout the crypts
(white arrows) following SBR, as well as
granule containing Paneth cells (black arrows) which typically reside at the base of
the crypt.
Quantitative morphometry. Intestinal adaptation was verified after SBR by counting the number of epithelial cells within
entire crypts and along one side of villi. As Paneth cells occupy
the base of crypts, to avoid a bias toward one side or the other,
we decided to count all epithelial cells within each crypt and
then divide the final number in half as a representation of crypt
depth. As can be seen in Fig. 4A, after SBR, significant
increases in ileal crypt cell number were detectable as early as
12 h. In contrast, significant increases in the number of epithelial cells per villi were not observed until 36 h after SBR.
Interestingly, total crypt cell numbers showed a modest decrease in sham-operated mice compared with nonoperated
controls at 36 h and 7 days (P ⬍ 0.01 in both cases), returning
to baseline at 28 days. For both crypts and villi, the two-way
ANOVA revealed significant interaction between treatment
Fig. 3. Photomicrographs of BrdU immunohistochemistry (⫻400) taken from the ileum
of sham-operated and SBR mice 12 h after
surgery and intraperitoneal administration of
BrdU. Although SBR increased the incorporation of BrdU within crypts, consistant with
increased proliferation, no staining was observed in any goblet or Paneth cells.
AJP-Gastrointest Liver Physiol • VOL
292 • JANUARY 2007 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.4 on June 18, 2017
from SBR vs. sham mice was not deemed possible due to the
overall sparse distribution of these cells within quantifiable
crypts and villi (as described in METHODS).
As we observed an early increase in both goblet and
Paneth cells following resection, the thymidine analog BrdU
was administered intraperitoneally following sham or SBR
to a separate group of mice (n ⫽ 5) as a marker of
proliferation within intestinal lineages. Although increased
incorporation was seen within the ileal crypts of mice
following SBR, consistent with increased proliferation, no
staining of goblet cells (within villi or crypts) or Paneth
cells was seen (Fig. 3). This finding suggests that the early
expansion of Alcian blue staining cells within the villus and
lysozyme-positive Paneth cells at the base of crypts is not a
result of newly formed cells.
INTESTINAL LINEAGE EXPANSION AFTER RESECTION IN MICE
and time, indicating that the effect of SBR became more
pronounced with time after surgery.
A marked increase in both the number (Fig. 5A) and percentage (Fig. 5B) of goblet cells on the villi was observed in
the SBR animals at the earliest time point studied (12 h). At
this time, sham-operated animals also showed a modest, but
significant, increase in the overall percentage of goblet cells
within the terminal ileal epithelium compared with nonoperated controls (P ⬍ 0.05). The total number and percentage of
villus goblet cells remained significantly elevated within the
epithelium from SBR compared with sham-operated mice at
36 h, 7 days, and 28 days postoperatively (Fig. 5, A and B).
Although the effects of SBR were still apparent at 28 days, the
overall trend was back toward baseline at this time point, and
this decline is statistically significant as indicated by the
interaction seen in the two-way ANOVA. In contrast to the
villus goblet cells, overall changes in the number of goblet
cells within crypts were not evident at 12 h (sham-operated
3.1 ⫾ 0.3 vs. SBR 3.0 ⫾ 0.2). Significant increases in crypt
goblet cell numbers were found at 36 h (sham-operated 2.8 ⫾
0.2 vs. SBR 6.2 ⫾ 0.4; P ⬍ 0.01), peaking at 7 days (shamoperated 2.7 ⫾ 03 vs. SBR 8.8 ⫾ 0.6; P ⬍ 0.01), with return to baseline at 28 days (sham-operated 2.9 ⫾ 0.4 vs. SBR
3.7 ⫾ 0.6).
The total number of Paneth cells within the ileal crypt was
significantly elevated by 12 h after SBR compared with sham,
a trend that continued to increase at 36 h and then plateau
through 28 days (Fig. 6A). Sham-operation significantly reAJP-Gastrointest Liver Physiol • VOL
duced the total number of Paneth cells within the epithelium of
crypts at all time points studied compared with nonoperated
controls (P ⬍ 0.01 in all cases). The effect of SBR on Paneth
cell number (Fig. 6A) exceeded that of total crypt cells (Fig.
4A). Thus when Paneth cells were expressed as a percentage of
crypt cells (Fig. 6B), significant increases were apparent at all
time points. Unlike goblet cells, which appear to be trending
back to baseline (Fig. 5B), the ratio of the percentage of Paneth
cells from SBR vs. sham-operated animals remained elevated
through 28 days.
In contrast to the patterns observed for the goblet cells and
Paneth cells, the absolute number and percentage of enterocytes was decreased in SBR compared with sham-operated
mice 12 h after resection. (Fig. 7) By 36 h, when the effects of
increased proliferation in SBR mice became apparent, the total
number of enterocytes was increased (Fig. 7A), yet the percentage of enterocytes within the ileal epithelium remained
significantly decreased (Fig. 7B), returning to baseline only at
28 days.
Assessment of mRNA changes. Early changes in the percentage of intestinal secretory lineages identified histologically
lead us to evaluate changes in mRNA levels of genes associated with proliferation and terminal differentiation of enterocytes, goblet, and Paneth cells within ileal homogenates taken
from nonoperated animals and mice 12 h after either shamoperation or SBR. As can be seen in Fig. 8, SBR resulted in
significant elevation of c-myc compared with sham-operated
mice, consistent with an increase in proliferation seen after
Fig. 5. Number (A) and percentage (B) of goblet cells per villi from the ileum
of unoperated (open bar), sham-operated (hatched bars), and 50% SBR (solid
bars) mice 12 h, 36 h, 7 days, and 28 days following surgery (n ⫽ 5
animals/group). On the basis of univariate analysis, significant differences
(*P ⬍ 0.05) between sham operation and SBR are shown. The two-way
ANOVA indicated significant treatment (P ⬍ 0.0001) and treatment ⫻ time
interaction (P ⬍ 0.0001) effects for both the number and percentage of goblet
cells.
292 • JANUARY 2007 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.4 on June 18, 2017
Fig. 4. Number of epithelial cells representing crypt depth (A) and villus
height (B) from the ileum of unoperated (open bar), sham-operated (hatched
bars), and 50% SBR (solid bars) mice 12 h, 36 h, 7 days, and 28 days following
surgery (n ⫽ 5 animals/group). On the basis of univariate analysis, significant
differences (*P ⬍ 0.05) between sham operation and SBR are shown. The
two-way ANOVA indicated significant treatment (P ⬍ 0.0001) and treatment ⫻ time interaction (P ⬍ 0.0001) effects for both the crypt and villus cells.
G219
G220
INTESTINAL LINEAGE EXPANSION AFTER RESECTION IN MICE
intestinal resection. Expression of Muc2 and Tff3 mRNAs,
related to goblet cell production of epithelial protective mucus,
were significantly greater in SBR compared with sham. Likewise, expression of the antimicrobial Paneth cell marker lysozyme was found to be significantly elevated in SBR vs.
sham-operated mice at 12 h, consistent with the increased
percentage of Paneth cells seen in Fig. 6. In contrast, mRNA
levels for sucrase-isomaltase, an enterocyte marker, were not
affected by SBR.
Fig. 7. Number (A) and percentage (B) of enterocytes per villi from the ileum
of unoperated (open bar), sham-operated (hatched bars), and 50% SBR (solid
bars) mice 12 h, 36 h, 7 days, and 28 days after surgery (n ⫽ 5 animals/group).
On the basis of univariate analysis, significant differences (*P ⬍ 0.05) between
sham operation and SBR are shown. The two-way ANOVA indicated significant treatment (P ⬍ 0.0001), time (P ⬍ 0.0001), and treatment ⫻ time
interaction (P ⬍ 0.0001) effects for both the number and percentage of
enterocytes.
the number and percentage of goblet and Paneth cells within
adapting ileal epithelium are demonstrated after SBR. All data
presented were obtained from evaluation of the residual ileum
after intestinal resection in our murine model. The adaptive
response and allocation of enterocytes, goblet and Paneth cells
was also assessed within jejunal epithelium following resection
DISCUSSION
After the loss of small bowel in animal models, the remaining intestine compensates by increasing the overall mucosal
surface area. The mechanism by which the intestine is able to
sense the need to increase and sustain proliferation required to
support augmented crypt depth and villus height is not currently understood. In this study, we hypothesized that early
changes in the overall allocation of epithelial progenitors
toward secretory lineages occur after SBR. We report that
adaptation in our murine model is evident as early as 12 h after
SBR, as the number of cells within ileal crypts is significantly
greater compared with sham-operated animals. This adaptive
response is sustained in animals after SBR at all time points
studied beyond 36 h, as measured by significant increases in
both crypt and villus cell numbers up to 28 days after surgery.
Consistent with our hypothesis, early significant increases in
AJP-Gastrointest Liver Physiol • VOL
Fig. 8. Relative abundance of mRNA markers for proliferation (c-myc), goblet
cells (Tff3 and Muc2), Paneth cells (lysozyme), and enterocytes (sucraseisomaltase, SI) in distal ileal homogenates from sham-operated (hatched bars)
and 50% SBR (solid bars) mice 12 h after surgery (n ⫽ 5 animals/group). Each
mRNA was measured by quantitative RT-PCR and compared with expression
levels from nonoperated distal ileal homogenates. Values are expressed as
means ⫹ SE. Significant differences using the t-test (*P ⬍ 0.05) are shown.
292 • JANUARY 2007 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.4 on June 18, 2017
Fig. 6. Number (A) and percentage (B) of Paneth cells per crypt from the ileum
of unoperated (open bar), sham-operated (hatched bars), and 50% SBR (solid
bars) mice 12 h, 36 h, 7 days, and 28 days following surgery (n ⫽ 5
animals/group). On the basis of univariate analysis, significant differences
(*P ⬍ 0.05) between sham operation and SBR are shown. The two-way
ANOVA indicated significant treatment (P ⬍ 0.0001) and treatment ⫻ time
interaction (P ⬍ 0.0001) effects for the number of Paneth cells. There were
treatment (P ⬍ 0.0001), time (P ⬍ 0.0001), and treatment ⫻ time interaction
(P ⫽ 0.03) effects for the percent of Paneth cells.
INTESTINAL LINEAGE EXPANSION AFTER RESECTION IN MICE
AJP-Gastrointest Liver Physiol • VOL
expand and produce factors, which may play a role in the
adaptive response after intestinal resection.
Similar to goblet cells, the early increase in both the number
and percentage of Paneth cells occurred 12 h after SBR. This
finding was supported by the significant increase in the mRNA
for the Paneth cell marker lysozyme and did not appear to be
due to proliferation as we did not observe incorporation of
BrdU within these cells. The increase in Paneth cell number
and percentage was sustained out to 28 days in our study. Other
studies have demonstrated increased overall numbers of Paneth
cells at 7 days after SBR, but these findings were not statistically significant (5). During this study, we found it technically
difficult to quantify Paneth cells within histological sections,
which may explain differences between studies. Our ultimate
methods for quantification required lysozyme immunohistochemical staining of Paneth cells from tissue sections that
clearly demonstrated a single epithelium throughout the crypt,
often requiring numerous sections to be taken from each
animal studied. The sustained increase of Paneth cells in our
study may reflect their increased life span (21 days) compared
with other epithelial lineages (3–5 days) (6) and may also
support an important role for Paneth cells regulating proliferation within the adapting crypt. Data supporting this statement
include the finding that Paneth cells produce Wnt factors and
other cytokines capable of regulating proliferation and allocation of epithelial cells (6, 12). Evaluating the effect of SBR on
the Paneth cell production of these factors may reveal important regulatory mechanisms of the adaptive response.
Recent data supporting the overall expression of two opposing basic helical-loop-helical factors Hes1 and Math1 appear
important to intestinal fate determination of epithelial progeny,
with unopposed expression of Hes 1 leading to absorptive
lineages and overexpression of Math1 leading to secretory
lineages. (17, 36) In our study, no changes in Hes1 and Math1
mRNA levels were observed in SBR vs sham-operated mice
12 h after operation (data not shown). Despite the lack of
significant changes in the overall expression of mRNA within
whole ileal samples after resection, relative changes in their
expression within intestinal progeny still may be playing an
important role in the ultimate fate determination. Exploring the
molecular mechanisms underlying the increase in secretory
lineages after SBR will be an interesting future avenue. We
predict at least three distinct mechanisms: 1) a rapid one
occurring on the villi responsible for the phenotype switch of
a subpopulation of enterocytes to goblet cells; 2) a rapid one
within crypts hastening conversion of Paneth progenitors to
fully differentiated Paneth cells; 3) a more sustained response
causing villus lengthening and thus functional adaptation.
In summary, early increases in the overall percentage of
secretory lineages within intestinal epithelium occur during the
adaptive response of the small bowel after SBR. The rapid
increase in Paneth and goblet cells may be an important
mechanism during intestinal adaptation after SBR. Future studies taking advantage of genetically engineered mice lacking
these intestinal lineages will provide important insight into the
role of secretory lineages during intestinal adaptation.
ACKNOWLEDGMENTS
We thank Claudia Kozinetz for the assistance in statistical analyses of all
data.
292 • JANUARY 2007 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.4 on June 18, 2017
and found to be similar to that presented from the ileum, yet
more modest (data not shown).
The vast majority of studies evaluating the adaptive process
following intestinal resection has focused on changes within
the absorptive enterocyte lineage, yet few reports have investigated the role of secretory lineages during this important
response. In 1981, Bjerknes and Cheng performed a detailed
study on a limited number of mice 1 and 3 wk after a 30%
proximal resection (5). Although the only significant increase
found in the absolute percentage of secretory lineages within
the entire jejunal epithelium was enteroendocrine cells at 1 wk,
they also observed changes in the overall distribution of goblet
and Paneth cells. The resection-induced presence of Paneth and
goblet cells within crypt cell positions typically considered to
contain undifferentiated dividing epithelial precursors, lead
these authors to postulate the resetting of a new steady state of
epithelium production toward secretory lineages. The limited
adaptive response observed within the proximal jejunum following a 30% resection may have masked the lineage changes
we observed in the ileum after 50% SBR. As the overall goal
of the Bjerknes and Cheng study was to document that a new
steady state occurred following resection, early changes responsible for resetting this compartment were not evaluated.
Our findings of increased goblet cells following intestinal
resection is supported by recent studies demonstrating both an
increase in overall number and density of goblet cells 1 wk
after SBR in rats (16, 26), yet other studies following SBR in
rats have not reported an affect of resection on goblet cell
number (21, 32). Differences in species of animals, extent, and
location of intestinal resection, methods used to quantify overall changes of goblet cells, time points studied, and location of
adapting intestine examined may account for the discrepancies
between studies. As the purpose of our study was to evaluate
early changes within epithelial secretory lineages, which may
affect adaptation, we studied mice at 12 h and 36 h after SBR.
To our knowledge, no studies to date have evaluated the early
effects of SBR on the allocation of secretory lineages. In this
study, we report the greatest increase in goblet cell number and
percentage occurs within the villi by 12 h after SBR and that at
this same time point, a significant increase in the mRNA
expression of the proliferative marker c-myc has occurred.
Despite this finding, our detailed histological examination
demonstrating early increases in goblet cells does not appear to
be due to dividing epithelial progeny becoming allocated
toward goblet cells, given the early increase is occurring within
villi and lack of BrdU uptake within the first 12 h after
resection within these cells. A rapid switch of villus enterocytes to a goblet phenotype is consistent with the decreased
numbers of enterocytes observed 12 h after SBR (Fig. 7). This
finding is similar to other forms of mucosal injury that have
shown early restitution of the epithelium by increased number
of villus goblet cells within hours of injury (15, 22). In situ
hybridization data demonstrating increased expression of Tff3
mRNA within nonsecretory cells in the crypt and villus after
various forms of injury, including surgical anastomosis in the
small intestine and colon, provides additional evidence to the
potential plasticity of otherwise committed absorptive enterocytes after injury (35). Our finding of increased expression of
differentiated mRNA goblet cell markers (Tff3, Muc2) 12 h
after SBR further supports stimulation of epithelial lineages to
G221
G222
INTESTINAL LINEAGE EXPANSION AFTER RESECTION IN MICE
GRANTS
Histological staining and immunohistochemistry was performed by the
Texas Gulf Coast Digestive Disease Center Morphology Core [supported by
National Institutes of Health (NIH) Grant P30 DK-56338]. This work was also
supported by NIH Grants K08 DK-067395 and T32 HL-6699-01A1.
20.
REFERENCES
21.
AJP-Gastrointest Liver Physiol • VOL
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
292 • JANUARY 2007 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.4 on June 18, 2017
1. ABIPRISM. 7700 Sequence Detection System. User Bulletin #2. Foster
City, CA: PE Applied Biosystems, 2001.
2. Altmann GG. Influence of bile and pancreatic secretions on the size of the
intestinal villi in the rat. Am J Anat 132: 167–177, 1971.
3. Beck PL, Wong JF, Li Y, Swaminathan S, Xavier RJ, Devaney KL,
and Podolsky DK. Chemotherapy- and radiotherapy-induced intestinal
damage is regulated by intestinal trefoil factor. Gastroenterology 126:
796 – 808, 2004.
4. Bjerknes M and Cheng H. The stem-cell zone of the small intestinal
epithelium. I. Evidence from Paneth cells in the adult mouse. Am J Anat
160: 51– 63, 1981.
5. Bjerknes M and Cheng H. The stem-cell zone of the small intestinal
epithelium. IV. Effects of resecting 30% of the small intestine. Am J Anat
160: 93–103, 1981.
6. Cheng H and Leblond CP. Origin, differentiation and renewal of the four
main epithelial cell types in the mouse small intestine. V. Unitarian theory
of the origin of the four epithelial cell types. Am J Anat 141: 537–562,
1974.
7. Dahly EM, Gillingham MB, Guo Z, Murali SG, Nelson DW, Holst JJ,
and Ney DM. Role of luminal nutrients and endogenous GLP-2 in
intestinal adaptation to mid-small bowel resection. Am J Physiol Gastrointest Liver Physiol 284: G670 –G682, 2003.
8. Dowling RH and Booth CC. Structural and functional changes following
small intestinal resection in the rat. Clin Sci 32: 139 –149, 1967.
9. Feldman EJ, Dowling RH, McNaughton J, and Peters TJ. Effects of
oral versus intravenous nutrition on intestinal adaptation after small bowel
resection in the dog. Gastroenterology 70: 712–719, 1976.
10. Fukuzawa H, Sawada M, Kayahara T, Morita-Fujisawa Y, Suzuki K,
Seno H, Takaishi S, and Chiba T. Identification of GM-CSF in Paneth
cells using single-cell RT-PCR. Biochem Biophys Res Commun 312:
897–902, 2003.
11. Garabedian EM, Roberts LJJ, McNevin MS, and Gordon JI. Examining the role of Paneth cells in the small intestine by lineage ablation in
transgenic mice. J Biol Chem 272: 23729 –23740, 1997.
12. Gregorieff A, Pinto D, Begthel H, Destree O, Kielman M, and Clevers
H. Expression pattern of Wnt signaling components in the adult intestine.
Gastroenterology 129: 626 – 638, 2005.
13. Hartmann B, Hare KJ, Kissow H, Thulesen J, Poulsen SS, and Holst
JJ. GLP-2 induces additional, but reversible, intestinal growth in rats
adapted to intestinal resection (Abstract). Gastroenterology 124: A-273,
2003.
14. Helmrath MA, VanderKolk WE, Can G, Erwin CR, and Warner BW.
Intestinal adaptation following massive small bowel resection in the
mouse. J Am Coll Surg 183: 441– 449, 1996.
15. Ikeda H, Yang CL, Tong J, Nishimaki H, Masuda K, Takeo T, Kasai
K, and Itoh G. Rat small intestinal goblet cell kinetics in the process of
restitution of surface epithelium subjected to ischemia-reperfusion injury.
Dig Dis Sci 47: 590 – 601, 2002.
16. Jarboe MD, Juno RJ, Stehr W, Bernal NP, Profitt S, Erwin CR, and
Warner BW. Epidermal growth factor receptor signaling regulates goblet
cell production after small bowel resection. J Pediatr Surg 40: 92–97,
2005.
17. Jensen J, Pedersen EE, Galante P, Hald J, Heller RS, Ishibashi M,
Kageyama R, Guillemot F, Serup P, and Madsen OD. Control of
endodermal endocrine development by Hes-1. Nat Genet 24: 36 – 44,
2000.
18. Juno RJ, Williams JL, Knott AW, Erwin CR, O’Brien DP, and
Warner BW. A serum factor after intestinal resection stimulates epider-
19.
mal growth factor receptor signaling and proliferation in intestinal epithelial cells. Surgery 132: 377–383, 2002.
Leeper LL and Henning SJ. Development and tissue distribution of
sucrase-isomaltase mRNA in rats. Am J Physiol Gastrointest Liver Physiol
258: G52–G58, 1990.
Levine GM, Deren JJ, and Yezdimir E. Small-bowel resection. Oral
intake is the stimulus for hyperplasia. Am J Dig Dis 21: 542–546, 1976.
Lukish J, Schwartz MZ, Rushin JM, and Riordan GP. A comparison
of the effect of growth factors on intestinal function and structure in short
bowel syndrome. J Pediatr Surg 32: 1652–1655, 1997.
Masuda K, Ikeda H, Kasai K, Fukuzawa Y, Nishimaki H, Takeo T,
and Itoh G. Diversity of restitution after deoxycholic acid-induced small
intestinal mucosal injury in the rat. Dig Dis Sci 48: 2108 –2115, 2003.
Nanthakumar NN and Henning SJ. Ontogeny of sucrase-isomaltase
gene expression in rat intestine: responsiveness to glucocorticoids. Am J
Physiol Gastrointest Liver Physiol 264: G306 –G311, 1993.
O’Brien DP, Nelson LA, Huang FS, and Warner BW. Intestinal
adaptation: structure, function, and regulation. Semin Pediatr Surg 10:
56 – 64, 2001.
Rubin DC, Swietlicki EA, Iordanov H, Fritsch C, and Levin MS.
Novel goblet cell gene related to IgGFcgammaBP is regulated in adapting
gut after small bowel resection. Am J Physiol Gastrointest Liver Physiol
279: G1003–G1010, 2000.
Rubin DC, Swietlicki EA, Iordanov H, Fritsch C, and Levin MS.
Novel goblet cell gene related to IgGFcgammaBP is regulated in adapting
gut after small bowel resection. Am J Physiol Gastrointest Liver Physiol
279: G1003–G1010, 2000.
Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, and
Reed MW. Quantitative reverse transcription-polymerase chain reaction
to study mRNA decay: comparison of endpoint and real-time methods.
Anal Biochem 285: 194 –204, 2000.
Schonhoff SE, Giel-Moloney M, and Leiter AB. Minireview: Development and differentiation of gut endocrine cells. Endocrinology 145:
2639 –2644, 2004.
Scott RB, Kirk D, MacNaughton WK, and Meddings JB. GLP-2
augments the adaptive response to massive intestinal resection in rat. Am J
Physiol Gastrointest Liver Physiol 275: G911–G921, 1998.
Seno H, Sawada M, Fukuzawa H, Morita-Fujisawa Y, Takaishi S,
Hiai H, and Chiba T. Involvement of tumor necrosis factor alpha in
intestinal epithelial cell proliferation following Paneth cell destruction.
Scand J Gastroenterol 37: 154 –160, 2002.
Stern LE, Erwin CR, O’Brien DP, Huang F, and Warner BW.
Epidermal growth factor is critical for intestinal adaptation following
small bowel resection. Microsc Res Tech 51: 138 –148, 2000.
Washizawa N, Gu LH, Gu L, Openo KP, Jones DP, and Ziegler TR.
Comparative effects of glucagon-like peptide-2 (GLP-2), growth hormone
(GH), and keratinocyte growth factor (KGF) on markers of gut adaptation
after massive small bowel resection in rats. J Parenter Enteral Nutr 28:
399 – 409, 2004.
Williamson RC and Bauer FL. Evidence for an enterotropic hormone:
compensatory hyperplasia in defunctioned bowel. Br J Surg 65: 736 –739,
1978.
Williamson RC, Buchholtz TW, and Malt RA. Humoral stimulation of
cell proliferation in small bowel after transection and resection in rats.
Gastroenterology 75: 249 –254, 1978.
Xian CJ, Howarth GS, Mardell CE, Cool JC, Familari M, Read LC,
and Giraud AS. Temporal changes in TFF3 expression and jejunal
morphology during methotrexate-induced damage and repair. Am J
Physiol Gastrointest Liver Physiol 277: G785–G795, 1999.
Yang Q, Bermingham NA, Finegold M, and Zoghbi HY. Requirement
of Math1 for secretory cell lineage commitment in the mouse intestine.
Science 294: 2155–2158, 2001.
Ziegler TR, Fernandez-Estivariz C, Gu LH, Bazargan N, Umeakunne
K, Wallace TM, Diaz EE, Rosado KE, Pascal RR, Galloway JR,
Wilcox JN, and Leader LM. Distribution of the H⫹/peptide transporter
PepT1 in human intestine: up-regulated expression in the colonic mucosa
of patients with short-bowel syndrome. Am J Clin Nutr 75: 922–930, 2002.